nitric oxide induces hypoxia-inducible factor 1 activation that is

Nitric oxide induces hypoxia-inducible factor 1 activation that is

dependent on MAP kinase and phosphatidylinositol 3-kinase signaling

Kenji Kasuno 1, 3, Satoshi Takabuchi 2, 4, Kazuhiko Fukuda 4, Shinae Kizaka-

Kondoh 5, Junji Yodoi 1, 3, Takehiko Adachi 2, Gregg L. Semenza 6, and Kiichi

Hirota 2, 4, 7

From 1Human Stress Signal Research Center, National Institute of Advanced

Industrial Science and Technology (AIST), IKEDA, Osaka, Japan 563-0053,

2Department of Anesthesia, Tazuke Kofukai Medical Research Institute Kitano

Hospital, 2-4-20, Ohgimachi, Kita-ku, Osaka 530-8480, 3Institute for Virus

Research, Kyoto University, 4Department of Anesthesia, Kyoto University

Hospital, Kyoto University, 5Department of Molecular Oncology, Kyoto

University Graduate School of Medicine, Sakyo-ku, Kyoto 606-850, Japan and

6McKusick-Nathans Institute of Genetic Medicine, The Johns Hopkins University

School of Medicine, Baltimore, Maryland 21287, USA

7 To whom correspondence should be addressed: Department of Anesthesia,

Tazuke Kofukai Medical Research Institute Kitano Hospital, 2-4-20,

synthesisαNitric oxide up-regulates HIF-1

.Kasuno et al

-0-

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on November 4, 2003 as Manuscript M308197200 by guest on A

pril 11, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Ohgimachi, Kita-ku, Osaka 530-8480; Tel:+81-6-6312-8831 Fax:+81-6-

6361-8867; e-mail:[email protected]


.Kasuno et al

-1-

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Running title

Nitric oxide up-regulates HIF-1α synthesis


.Kasuno et al

-2-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Summary

Hypoxia inducible factor-1 (HIF-1) is a master regulator of cellular adaptive

responses to hypoxia. Levels of the HIF-1α subunit increase under hypoxic

conditions. Exposure of cells to certain nitric oxide (NO) donors also induces

HIF-1α expression under non-hypoxic conditions. We demonstrate that exposure

of cells to the NO donor NOC18 or GSNO induces HIF-1α expression and

transcriptional activity. In contrast to hypoxia, NOC18 did not inhibit HIF-1α

hydroxylation, ubiquitination, and degradation, indicating an effect on HIF-1α

protein synthesis that was confirmed by pulse labeling studies. NOC18 stimulation

of HIF-1α protein and HIF-1-dependent gene expression was blocked by treating

cells with an inhibitor of the phosphatidylinositol 3-kinase or MAP kinase-

signaling pathway. These inhibitors also blocked NOC18-induced

phosphorylation of the translational regulatory proteins 4E-BP1, p70 S6 kinase,

and eIF-4E, thus providing a mechanism for the modulation of HIF-1α protein

synthesis. In addition, expression of a dominant-negative form of Ras


.Kasuno et al

-3-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

significantly suppressed HIF-1 activation by NOC18. We conclude that the NO

donor NOC18 induces HIF-1α synthesis under conditions of NO formation during

normoxia and that hydroxylation of HIF-1α is not regulated by NOC18.

Introduction

Hypoxia induces a series of adaptive physiological responses (1). At the cellular

level, the adaptation involves a switch of energy metabolism from oxidative

phosphorylation to anaerobic glycolysis, increased glucose uptake, and the

expression of stress proteins related to cell survival or death (2). At the molecular

level, the adaptation involves changes in mRNA transcription and mRNA stability

(2,3). One of the most important transcription factors that activates the expression

of oxygen-regulated genes including vascular endothelial growth factor (VEGF)

and inducible nitric oxide synthase (iNOS) is hypoxia-inducible factor 1 (HIF-1)

(4-6). VEGF is a potent angiogenic and vascular permeability factor that plays


.Kasuno et al

-4-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

critical roles in both physiological and pathological angiogenesis (7). Recently, the

expression of VEGF in response to heregulin-induced activation of the HER2/neu

receptor tyrosine kinase in breast cancer cells (8), IGF-1 stimulation of colon

cancer cells (9), and insulin treatment of retinal pigment epithelial cells (10) was

shown to be mediated by HIF-1 via the phosphatidylinositol 3-kinase (PI3K) and

MAP kinase (MAPK) pathways. Thus, HIF-1 regulates both hypoxia- and growth

factor-induced VEGF expression.

HIF-1 is a heterodimer composed of a constitutively expressed β subunit

(HIF-1β) and an inducibly expressed α subunit (HIF-1α) (4). The regulation of

HIF-1 activity occurs at multiple levels in vivo (11). Among these, the

mechanisms regulating HIF-1α protein expression and transcriptional activity

have been most extensively analyzed. The von Hippel-Lindau tumor-suppressor

protein (VHL) has been identified as the HIF-1α-binding component of a

ubiquitin-protein ligase that targets HIF-1α for proteasomal degradation in non-

hypoxic cells (12-15). Under hypoxic conditions, the hydroxylation of specific


.Kasuno et al

-5-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

proline and asparagine residues in HIF-1α is inhibited due to substrate (O2)

limitation, resulting in HIF-1α protein stabilization and transcriptional activation

(14,16,17). The iron chelator deferrioxamine (DFX) inhibits the prolyl and

asparaginyl hydroxylases, which contain Fe2+ at their catalytic sites, causing HIF-

1α stabilization and transactivation under normoxic conditions (12,13).

Signaling via the HER2/neu and IGF-1 receptor tyrosine kinases induces

HIF-1 expression by an independent mechanism. HER2/neu activation increases

the rate of HIF-1α protein synthesis via PI3K and the downstream serine-

threonine kinases AKT (protein kinase B) and FRAP (FKBP/rapamycin-

associated protein; also known as mTOR [mammalian target of rapamycin]) (8).

IGF-1-induced HIF-1α synthesis is dependent upon both the PI3K and MAPK

pathways (10). FRAP/mTOR phosphorylates and activates the translational

regulatory proteins eIF-4E-binding protein 1 (4E-BP1) and p70 S6 kinase

(p70S6K). Phosphorylation of 4E-BP1 disrupts its inhibitory interaction with eukaryotic

initiation factor 4E (eIF-4E), whereas activated p70S6K phosphorylates the 40S


.Kasuno et al

-6-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ribosomal protein S6. The effect of HER2/neu signaling on translation of HIF-1α

protein is dependent upon the presence of the 5’-untranslated region of HIF-1α

mRNA (8).

Nitric oxide (NO) is known to mediate many physiological and pathological

functions including vascular dilatation, cytotoxicity mediated by activated

macrophages, and cGMP formation following glutamate receptor activation in

neurons (18). NO has also been implicated in pathological conditions such as

destruction of tumor cells by macrophages, rheumatoid arthritis, and focal brain

ischemia. There are several reports demonstrating that exposure of cells to certain

NO donors or gaseous NO modulates HIF-1 activity (19-23). S-

nitrosoglutathione (GSNO) or NOC18 induces HIF-1 activity under non-hypoxic

conditions (22). In contrast, sodium nitroprusside (SNP) inhibits hypoxia-induced

HIF-1 activation (19-21). However, the molecular mechanisms that regulate

HIF-1α expression and transactivation in response to NO donors are poorly

defined. In this study, we found that NOC18 induces HIF-1 activity by increasing


.Kasuno et al

-7-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

HIF-1α protein synthesis via PI3K- and MAPK-dependent pathways.

Experimental Procedures

Cell culture and reagents

Hep3B cells, HEK293 cells, and HCT116 cells were maintained in MEM with Earle’s

salts, DMEM, and McCoy’s 5A medium, respectively supplemented with 10% FBS and 100

units/ml penicillin, and 100 µg/ml streptomycin. Human umbilical vein endothelial cells

(HUVECs) were obtained from Kurabo (Osaka, Japan) and cultured with HuMedia-EG2

(Kurabo). DFX, and the thiol-dependent NO releaser GSNO, N-acetyl cysteine were obtained

from Sigma. The spontaneous NO releaser NOR4 (half-life, 60 min), NOR5 (half-life, 20 h),

NOC12 (half-life, 100 min), and NOC18 (half-life, 21 h) were obtained from Dojindo

(Kumamoto, Japan). Cycloheximide (CHX), SNP, wortmannin, genistein, LY294002, PD98059,

and rapamycin were obtained from Calbiochem (San Diego, CA).

Plasmid constructs

Expression vectors pGAL4/HIF-1α(531-826), pGAL4/HIF-1α(531-575),

pGAL4/HIF-1α(726-826) and pGAL4/HIF-1α(786-826) were described


.Kasuno et al

-8-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

previously (24). Plasmid p2.1 contains a 68-bp hypoxia response element (HRE)

from the ENO1 gene inserted upstream of an SV40 promoter in the luciferase

reporter plasmid pGL2-Promoter (Promega) and p2.4 contains a mutation in the

HRE (24,25). Plasmid pVEGF-KpnI contains nucleotides –2274 to +379 of the

human VEGF gene inserted into the luciferase reporter pGL2-Basic (Promega)

(26). The reporter GAL4E1bLuc contains 5 copies of a GAL4 binding site

upstream of a TATA sequence and firefly luciferase coding sequences (24). A

FLAG-tagged dominant negative form of HIF-1α pCMV-3XFLAG-HIF-

1αNBAB was generated based on pCEP4-HIF-1αNBAB (27). The expression plasmid

pCH-NLS-HIF1α(548-603)-LacZ was described elsewhere (28). Plasmids

encoding p85, a dominant-negative form of the PI3K p85 regulatory subunit, and a

kinase dead form of Akt were gifts from Dr. Wataru Ogawa (Kobe University,

Kobe, Japan) (29,30). Plasmid encoding a dominant negative form of Ras (31) was

a generous gift from Dr. Kaikobad Irani (Johns Hopkins University, Baltimore,

MD).


.Kasuno et al

-9-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Hypoxic treatment

Tissue culture dishes were transferred to a modular incubator chamber

(Billups-Rothenberg, Del Mar, CA) which was flushed with 1% O2-5% CO2-

O2%-94%N2, sealed, and placed at 37 ÚC.

Immunoblot Assays

Whole cell lysates were prepared by incubating cells for 30 min in cold

radioimmune precipitation assay buffer containing 2 mM dithiothreitol, 1 mM

NaVO3, and Complete protease inhibitor (Roche Applied Science, Tokyo Japan)

(32). Samples were centrifuged at 10,000 x g to pellet cell debris. For HIF-1α

and HIF-1β, 100-µg aliquots were fractionated by 7.5% SDS-PAGE and

subjected to immunoblot assay using mouse monoclonal antibody against HIF-1α

(BD Biosciences, San Jose, CA) or HIF-1β (H1β234; Novus Biologicals,

Littleton, CO) at 1:1000 dilution. Signal was developed using ECL reagent

(Amersham Biosciences, Piscataway, NJ). For phosphorylated protein, HEK293


.Kasuno et al

-10-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

cells or HCT116 cells were serum-starved (0.1% FBS for 24 h), treated with

NOC18, and 50-µg aliquots were analyzed using specific antibodies (1:1000

dilution) (Cell Signaling Technology, Beverly, MA). Signal was developed by

using ECL reagents (Amersham Biosciences).

Inhibitor Treatments

PD98059, LY294002, genistein, or rapamycin was added 1 h before

exposure to NOC18 or 1% O2. CHX was added to the medium of HEK293 cells

that were treated with NOC18, GSNO, or DFX for 4 h, and whole cell extracts

were prepared at 15, 30, and 60 min.

RT-PCR

The protocol of RT-PCR is described elsewhere (33). Briefly, cells were

lysed, and RNA was isolated with TRIzol reagent (Invitrogen). 0.5 µg of total

RNA were subjected to first strand cDNA synthesis using SuperScript II RT kit


.Kasuno et al

-11-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(Invitrogen) with random hexamers. cDNAs were amplified with TaqGold

polymerase in a thermal cycler with the following primer pairs: HIF1A,

GAAAGCGCAAGTCCTCAAA and CTATATGGTGATGATGTGGCACTA;

VEGF, CCATGAACTTTCTGCTGTCTT and ATCGCATCAGGGGCACACAG;

GLUT1, GGGCATGTGCTTCCAGTATGT and

ACGAGGAGCACCGTGAAGAT; 18S, ATCCTGCCAGTAGCATATGC and

ACCCGGGTTGGTTTTGATCTG. For each primer pair, PCR was optimized for

cycle number to obtain linearity between the amount of input RT product and

output PCR product. Thermocycling conditions were 30 s at 94°C, 60 s at 57°C,

and 30 s at 72°C for 25 (HIF1A), 27 (VEGF), or 14 (18S rRNA) cycles preceded

by 10 min at 94°C. PCR products were fractionated by 3% Nusieve agarose gel

electrophoresis, stained with ethidium bromide, and visualized with UV.

Metabolic labeling assay

The protocol is described elsewhere (8). Briefly, a total of HEK293 cells were plated in a


.Kasuno et al

-12-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10-cm dish, and 24 h later the cells were serum starved for 20 h. The cells were pretreated with

500 µM NOC18 or 100 µM DFX for 30 min in methionine-free DMEM. [ 35 S]Met-Cys was

added to a final concentration of 0.3 mCi/ml, and the cells were pulse-labeled for 20 to 40 min

and then harvested. Whole-cell extracts were prepared and 1 mg of extract was precleared with

60 µl of protein A-Sepharose for 1h. Twenty microliters of anti-HIF-1 antibody H1 67 was

added to the supernatant and rotated overnight at 4°C. Forty microliters of protein A-Sepharose

was added, rotated for 2 h at 4°C, pelleted, and washed five times with 1 ml of RIPA buffer. The

samples were analysed by SDS-polyacrylamide gel electrophoresis. The gel was dried and

exposed to X-ray film.

Immunoprecipitation Assay

Cells were harvested in 200 µL of lysis buffer (Dulbecco’s PBS [pH 7.4], 0.1% Tween-

20, 1 mM sodium orthovanadate, and Complete protease inhibitor) and drawn through a 20G

needle 4 times. The lysate was incubated on ice for 1 h followed by centrifugation at 14,000 rpm

for 15 min. The cleared lysates were brought to a volume of 1 mL with lysis buffer followed by

a 2-h incubation with 20 µL of anti-HA (Roche) or anti-FLAG (Sigma) affinity matrix beads at

4 ÚC on a rotator. The beads were then washed 3 times with lysis buffer. Protein was eluted by

the addition of Laemmli sample buffer and analyzed by SDS-PAGE and immunoblot analysis


.Kasuno et al

-13-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(16).

In Vitro HIF-1α-VHL Interaction Assay

Glutathione S-transferase (GST)-HIF-1α(429-608) fusion protein was

expressed in E. coli as described (16,33). Biotinylated methionine-labeled

proteins were generated in reticulocyte lysates using the TNT T7 coupled

transcription/translation system using Transcend Biotinylated tRNA (Promega).

25-µg aliquots of HEK293 cell lysate were preincubated with NO donor or DFX

for 30 min at 30 ÚC, 2.5 µg of GST-HIF-1α(429-608) was added and incubated

for 30 min at 30 ÚC. A 5-µl aliquot of in vitro-translated biotinylated VHL

protein was mixed with 4 µg of GST fusion protein in a final volume of 200 µL of

binding buffer (Dulbecco’s PBS [pH 7.4], 0.1% Tween-20) and incubated for 2 h

at 4 ÚC with rotation followed by addition of 10 µL of glutathione-Sepharose 4B

beads (Pharmacia) and incubation at 4 ÚC for 1 h. The beads were pelleted,

washed 3 times in binding buffer, pelleted, resuspended in Laemmli sample buffer,

and analyzed by SDS-PAGE. Proteins were transferred to PVDF membrane and


.Kasuno et al

-14-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

visualized using streptavidin-labeled horseradish peroxidase and ECL reagent

(Amersham Biosciences).

In Vitro Ubiquitination Assay

HEK293 cells were washed twice with cold hypotonic extraction buffer (20

mM Tris [pH 7.5], 5 mM KCl, 1.5 mM MgCl2, 1mM dithiothreitol), and lysed in a

Dounce homogenizer. The cell extract was centrifuged at 10,000 x g for 10 min at

4ÚC, and the supernatant was stored at 70ÚC. Ubiquitination assays were

performed as described previously (33). At 30ÚC in a volume of 40 µl containing

27 µl (50 µg) of cell extract, 4 µl of 10 x ATP-regenerating system (20 m M Tris

[pH 7.5], 10 mM ATP, 10 mM magnesium acetate, 300 mM creatine phosphate,

0.5 mg/ml creatine phosphokinase), 4 µl of 5 mg/ml ubiquitin (Sigma), 1 µl of 150

µM ubiquitin aldehyde (Sigma), and 2 µl of HA-HIF-1α that was in vitro

translated (TNT Quick Coupled Transcription/Translation System, Promega) in the

presence of [35S] methionine. HA-HIF-1α was recovered using anti-HA-


.Kasuno et al

-15-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

agarose beads, which were then mixed with SDS sample buffer and boiled for 5

min. The eluates were analyzed by SDS-PAGE and autoradiography.

Reporter Gene Assays

Reporter assays were performed in Hep3B cells and HEK293 cells (32,34). 5x104 cells

were plated per well on the day before transfection. In each transfection, indicated dose of test

plasmids, 200 ng of reporter gene plasmid, and 50 ng of the control plasmid pTK-RL (Promega),

containing a thymidine kinase promoter upstream of Renilla reniformis (sea pansy) luciferase

coding sequences, were pre-mixed with Fugene 6 transfection reagent (Roche). In each assay

the total amount of DNA was held constant by addition of empty vector. After treatment, the

cells were harvested and the luciferase activity was determined using the Dual-Luciferase

Reporter Assay System (Promega). The ratio of firefly to sea pansy luciferase activity was

determined. For each experiment, at least two independent transfections were performed in

triplicate.

X-gal staining

HEK293 cells were washed twice with PBS, fixed with 1% formaldehyde-0.2%


.Kasuno et al

-16-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

glutaraldehyde solution, washed twice with PBS, and then treated with an X-gal staining

solution (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 1 mM MgCl2, and 0.04%

X-gal) at 37°C (28).


.Kasuno et al

-17-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Results

NO donors activate HIF-1 under non-hypoxic conditions

To study the effect of NO on HIF-1 activation, we tested several NO donors. NORs and

NOCs spontaneously release NO with different kinetics (see Experimental Procedures) whereas

GSNO and SNP require cellular thiol for NO release. HEK293 cells were exposed to the

compounds for 1-4 h at 20% O2, harvested, and subjected to immunoblot analysis using anti-

HIF-1α or anti-HIF-1β antibody (Fig. 1A). Neither NOR4 nor NOR5 induced

HIF-1α protein accumulation (lane 2-6). In contrast, exposure of cells to NOC18

or GSNO efficiently induced HIF-1α protein accumulation comparably to 100 µM

DFX (lane 6-8, 12,13). SNP did not induce HIF-1α accumulation (lane 10, 11).

Expression of HIF-1β was not affected by NO donors or DFX. NOCs induced

accumulation of HIF-1α with quite different kinetics as compared to GSNO.

NOC18-induced accumulation was detected as early as 30 min and lasted no less

than 8 h. The effect of GSNO peaked at 1 h (lane 8) and was lost by 4 h after

addition (lane 9).


.Kasuno et al

-18-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

NOC18 induced HIF-1α accumulation in a dose-dependent manner up to

500 µM (Fig. 1B). Induction by GSNO was saturated at a concentration of 100

µM. The accumulation of HIF-1α induced by NOC12, which releases NO by the

same mechanism as NOC18 but has a different NO-releasing time-constant, was

stronger than that induced by NOC18 at 30 min at a concentration of 250 µM (Fig.

1C, top panel). However, the induction of HIF-1α was dose-dependent such that

the effect of 40 µM NOC12 was weaker than 500 µM NOC18 (Fig.1C, bottom

panel).

We screened other cell lines for the effect of NO donors on HIF-1α protein

levels. 500 µM NOC18 induced HIF-1α accumulation in Hep3B human

hepatocellular carcinoma cells and HCT116 human colorectal carcinoma cells as

strongly as 100 µM DFX (data not shown). NOC18 also induced HIF-1α in

HUVECs (data not shown). These results indicate that the effect of NOC18 on

HIF-1α expression is observed in multiple transformed and primary cell types.

We investigated by RT-PCR whether NO donors induced gene expression


.Kasuno et al

-19-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

downstream of HIF-1. VEGF and GLUT1 mRNA expression was induced by

NOC18 treatment under non-hypoxic conditions (Fig. 2). In contrast, HIF-1α

mRNA expression was not affected by NOC18 treatment, indicating that the effect

of NOC18 occurs at the level of HIF-1α protein expression. HEK293 cells were

transfected with the reporter p2.1, containing a HIF-1-dependent HRE, or p2.4,

containing a mutated HRE. NOC18 induced HRE-dependent gene expression in a

dose-dependent manner comparably to DFX or 1% O2 (Fig. 3A, B). The mutated

reporter p2.4 was not activated by NOC18 (Fig, 3B) and expression of a dominant

negative form of HIF-1α reduced p2.1 reporter gene expression (Fig. 3C)

providing evidence that the gene activation was HRE- and HIF-1-dependent.

NOC18 also induced dose-dependent transcription of a reporter gene containing

the VEGF promoter encompassing nucleotides -2274 to +379 relative to the

transcription start site (Fig. 3D).

NOC18 does not prolong HIF-1α protein half-life


.Kasuno et al

-20-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

To determine whether NOC18 treatment affected HIF-1α protein half-life,

HEK293 cells were treated with NOC18 or DFX for 4 h to induce HIF-1α

expression, and then CHX was added to block ongoing protein synthesis. In the

presence of CHX, the half-life of HIF-1α was > 30 min in DFX-treated cells but

< 15 min in NOC18-treated cells (Fig. 4A). Similarly the half-life of GSNO-

induced HIF-1α is < 15 min in the presence of CHX (Fig. 4B). These results

indicate that HIF-1α expression in NOC18-treated cells is dependent upon

ongoing protein synthesis. Similar results were observed in Hep3B cells and

HUVECs (data not shown).

To analyze the rate of HIF-1α synthesis, serum-starved HEK293 cells were

pretreated with NOC18 or DFX for 30 min and then pulse-labeled with [35

S]Met-Cys for 20 or 40 min, followed by immunoprecipitation of HIF-1α (Fig.

4C). In contrast to control serum-starved cells (Fig. 4C, lane 1), 35S-labeled HIF-

1α was clearly increased in NOC18-treated cells (lanes 2 and 3), whereas, the

amount of labeled HIF-1α protein was not increased in cells treated with DFX


.Kasuno et al

-21-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(lanes 4). Thus, both the cycloheximide addition and metabolic labeling

experiments provide evidence for increased synthesis of HIF-1α in response to

NOC18 treatment.

We also assayed the stability of a fusion protein, consisting of a nuclear

localization signal (NLS), ß-galactosidase (β-gal) sequences (encoded by the lac

Z gene), and HIF-1α residues 548603. The NLS-LacZ-HIF1α(548603)

expression vector was transfected into HEK293 cells and β-gal activity was

analyzed by X-gal staining after incubation of the cells in the presence of 500 µM

NOC18 or 100 µM DFX. There was essentially no X-gal staining in cells that were

transfected with empty vector, transfected with NLS-LacZ-HIF1α(548603)

without treatment, or transfected with NLS-LacZ-HIF-1α(548603) with NOC18

treatment (Fig. 4D). In contrast, significant X-gal staining was detected in NLS-

LacZ-HIF-1α(548603)-transfected cells that were treated with DFX, which

inhibits O2-dependent degradation mediated by the HIF-1α domain of the fusion

protein.


.Kasuno et al

-22-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

NOC18 does not affect the interaction between HIF-1α and VHL in vitro or in

vivo

Under hypoxic conditions, VHL-dependent ubiquitination of HIF-1α is

inhibited (12-14). To determine whether NOC18 treatment affects ubiquitination,

an in vitro assay was performed using lysates prepared from control and NOC18-

treated cells. As shown in Fig. 5A, there was no significant difference detected

between lysates from NOC18-treated or untreated cells with respect to their ability

to ubiquitinate HIF-1α.

Incubation of a GST-HIF-1α(429-608) fusion protein with lysate from

untreated cells resulted in prolyl hydroxylation of HIF-1α and interaction with

VHL (Fig. 5B. lane 2). Lysate from cells treated with DFX did not promote

interaction of GST-HIF-1α(429-608) with VHL (lane 6). In contrast, lysate from

cells treated with NOC18 promoted the interaction (lane 3), similar to control

lysates, again providing evidence that NOC18 treatment does not induce HIF-1α

expression by inhibiting VHL-mediated ubiquitination. Similar results were


.Kasuno et al

-23-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

obtained from experiments using rabbit reticulocyte lysates (which also have HIF-

1α prolyl hydroxylase activity) instead of HEK293 cell lysates (data not shown).

Remarkably, lysate from GSNO-treated cells partially inhibited the interaction of

GST-HIF-1α(429-608) with VHL (lane 4), whereas lysate from SNP-treated

cells dramatically increased the interaction (lane 5).

HEK293 cells were co-transfected with expression vectors encoding HA-

tagged VHL and FLAG-tagged HIF-1α. Aliquots of whole cell lysates were

analyzed for expression of the proteins directly or following immunoprecipitation

of HA-VHL or FLAG-HIF-1α. HIF-1α was present in anti-HA

immunoprecipitates from cells co-expressing HA-VHL and FLAG-HIF-1α (Fig.

5C, lane 3). Exposure of cells to NOC18 did not alter the interaction of HA-VHL

and FLAG-HIF-1α (Fig. 5C, lane 4 and 5), consistent with the inability of

NOC18 to inhibit VHL and HIF-1α interaction in vitro. In contrast, DFX

treatment inhibited the interaction (lane 6). FIH-1 is the asparagines hydroxylase

that negatively regulates HIF-1α transactivation domain function under non-


.Kasuno et al

-24-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

hypoxic conditions (16, 17). The interaction between HA-FIH-1 and FLAG-

HIF-1α was not affected by either NOC18 or DFX (Fig. 5D). Taken together,

results presented in Fig. 5 indicate that the molecular mechanism of NOC18 action

is distinct from the inhibition of hydroxylase activity that occurs in cells exposed to

hypoxia or DFX.

Impact of NO scavenger, guanyl cyclase inhibitor, and antioxidant on NOC18-

induced HIF-1α accumulation

To examine signal transduction pathways mediating effects of NO donors on

HIF-1α protein induction, the NO scavenger carboxyl-PTIO was utilized (35).

Carboxyl-PTIO significantly suppressed HIF-1α accumulation induced by

NOC18 but not by DFX (Fig. 6A). Carboxyl-PTIO by itself did not have any

effects. Next we examined the impact of guanylyl cyclase activity on HIF-1α

accumulation. NO stimulates the activity of guanylyl cyclase, which catalyzes the

production of cGMP, an important second messenger for signal transduction. In


.Kasuno et al

-25-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

HEK293 cells, the specific guanyl cyclase inhibitor ODQ did not affect NOC18-

induced HIF-1α accumulation (Fig. 6B), providing the evidence that the guanylyl

cyclase-cGMP pathway does not contribute to HIF-1α accumulation induced by

NOC18.

NO is a radical and equimolar amounts of O2- and NO form peroxynitrite

(ONOO-), which decomposes at physiological pH to generate oxidant with similar

reactivity to the hydroxyl radical. To examine whether intracellular redox state

modulates NOC18-induced HIF-1α accumulation, HEK293 cells were treated

with NOC18 in the presence of 50 mM N-acetyl cysteine (NAC) (Fig. 6C). NAC

treatment did not affect HIF-1α levels, suggesting that thiol-mediated redox status

does not play a critical role in NOC18-induced HIF-1α expression. Transient

overexpression of the intracellular redox regulator thioredoxin also did not affect

induction of HIF-1α expression by NOC18 (data not shown).

HIF-1α-mediated transactivation in response to NOC18 treatment


.Kasuno et al

-26-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

We next investigated the impact of NOC18 on HIF-1α transcriptional

activity. There are two independent transactivation domains (TADs) present in

HIF-1α which are designated as the amino-terminal (amino acids 531-575) and

carboxyl-terminal (amino acids 786-826) TADs (TAD-N and TAD-C,

respectively) (24). Steady-state levels of proteins consisting of the GAL4 DNA-

binding domain fused to HIF-1α TADs [GAL4-HIF-1α(531-575), GAL4-HIF-

1α(531-826), and GAL4-HIF-1α(786-826)] are similar under hypoxic and non-

hypoxic conditions (24). These GAL4-HIF-1α fusion constructs can thus be used

to examine the transcriptional activity of HIF-1α independent of its protein

expression (24,32). Transactivation mediated by GAL4-HIF-1α(531-826), which

contains both TAD-N and TAD-C, or GAL4-HIF-1α(531-575), which contains

only TAD-N, is increased in cells exposed to hypoxia or DFX (24). In contrast,

GAL4-HIF-1α(786-826), which contains only TAD-C, is constitutively active in

untreated cells. NOC18 treatment increased transactivation mediated by GAL4-

HIF-1α(531-826) or GAL4-HIF-1α(531-575) in a dose-dependent manner


.Kasuno et al

-27-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

whereas transactivation mediated by GAL4-HIF-1α(786-826) was not increased

by exposure of cells to NOC18 or DFX (Fig. 7). These results demonstrate that

NOC18 not only promotes accumulation of HIF-1α but also enhances HIF-1α

transcriptional activity.

Effect of kinase inhibitors on NOC18-induced HIF-1 activation

HEK293 cells were pretreated with LY294002, genistein, PD98059 or rapamycin, which

are selective pharmacologic inhibitors of PI3K, tyrosine kinases, MEK, and FRAP/mTOR kinase

activity, respectively. All the agents inhibited the induction of HIF-1α protein expression in

NOC18-treated cells (Fig. 8A). The combination of LY294002, PD98059 and

rapamycin markedly inhibited NOC18-induced HIF-1α expression (Fig. 8B). In

contrast to their effects on HIF-1α protein expression induced by NOC18

treatment, LY294002 or PD98059 had little inhibitory effect on the expression of

HIF-1α in DFX-treated HEK293 cells (Fig. 8A; lane 9-14).

LY294002 and rapamycin inhibited expression of the HIF-1-dependent

reporter gene p2.1 induced by NOC18 but not by DFX, whereas genistein and


.Kasuno et al

-28-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

PD98059 inhibited both NOC18- and DFX-induced reporter gene expression

(Fig. 8C, upper panel). Interestingly, the stimulation of HIF-1α transactivation

domain function by NOC18 was also blocked by kinase inhibitors, whereas only

genistein blocked DFX-induced transactivation (Fig. 8C, lower panel). These

results provide further evidence that NOC18 and DFX induce HIF-1 by distinct

molecular mechanisms. Moreover, NOC18-induced HRE-dependent gene

expression was suppressed by a dominant negative form of PI3K p85 subunit,

AKT, or Ras, indicating critical roles of these signaling proteins in transducing the

effects of NOC18 to HIF-1 (Fig. 8D).

NOC18-induced activation of MAPK, PI3K, and translational regulators

HIF-1 activity induced by the stimulation of receptor tyrosine kinases or G protein-

coupled receptors requires MAPK and PI3K signaling (10,36). To determine whether the MAPK

and PI3K pathways were activated in NOC-18-treated cells, the phosphorylation of

p42ERK2/p44ERK1 and AKT were analyzed in HEK293 cells and HCT116 cells. Increased

phosphorylation of p42ERK2/p44ERK1 (Fig. 9A) and AKT (Fig. 9B) was induced by NOC18


.Kasuno et al

-29-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

treatment in both cell types.

The signal transduction pathway involving PI3K, AKT, and mTOR has been shown to

regulate protein translation via phosphorylation of p70S6K, the S6 ribosomal protein, and 4E-

BP1. In both HCT116 cells (Fig. 10) and HEK293 cells (data not shown), the phosphorylation

of p70S6K , S6, and 4E-BP1 was induced by NOC18 stimulation in a dose- and time-

dependent manner. The mRNA cap-binding protein eIF-4E, was also phosphorylated by

NOC18 treatment of HCT116 cells (Fig. 10). This result is consistent with studies indicating that

ERK activates the MAPK signal integrating kinases, MNK1 and MNK2, which in turn

phosphorylate eIF-4E (37,38).


.Kasuno et al

-30-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Discussion

The studies reported above demonstrate that treatment of several different

cell types with the NO donor NOC18 induces HIF-1α protein expression and

HIF-1 transcriptional activation resulting in VEGF and GLUT1 mRNA

expression. NOC18 treatment did not increase the half-life of HIF-1α protein, did

not inhibit the interaction between HIF-1α and VHL, and did not inhibit the

ubiquitination of HIF-1α, indicating that the mechanism of NOC18 action does

not involve inhibition of HIF-1α prolyl hydroxylation. Rather than increasing the

stability of HIF-1α, the data suggest that NOC18 increases the rate of HIF-1α

protein synthesis.

Whereas exposure of cells to hypoxia or DFX decreases HIF-1α protein

degradation, exposure of cells to heregulin, IGF-1, insulin, or prostaglandin E2

increases HIF-1α protein synthesis (8-10,36). In previous studies of MCF-7 and

HCT116 cells, the effect on protein synthesis was documented by cycloheximide


.Kasuno et al

-31-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

inhibition and by pulse-chase experiments (8). In the present study, we also

confirmed that NOC18 treatment stimulated the synthesis of HIF-1α but had no

effect on HIF-1α protein stability in HEK293 cells. Thus, as in the case of growth

factor-treated cells, the increased expression of HIF-1α protein in NOC18-treated

cells is due to increased synthesis.

As previously observed in growth factor-treated cells, the effect of NOC18

is dependent upon its activation of the PI3K and MAPK pathways. Dependence on

MEK activity for phosphorylation of 4E-BP1 and p70S6K has been demonstrated

in other cellular contexts. In the case of IGF-1-stimulated colon cancer cells, both

MEK and PI3K are required for activation of p70S6K, with MEK inhibitors

preventing the phosphorylation of Thr-421/Ser-424 in the Thr-389 by mTOR

(39). ERK has been shown to phosphorylate 4E-BP1 in vitro (40). The MEK-

ERK pathway also stimulates the phosphorylation of eIF-4E, which is required for

its mRNA cap binding activity (37). Thus, NOC signaling both de-represses (via

phosphorylation of 4E-BP1) and activates (via phosphorylation of eIF-4E and


.Kasuno et al

-32-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

p70S6K) protein synthesis. The effects of NO donors may not be specific for HIF-1α.

The known targets for phosphorylation by mTOR are regulators of protein

synthesis. The translation of several dozen different mRNAs are known to be

regulated by this pathway and sequences in the 5’-untranslated region of the

respective mRNAs may determine the degree to which the translation of any

particular mRNA can be modulated by mTOR signaling. HIF-1α protein

expression is likely to be particularly sensitive to changes in the rate of synthesis

because of its extremely short half-life under non-hypoxic conditions.

HIF-1 activity is regulated not only by HIF-1α protein expression but also

by HIF-1α transcriptional activity. Our data analyzing transactivation mediated

by Gal4-HIF-1α-TAD fusion proteins demonstrate that NOC18 treatment also

induces HIF-1α TAD activity under non-hypoxic conditions. A regulatory switch

controlling TAD activity involves O2-dependent hydroxylation of Asn-803 by

FIH-1. NOC18 treatment did not promote dissociation of FIH-1 and HIF-1α.

TAD activity is also regulated by a MAPK-dependent mechanism (41). The


.Kasuno et al

-33-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

MEK-1 inhibitor PD98059 blocked NOC18-induced HIF-1 activation and

NOC18-induced MAPK activation, suggesting a link between NOC18,

MEK/ERK, and HIF-1α. Published data suggest that the direct target of

MEK/ERK may be the coactivators CBP and p300 which interact with the TADs

(42).

The action of NO in biological systems can be mediated directly by NO or

by conversion of NO to NO- or NO+ equivalents (43). Because two enzymes in

the ubiquitin-proteasome pathway, E1 and E2, contain thiols in their active sites,

these thiols were a priori candidates as targets of NO donors. However, our

experimental results do not support this mechanism of action for NOC18. Another

potential target is HIF-1α itself, as there is a report that GSNO induces

nitrosylation of HIF-1α (44). However, our results indicate that if NOC18 induces

nitrosylation of HIF-1α, this modification does not lead to accumulation of the

protein. NOC18 treatment had no effect on the interaction of HIF-1α and VHL,

whereas GSNO partially inhibited the interaction and SNP dramatically augmented


.Kasuno et al

-34-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

the interaction. SNP may stimulate the prolyl hydroxylation-ubiquitination system

and promote increased HIF-1α degradation. Consistent with this hypothesis, SNP

inhibited HIF-1α accumulation induced by DFX. Thus, different NO donors

activate or inhibit HIF-1 through different molecular mechanisms.

Recent studies have demonstrated that NO donors stimulate cellular

signaling cascades (45-47). Overexpression of a dominant negative form of Ras

significantly inhibited NOC18-induced HRE-dependent gene expression and the

tyrosine kinase inhibitor genistein almost completely abolished NOC18-induced

HIF-1α expression, suggesting that one or more protein tyrosine kinases or

phosphatases may be regulated by nitrosative modification. NOC18 treatment also

induced phosphorylation of both AKT and ERK. Thus, NOC18 treatment

modulates protein kinase signaling pathways similar to the effects of growth factor

treatment. The extent to which NO signaling to HIF-1 participates in

physiological and pathophysiological processes will require further investigation.


.Kasuno et al

-35-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Footnotes

This work was supported in part by a grant-in-aid for scientific research on

priority areas “Cancer” from ministry of education, culture, sports, science and

technology to KH.

1. The abbreviations used are: HIF-1, hypoxia-inducible factor 1; VEGF,

vascular endothelial growth factor; Glut1, glucose transporter 1; MAP,

mitogen-activated protein; MAP kinase, MAPK; PI3K, phosphatidylinositol 3-

kinase; NO, nitric oxide; elF-4E, eukaryotic initiation factor; 4E-BP1, elF-

4E-binding protein1; FRAP, FKBP/rapamycin-associated protein; mTOR,

mammalian target of rapamycin; VHL, von Hippel-Lindau; HRE, hypoxia

responsive element; DFX, desferrioxamine; TAD, transactivation domain; HA,

hemagglutinin; GST, glutathione S-transferase


.Kasuno et al

-36-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Acknowledgment

We are grateful to Drs. Wataru Ogawa, and Kaikobad Irani for providing plasmid

vectors, and Mrs. Keiko Nishio for technical assistance.


.Kasuno et al

-37-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

References

1. Hochachka, P. W., Buck, L. T., Doll, C. J., and Land, S. C. (1996) Proc.

Natl. Acad. Sci. USA 93, 9493-9498

2. Guillemin, K., and Krasnow, M. A. (1997) Cell 89, 9-12

3. Paulding, W. R., and Czyzyk-Krzeska, M. F. (2000) Adv Exp Med Biol

475, 111-121

4. Wang, G. L., Jiang, B. H., Rue, E. A., and Semenza, G. L. (1995) Proc Natl

Acad Sci U S A 92, 5510-5514

5. Semenza, G. L. (2000) Genes Dev 14, 1983-1991

6. Hirota, K. (2002) J. Anesthesia 16, 150-159

7. Carmeliet, P., and Jain, R. K. (2000) Nature 407, 249-257

8. Laughner, E., Taghavi, P., Chiles, K., Mahon, P. C., and Semenza, G. L.

(2001) Mol Cell Biol. 21, 3995-4004

9. Treins, C., Giorgetti-Peraldi, S., Murdaca, J., Semenza, G. L., and Van


.Kasuno et al

-38-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Obberghen, E. (2002) J Biol Chem 277, 27975-27981

10. Fukuda, R., Hirota, K., Fan, F., Jung, Y. D., Ellis, L. M., and Semenza, G. L.

(2002) J Biol Chem 277, 38205-38211.

11. Semenza, G. L. (1998) Curr. Opin. Genet. Dev. 8, 588-594

12. Jaakkola, P., Mole, D. R., Tian, Y.-M., Wilson, M. I., Gielbert, J., Gaskell,

S. J., von Kriegsheim, A., Hebestreit, H. F., Mukherji, M., Schofield, C. J.,

Maxwell, P. H., Pugh, C. W., and Ratcliffe, P. J. (2001) Science 292, 468-

472

13. Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M., Salic, A.,

Asara, J. M., Lane, W. S., and Kaelin, W. G., Jr. (2001) Science 292, 464-

468

14. Epstein, A. C., Gleadle, J. M., McNeill, L. A., Hewitson, K. S., O’Rourke,

J., Mole, D. R., Mukherji, M., Metzen, E., Wilson, M. I., Dhanda, A., Tian,

Y. M., Masson, N., Hamilton, D. L., Jaakkola, P., Barstead, R., Hodgkin, J.,

Maxwell, P. H., Pugh, C. W., Schofield, C. J., and Ratcliffe, P. J. (2001) Cell


.Kasuno et al

-39-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

107, 43-54

15. Semenza, G. L. (2001) Cell 107, 1-3

16. Mahon, P. C., Hirota, K., and Semenza, G. L. (2001) Genes. Dev. 15, 2675-

2685

17. Lando, D., Peet, D. J., Gorman, J. J., Whelan, D. A., Whitelaw, M. L., and

Bruick, R. K. (2002) Genes Dev 16, 1466-1471

18. Ignarro, L. J., Cirino, G., Casini, A., and Napoli, C. (1999) J Cardiovasc

Pharmacol 34, 879-886

19. Liu, Y., Christou, H., Morita, T., Laughner, E., Semenza, G. L., and

Kourembanas, S. (1998) J Biol Chem 273, 15257-15262.

20. Huang, L. E., Willmore, W. G., Gu, J., Goldberg, M. A., and Bunn, H. F.

(1999) J Biol Chem 274, 9038-9044.

21. Sogawa, K., Numayama-Tsuruta, K., Ema, M., Abe, M., Abe, H., and

Fujii-Kuriyama, Y. (1998) Proc Natl Acad Sci U S A 95, 7368-7373.

22. Palmer, L. A., Gaston, B., and Johns, R. A. (2000) Mol Pharmacol 58,


.Kasuno et al

-40-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

1197-1203.

23. Kimura, H., Weisz, A., Kurashima, Y., Hashimoto, K., Ogura, T.,

D’Acquisto, F., Addeo, R., Makuuchi, M., and Esumi, H. (2000) Blood 95,

189-197.

24. Jiang, B. H., Zheng, J. Z., Leung, S. W., Roe, R., and Semenza, G. L. (1997)

J Biol Chem 272, 19253-19260

25. Semenza, G. L., Jiang, B. H., Leung, S. W., Passantino, R., Concordet, J. P.,

Maire, P., and Giallongo, A. (1996) J Biol Chem 271, 32529-32537

26. Forsythe, J. A., Jiang, B. H., Iyer, N. V., Agani, F., Leung, S. W., Koos, R.

D., and Semenza, G. L. (1996) Mol Cell Biol 16, 4604-4613

27. Jiang, B. H., Rue, E., Wang, G. L., Roe, R., and Semenza, G. L. (1996) J

Biol Chem 271, 17771-17778

28. Harada, H., Hiraoka, M., and Kizaka-Kondoh, S. (2002) Cancer Res. 62,

2013-2018

29. Higaki, M., Sakaue, H., Ogawa, W., Kasuga, M., and Shimokado, K. (1996)


.Kasuno et al

-41-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

J Biol Chem 271, 29342-29346

30. Kotani, K., Ogawa, W., Hino, Y., Kitamura, T., Ueno, H., Sano, W.,

Sutherland, C., Granner, D. K., and Kasuga, M. (1999) J Biol Chem 274,

21305-21312

31. Irani, K., Xia, Y., Zweier, J. L., Sollott, S. J., Der, C. J., Fearon, E. R.,

Sundaresan, M., Finkel, T., and Goldschmidt-Clermont, P. J. (1997) Science

275, 1649-1652

32. Hirota, K., and Semenza, G. L. (2001) J. Biol. Chem. 276, 21166-21172

33. Ang, S. O., Chen, H., Hirota, K., Gordeuk, V. R., Jelinek, J., Guan, Y., Liu,

E., Sergueeva, A. I., Miasnikova, G. Y., Mole, D., Maxwell, P., Stockton, D.

W., Semenza, G. L., and Prchal, J. T. (2002) Nature Genetics 32, 614-621

34. Itoh, T., Namba, T., Kazuhiko, F., Semenza, L. G., and Hirota, K. (2001)

FEBS Lett. 509, 225-229

35. Akaike, T., and Maeda, H. (1996) Methods in Enzymol 268, 211-221

36. Fukuda, R., Kelly, B., and Semenza, G. L. (2003) Cancer Res 63, 2330-


.Kasuno et al

-42-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

2334

37. Waskiewicz, A. J., Johnson, J. C., Penn, B., Mahalingam, M., Kimball, S.

R., and Cooper, J. A. (1999) Mol Cell Biol 19, 1871-1880

38. Morino, S., Imataka, H., Svitkin, Y. V., Pestova, T. V., and Sonenberg, N.

(2000) Mol Cell Biol 20, 468-477

39. Haystead, T. A., Haystead, C. M., Hu, C., Lin, T. A., and Lawrence, J. C., Jr.

(1994) J Biol Chem 269, 23185-23191

40. Waskiewicz, A. J., Flynn, A., Proud, C. G., and Cooper, J. A. (1997) EMBO

J 16, 1909-1920

41. Sodhi, A., Montaner, S., Miyazaki, H., and Gutkind, J. S. (2001) Biochem.

Biophys. Res. Commun. 287, 292-300

42. Sang, N., Stiehl, D. P., Bohensky, J., Leshchinsky, I., Srinivas, V., and Caro,

J. (2003) J Biol Chem 278, 14013-14019

43. Stamler, J. S., Single, D. J., and Loscalzo, J. (1992) Science 258, 1898-1902

44. Sumbayev, V. V., Budde, A., Zhou, J., and Brüne, B. (2003) FEBS lett. 535,


.Kasuno et al

-43-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

106-112

45. Lander, H. M., Ogiste, J. S., Pearce, S. F., Levi, R., and Novogrodsky, A.

(1995) J Biol Chem 270, 7017-7020

46. Lander, H. M., Milbank, A. J., Tauras, J. M., Hajjar, D. P., Hempstead, B.

L., Schwartz, G. D., Kraemer, R. T., Mirza, U. A., Chait, B. T., Burk, S. C.,

and Quilliam, L. A. (1996) Nature 381, 380-381

47. Marshall, H. E., Merchant, K., and Stamler, J. S. (2000) FASEB J 14, 1889-

1900


.Kasuno et al

-44-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure Legends

Fig. 1. Effect of NO donors on HIF-1α levels in HEK293 cells. A, HEK293 cells

were exposed to 500 µM NOR4 (lane 2 and 3), 500 µM NOR5 (lane 4 and 5), 500

µM NOC18 (lane 6 and 7), 500 µM GSNO (lane 8 and 9), 100 µM SNP (lane 10

and 11), or 100 µM DFX (lane 12 and 13) for the indicated periods and whole cell

lysates were subject to immunoblot assay for HIF-1α (upper panel) or HIF-1β

(lower panel) protein expression. B, HEK293 cells were exposed to 500 µM

NOC18 or 100 µM DFX for 30 min-8 h prior to immunoblot analysis of whole cell

lysates using monoclonal antibodies specific for HIF-1α (upper panel) or HIF-1β

protein (lower panel). C, Comparison of kinetics of HIF-1α induction by NOC12

and NOC18. Cells were exposed to 500 µM NOC12 (upper panel: lane 2, 3 and 4),

500 µM NOC18 (upper panel: lane 5, 6, and 7), 40 µM NOC12 (lower panel: lane

2, 3 and 4), or 500 µM NOC18 (lower panel: lane 5, 6, and 7) for 30 min-8 h prior


.Kasuno et al

-45-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

to immunoblot analysis.

Fig. 2. Effect of NOC18 on expression of HIF-1 target genes. HEK293 cells were

treated with NOC18 or DFX for 24 h and total RNA was isolated. Expression of

VEGF, GLUT1, and HIF-1α mRNA, and 18S rRNA was analyzed by RT-PCR.

Fig. 3. Effect of NO donors on HRE-dependent gene expression. HEK293 cells

were transfected with pTK-RL encoding Renilla luciferase and one of the

following plasmids encoding firefly luciferase: HRE reporter p2.1 (A, B, C,),

mutant HRE reporter p2.4 (B), or VEGF promoter reporter pVEGF-KpnI-Luc

(D). Cells were exposed to 20% or 1% O2 with or without NO donors for 16 h and

then harvested for luciferase assays. In C, cells were co-transfected with p2.1,

pTK-RL, and the indicated amount of expression vectors encoding either no

protein (EV) or a dominant negative form of HIF-1α (DN). The total amount of

expression vectors was adjusted to 500 ng with empty vector. The ratio of


.Kasuno et al

-46-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

firefly:Renilla luciferase activity (RLA) was determined and normalized to the value

obtained from non-hypoxic cells transfected with empty vector to obtain the

relative luciferase activity. Results shown represent mean ± S.D. of three

independent transfections.

Fig. 4. Effect of NOC18 and GSNO on HIF-1 protein stability and synthesis.

HEK293 cells were exposed to 500 µM NOC18 (A), 250 µM GSNO (B), or 100

µM DFX (A, B) for 4 h and then cycloheximide (CHX) was added to a final

concentration of 100 µM. The cells were incubated for 0-60 min, and whole cell

lysates were subject to immunoblot assay using anti-HIF-1α (upper panel) and

HIF-1β (lower panel) antibodies. C, Pulse-labeling of HEK293 cells. Serum-

starved cells were pretreated with no drug, NOC18, or DFX for 30 min in Met-

free medium. [35 S]Met-Cys was added, and the cells were incubated for 20 or 40

min prior to preparation of cell lysates and immunoprecipitation of HIF-1α. D,

HEK293 cells were transfected with plasmid pCH-NLS-HIF-1α(574-603)-LacZ


.Kasuno et al

-47-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(b, c, and d) or empty vector (a) and treated with NOC18 (c) or DFX (d). The cells

were stained with X-gal to detect nuclear expression of β-gal.

Fig. 5. Analysis of HIF-1α ubiquitination and interaction with VHL. A, in vitro

ubiquitination assay. Lysates prepared from cells exposed to vehicle (-) or

NOC18 (+) for 4 h were incubated with in vitro translated HIF-1α in the presence

of ubiquitin and ATP for 0, or 150 min. Polyubiquitinated forms of HIF-1α (Ubi-

HIF-1α) were identified by their reduced mobility after PAGE. B, GST-HIF-

1α(429-608) fusion protein was incubated with in vitro translated VHL in the

presence of PBS or lysates untreated or treated with the indicated reagents.

Glutathione-Sepharose beads were used to capture GST-HIF-1α and the presence

of associated VHL in the samples was determined by PAGE. One-fifth of the

input VHL protein was also analyzed. C and D, FLAG-tagged HIF-1α and HA-

tagged VHL were expressed in HEK293 cells. Cells were treated or untreated with

250-500 µM NOC18 or 100 µM DFX for 2 h and harvested. Lysates were


.Kasuno et al

-48-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

incubated with anti-FLAG affinity beads and captured protein was eluted and

analyzed by SDS-PAGE. Epitopes were detected with anti-FLAG (upper) or

anti-HA (lower) antibody.

Fig. 6. Effect of NO scavenger, guanylate cyclase inhibitor, and antioxidant on

HIF-1α induction by NOC18. HEK293 cells were treated with 250 µM NOC18 or

100 µM DFX with or without carboxyl-PTIO (A), ODQ (B) or NAC (C) for 4 h

and harvested. Then the lysates were subjected to immunoblot assay with anti-

HIF-1α antibody.

Fig. 7. Effects of NOC18 on HIF-1α transactivation-domain function. Constructs

encoding the GAL4 DNA-binding domain (amino acids 1-147) fused to the

indicated amino acids of HIF-1α were analyzed for their ability to transactivate

reporter gene GAL4E1bLuc containing five GAL4-binding sites. HEK293 cells

were co-transfected with pTK-RL (50 ng), GAL4E1bLuc (100 ng), and GAL4-


.Kasuno et al

-49-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

HIF-1α fusion protein expression plasmids (100 ng). Cells were treated with 100

µM DFX or 100-500 µM NOC18 for 16h and then harvested. The ratio of

firefly:Renilla luciferase activity was determined and normalized to the value obtained from

untreated cells transfected with plasmid encoding GAL4(1-147) to obtain the

relative luciferase activity (RLA).

Fig.8. Effect of kinase inhibitors on the induction of HIF-1α protein and

transactivation. (A, B) HEK293 cells were exposed to vehicle, 500 µM NOC18, or

DFX in the presence (+) of 100 µM genistein (GEN), 50 µM LY294002 (LY), 50

µM PD98059 (PD), 100 nM wortmannin (WT) or 200 nM rapamycin (Rap) and

harvested after 4 h for analysis of HIF-1α protein. HRE-dependent gene

expression (C, upper and D) or HIF-1α transactivation domain function (C, lower)

were analyzed using p2.1 or Gal4-HIF-1α(531-826) and GAL4E1bLuc,

respectively. Cells were pre-treated with LY, GEN, PD, or Rap and exposed to

250 µM NOC18 or 100 µM DFX. D, Cells were transfected with an expression


.Kasuno et al

-50-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

vector encoding a dominant negative form of p85 PI3K, Akt, or Ras.

Fig.9 MAPK and PI3K pathway signaling in NOC18-treated cells. HEK293 and

HCT116 cells were exposed to 500 µM NOC18. Whole cell lysates were prepared

after 15 min, 30 min or 60 min and subject to immunoblot assays using antibodies

specific for phosphorylated (Thr-202/Tyr-204) or total p42ERK2/p44 ERK1

MAPK (A) and phosphorylated (Ser-473) or total AKT (B).

Fig.10 Phosphorylation of the translational regulators p70S6K, S6 ribosomal

protein, and elF-4E in NOC18-treated HCT116 cells. Serum-starved cells were

pretreated with inhibitors for 1 h prior to NOC18 treatment as indicated. Whole

cell extracts were prepared after 1 h of NOC18 stimulation and subjected to

immunoblot assays using antibodies specific for phosphorylated (Thr-421/Ser-

424) or total p70S6K (A), phosphorylated (Ser235/236) or total S6 ribosomal

protein (S6R) (B), phosphorylated (Ser-65) or total 4E-BP (C) and


.Kasuno et al

-51-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

phosphorylated (Ser-209) or total elF-4E (D).


.Kasuno et al

-52-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Takehiko Adachi, Gregg L. Semenza and Kiichi HirotaKenji Kasuno, Satoshi Takabuchi, Kazuhiko Fukuda, Shinae Kizaka-Kondoh, Junji Yodoi,

kinase and phosphatidylinositol 3-kinase signalingNitric oxide induces hypoxia-inducible factor 1 activation that is dependent on MAP

published online November 4, 2003J. Biol. Chem.

10.1074/jbc.M308197200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M308197200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M308197200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/11/04/jbc.M308197200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/11/04/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/11/04/jbc.M308197200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

nitric oxide induces hypoxia-inducible factor 1 activation that is

Documents