PATTERNS & PHENOTYPES

Notch 2 and Notch 1/3 Segregate to Neuronaland Glial Lineages of the Developing OlfactoryEpitheliumChristine Carson, Barbara Murdoch, and A. Jane Roskams*

The murine olfactory epithelium (OE) generates olfactory receptor neurons (ORNs) throughoutdevelopment and into adulthood, but only a few of the factors regulating olfactory neuro- and glio-genesishave been delineated. Notch receptors maintain CNS neuronal progenitors and drive glial differentiation,and the Notch effectors Hes 1 and 5 are expressed in the OE, but the Notch receptors that stimulate Hes geneactivation in defined lineages during OE development have not been determined. Here, we first use RT-PCRto reveal which Notch receptors and ligands are expressed in the developing and adult OE. This is followedby immunofluorescent detection, combined with lineage-specific markers to define the stage-specificdevelopmental expression of different Notch family members. We show that throughout development,Notch 1 and 3 are expressed in cells retained within the lamina propria, where Notch 3 is expressed inolfactory ensheathing cells (OECs). In contrast, Notch 2 is expressed in apical embryonic and earlypostnatal OE neuronal progenitors. In postnatal and adult OE, Notch 1 is expressed predominantly inBowman’s glands, and Notch 2 in sustentacular cells. Notch 2 and Notch 1/3 may, therefore, have differentroles in the commitment and differentiation of neuronal and glial lineages of the OE during development,and the maintenance of non-neuronal phenotypes postnatally. Developmental Dynamics 235:1678–1688,2006. © 2006 Wiley-Liss, Inc.© 2006 Wiley-Liss, Inc.

Key words: Notch; Numb; olfactory epithelium; embryonic; postnatal; adult

Accepted 31 January 2006

INTRODUCTION

Notch signaling regulates neurogen-esis and gliogenesis in the developingCNS (reviewed in Yoon and Gaiano,2005). Notch 1 signaling can maintainthe progenitor pool during embryonicneurogenesis (Gaiano et al., 2000; Yunet al., 2002; Tokunaga et al., 2004),where it activates the transcriptionalrepressors Hes-1 and Hes-5 (Ohtsukaet al., 1999, 2001). Its role in progen-itor maintenance is supported byNotch 1 mRNA expression in the em-

bryonic ventricular zone, along withits effector Hes-5 and multiple ligandsJagged 1 and Delta-like 1 and 3. Post-natally, Notch 1 has been detected inscattered cells within the subventricu-lar zone (SVZ) progenitor-containingniche, in the vicinity of Jagged-1 ex-pressing cells (Irvin et al., 2001, 2004;Stump et al., 2002; Nyfeler et al.,2005). In addition, Notch 1 and 3 con-tribute to gliogenesis (Tanigaki et al.,2001; Lutolf et al., 2002; Tokunaga etal., 2004). The Notch regulator,

Numb, has also been detected in theSVZ, where it is asymmetrically lo-cated to the apical membrane of pro-genitors and contributes to theirmaintenance (Zhong et al., 1996,2000; Petersen et al., 2002, 2004).Notch 2 is found in cerebellar granuleneuron precursors, where it prolongsproliferation when overexpressed inactivated form, suggesting that it mayalso contribute to progenitor mainte-nance (Solecki et al., 2001).

The mammalian olfactory epithe-

Department of Zoology, University of British Columbia, Vancouver, BC, CanadaGrant sponsor: CIHR; Grant number: TOP37542; Grant sponsor: NIH; Grant number: DC04579-02S1.*Correspondence to: Dr. A. Jane Roskams, Department of Zoology, Life Sciences Centre, UBC, 2350 Health Sciences Mall,Vancouver, BC V6T 1Z3, Canada. E-mail: roskams@zoology.ubc.ca

DOI 10.1002/dvdy.20733Published online 3 March 2006 in Wiley InterScience (www.interscience.wiley.com).

DEVELOPMENTAL DYNAMICS 235:1678–1688, 2006

© 2006 Wiley-Liss, Inc.

lium (OE) and bulb (OBu) have beenrecognized for over 30 years as asource of adult neural progenitor ac-tivity and neurogenesis (Altman,1969; Graziadei and Graziadei, 1979;Luskin, 1993). In the OE, apoptoticolfactory receptor neurons (ORNs) areroutinely replaced by neurogenesisfrom a basally-situated adult progen-itor population to adapt and maintainthe sense of smell (Graziadei and Gra-ziadei, 1979; Farbman, 1990; Carrand Farbman, 1992; Roskams et al.,1996; Huard et al., 1998). The specificcellular identity of OE progenitors ineither the adult or embryo is notknown. The OE proper containsORNs, their progenitors, and support-ing sustentacular (Sus) cells, whilethe underlying lamina propria (LP)contains fasiculated ORN axon bun-dles, olfactory ensheathing cells(OECs) and their precursors, Bow-man’s glands and the vasculature.During embryogenesis, two progenitorpopulations are located at the apicaland basal OE borders. Postnatally,only basal progenitors persist, com-prising two subpopulations defined bytheir position and morphology: hori-zontal basal cells (HBCs) and globosebasal cells (GBCs). HBCs express anumber of surface markers character-istic of stem cells, cycle slowly andshow multilineage potential in clonalanalysis in vitro, indicating that theyare candidate stem cells (SchwartzLevey et al., 1991; Carter et al., 2004).GBCs contain transit amplifying (TA)cells, which divide rapidly in responseto neurogenic stimulus, and expressthe proneurogenic factor Mash-1 thatupregulates Notch ligand gene expres-sion. Additional GBCs represent im-mediate neuronal precursors (INPs),which divide only once or twice to gen-erate immature receptor neurons(iORNS), and express the proneuro-genic factors Ngn1 and NeuroD. Suscells can also be generated from GBCsfollowing methylbromide-induced in-jury to the OE (Schwartz Levey et al.,1991; Guillemot et al., 1993; Cau etal., 1997; Huard et al., 1998; Suzuki etal., 2003; Chen et al., 2004). In thelamina propria, OECs, derived fromCNS progenitors, are thought to begenerated through a glia-restrictedprecursor (GRP) amplification step,but these cells have yet to be identifiedin the developing LP.

The Notch effectors Hes-1 andHes-5 are expressed in a Mash 1-de-pendent manner in the apical andbasal progenitors, respectively, of theembryonic day (E) 12.5 murine OE,where they are proposed to controlneuronal density (Cau et al., 2000).Their roles in adult olfactory mucosa,where they are expressed in Sus cellsand OECs, respectively (Manglapus etal., 2004), are not known. In contrastto Hes distribution, Notch 1 mRNAhas been found in scattered cells of thebasal cell layer, Notch 2 mRNA inmore apical cell layers, and Notch 3mRNA in medial cell layers of E13.5rat OE (Lindsell et al., 1996). Immu-nohistochemical (IHC) detection ofNotch in neonatal mice has suggestedtransient, very low levels of Notch 1expression in or near basal progeni-tors from P1–P14, along with faintpan-OE expression of Notch 3 thatcould not be assigned to a specific celltype (Doi et al., 2004).

Here, we have generated a stage-specific developmental profile of Notchreceptor and ligand expression in theOE using RT-PCR, and immunofluo-rescent detection, combined with lin-eage-specific markers. We find thatdistinct switches in Notch receptor ex-pression accompany changes in stateduring neuroglial differentiation.Notch 1 is found in lineage-negativecell clusters within the embryonic LPand in Bowman’s glands of the adultOE. Notch 2 is found on embryonicapical OE progenitors, and predomi-nantly on postnatal sustentacularcells. Notch 3 was consistently de-tected in embryonic and early postna-tal OECs, and Numb expression cor-related with Notch in each of thesedevelopmental stages.

RESULTS AND DISCUSSION

A Complex Pattern of NotchReceptors Is Expressed inthe Olfactory Mucosa

To determine which Notch receptorsare expressed during ORN and OECdevelopment, we used RT-PCR to de-tect transcripts for Notch receptorsand their ligands during olfactory de-velopment (Fig. 1). We found tran-scripts for Notch receptors 1–3, alongwith multiple Jagged and Delta li-gands, and the downstream effector

Hes-1 in mRNA samples from postna-tal brain (Fig. 1B, top row) and olfac-tory bulb (Fig. 1B, second row), as ex-pected (Irvin et al., 2001, 2004; Stumpet al., 2002; Benedito and Duarte,2005), and also detected Notch 4.Transcripts for all four Notch recep-tors were obtained from the OE of E15mouse embryos (Fig. 1A), with Notch1–3 in P5 mucosa (Fig. 1B, third row),in samples containing both the devel-oping OE and its underlying laminapropria. We also detected the ligandsJagged 1 and 2, Delta 1 and, in agree-ment with previous reports, (Beneditoand Duarte, 2005), Delta 4, and theeffector Hes-1 at E15 and P5. The ex-pression of Notch receptors 1 and 3,along with ligands Jagged 1 and Delta1, was also confirmed in early passageOECs, purified from the lamina pro-pria of P5 mice (data not shown). Inadult OE, we found Notch 1, 2, and 4transcripts, along with Jagged 1 and2, Delta 1 and 4, and, as expected,Hes-1 (Fig. 1C) (Manglapus et al.,2004). The expression of Notch recep-tors 1 and 2 at all ages tested suggestsNotch signaling could dynamicallyregulate OE neuro or gliogenesisthroughout development.

Notch 1 Is Expressed inCells of the Lamina Propria

In order to accurately define the cell-type specific developmental expres-sion of pattern of Notch receptors inthe olfactory mucosa, we next exam-ined expression of Notch 1–3 by com-bining immunoflourescence with lin-eage-specific markers. Notch 4 wasnot pursued further, as its main as-cribed function is in the developmentof the vasculature (Uyttendaele etal., 1996; Leong et al., 2002). In theembryonic OE (Fig. 2A), the epithe-lium proper contains both apical andbasally-situated ORN progenitors,with developing ORNs sandwiched be-tween. Developing OECs and theirprogenitors are located in the under-lying lamina propria. Postnatally (Fig.2B), the OE develops a pseudo-strati-fied organization, with progenitorsfound in the basal layers, and neuro-nal precursors, immature and matureORNS occupying progressively moreapical layers of the epithelium. Themost apical cell body layer is occupiedby supporting sustentacular cells.

NOTCH IN OLFACTORY EPITHELIUM DEVELOPMENT 1679

In embryonic OE (Fig. 2C), Notch 1was detected in subsets of cells in thelamina propria, but not in the neuro-nal or neural progenitor layers of theOE, or in negative controls (Fig 2D).We also detected Notch1 on cells inthe developing glomerular layer andthe apical dendrites of olfactory bulbmitral cells (data not shown). At P5(Fig. 2E–G), Notch 1 was more readilydetectable in small clusters of cellsthroughout the lamina propria, situ-ated close to Beta III-, Neuron-SpecificTubulin (NST)-expressing axon bun-dles (Fig.2E). Notch 1-positive cellswere typically PCNA-negative (Fig.2F), and asymmetric distribution ofNotch 1 within the plasma membranecould be more clearly seen using con-focal microscopy, at high resolution(Fig. 2G). To better understand therelationship of Notch 1 to potentialprecursor populations in the embry-onic lamina propria, we next exam-ined known markers of neuronal andglial precursors. Brain lipid bindingprotein (BLBP) is a marker of neuro-genic radial glia in the CNS, where itsexpression can be regulated by Notch1 (Anthony et al., 2004, 2005), whiledoublecortin (Dcx), is a microtubule-associated protein found in immatureneurons and neuroblasts of the CNS(Francis et al., 1999; Gleeson et al.,1999). In the peripheral olfactory sys-tem, BLBP is strongly expressed inthe E14 LP, in developing OECs thatensheathe the olfactory nerve. Inter-estingly, Dcx is expressed in develop-ing ORN axons and also in BLBP-neg-ative putative migrating neuroblastswith large nuclei that appear to beencased by smaller, elongated BLBP-positive migrating glioblasts withinthe developing olfactory nerve (Fig.3A,B). These Dcx� neuroblasts(shown at E14) can be detected withinthe olfactory nerve from E12.5–E16.5,a time course that corresponds withthe emergence of GnRH� progenitorsfrom the embryonic OE (Livne et al.,1993). BLBP is strongly co-expressedwith S100� in OECs throughout de-velopment, including some OECs notassociated with axon bundles, locatedadjacent to the basal lamina (Fig.3C,D). We could not detect Notch 1 ineither the BLBP- or Dcx-expressingprogenitor populations of the embry-onic LP (data not shown). Postnatally,Notch 1-positive/BLBP-negative cell

pairs or clusters were most frequentlyfound adjacent to BLBP-positive/Notch1-negative cells or axon en-sheathments, but became less abun-dant in adulthood (Fig. 3E,F). Notch 1was also detected in Bowman’sglands, occasionally at P5 and morehighly expressed in bowman’s glandcell clusters in the adult (Fig. 3E,F).Taken together, these data suggestthat the Notch 1 is not associated withneuronal lineages in the OE, and in-stead is expressed by non-neuronalcells in the lamina propria, where itcould contribute to the regulation ofboth OEC and Bowmans gland pro-duction and/or maintenance.

Embryonic and PostnatalNeuronal Progenitors, andAdult Sustentacular CellsExpress Notch 2

Because we were able to detect Notch2 transcripts throughout OE develop-

ment (Fig. 1), we next examined theexpression of Notch 2 protein in theOE. At E14, we detected Notch 2 inthe 2–3 most apical cell layers of theneuroepithelium, in areas whereNST-positive neurons were not abun-dant (Fig. 4A). The developing OE ishighly variable, with regions undergo-ing rapid neurogenic expansion di-rectly adjacent to more quiescent, ma-ture regions. Significantly morePCNA-positive/Notch 2-positive celllayers were observed in areas wherethe epithelium was rapidly expandingin neurogenic clusters (Fig. 4B), corre-lating with the in situ hybridizationpattern for Notch 2 in rat OE (Lindsellet al., 1996). At P5, Notch 2 was barelydetectable in several cell layers in thebasal OE, but where it was found, itwas largely co-expressed in PCNA-positive basally-situated progenitors(Fig. 4D), underlying the immatureORNS, which expressed doublecortin(Fig. 4C). Notch 2 basal expression at

Fig. 1. Expression of Notch receptors and ligands in the olfactory epithelium. RT-PCR of mRNAisolated from (A) the olfactory epithelium of E15 embryos, (B) the brain, olfactory bulb, and olfactoryepithelium of postnatal day 5 pups, (C) adult OE of CD-1 mice detected expression of (columnsfrom left to right) Notch receptors 1–4; Notch ligands Jagged 1 and 2, Delta-like 1 and 4; and thedownstream Notch effector Hes 1. D: Control reactions: cDNA templates in all samples wereconfirmed by amplification of � actin; no RT controls demonstrated purity of the mRNA. Theposition of the nearest size standard is indicated to the left of each gel. E, embryonic day; P,postnatal day; Ad, adult; OE, olfactory epithelium; LP-OEC, lamina propria olfactory ensheathingcells; RT, reverse transcriptase.

1680 CARSON ET AL.

P5 was most prominent in less matureareas of the OE, where neurogenesisis still proceeding, and fewer cell lay-ers are occupied by Dcx- or NST-posi-tive immature neurons. Notch 2 ex-pression in neuronal precursors has

also been detected in the externalgranule layer of the cerebellum(Solecki et al., 2001), where it corre-lated with expression of Hes-1. In ad-dition, we found a novel Notch 2 ex-pression pattern in some Sus4-

positive sustentacular cells, bothactively cycling and PCNA-negative(Fig. 4D,E). Although Notch 2 detec-tion in sustentacular cell processeswas compromised by the trypsin treat-ment required to reveal the Sus4 an-tigen (Fig. 4E), co-expression of Notch2 and Sus 4 could be confirmed in de-convolved image stacks (Fig. 4E, in-set). In adult OE, Notch 2 was ex-pressed in sustentacular cells andtheir processes (Fig. 4F–H), and wasmost robustly expressed by Sustentac-ular cells in the septum and dorsalrecess. Notch 2 was not found in com-mitted neurons expressing NST orOMP (Fig. 4F,G), or PCNA-positivebasal cells of the adult OE (Fig. 4H).These results demonstrate that Notch2 expression in the olfactory epithe-lium occurs in two distinct subpopula-tions of cells, with overlapping devel-opmental profiles at early postnataltime points: (1) embryonic and earlypostnatal putative neuronal progeni-tors; and (2) postnatal sustentacularcells. This pattern is entirely coinci-dent with that reported for Hes-1mRNA in apical progenitors of theE12.5 OE, and in sustentacular cells

Fig. 2. Notch 1 is expressed by cells of thelamina propria. The embryonic OE (A) com-prises the developing epithelium proper, con-taining apical and basal progenitor layers sur-rounding layers of developing olfactoryreceptor neurons, and the developing laminapropria underlying it, which contains emergingaxons, the developing OECs that ensheathethem, and OEC progenitors. In contrast, post-natal OE (B) is a pseudo-stratified tissue, withbasally-situated progenitors, layers of increas-ingly differentiated ORNs, and an apical layer ofsupporting sustentacular cell bodies. C: E14embryos, Notch 1 protein was detected in thedeveloping lamina propria (arrowheads), a spe-cific signal not seen in adjacent controls(D) incubated with PBS in place of primary an-tibody. At P5 (E), Notch 1 (green) was detectedin small cell clusters in the LP (arrowheads),adjacent to NST-positive (red) axon bundles(arrow). F: Notch 1-expressing LP cell clusters(green, box) did not contain PCNA-positive (red)nuclei (arrowhead). Within the Notch 1-positiveclusters (such as those indicated by the box inF), asymmetric subcellular distribution of theprotein could be demonstrated by projection ofa deconvolved image stack (G, arrowheads).Scale bar � 50 �m in C,D; 20 �m in E, and 10�m in F. In all panels, blue, DAPI; dashed line,basal lamina; OE, olfactory epithelium; LP, lam-ina propria; Ax, axon bundle; ORN, olfactoryreceptor neuron; OEC, olfactory ensheathingcell; i, immature; Sus, sustentacular cell.

NOTCH IN OLFACTORY EPITHELIUM DEVELOPMENT 1681

of the adult (Cau et al., 2000; Mang-lapus et al., 2004). Notch 2 expressionby both neuronal progenitors andpostnatal sustentacular cells may re-flect their shared common lineage;both endogenous and transplantedglobose basal cells in the methyl bro-mide-lesioned adult OE can give riseto a mix of neuronal and sustentacu-lar cells, replacing the populations de-pleted by methyl bromide (Chen et al.,

Fig. 3.

Fig. 4.

Fig. 3. Notch 1 is not expressed by known glialor neuronal progenitors in the developing lam-ina propria. At E14 (A,B), BLBP (green) anddoublecortin (Dcx, red, arrowheads and box inA) -positive cells were detected in the laminapropria, within the developing olfactory nerve(ON). In high-resolution deconvolved imagestacks (B, depicts boxed area in A), BLBP-pos-itive processes (arrow) ensheathing the nerve atits boundaries were detected, along with Dcx-positive migrating neuroblasts (arrowhead)within the ON. In both E17 embryos (C) andadults (D), BLBP (red) was detected in individ-ual cells underlying the basal lamina (asterisks),and in ensheathments (arrows) surrounding (C)Dcx-expressing (green) axons, where (D) theOEC marker S100-� (green) was co-expressed.In P5 (E) and adult OE (F), Notch 1 (green) wasoften detected in glands of the LP (arrow-heads), and in cell clusters adjacent to BLBP-positive (red) axon ensheathments (arrows) orcells (asterisks). Scale bar � 50 �m in A, C–D;20 �m in B, E,F. In all panels, blue, DAPI;dashed line, basal lamina; OB, olfactory bulb;ON, olfactory nerve; CP, cribriform plate; OE,olfactory epithelium.

Fig. 4. Notch 2 is expressed by neuronal pro-genitors of the developing OE and adult sus-tentacular cells. In E14 embryos (A,B), Notch 2(green) was detected (A) in areas of the devel-oping OE with few NST-positive (red) neurons(asterisks), where (B) PCNA-positive (red) apicalprogenitors were abundant (asterisk). At P5 (C–E), Notch 2 (green) was detected (C) weakly inbasal cell layers (asterisk), in areas with fewerlayers of doublecortin-positive (red) immatureolfactory neurons, where (D) it was co-ex-pressed in some PCNA-positive (red) basal pro-genitors (asterisk). Notch 2 was also detected insustentacular cells and their processes, whichtraversed the OE (arrowheads), some of whichwere also PCNA-positive (arrow) and (E, red,box) co-expressed Sus4 (inset: high-resolutiondeconvolved image). In adult (F–H), Notch 2(green) was detected in apical cell bodies (as-terisks), processes that traversed the OE (ar-rows) and endfeet adjacent to the basal lamina(arrowheads) that were distinct from (F, red)NST-positive immature and (G, red) OMP-pos-itive mature ORNs (inset: high-resolution de-convolved image), and (F, red) PCNA-positivebasal progenitors in a projection of a decon-volved image stack. Scale bar � 50 �m in A–C;20 �m in D–H; 10 �m in E and G insets. In allpanels, green, Notch 2; blue, DAPI; dashed line,basal lamina; OE, olfactory epithelium; LP, lam-ina propria.

1682 CARSON ET AL.

2004; Manglapus et al., 2004). Thepresence of Notch 2 in the most api-cally-situated mature cells of the sus-tentacular lineage suggests thatNotch 2 may be assymetrically dis-tributed to this lineage as precursorsdivide.

Notch 3 Is Expressed inDeveloping OlfactoryEnsheathing Cells

Notch 3 has been associated with glio-genesis in CNS progenitors (Tanigakiet al., 2001), and we have previouslydetected Notch 3 in subpopulations ofearly passage OECs in vitro, derivedfrom P5 LP (Au and Roskams, 2003).Throughout development (E13 to P4),Notch 3 expression was not detectedin the developing neurons of the OE,and was largely associated with cellsaligning axon bundles of the LP andthe nerve fibre layer of the olfactorybulb (Fig. 5). All developing ORN ax-ons express NCAM, whereas develop-ing OECs can transiently expressPSA-NCAM (Barnett and France-schini, 1999). Regardless, examina-tion of the less-densely packaged, de-fasiculating axons within the nervefibre layer of the olfactory bulb clearlyshowed very little overlap of NCAMand Notch 3, with Notch 3 signal dis-tinct from NCAM-positive axon tracts(Fig. 5A, inset). In contrast, Notch 3 isco-expressed completely with OEC-as-sociated S100� in the OE and OB (Fig.5B, inset) (in a pattern similar to thatseen for BLBP in Fig. 3D), and GFAP(Fig. 5C, inset), an alternate markerof OECs expressed more highly duringembryonic development. Some OECsin the developing OE express GFAP,with the exclusion of Notch 3. Contin-ued expression of Notch 3 in OEC sub-populations postnatally suggests itcould play a role in the continued ex-pression of BLBP (which is induced byNotch 1 activation in the CNS) inOECs throughout development. Thesefindings parallel results from studiesof the CNS defects in conditionalNotch 1 and Notch 3/conditionalNotch 1 knockout mice, which showdecreased production of radial gliaand decreased expression of the Notchtarget gene BLBP, respectively, in theabsence of one or both receptors(Gaiano et al., 2000; Anthony et al.,2005).

Numb Correlates With Notch1-2 Expression in theOlfactory Epithelium

We next examined expression of theNotch intrinsic regulator, Numb, inthe OE. We wanted to test if Notchpathway regulators could be found innestin-expressing, radial glia-likecells of the embryonic OE, and also todetermine whether Numb expressioncoincided with the cell-specific Notchexpression patterns we had detected.Throughout embryogenesis and earlypostnatal development, the OE con-tains nestin-expressing cells with ra-dial processes that span the neuronallayers of the OE (Fig. 6A,B; green), ina similar manner to radial glia of theCNS (Hockfield and McKay, 1985). AtE14 (Fig. 6A), Numb was widely ex-pressed at low levels in cells through-out the neuronal layers of the OE. Weoften found “chains” of Numb-express-ing cells adjacent to the radial pro-cesses of nestin-expressing putativeembryonic OE progenitors (Fig. 6A,arrowheads), but Numb and nestinwere not co-expressed, a pattern thatremained consistent throughout de-velopment (Fig. 6B). In addition, atE14 Numb was co-expressed in apicalNotch 2-positive cells of the OE (Fig.6C, asterisk). This expression is con-sistent with a role for Numb in regu-lating neuronal cell fate in both OEand CNS progenitors. Numb may beasymmetrically distributed to only theprogeny of OE-based progenitors,which are committed to a neuronalfate, similar to cortical progenitorswhere asymmetric segregation ofNumb into one daughter is associatedwith adoption of a neuronal fate (Shenet al., 2002; Fishell and Kriegstein,2003). At P5 and in adult, we detectedNumb co-expression with Notch 2 insustentacular cells and their pro-cesses (Fig. 6D–F), where Numb andNotch 2 co-localized at the plasmamembrane (Fig. 6F). Numb was alsoco-expressed with Notch 1 in subsetsof cells in the lamina propria (Fig. 6G–I), although Numb was evenly distrib-uted throughout the LP cells withasymmetric Notch 1 (Fig. 6H,I).Taken together, these data indicatethat Numb may be a common media-tor of Notch receptor 1–2 signaling inthe olfactory epithelium, where it maysegregate into the more differentiated

progeny of glial and neuronal lin-eages. This broad profile of Numb ex-pression apparently contrasts withthe CNS, where Numb is seen in em-bryonic neuronal progenitors, but notin postmitotic neurons, where the re-lated protein Numblike is abundant(Zhong et al., 1997). Although we didnot detect Numb (using this antibody)in mature CNS neurons, because theepitope recognized by the anti-Numbused in this study differs from the cor-responding sequence in Numblike atonly two amino acids, we cannot ruleout the possibility that we may detect,in part, Numblike, if it is expressed ata significant level. Four isoforms ofNumb can be generated by alternatesplicing of two sequences within theprotein (Dho et al., 1999), and allwould be recognized by the antibodyused here. The different isoforms havebeen implicated in differential local-ization to the plasma membrane incultured cells and alternate fatechoices, promoting either continuedproliferation or differentiation (Dho etal., 1999; Verdi et al., 1999). In theembryo, Numb co-expressed withNotch 2 in apical neuronal progenitorscould, therefore, be associated withmaintenance of the progenitor poolthrough continued proliferation, a roleanalogous to its function in CNS pro-genitors throughout embryonic devel-opment (Zhong et al., 2000; Petersenet al., 2004). In the adult, mem-brane-bound Numb expressed innon-cycling Bowman’s glands andsustentacular cells could insteadplay a role in maintenance of thedifferentiated phenotype, and inhibi-tion of mitosis.

Notch Family MembersSegregate to DifferentLineages in the OlfactoryEpithelium

Taken together with published data,the spatiotemporal pattern of Notchreceptor expression reported here sup-ports a model of tightly-controlled,distinct Notch activation maintainingprogenitors and driving differentia-tion down defined neuronal and gliallineages in the developing olfactoryepithelium and lamina propria (sum-marized in Fig. 7). Notch 2 is co-ex-pressed with Numb in embryonic cy-

NOTCH IN OLFACTORY EPITHELIUM DEVELOPMENT 1683

cling apical OE progenitors (Figs.4A,B, 6C), which also express Hes-1(Cau et al., 2000) and Pax 6 (Tietjen etal., 2003). Progenitors in the basal celllayers of the postnatal OE, which mayinclude both Mash-1-expressing tran-sit amplifiers and Neurogenin 1-ex-pressing immediate neuronal precur-sors (Guillemot et al., 1993; Cau et al.,1997; Huard et al., 1998) expressNotch 2 (Fig. 4C,D), and Numb (Fig.6D). The Notch ligands, Delta-like 1,Delta-like 4, and Jagged, and the ef-fector Hes-5 are also found in somebasal progenitors, placing them in anideal position to regulate their neigh-bors by lateral inhibition (Lindsell etal., 1996; Cau et al., 2000; Beneditoand Duarte, 2005). The detection of

Fig. 5.

Fig. 6.

Fig. 7. Developmental stage-specific Notch receptor expression in theOE. Notch 1 is co-expressed with Numb in putative bipotential progen-itor cell clusters of the lamina propria, which may generate both Notch3-positive/BLBP-positive cells of the OEC lineage, and Notch 1-positiveBowman’s glands. Notch 2 is detected in apical embryonic OE progen-itors, which also express Hes-1, and several cell layers of basal progen-itors in the postnatal OE. Numb is co-expressed in both cell types.Postnatally, Notch 2 and Numb are also detected in Hes-1-expressingsustentacular cells. BPP, bipotential progenitor; ORN, olfactory receptorneuron; GRP, glial restricted precursor; OEC, olfactory ensheathing cell;N, Notch; i, immature; BG, Bowman’s gland; Sus, sustentacular cell;dashed border, cellular expression predominant in early postnatal de-velopment; solid border, phenotype predominant in adults.

1684 CARSON ET AL.

Notch 2 in sequential Hes-1 and Hes-5-expressing neuronal progenitors(Cau et al., 2000; Manglapus et al.,2004) concurs with observations of OEdevelopment in Hes knockout mice,suggesting that Hes-1 acts at an ear-lier step in ORN development thanHes-5 (Cau et al., 2000). Our data donot concur with low-power in situ hy-bridization profiles suggesting Notch1 may be expressed in embryonic OEbasal progenitors (Lindsell et al.,1996), but this discrepancy may bedue to both a difference in sensitivityof techniques, and enhanced cell type-specific expression elucidated in thisstudy. Here, we detect Notch 1 (Figs.2C–G, 3E–F) and Numb (Fig. 6G–I) incell clusters exclusively within the de-veloping lamina propria, where theyare ideally situated to feed into theOEC lineage, producing progeny thatthen become Notch1-/BLBP�. Notch 3(Fig. 5) is co-expressed with the Notchtarget gene BLBP (Fig. 3C,D) in devel-oping OECs, which also express Hes-5(Manglapus et al., 2004). In contrastto their embryonic profiles, Notch 1and Notch 2 were robustly expressedin the postnatal olfactory mucosa intwo differentiated cell types, Notch 1in Bowman’s glands (Fig. 3E,F) andNotch 2 (with Numb), throughout sus-tentacular cells (Figs. 4D–H, 6D–F),which also express Hes-1 and Pax 6(Davis and Reed, 1996; Manglapus etal., 2004). The recurring correlation ofNotch 2 and Hes-1 in distinct celltypes of the OE suggests that, as inthe CNS, similar signals may give rise

to distinct developmental outcomes(maintenance of progenitor pheno-type, vs. a mature physical pheno-type), at different stages of OE matu-rity.

In summary, our data demon-strate that Notch receptor and li-gand mRNAs are expressed in theOE throughout development, andthat Notch receptor family memberssegregate to different neuronal andglial lineages in the olfactory epithe-lium and lamina propria. Notch 2 isfirst expressed in neuronal progeni-tors, while Notch 1 and 3 proteinsare detected in putative glial progen-itors and OECs of the developing LP,respectively. In the adult OE, Notch1 is restricted to Bowman’s glandsand Notch 2 to sustentacular cells,where Notch 3 is found on occasionalLP-based OECs. Our data reveal theupstream receptors that can feedinto the well-described Hes expres-sion profiles in ORN and OEC devel-opment, and suggest that Notch sig-naling may play different andcontrasting roles in the maintenanceof both progenitors and differenti-ated cells in the peripheral olfactorysystem. These data also highlight anemerging concept in neuronal pro-genitor biology, that embryonic andadult progenitors not only have dis-tinct identities, but that the mecha-nisms that regulate their fate com-mitment differ significantly betweenembryonic and adult neuro-gliogen-esis.

EXPERIMENTALPROCEDURES

Tissue Preparation forImmunohistochemistry

Adult and timed pregnant CD-1 mice(n � 3 per developmental stage) wereanaesthetized with Xylaket (25% Ket-amine HCL, MTC Pharmaceuticals),2.5% Xylazine (Bayer Inc.), 15% etha-nol, 0.55% NaCl), and the adults per-fused with PBS followed by 4% para-formaldehyde (Fischer Chemicals,Fair Lawn, NJ) in 0.1M phosphatebuffer, pH � 7.4 (PFA). Brains, olfac-tory bulbs, and olfactory epitheliawere dissected out and post-fixed in4% PFA as described (Cowan et al.,2001; Cowan and Roskams, 2004; Car-son et al., 2005). P5 mice were anaes-thetised with Aerrane (isoflurane) in-halation anaesthetic (Baxter Corp.,Toronto, ON, Canada), perfused byhand, decapitated, and whole headspostfixed in 4% PFA. Embryos weredissected out and immersion-fixed in4% PFA as described (Cowan andRoskams, 2004). Tissues were equili-brated in 10 and 30% sucrose, P5 skinand nose tips were removed, and sam-ples were embedded in TissueTek(Sakura Finetek, Torrance, CA) andfrozen in liquid nitrogen. Then, 10–16-�m coronal P5 and adult, trans-verse adult, and sagittal embryonicfrozen sections were prepared on aHM 500 cryostat (Micron) and storedat �20°C.

Tissue Preparation formRNA Isolation

Mice were decapitated following anes-thesia; brains or olfactory tissue weredissected out without perfusion, snapfrozen on dry ice, and stored at �80°C.At least two sets of tissue per develop-mental time point were prepared. P5OECs were cultured as described (Auand Roskams, 2003). At passage 2,cells were trypsinized, collected bycentrifugation, and the pellet snapfrozen.

RT-PCR mRNA was isolated di-rectly from tissues or cells using aQuickPrep Micro mRNA PurificationKit, and cDNAs reversed transcribedusing pd(N)6 primers and the FirstStrand cDNA Synthesis Kit (both Am-ersham Biosciences, Piscataway, NJ).PCR amplification was carried out for:

Fig. 5. Notch 3 is expressed by developing olfactory ensheathing cells. At E17, Notch 3 (red) wasdetected (A) in NCAM-positive (green) axon bundles of the developing LP. In higher resolutionimages of the defasiculated axons within the nerve fibre layer of the olfactory bulb (A,B, insets),Notch 3 (red, arrow) was distinct from (A) NCAM-positive (green) axon tracts and was co-expressedwith (B) S100� (green) detected on OECs. C: Notch 3 was co-expressed with GFAP (green) in OECaxon ensheathments of the LP. Scale bar � 100 �m for A–C. In all panels, OE, olfactory epithelium;LP, lamina propria; OB, olfactory bulb; CP, cribriform plate; Gl, glomerular layer of the olfactorybulb; Sep, septum; dashed line, basal lamina.

Fig. 6. Numb expression correlates with Notch 1 and 2 in the olfactory epithelium. At E14 (A,C) andP5 (B), Numb (red) was detected in cells within the middle layers of the OE (arrowheads), adjacentto (A,B) nestin-expressing (green) putative progenitors. At E14, Numb was co-expressed with (C)Notch 2-positive (green) apical OE cells (asterisk). At P5 (D), Numb (red) was co-expressed withNotch 2 (green) in Sus cells and their processes that traversed the OE (arrowheads). In adult OE(E,F), Numb (red) was detected in Notch 2-positive (green) Sus cells (E) throughout their processes(arrowheads), where (F, projection of deconvolved image stack) Numb and Notch 2 colocalized atthe plasma membrane (arrowheads). At P5 (G–I), Numb (red) and Notch 1 (green) were co-expressed in LP cell clusters (G, boxes), although only Notch 1 displayed asymmetric subcellulardistribution (H,I) when examined at high resolution. Scale bar � 50 �m in A–D; 20 �m in E–G; 10�m in H,I. In all panels, blue, DAPI; dashed line, basal lamina; OE, olfactory epithelium; LP, laminapropria; Sus, sustentacular cell layer.

NOTCH IN OLFACTORY EPITHELIUM DEVELOPMENT 1685

1 cycle of 95°C for 5 min; 35 cycles of95°C for 30 sec, 60°C for 30 sec, 72°Cfor 45 sec; and 1 cycle of 72°C for 10min. Primer sequences and productsizes are described in Table 1.

Immunohistochemistry

Sections were post-fixed in 4% PFAand free aldehyde groups reduced bythree washes in 0.1% sodium borohy-dride (Fischer) in PBS. Sections werethen microwaved for 10 min in 0.01Mcitric acid (Sigma Chemical Co., St.Louis, MO), pH � 6, to reveal epitopes(except for Sus4 and Notch 3) and per-meabilized in 0.1% Triton-X-100(Pierce, Rockford, IL) for 30 min. Fordetection of Sus4, sections weretreated for 1 min with 0.125% trypsin-EDTA (GIBCO Invitrogen Corp.) inPBS. All sections were blocked with4% normal serum (GIBCO) and 1%BSA (Sigma), and incubated at 4°Covernight with primary antibody.Controls for non-specific secondarybinding were incubated overnightwith an equal volume of PBS. For im-muno-histochemistry, sections wereincubated for 30 min at room temper-ature in biotin-conjugated secondaryantibody and binding visualized withthe Vectastain ABC peroxidase andVIP chromogen kits (all Vector Labo-ratories, Burlingame, CA). For doubleimmunofluorescence, sections were in-cubated with appropriate Alexa 488-and Alexa 594-conjugated secondaryantibodies (Molecular Probes, Eu-gene, OR) for 1 hr at room tempera-ture, then counterstained with DAPI(Boehringer Mannheim, Germany)and mounted in Vectashield (Vector).Staining patterns were observed con-sistently using at least two differentsecondary antibodies (E.G.; Fig. 3A vs.C). Immuno-fluorescence runs for

Notch receptors and Numb were per-formed on a series of adjacent sectionsand employed negative controls wherethe primary antibody was omitted (tocontrol for non-specific binding of sec-ondary antibodies), the secondary an-tibody was omitted (to control forautofluorescence), and where alterna-tive isotype (species-specific) primaryantibodies were used to recognize dif-ferent antigens with different cellulardistributions.

Antibodies

Rat monoclonal antibodies to Notch 1(Figs. 2,3, bTAN20 supernatant, usedat 1:5) and Notch 2 (C651.6DbHN su-pernatant, used at 1:2) are availablethrough Developmental Studies Hy-bridoma Bank (University of Iowa),and gave similar results as rabbitpolyclonal anti-Notch 2 (Fig. 4, used at1:100), and goat polyclonal anti-Notch1 (used at 1:50), purchased from SantaCruz Biotech (Santa Cruz, CA). Goatanti-Notch 3 (used at 1:50) and anti-doublecortin (used at 1:200) were fromSanta Cruz; goat anti-Numb (used at1:200) was obtained from AbCam(Cambridge, MA); rabbit anti-GFAP(used at 1:400) was from Dako (Den-mark); mouse monoclonal anti-S100�(SH-B1, used at 1:1,000) and anti-PCNA ( PC10, used at 1:5,000) werefrom Sigma; rabbit anti-NCAM (usedat 1:500) was from Chemicon (Te-mecula, CA); and neuron-specific �IIItubulin (NST) monoclonal (TuJ1, usedat 1:500) and rabbit anti-mouse nestin(used at 1:500) were obtained from Co-vance (Richmond, CA). Goat poly-clonal antibody to Olfactory MarkerProtein (used at 1:5,000) was the giftof Frank L. Margolis (University ofMaryland, Baltimore, MD), rabbitpolyclonal antibody to BLBP (used at

1:2,000) was received from NathanielHeintz (Rockefeller University, NewYork, NY), and mouse monoclonal hy-bridoma supernatant to Sus4 (used at1:50) was a gift from Jim Schwob(Tufts University, Boston, MA).

Image Capture

Digital images were captured from anAxioplan 2 microscope (Zeiss, Jena,Germany), using a Retiga digital cam-era (QImaging, Burnaby, BC, Can-ada) and Northern Eclipse software(Empix Imaging Inc., Mississauga,ON, Canada). Image stacks for Fig-ures 2G, 3B, 4E (inset), 4G (inset), 4H,and 6F were captured on a DeltaVi-sion deconvolution microscope and de-convolved with the accompanyingSoftWoRx program using 5-15 itera-tions (both Applied Precision, Issa-quah, WA). Images were processedand assembled using Adobe Photo-shop 6/7.

ACKNOWLEDGMENTSWe thank Nasha Lazarri for technicalassistance, Dr. Mary Gilbert sharingher expertise in image deconvolution,and Aly Karsen for the gift of Notch 1monoclonal supernatant. C.C. is sup-ported by a fellowship from the NCEStem Cell Network and B.M. is fundedby fellowships from the Heart andStroke Foundation of Canada and theMichael Smith Foundation for HealthResearch.

REFERENCES

Altman J. 1969. Autoradiographic and his-tological studies of postnatal neurogen-esis. IV. Cell proliferation and migrationin the anterior forebrain, with specialreference to persisting neurogenesis in

TABLE 1. Primer Sequences for RT-PCR and Expected Product Sizes

Forward primer (5�–3�) Reverse primer (5�–3�) PCR product (bp)

Notch 1 GGT GAA CAA TGT GGA TGC TG GTG GAGACAGAGTGGGTG T 303Notch 2 ACAGGACCAGTGTGCCAGAT ACACCGGAAACCATTCACAT 545Notch 3 GCA CCT GCA ACC CTG TTT AT ACA GAG CCG GTT GTC AAT CT 380Notch 4 CAG GGG CTC TCT GTG ACT TC TCA TCC ACA TCT CCC TCA CA 400Jagged 1 CTT GGC CAG TGT CAG AAT GA GTG GTA CGG CAG TGG TCT TT 347Jagged 2 CGT CGT CAT TCC CTT TCA GT CCC GTG GAG CAA ATT ACA TC 376Delta-like 1 GAA GAT CGC CCC AAC ACT TA TAG TGC AAT GGG AAC AAC CA 372Delta-like 4 TCA GCC AAA TCA TCA TCC AA GTG GGG GAT ACA TTC ATT GC 350Hes 1 CCAAGCTAGAGAAGGCAGACA AGCCACTGGAAGGTGACACT 588

1686 CARSON ET AL.

the olfactory bulb. J Comp Neurol 137:433–457.

Anthony TE, Klein C, Fishell G, Heintz N.2004. Radial glia serve as neuronal pro-genitors in all regions of the central ner-vous system. Neuron 41:881–890.

Anthony TE, Mason HA, Gridley T, FishellG, Heintz N. 2005. Brain lipid-bindingprotein is a direct target of Notch signal-ing in radial glial cells. Genes Dev 19:1028–1033.

Au E, Roskams AJ. 2003. Olfactory en-sheathing cells of the lamina propria invivo and in vitro. Glia 41:224–236.

Barnett SC, Franceschini IA. 1999. Adhe-sion molecule expression and phenotypeof glial cells in the olfactory tract. AdvExp Med Biol 468:297–307.

Benedito R, Duarte A. 2005. Expression ofDll4 during mouse embryogenesis sug-gests multiple developmental roles.Gene Expr Patterns 5:750–755.

Carr VM, Farbman AI. 1992. Ablation ofthe olfactory bulb up-regulates the rateof neurogenesis and induces precociouscell death in olfactory epithelium. ExpNeurol 115:55–59.

Carson C, Saleh M, Fung FW, NicholsonDW, Roskams AJ. 2005. Axonal dynactinp150Glued transports caspase-8 to driveretrograde olfactory receptor neuron ap-optosis. J Neurosci 25:6092–6104.

Carter LA, MacDonald JL, Roskams AJ.2004. Olfactory horizontal basal cellsdemonstrate a conserved multipotentprogenitor phenotype. J Neurosci 24:5670–5683.

Cau E, Gradwohl G, Fode C, Guillemot F.1997. Mash1 activates a cascade ofbHLH regulators in olfactory neuronprogenitors. Development 124:1611–1621.

Cau E, Gradwohl G, Casarosa S,Kageyama R, Guillemot F. 2000. Hesgenes regulate sequential stages of neu-rogenesis in the olfactory epithelium.Development 127:2323–2332.

Chen X, Fang H, Schwob JE. 2004. Multi-potency of purified, transplanted globosebasal cells in olfactory epithelium.J Comp Neurol 469:457–474.

Cowan CM, Roskams AJ. 2004. Caspase-3and caspase-9 mediate developmentalapoptosis in the mouse olfactory system.J Comp Neurol 474:136–148.

Cowan CM, Thai J, Krajewski S, Reed JC,Nicholson DW, Kaufmann SH, RoskamsAJ. 2001. Caspases 3 and 9 send a pro-apoptotic signal from synapse to cellbody in olfactory receptor neurons.J Neurosci 21:7099–7109.

Davis JA, Reed RR. 1996. Role of Olf-1 andPax-6 transcription factors in neurode-velopment. J Neurosci 16:5082–5094.

Dho SE, French MB, Woods SA, McGladeCJ. 1999. Characterization of four mam-malian numb protein isoforms. Identifi-cation of cytoplasmic and membrane-as-sociated variants of the phosphotyrosinebinding domain. J Biol Chem 274:33097–33104.

Doi K, Ishida H, Nibu K. 2004. Notch ex-pression in developing olfactory neuroep-ithelium. Neuroreport 15:945–947.

Farbman AI. 1990. Olfactory neurogenesis:genetic or environmental controls?Trends Neurosci 13:362–365.

Fishell G, Kriegstein AR. 2003. Neuronsfrom radial glia: the consequences ofasymmetric inheritance. Curr Opin Neu-robiol 13:34–41.

Francis F, Koulakoff A, Boucher D, ChafeyP, Schaar B, Vinet MC, Friocourt G, Mc-Donnell N, Reiner O, Kahn A, McConnellSK, Berwald-Netter Y, Denoulet P,Chelly J. 1999. Doublecortin is a devel-opmentally regulated, microtubule-asso-ciated protein expressed in migratingand differentiating neurons. Neuron 23:247–256.

Gaiano N, Nye JS, Fishell G. 2000. Radialglial identity is promoted by Notch1 sig-naling in the murine forebrain. Neuron26:395–404.

Gleeson JG, Lin PT, Flanagan LA, WalshCA. 1999. Doublecortin is a microtubule-associated protein and is expressedwidely by migrating neurons. Neuron 23:257–271.

Graziadei PP, Graziadei GA. 1979. Neuro-genesis and neuron regeneration in theolfactory system of mammals. I. Morpho-logical aspects of differentiation andstructural organization of the olfactorysensory neurons. J Neurocytol 8:1–18.

Guillemot F, Lo LC, Johnson JE, AuerbachA, Anderson DJ, Joyner AL. 1993. Mam-malian achaete-scute homolog 1 is re-quired for the early development of olfac-tory and autonomic neurons. Cell 75:463–476.

Hockfield S, McKay RD. 1985. Identifica-tion of major cell classes in the develop-ing mammalian nervous system. J Neu-rosci 5:3310–3328.

Huard JM, Youngentob SL, Goldstein BJ,Luskin MB, Schwob JE. 1998. Adult ol-factory epithelium contains multipotentprogenitors that give rise to neurons andnon-neuralcells.JCompNeurol400:469–486.

Irvin DK, Zurcher SD, Nguyen T, Wein-master G, Kornblum HI. 2001. Expres-sion patterns of Notch1, Notch2, andNotch3 suggest multiple functional rolesfor the Notch-DSL signaling system dur-ing brain development. J Comp Neurol436:167–181.

Irvin DK, Nakano I, Paucar A, KornblumHI. 2004. Patterns of Jagged1, Jagged2,Delta-like 1 and Delta-like 3 expressionduring late embryonic and postnatalbrain development suggest multiplefunctional roles in progenitors and dif-ferentiated cells. J Neurosci Res 75:330–343.

Leong KG, Hu X, Li L, Noseda M, LarriveeB, Hull C, Hood L, Wong F, Karsan A.2002. Activated Notch4 inhibits angio-genesis: role of beta 1-integrin activa-tion. Mol Cell Biol 22:2830–2841.

Lindsell CE, Boulter J, diSibio G, GosslerA, Weinmaster G. 1996. Expression pat-terns of Jagged, Delta1, Notch1, Notch2,and Notch3 genes identify ligand-recep-tor pairs that may function in neuraldevelopment. Mol Cell Neurosci 8:14–27.

Livne I, Gibson MJ, Silverman AJ. 1993.Biochemical differentiation and intercel-lular interactions of migratory gonado-tropin-releasing hormone (GnRH) cellsin the mouse. Dev Biol 159:643–656.

Luskin MB. 1993. Restricted proliferationand migration of postnatally generatedneurons derived from the forebrain sub-ventricular zone. Neuron 11:173–189.

Lutolf S, Radtke F, Aguet M, Suter U, Tay-lor V. 2002. Notch1 is required for neu-ronal and glial differentiation in the cer-ebellum. Development 129:373–385.

Manglapus GL, Youngentob SL, SchwobJE. 2004. Expression patterns of basichelix-loop-helix transcription factors de-fine subsets of olfactory progenitor cells.J Comp Neurol 479:216–233.

Nyfeler Y, Kirch RD, Mantei N, Leone DP,Radtke F, Suter U, Taylor V. 2005.Jagged1 signals in the postnatal subven-tricular zone are required for neuralstem cell self-renewal. Embo J 90:142–154.

Ohtsuka T, Ishibashi M, Gradwohl G, Na-kanishi S, Guillemot F, Kageyama R.1999. Hes1 and Hes5 as notch effectorsin mammalian neuronal differentiation.Embo J 18:2196–2207.

Ohtsuka T, Sakamoto M, Guillemot F,Kageyama R. 2001. Roles of the basichelix-loop-helix genes Hes1 and Hes5 inexpansion of neural stem cells of the de-veloping brain. J Biol Chem 276:30467–30474.

Petersen PH, Zou K, Hwang JK, Jan YN,Zhong W. 2002. Progenitor cell mainte-nance requires numb and numblike dur-ingmouseneurogenesis.Nature419:929–934.

Petersen PH, Zou K, Krauss S, Zhong W.2004. Continuing role for mouse Numband Numbl in maintaining progenitorcells during cortical neurogenesis. NatNeurosci 7:803–811.

Roskams AJ, Bethel MA, Hurt KJ, RonnettGV. 1996. Sequential expression of TrksA, B, and C in the regenerating olfactoryneuroepithelium. J Neurosci 16:1294–1307.

Schwartz Levey M, Chikaraishi DM,Kauer JS. 1991. Characterization of po-tential precursor populations in themouse olfactory epithelium using immu-nocytochemistry and autoradiography.J Neurosci 11:3556–3564.

Shen Q, Zhong W, Jan YN, Temple S. 2002.Asymmetric Numb distribution is criti-cal for asymmetric cell division of mousecerebral cortical stem cells and neuro-blasts. Development 129:4843–4853.

Solecki DJ, Liu XL, Tomoda T, Fang Y,Hatten ME. 2001. Activated Notch2 sig-naling inhibits differentiation of cerebel-lar granule neuron precursors by main-taining proliferation. Neuron 31:557–568.

Stump G, Durrer A, Klein AL, Lutolf S,Suter U, Taylor V. 2002. Notch1 and itsligands Delta-like and Jagged are ex-pressed and active in distinct cell popu-lations in the postnatal mouse brain.Mech Dev 114:153–159.

NOTCH IN OLFACTORY EPITHELIUM DEVELOPMENT 1687

Suzuki Y, Mizoguchi I, Nishiyama H,Takeda M, Obara N. 2003. Expression ofHes6 and NeuroD in the olfactory epithe-lium, vomeronasal organ and non-sen-sory patches. Chem Senses 28:197–205.

Tanigaki K, Nogaki F, Takahashi J,Tashiro K, Kurooka H, Honjo T. 2001.Notch1 and Notch3 instructively restrictbFGF-responsive multipotent neuralprogenitor cells to an astroglial fate.Neuron 29:45–55.

Tietjen I, Rihel JM, Cao Y, Koentges G,Zakhary L, Dulac C. 2003. Single-celltranscriptional analysis of neuronal pro-genitors. Neuron 38:161–175.

Tokunaga A, Kohyama J, Yoshida T, Na-kao K, Sawamoto K, Okano H. 2004.Mapping spatio-temporal activation ofNotch signaling during neurogenesis

and gliogenesis in the developing mousebrain. J Neurochem 90:142–154.

Uyttendaele H, Marazzi G, Wu G, Yan Q,Sassoon D, Kitajewski J. 1996. Notch4/int-3, a mammary proto-oncogene, is anendothelial cell-specific mammalian Notchgene. Development 122:2251–2259.

Verdi JM, Bashirullah A, Goldhawk DE,Kubu CJ, Jamali M, Meakin SO, Lip-shitz HD. 1999. Distinct human NUMBisoforms regulate differentiation vs.proliferation in the neuronal lineage.Proc Natl Acad Sci USA 96:10472–10476.

Yoon K, Gaiano N. 2005. Notch signalingin the mammalian central nervous sys-tem: insights from mouse mutants. NatNeurosci 8:709–715.

Yun K, Fischman S, Johnson J, Hrabe deAngelis M, Weinmaster G, Rubenstein JL.

2002. Modulation of the notch signaling byMash1 and Dlx1/2 regulates sequentialspecification and differentiation of progen-itor cell types in the subcortical telenceph-alon. Development 129:5029–5040.

Zhong W, Feder JN, Jiang MM, Jan LY, JanYN. 1996. Asymmetric localization of amammalian numb homolog during mousecortical neurogenesis. Neuron 17:43–53.

Zhong W, Jiang MM, Weinmaster G, JanLY, Jan YN. 1997. Differential expres-sion of mammalian Numb, Numblikeand Notch1 suggests distinct roles dur-ing mouse cortical neurogenesis. Devel-opment 124:1887–1897.

Zhong W, Jiang MM, Schonemann MD,Meneses JJ, Pedersen RA, Jan LY, JanYN. 2000. Mouse numb is an essentialgene involved in cortical neurogenesis.Proc Natl Acad Sci USA 97:6844–6849.

1688 CARSON ET AL.