nuclear expression of b-catenin promotes rb stability...

MCR-12-0670; 5/2/2015; 22:52:50

Cell Cycle and Senescence

Nuclear Expression of b-Catenin Promotes RB Stability andResistance to TNF-Induced Apoptosis in Colon Cancer Cells

Jinbo Han1, Rossana C. Soletti1,3, Anil Sadarangani1, Priya Sridevi1, Michael E. Ramirez1,Lars Eckmann1,2, Helena L. Borges3, and Jean Y.J. Wang1,2

AbstractTumor necrosis factor (TNF)-a promotes tumor development under chronic inflammation. Because TNF also

activates caspase-8, selective inhibition of TNF-induced extrinsic apoptosis would be required for inflammation-associated tumor growth. In a mouse model of inflammation-associated colon carcinogenesis, we found nuclearexpression of b-catenin in tumors of wild-type, but not mutant, mice that were made resistant to TNF-inducedapoptosis by a germline mutation blocking caspase cleavage of the retinoblastoma (RB) protein, despite similarfrequencies of b-catenin exon-3 mutations in these two genetic backgrounds. TNF-induced apoptosis was alsoattenuated in human colon cancer cell lines with genetically activated b-catenin. However, we found that HCT116cells, which contain an activated allele of b-catenin but do not express nuclear b-catenin, were sensitive to TNF-induced apoptosis. InHCT116 cells, TNF stimulated efficientRB cleavage that preceded chromatin condensation. Incontrast, TNF did not induce RB cleavage in colon cancer cells expressing nuclear b-catenin and these cells could besensitized to basal and/or TNF-induced apoptosis by the knockdown of b-catenin or RB. In the apoptosis-resistantcolon cancer cells, knockdown of b-catenin led to a reduction in the RB protein without affecting RB mRNA.Furthermore, ectopic expression of the caspase-resistant, but not the wild-type, RB re-established resistance to TNF-induced caspase activation in colon cancer cells without b-catenin. Together, these results suggest that nuclearb-catenin–dependent RB stabilization suppresses TNF-induced apoptosis in caspase-8–positive colon cancer cells.

Visual Overview: http://mcr.aacrjournals.org/content/11/3/207/F1.large.jpg.Mol Cancer Res; 11(3); 207–18. �2012 AACR.

IntroductionInflammation is a complex physiologic response induced

by infections and injuries to eliminate damaged cells andstimulate tissue repair. While the inflammatory response isessential to health, chronic inflammation has been recog-nized as amajor risk factor for cancer (1). Inmousemodels ofinflammation-associated cancer, TNF and its downstreaminflammatory effector, NF-kB, have been shown to play keyroles in tumorigenesis (1). Interestingly, TNF receptor 1(TNFR1) and its signaling complex of TRADD, RIPK1,TRAF2, and cIAP not only activate NF-kB but also activatecaspase-8 through the adaptor FADD (2). While caspase-8and FADD are essential to the induction of extrinsic apo-ptosis downstream of TNFR1, studies of caspase-8 andFADD knockout mice have shown that these two proteins

also play a critical role in cell survival (3, 4). Recent studieshave uncovered the mechanism underlying caspase-8–dependent survival, which involves the suppression of necro-sis (5). The current data support a model where assembly ofa heterodimeric complex of caspase-8 and FLIP throughactivated FADD leads to caspase-8 activation without self-cleavage and this caspase-8-FLIP complex cleaves CLYD,RIPK1, and RIPK3 to inhibit necrosis (necroptosis) inlymphocytes and intestinal epithelial cells (5–8). On theother hand, formation of a homo-oligomeric complex ofcaspase-8 and FADD is required for self-cleavage and theapoptotic activation of caspase-8 (5, 9). The discovery ofthe antinecrosis function of caspase-8 provides an explana-tion for the continued expression of caspase-8 in themajorityof cancer cells. However, inflammation-associated tumordevelopment would require mechanisms that inactivateTNF-induced apoptosis in caspase-8–positive cancer cells.The canonical Wnt/b-catenin signaling cascade plays a

crucial role in the intestinal crypt proliferation and homeo-stasis (10, 11). From a comprehensive genetic and epigeneticanalysis of 276 human colorectal cancer (CRC) samples,it has been determined that the canonical Wnt pathwayis constitutively activated in more than 90% of humanCRCs through mutational activation of CTNNB1 (b-cate-nin) or inactivation of DKK, APC, AXIN2 (12). Whileactivated b-catenin can enter the nucleus to regulate gene

Authors' Affiliations: 1Moores Cancer Center and 2Department of Med-icine, University of California San Diego, La Jolla, California; and 3Institutode Ciencias Biom�edicas, Universidade Federal do Rio de Janeiro, Rio deJaneiro, Brazil

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Author: Jean Y.J. Wang, Moores UCSD Cancer Center,Room 4328, 3855 Health Sciences Drive, La Jolla, CA 92093. Phone: 858-534-6253; Fax: 858-534-2821; E-mail: [email protected]

doi: 10.1158/1541-7786.MCR-12-0670

�2012 American Association for Cancer Research.

MolecularCancer

Research

www.aacrjournals.org 207

on June 15, 2018. © 2013 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst January 21, 2013; DOI: 10.1158/1541-7786.MCR-12-0670

http://mcr.aacrjournals.org/

MCR-12-0670; 5/2/2015; 22:52:51

expression, its nuclear translocation and accumulationrequire additional factors, for example, Ahi1 or FOXM,and is not fully understood (13–15). Although the Wntpathway is activated by genetic and epigenetic alterations inmore than 90% of human colorectal cancer (12), nuclearb-catenin expression has been detected in only 47% of 742sporadic human colon cancer tissue samples (16). Thesefindings suggest that nuclear expression of b-catenin mayrequire additional selective pressure beyond activation of theWnt pathway in colon cancer cells.We have previously shown that retinoblastoma (RB) is

cleaved by caspase at a C-terminal site, DEAD886G887, togenerate 2 fragments—DRB (1-886) and C42 (887-928),which are unstable and further degraded in apoptotic cells(17, 18).We created anRb-MI allele in themouse genome toencode a caspase-resistant RB-MI protein (DEAA886E887)and have shown that intestinal epithelial cells in the Rb-MImice are protected from inflammation-induced apoptosis(19–21).We have shown that Rb-MI promotes colon tumordevelopment in a p53-null genetic background (19). Wetherefore subjected Rb-MI mice to an inflammation-associ-ated colon carcinogenesis protocol. We show here thatcolonic tumors in the Rb-wt mice acquire resistance toTNF-induced apoptosis, which is a normal phenotype ofthe Rb-MI colonic epithelial cells. In this inflammation-associated colon carcinogenesis model, b-catenin is consis-tently activated by exon-3 mutations and expressed in thenucleus of colon tumor cells (22, 23). We found exon-3mutations in the Rb-wt and Rb-MI colon tumors; however,nuclear expression of b-catenin was mostly absent from theRb-MI tumor cells. These observations led us to investigatehow nuclear b-catenin expression might affect RB stabilityand TNF-induced apoptosis in colon cancer cells.

Materials and MethodsAntibodiesAnti-b-catenin (610153), anti-FADD (556402), and anti-

RIPK1 (610458) were from BD Biosciences. Anti-caspase-8(#9746), anti-cleaved caspase-8 (#9496), anti-cleaved caspase-3(#9664), anti-PARP1 (#9542), anti-FLIP (#3210), anti-cIAP(#4952), anti-XIAP (#2042), and horseradish peroxidase(HRP)-conjugated secondary antibodies were from Cell Sig-naling Technology. Anti-RB (RB-C) (ab1119) and anti-TNFRI (ab19139) were from Abcam. Anti-GAPDH(MAB374)andanti-active-b-catenin (05-665)were fromMilli-pore. Anti-TRADD (sc-7868) and anti-IKB-a (SC-371) werefrom Santa Cruz Biotechnology. Anti-RB (851) was raisedagainst the C-terminal fragment (residues 768–928) of RB.

MiceConstruction of the mouse Rb-MI allele and genotyping

were described previously (20). All animal studies wereconducted under protocols approved by the University ofCalifornia at San Diego (La Jolla, CA) Institutional AnimalCare and Use Committee. For the induction of colontumors, 6- to 7-week-old male mice were injected intraper-itoneally (i.p.) once with 12.5 mg/kg azoxymethane (AOM;Sigma Aldrich) and a week later were fed dextran sulfate

sodium (DSS) salt (3%, 36–50 kDa, ICNBiomedical) in thedrinking water for 7 days and euthanized 21 weeks afterAOM injection. Tumor-bearingmice were i.p. injected withmurine recombinant TNF-a (PeproTech; 1 mg/mouse inPBS containing 2% FBS) or with PBS containing 2% FBSand euthanized 24 hours later. For the ulceration study, malemice at 6 weeks of age injected with AOM and then treatedwith DSS were euthanized 24 hours after the completion ofDSS treatment, and the colonic tissues were collected forhematoxylin and eosin (H&E) staining.

Immunohistochemistry and terminal deoxynucleotidyltransferase–mediated dUTP nick-end labeling assayImmunohistochemistry was carried out with DAKO

LSABþ System-HRP according tomanufacturer's protocol.Terminal deoxynucleotidyl transferase–mediated dUTPnick-end labeling assay (TUNEL) with the TACS XL InSituApoptosisDetectionKit was conducted according to themanufacturer's instructions (R&D Systems).

Cell cultureThe LIM cell lines were maintained as previously

described (24). Other cell lines were from American TypeCulture Collection and maintained accordingly.

RNA interferencesiRNAs targeting b-catenin (s438) were from Ambion. The

lentiviral shRNA plasmids were from Sigma-Aldrich:TRCN0000003846 (b-catenin shRNA-A), TRCN0000-003845 (b-catenin shRNA-B), TRCN0000010419 (RB#1), TRCN0000010418 (RB #2), and TRCN0000040167(shRB). The lentiviral b-catenin short hairpin RNA (shRNA)plasmid and packaging plasmids were transfected into 293FTcells using GeneTran (Biomiga) to produce lentiviral particles.

RNA preparation and quantitative real-time PCRTotal RNA was isolated from cells using the RNeasy Kit

(QIAGEN) and reverse transcribed with the ABI revere tran-scription kit. Quantitative real-time polymerase chain reaction(Q-RT-PCR) was carried out using 7900HT Fast Real-TimePCR System (ABI) with primers: 50GATTGATTCGA-AATCTTGCCCT30 and 50CTGATGTGCACGAACA-AGCA30 for b-catenin; 50GCAGTATGCTTCCACCAG-GC30 and 50AATCCGTAAGGGTGAACTAGGAAAC30for RB.

CoimmunoprecipitationCells were collected in PBS with 10% glycerol, lysed in lysis

buffer [10 mmol/L Tris-HCl, 200mmol/L NaCl, 1.5 mmol/LMgCl2, 0.2mmol/LEDTA, 0.5mmol/Ldithiothreitol (DTT),0.5% NP-40, 0.125% sodium deoxycholate, 0.05%SDS, and20% glycerol] supplemented with 5 mmol/L ethidium bromideand protease inhibitors (Roche). The lysates were sonicated,treated with RNase (100 mg/mL) and DNase (100 mg/mL) for30 minutes on ice, sonicated again, and then centrifuged at14,000 rpm at 4�C for 30 minutes. Primary antibody (2mg/mL) was added to 500 mg of total cell lysate and incubatedovernight at 4�C, followed by adding 15 mL of protein A/Gagarose for 2 hours. Immunoprecipitated proteinswere analyzedby Western blotting (Supplementary Fig. S6).

Han et al.

Mol Cancer Res; 11(3) March 2013 Molecular Cancer Research208




MCR-12-0670; 5/2/2015; 22:52:51

Statistical analysisGraphPad Prism programs were used to analyze the data

and plot curves. Data are represented as mean and SD. Two-tailed unpaired t test was used to determine statisticalsignificance of the differences between data sets. P < 0.05was considered as statistically significant.

ResultsInflammation-associated colonic tumors acquireresistance to TNF-induced apoptosisIn Rb-MI mice, intestinal epithelial cells are resistant to

apoptosis induced by bacterial lipopolysaccharide (LPS) orDSS (19–21).We show here that colonic epithelial apoptosis

Figure 1. Inflammation-induced colonic tumors acquire resistance to TNF-induced apoptosis. A toC, TUNEL staining (blue) of normal (A) and tumor (B) colonictissue sections and quantification (C) from the indicated number (n) of tumor-bearing mouse treated with PBS (Veh) or murine TNF (1 mg per mouse) for24 hours. Nuclei were counterstained with TACS Fast Red. Scale bar, 50 mm. D, TNFR1 and cleaved caspase-3 expression in normal colonic tissue extractsfrom the indicated mice after TNF treatment. E, TNFR1 and caspase-8 expression in normal (N) or tumor (T) colonic tissues from the indicated mice. F,TNF-induced RB cleavage in normal (N) and tumor (T) colonic tissues from the indicated mice. G, summary of the AOM/DSS colon carcinogenesisprotocol. Only male mice were used in this study and the protocol began with mice at 6 weeks of age. H, tumor incidence of AOM/DSS-treated Rb-wt andRb-MI mice. I, number of tumors per mouse, n, number of mice. J, DSS-induced colonic ulceration was suppressed in Rb-MI mice. Area of ulceration isdenoted by dashed line in sections stained with H&E. Images from 2 different magnifications are shown. Scale bar, 100 mm. Histograms show thenumber and size distribution of ulceration. Ulceration diameter was determined using ImageJ software. �, P < 0.05; ��, P < 0.01. K, immunohistochemicalstaining for E-cadherin and b-catenin in colonic tissues of AOM/DSS-treated Rb-wt (þ/þ) and Rb-MI (MI/MI) mice at 24 hours after the cessation of DSSfeeding. Note that E-cadherin and b-catenin were not detected in tissues that expanded in areas of ulceration. Scale bar, 100 mm.

Nuclear b-Catenin Suppresses Apoptosis

www.aacrjournals.org Mol Cancer Res; 11(3) March 2013 209




MCR-12-0670; 5/2/2015; 22:53:9

induced by TNF was also suppressed in the Rb-MI mice(Fig. 1A, C, D), despite wild-type levels of TNFR1 and pro-caspase-8 expression (Fig. 1E) and wild type-levels of splenicapoptosis (Supplementary Fig. S1). We then placed theRb-wt and Rb-MI mice on the AOM/DSS carcinogenesisprotocol (Fig. 1G) to induce colon tumors (25) and treatedtumor-bearing mice with TNF. We found that colonictumors in the Rb-wtmice became resistant to TNF-inducedapoptosis (Fig. 1B and C), and showed reduced RB cleavageresponse to TNF (Fig. 1F), although these apoptosis-resis-tant Rb-wt tumors continued to express TNFR1 and cas-pase-8 (Fig. 1E).We have previously shown that Rb-MI stimulates spon-

taneous colon cancer development in the p53-null back-ground (19). However, Rb-MI did not promote colonictumor development in the AOM/DSS carcinogenesis pro-tocol (Fig. 1H and I; Supplementary Fig. S2). The tumorincidences (Fig. 1H and I), histologic features (Supplemen-tary Fig. S2A), tumor size distributions (SupplementaryFig. S2B), and tumor expression of proliferation markers[proliferating cell nuclear antigen (PCNA), Ki67, cyclin D1,and c-Myc; Supplementary Fig. S2C–S2F] were found to besimilar in the Rb-wt and Rb-MImice. A possible explanationfor why Rb-MI did not promote tumor development in theAOM/DSS carcinogenesis protocol could be because Rb-MIsuppressed DSS-induced tissue damage (Fig. 1J). Associatedwith DSS-induced ulceration and tissue damage was anexpansion of stromal tissues, which could be distinguishedfrom the epithelial tissues by the lack of cell surface expres-

sion of E-cadherin and b-catenin (Fig. 1K). This injury-associated tissue expansion was observed in the Rb-wt micebut diminished in the Rb-MImice (Fig. 1K). Therefore, theRb-MI–mediated epithelial survival might have a double-edged effect—it reduced apoptosis but it also reduced tissueregeneration; as a result, on balance, Rb-MI did not affect thetumor outcome. It is also possible that an alternative apo-ptosis suppression mechanism is readily activated by theAOM/DSS treatment; as a result, the antiapoptosis functionof Rb-MI became irrelevant in this colon carcinogenesismodel.

Nuclear b-catenin is mostly absent from colonic tumorsof Rb-MI micePrevious studies have shown that b-catenin exon-3

mutations that interfere with phosphorylation by GSK3bare frequently found in AOM/DSS–induced colon tumors(23, 26, 27). Consistently, we found similar frequencyof b-catenin exon-3 mutations (Fig. 2B), higher levels ofb-catenin protein (Fig. 2C), and similar expression ofE-cadherin (Fig. 2D) in the Rb-wt and the Rb-MI colonictumors. The expression of cyclin D1 and c-Myc, 2established b-catenin target genes, was similarly upregu-lated in the Rb-wt and the Rb-MI colonic tumors (Sup-plementary Fig. S2E and S2F). Microarray-based geneexpression analysis further confirmed similar expressionprofiles for the Rb-wt and the Rb-MI colonic tumors (notshown). However, immunohistochemical analysis oftumor sections showed that the majority of Rb-wt tumor

Figure 2. Nuclear expression ofb-catenin in colonic tumors of Rb-wt but not Rb-MImice. Subcellularlocalization (A), exon-3 mutations(B) and levels of b-catenin in normalor tumor colonic tissues (C) fromthe indicated mice. Scale bar,100 mm. n, number of tumorsanalyzed. �,P < 0.05. D, staining forb-catenin and E-cadherin incolonic tumor tissues of theindicated mice.

Han et al.





MCR-12-0670; 5/2/2015; 22:53:32

cells (in 19 adenomas examined) expressed nuclear b-cate-nin, whereas less than 20% of Rb-MI tumor cells (in26 adenomas examined) expressed nuclear b-catenin(Fig. 2A). These results suggest that nuclear expressionof exon-3–mutated b-catenin is not necessary for itstransactivation function in the AOM/DSS-induced colon-ic tumors. Instead, nuclear expression of b-cateninappeared to be a tumor phenotype in the Rb-wt micethat involved factors other than exon-3 mutation orE-cadherin expression. While those other factors were notidentified by this study, our data showed that nuclearexpression of b-catenin was mostly absent from AOM/DSS–induced colon tumors of the Rb-MI mice. Thisobservation suggests that nuclear expression of b-cateninmight suppress TNF-induced apoptosis, and thus theselection for this cancer phenotype could be bypassed inthe Rb-MI mice.

Resistance to TNF-induced apoptosis in human coloncancer cells with nuclear b-cateninTo test the hypothesis that nuclear expression of b-cate-

nin, besides its mutational activation, is required tosuppress apoptosis, we examined several human coloncancer cell lines containing CTNNB1 (b-catenin) or APCmutations (Fig. 3A) for b-catenin nuclear localization andresponse to TNF-induced apoptosis. Nuclear b-cateninwas detected in LIM1215, LIM1899, and SW480 coloncancer cells but not in HCT116 cells (Fig. 3B), and theapoptotic response to TNF was significantly lower in cellsexpressing nuclear b-catenin (Fig. 3C and D). Previouslypublished reports have established that the mutant b-cate-nin is constitutively active in HCT116 cells and can driveT-cell factor (TCF)-dependent transcription (28, 29);however, this activated b-catenin is not constitutivelylocalized to the nucleus (Fig. 3B), and the non-nuclear

Figure 3. Human colon cancer cells with nuclear expression of b-catenin showed resistance to TNF-induced apoptosis. A, summary of known mutationsin HeLa, HCT116, LIM1215, LIM1899, and SW480 cell lines. RCGDB, The Roche Cancer Genome Database. B, subcellular localization of b-catenin incolon cancer cell lines. Scale bar, 10 mm. C and D, colon cancer cells expressing nuclear b-catenin are resistant to TNF (10 ng/mL)/CHX (2.5 mg/mL)-inducedapoptosis measured by sub-G1 (C) or caspase cleavage (D).






MCR-12-0670; 5/2/2015; 22:53:47

Han et al.





MCR-12-0670; 5/2/2015; 22:54:58

localization of activated b-catenin correlated with sensi-tivity to TNF-induced apoptosis in HCT116 cells (Fig 3Cand D).

RB cleavage is more efficient and precedes chromatincondensation in apoptosis-sensitive colon cancer cellslacking nuclear b-cateninBoth the HCT116 and the LIM1899 cells contain codon-

45–mutated b-catenin (Fig. 3A; confirmed by resequencing;Supplementary Fig. S3A), except that HCT116 cells alsocontain awild-typeb-catenin allele (Supplementary Fig. S3A;ref. 28). Both cell lines express E-cadherin (SupplementaryFig. S3B), TNFR1, TRADD, RIPK1, TRAF2, cIAP,FADD, FLIP, and caspase-8 (Supplementary Fig. S3C). Inboth cell lines, the NF-kB signaling pathway is activated byTNF as shown by the degradation of IkB and the sensitivityto an inhibitor of IKKb (sc-514, Fig. 4A). Treatment ofHCT116 cells with TNF alone, TNF plus sc-514, or TNFplus cycloheximide (CHX) induced DNA fragmentation(Fig. 4B). However, LIM1899 cells were resistant to TNFor TNF/sc-514 and underwent DNA fragmentation onlywhen treated with TNF/CHX but with a lower sensitivitythan HCT116 cells (Fig. 4B). We therefore used the com-bined treatment of TNF/CHX to further compare theapoptotic response between HCT116 and LIM1899 cells.TNF/CHX-induced DNA fragmentation was abolished

by a pan-caspase inhibitor (zVADfmk) but not by an anti-oxidant (BHA, butylated hydroxyanisole; Fig. 4C), showingthat TNF induced caspase-dependent apoptosis rather thannecrosis in these colon cancer cells. Caspase activation,assessed by caspase-8 cleavage (which is required for theexecution of apoptosis but not necrosis; ref. 9), caspase-3,and PARP1, occurred at a faster rate and to a greater extentin HCT116 than in LIM1899 cells (Fig. 4D). The cleavageof RB (loss of reactivity to anti-RB-C, and formation ofDRB) was also more efficient in HCT116 than in LIM1899cells (Fig. 4D). In another apoptosis-resistant colon cancercell line, SW480, TNF/CHX also induced IkB degradation(Supplementary Fig. S3D) but not RB cleavage (Fig. 4E).We have previously shown that caspase-8 is required forTNF to induce RB cleavage, and the cleavage of RB is thenrequired for TNF to induce apoptosis (21). We show herethat RB cleavage, assessed by the loss of reactivity to anti-RB-C antibody (Fig. 4F schematic diagram), preceded TNF/CHX-induced nuclear condensation in HCT116 cells(Fig. 4F). Consistent with the conclusion that full-lengthRB suppresses apoptosis, RB knockdown with 3 differentlentiviral shRNAs (Fig. 4G and Supplementary Fig. S4)sensitized both LIM1899 and HCT116 cells to TNF-induced apoptosis (Fig. 4G, Supplementary Fig. S4).

Together, these results establish a correlation between nucle-ar b-catenin expression, inefficient RB cleavage, and reducedapoptotic response in colon cancer cells.

Enforced nuclear expression of b-catenin reduces TNF-induced apoptosisBecause HCT116 cells contain a wild-type allele of

b-catenin (ref. 28; Supplementary Fig. S3A), we treatedthem with a GSK3b inhibitor AR-A014418 (AR) toinduce dephosphorylation and nuclear localization of thewild-type b-catenin (Fig. 5A and B). We found that TNF-induced DNA fragmentation (Fig. 5C) and caspase cleav-age (Supplementary Fig. S5A) were reduced in AR-treatedcells. To control for AR off-target effects, we stablyknocked-down b-catenin and showed that the inhibitoryeffect of AR on TNF-induced DNA fragmentation wasb-catenin–dependent because the apoptosis-inhibitoryeffect of AR was abolished by shRNA-B, which efficientlyknocked-down b-catenin but not shRNA-A, which didnot knockdown b-catenin (Fig. 5D). AR treatment didnot alter the expression of TNFRI, FADD, TRADD,TRAF2, RIPK1, FLIP, XIAP, c-IAP, or survivin (Sup-plementary Fig. s5B). We also ectopically expressed anactivated mutant S37A-b-catenin protein in HCT116(Fig. 5E), found it localized to the nucleus (Fig. 5F), andcaused a reduction in TNF/CHX-induced DNA fragmen-tation (Fig. 5G). Together, these results suggest thatnuclear expression of b-catenin protein can suppressTNF-induced apoptosis in HCT116 cells.

b-catenin knockdown enhances TNF-inducedapoptosis in colon cancer cells expressing nuclearb-cateninIt is generally accepted that colon cancer cells are

dependent on b-catenin for proliferation and survival(11). However, we found that the knockdown of b-cate-nin had different effects on the survival of HCT116,SW480, LIM1215, and LIM1899 cells. We could stablypropagate HCT116 cells in which b-catenin wasknocked-down with lentiviral shRNA (Fig. 5D), consis-tent with a previous report showing that the proliferationand survival of HCT116 cells are independent of b-cate-nin (28). Similarly, we could stably propagate b-cateninknockdown SW480 cells (Fig. 6B). However, withLIM1215 and LIM1899, b-catenin–positive cells over-took the knockdown cells within 2 to 3 passages postin-fection with the shRNA lentivirus. The dependency ofLIM1899 and LIM1215 cells on b-catenin for survivalwas further shown by the induction of DNA fragmenta-tion (Fig. 6A, LIM1899) or caspase activation (Fig. 6E,

Figure 4. RB cleavage precedes chromatin condensation in apoptosis-sensitive HCT116 cells. A, TNF-induced IkBa degradation. Whole-cell lysatesharvested at the indicated time following treatment with TNF (10 ng/mL) or the IKKb inhibitor sc-514 (25 mmol/L) were probed with the indicatedantibodies. B, TNF-induced DNA fragmentation was determined by FACS; mean and SDs from 3 independent experiments are shown. C, TNF inducedcaspase-dependent DNA fragmentation in colon cancer cells. Values shown are mean and SD from 3 independent experiments. ��, P < 0.001. D and E,TNF/CHX-induced protein cleavage in the indicated cells with indicated treatments. F, in situ detection of RB C-terminal cleavage with anti-RB-C andchromatin condensation in HCT116 cells. �, P < 0.05; ��, P < 0.01. G, stable knockdown of RB (Western blots) sensitized colon cancer cells toTNF-induced apoptosis. CHX (2.5 mg/mL) was added to all TNF concentrations (0–10 ng/mL).






MCR-12-0670; 5/2/2015; 22:54:58

LIM1215) when b-catenin was transiently knocked-downwith siRNA.We then examined the effect of transient or stable

b-catenin knockdown on TNF/CHX-induced apoptoticresponse in LIM1899, HCT116, and SW480 cells.In HCT116 cells, b-catenin knockdown did not affectthe DNA fragmentation (Fig. 6A) or the caspase cleav-age (Fig. 6D) response to TNF/CHX. In contrast, inLIM1899 cells, b-catenin knockdown enhanced the

DNA fragmentation (Fig. 6A), caspase activation (Fig.6C), and cleavage (Fig. 6D) response to TNF/CHX. InSW480 cells, the stable knockdown of b-catenin alsoenhanced the DNA fragmentation response to TNF/CHX relative to parental cells or populations infectedwith vector or irrelevant shRNA (Fig. 6B). The knock-down of b-catenin did not alter the levels of TNFR1,RIPK1, TRADD, FLIP, and XIAP in HCT116,LIM1899, or SW480 cells (Fig. 6F). A reduction in the

Figure 5. Nuclear accumulation of b-catenin reduces TNF-induced apoptosis in HCT116 cells. A, GSK3b inhibitor AR-A014418 (AR; 20 mmol/L) inducednuclear accumulation of b-catenin in HCT116 cells. Scale bars, 10 mm. B, AR treatment induced b-catenin dephosphorylation. Whole-cell lysates wereprobed with the indicated antibodies. C, AR treatment reduced TNF-induced apoptosis. Values shown are mean and SD from 3 independentexperiments. �, P < 0.05. D, inhibitory effect of AR on TNF-induced apoptosis was dependent on b-catenin. HCT116 cells stably transduced with theindicated shRNA (see Western blots for b-catenin knockdown efficiency) were treated with the indicated reagents and the sub-G1 fractions measured byFACS at 8 hours. Values shown are mean and SD from 3 independent experiments. �, P < 0.05. E and F, expression and nuclear localization of HA-S37-b-catenin (S37A) in HCT116 cells cotransfected with GFP. Scale bars, 10 mm. G, ectopic expression of nuclear b-catenin reduced TNF-inducedapoptosis. Transfected cells were sorted into GFP-positive or negative fractions and then treated as indicated, and sub-G1 fractions were determined.Values shown are mean and SD from 3 independent experiments. ��, P < 0.01.

Han et al.





MCR-12-0670; 5/2/2015; 22:55:45

levels TRAF2, caspase-8, FADD, and IkB were detectedin b-catenin knockdown LIM1899 cells but becausecaspase activity was actually enhanced, this reductionwas not pertinent to the survival function of nuclearb-catenin. These results suggest that the suppression ofTNF-induced apoptosis by nuclear b-catenin did notinvolve previously established resistance mechanisms, forexample, the upregulation of FLIP, the downregulation ofXIAP, or altered expression of other known componentsof the extrinsic apoptosis pathway.

b-catenin–dependent RB protein expressionBecause nuclear expression of b-catenin or the MI

mutation of RB is associated with resistance to TNF-induced apoptosis in the mouse colonic epithelial cells andbecause TNF-induced RB cleavage is reduced in coloncancer cells expressing nuclear b-catenin, we examinedwhether nuclear b-catenin might affect the cleavage or the

stability of RB protein. The knockdown of b-catenin didnot reduce the levels of RB mRNAs in the 4 colon cancercell lines examined (Fig. 7A). However, b-catenin knock-down had different effects on the RB protein levels, withsignificant reductions in the phosphorylation and theoverall levels of RB observed with LIM1899 andLIM1215 cells (Fig. 7B). As the knockdown of b-catenincaused a higher level of G1 increase in LIM1899 than inHCT116 cells (Fig. 7C), the reduction in RB phosphor-ylation could be the result of G1 arrest. The RB proteinlevel but not its phosphorylation could be partiallyrestored by treatment with a proteasome inhibitor (Fig.7D), suggesting that the knockdown of b-catenin alsodestabilized RB in LIM1899 cells. When treated withTNF/CHX, RB and b-catenin were both cleaved anddegraded in HCT116 cells (Fig. 7E, lane 6). In b-cateninknockdown LIM1899 cells, the already lower levels of RBwere not further reduced by TNF/CHX treatment (Fig.

Figure 6. Effects of b-cateninknockdown on basal and TNF-induced apoptosis in colon cancercells. A, LIM1899 but not HCT116cells were sensitized to basal andTNF-induced apoptosis upontransient knockdown of b-catenin.Values shown are mean and SD from3 independent experiments. B,stable knockdown of b-cateninenhanced TNF/CHX-induced DNAfragmentation inSW480 cells. Valuesshown are mean and SD from 3independent experiments. C, stableknockdown of b-catenin enhancedcaspase activation in LIM1899 cells.D, transient knockdown of b-cateninsensitized LIM1899 but not HCT116cells to TNF/CHX-induced proteincleavage. C and D, TNF/CHXtreatment was for 8 hours at 48 hoursposttransfection. E, transientknockdown of b-catenin sensitizedLIM1215 cells to caspase activationat 48 hours posttransfection. F,expression of a panel of proteins at48 hours after the knockdown ofb-catenin in the indicated cells.






MCR-12-0670; 5/2/2015; 22:57:0

7E lanes 3, 4). Because the knockdown of RB couldsensitize LIM1899 cells to TNF-induced apoptosis (Fig.4F), the reduction in RB protein was likely to account forthe enhanced apoptotic response to TNF upon b-cateninknockdown in LIM1899 cells. Together, these resultsshow that nuclear expression of b-catenin is required forthe stable expression of RB protein, which is required tosuppress the apoptotic response to TNF in colon cancercells.In the apoptosis-resistant LIM1899 cells, knockdown of

b-catenin enhanced TNF/CHX-induced caspase-8 cleav-

age (Fig. 6D, lane 4), which is required for caspase-8 toinduce apoptosis (9). If stabilization of RB is required forthe suppression of caspase-8 cleavage, the ectopic expres-sion of RB-MI (cleavage-resistant RB) would inhibitTNF/CHX-induced caspase cleavage more efficiently thanRB-wt (cleavage-sensitive RB) in b-catenin–deficientLIM1899 cells. As shown in Fig. 7F, cotransfection ofRB with the b-catenin siRNA transiently restored RBlevels to that of the endogenous RB (in the nt-siRNA–transfected cells); however, TNF/CHX-induced caspasecleavage remained higher than that of the nt-siRNA–

Figure 7. Ectopic expression of RB-MI, but not RB, reduced caspase-8cleavage in b-catenin knockdowncells. A, effect of b-cateninknockdown (top histograms) onRBmRNA levels (bottom histograms).B, effect of b-catenin knockdownon RB protein levels. C, effect ofb-catenin knockdown on the cellcycle. D, effect of inhibitors z-VADfmk (pan-caspase, 20 mmol/L),MG132 (proteasome, 20 mmol/L),E/P (E64D and pepstatin,lysosome, 10 mg/mL each), andChl(chloroquine, lysosome, 100 mmol/L) on RB phosphorylation andprotein levels in LIM1899 cellsposttransfectionwith nontarget (nt)or b-catenin (b-cat) siRNA. Drugswere added at 48 hoursposttransfection for 6 hours.E, effect of transient b-cateninknockdown on TNF/CHX-inducedRB cleavage and degradation inthe indicated cells. F, ectopicexpression of RB-MI, but not RB-wt, suppressed TNF/CHX-inducedcaspase-cleavage. Cellstransfected with the indicatedsiRNA and the RB expressionplasmids were treated with TNF/CHX, and the levels of cleavedcaspase-8 and caspase-3 weredetermined from whole-celllysates.

Han et al.





MCR-12-0670; 5/2/2015; 22:57:41

transfected LIM1899 cells (Fig. 7F, compare lane 4 to 2).In contrast, ectopic expression of RB-MI reduced caspasecleavage in these b-catenin–deficient cells (Fig. 7F, lane6). Together, these results suggest that sustaining theexpression of full-length RB is a mechanism by whichnuclear b-catenin suppresses TNF-induced apoptosis incolon cancer cells.

DiscussionPrevious studies of the Rb-MI mice (19–21) have shown

that caspase cleavage of RB is required for TNF to induceapoptosis in intestinal epithelial cells. TNF-induced geneexpression is not altered inRb-MI cells (21). The RB cleavageproducts (DRB and the C-terminal 42 amino acid peptide)are unstable in apoptotic cells and ectopic expression ofeither or both fragments did not stimulate apoptosis inLIM1899 cells (J. Han, unpublished). These findings sug-gest that preservation of the full-length RB is required toinhibit TNF-induced epithelial apoptosis. We show herethat C-terminal cleavage of RB occurred in the apoptosis-sensitiveHCT116 cells before nuclear condensation. Recentstudies have shown that RB can regulate the centromericlocalization of condesin to ensure the fidelity of chromo-somal segregation during mitosis (30). Perhaps RB couldfunction as a barrier for premature chromatin condensationand has to be destabilized for apoptosis to proceed.Recent studies have found that intestinal-specific

knockout of caspase-8 causes spontaneous colitis, severesensitivity to DSS, and premature death (ref. 8; L. Eck-mann, unpublished). This is consistent with the fact thatcaspase-8 is required to inhibit TNF-induced necrosis (6,7). The Rb-MI mice do not suffer from spontaneouscolitis, instead, are protected from DSS-induced ulcera-tion (Fig. 1J). Thus, the antinecrosis function of caspase-8must be intact in the Rb-MI mice. Given that RB cleavageis specifically required for the activation of TNF-inducedapoptosis in intestinal epithelial cells, it is not surprising tofind that caspase-8–positive colon cancer cells suppressTNF-induced apoptosis by stabilizing the full-length RBprotein.The mechanism by which nuclear b-catenin regulates the

expression of RB protein is presently unknown. Our resultsindicate that the nuclear expression, besides the mutationalactivation, of b-catenin is involved. We have observed thecoimmunoprecipitation of RB and b-catenin in LIM1899,SW480, and HCT116 cells and found that this associationwas not altered by TNF treatment (Supplementary Fig. S6).We have also shown that the RB protein immunoprecipi-tated with b-catenin or with E2F1 can be cleaved by caspase-8 or caspase-3 in vitro (Supplementary Fig. S6), suggestingthat b-catenin by itself does not protect RB from caspase

cleavage. Elucidation of the mechanism underlying nuclearb-catenin–dependent RB stabilization will await furtherinvestigation.The TCGA data have shown a consistent upregulation of

RB1 expression in human CRC samples (12). A previousreport has suggested that wild type RB expression is requiredto restrain the inhibitory activity of E2F1 on b-catenin incolon cancer cells (31). Our finding provides an additionalexplanation for the upregulation of RB expression in coloncancer cells, as it is also required to inhibit TNF-inducedapoptosis. The TCGA data have shown that the Wntpathway is activated by genetic and epigenetic alterationsinmore than 90%of human colorectal cancer (12); however,nuclear b-catenin expression has been detected in only 47%of 742 sporadic human colon cancer tissue samples (16),consistent with the fact that activation of the canonical Wntpathway is necessary but not sufficient for the nuclearaccumulation of b-catenin (13). Our results suggest thatthe expression of nuclear b-catenin is associated with cancercell resistance to TNF-induced apoptosis and thereforemay be used as a biomarker to identify tumors that aredependent on b-catenin to suppress the apoptotic activationof caspase-8.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: J. Han, R.C. Soletti, A. Sadarangani, L. Eckmann, H.L.Borges, J.Y.J. WangDevelopment of methodology: J. Han, R.C. Soletti, P. Sridevi, J.Y.J. WangAcquisition of data (provided animals, acquired and managed patients, providedfacilities, etc.): J. Han, R.C. Soletti, A. Sadarangani, P. Sridevi, M.E. Ramirez, J.Y.J.WangAnalysis and interpretation of data (e.g., statistical analysis, biostatistics, compu-tational analysis): J. Han, R.C. Soletti, A. Sadarangani, P. Sridevi, L. Eckmann, J.Y.J.Wang, J.Y.J. WangWriting, review, and/or revision of the manuscript: R.C. Soletti, P. Sridevi,L. Eckmann, J.Y.J. WangAdministrative, technical, or material support (i.e., reporting or organizing data,constructing databases): A. SadaranganiStudy supervision: A. Sadarangani, H.L. Borges, J.Y.J. Wang

AcknowledgmentsThe authors thank Dr. Tony Burgess at the Ludwig Cancer Research Institute in

Melbourne, Australia, for the generous gifts of the LIM1899 and LIM1215 cells,which were previously described in reference 24.

Grant SupportThe study was supported by RO1CA058320 to J.Y.J. Wang, P30DK80506 to

L. Eckmann, and theNational Council for Scientific andTechnological Development,Brazil to R.C. Soletti, and H.L. Borges.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received December 6, 2012; acceptedDecember 7, 2012; publishedOnlineFirstJanuary 21, 2013.

References1. Ben-Neriah Y, Karin M. Inflammation meets cancer, with

NF-kappaB as the matchmaker. Nat Immunol 2011;12:715–23.

2. Muppidi JR, Tschopp J, Siegel RM. Life and death decisions: sec-ondary complexes and lipid rafts in TNF receptor family signal trans-duction. Immunity 2004;21:461–5.






MCR-12-0670; 5/2/2015; 22:57:42

3. Varfolomeev EE, Schuchmann M, Luria V, Chiannilkulchai N,Beckmann JS, Mett IL, et al. Targeted disruption of the mouseCaspase 8 gene ablates cell death induction by the TNF receptors,Fas/Apo1, and DR3 and is lethal prenatally. Immunity 1998;9:267–76.

4. Yeh WC, Pompa JL, McCurrach ME, Shu HB, Elia AJ, Shahinian A,et al. FADD: essential for embryo development and signaling fromsome, but not all, inducers of apoptosis. Science 1998;279:1954–8.

5. Green DR, Oberst A, Dillon CP, Weinlich R, Salvesen GS. RIPK-dependent necrosis and its regulation by caspases: a mystery in fiveacts. Mol Cell 2011;44:9–16.

6. O'Donnell MA, Perez-Jimenez E, Oberst A, Ng A, Massoumi R, XavierR, et al. Caspase 8 inhibits programmed necrosis byprocessingCYLD.Nat Cell Biol 2011;13:1437–42.

7. Oberst A, Green DR. It cuts both ways: reconciling the dual roles ofcaspase 8 in cell death and survival. Nat Rev Mol Cell Biol 2011;12:757–63.

8. Gunther C, Martini E, Wittkopf N, Amann K,Weigmann B, Neumann H,et al. Caspase-8 regulates TNF-alpha-induced epithelial necroptosisand terminal ileitis. Nature 2011;477:335–9.

9. Kang TB, Oh GS, Scandella E, Bolinger B, Ludewig B, KovalenkoA, et al. Mutation of a self-processing site in caspase-8 compro-mises its apoptotic but not its nonapoptotic functions in bacterialartificial chromosome-transgenic mice. J Immunol 2008;181:2522–32.

10. Medema JP, Vermeulen L.Microenvironmental regulation of stemcellsin intestinal homeostasis and cancer. Nature 2011;474:318–26.

11. Clevers H. Wnt/beta-catenin signaling in development and disease.Cell 2006;127:469–80.

12. Network TT. Comprehensive molecular characterization of humancolon and rectal cancer. Nature 2012;487:330–7.

13. Bowman A, Nusse R. Location, location, location: FoxM1 mediatesbeta-catenin nuclear translocation and promotes glioma tumorigen-esis. Cancer Cell 2011;20:415–6.

14. LancasterMA, Louie CM, Silhavy JL, Sintasath L, DecambreM, NigamSK, et al. Impaired Wnt-beta-catenin signaling disrupts adult renalhomeostasis and leads to cystic kidney ciliopathy. Nat Med 2009;15:1046–54.

15. Zhang N, Wei P, Gong A, Chiu WT, Lee HT, Colman H, et al. FoxM1promotes beta-catenin nuclear localization and controls Wnt target-gene expression and glioma tumorigenesis. Cancer Cell 2011;20:427–42.

16. Morikawa T, Baba Y, Yamauchi M, Kuchiba A, Nosho K, Shima K, et al.STAT3 expression, molecular features, inflammation patterns, andprognosis in a database of 724 colorectal cancers. Clin Cancer Res2011;17:1452–62.

17. Tan X, Martin SJ, Green DR, Wang JY. Degradation of retinoblastomaprotein in tumor necrosis factor- and CD95-induced cell death. J BiolChem 1997;272:9613–6.

18. Tan X,Wang JY. The caspase-RB connection in cell death. TrendsCellBiol 1998;8:116–20.

19. Borges HL, Bird J, Wasson K, Cardiff RD, Varki N, Eckmann L, et al.Tumor promotion by caspase-resistant retinoblastoma protein. ProcNatl Acad Sci U S A 2005;102:15587–92.

20. Chau BN, Borges HL, Chen TT, Masselli A, Hunton IC, Wang JY.Signal-dependent protection from apoptosis in mice expressing cas-pase-resistant Rb. Nat Cell Biol 2002;4:757–65.

21. Huang X, Masselli A, Frisch SM, Hunton IC, Jiang Y, Wang JY.Blockade of tumor necrosis factor-induced Bid cleavage by cas-pase-resistant Rb. J Biol Chem 2007;282:29401–13.

22. Greten FR, Eckmann L, Greten TF, Park JM, Li ZW, Egan LJ, et al.IKKbeta links inflammation and tumorigenesis in a mouse model ofcolitis-associated cancer. Cell 2004;118:285–96.

23. Takahashi M, Nakatsugi S, Sugimura T, Wakabayashi K. Frequentmutations of the beta-catenin gene in mouse colon tumors induced byazoxymethane. Carcinogenesis 2000;21:1117–20.

24. ZhangHH,Walker F, KiflemariamS,WhiteheadRH,WilliamsD,PhillipsWA, et al. Selective inhibition of proliferation in colorectal carcinomacell lines expressing mutant APC or activated B-Raf. Int J Cancer2009;125:297–307.

25. Tanaka T, Kohno H, Suzuki R, Yamada Y, Sugie S, Mori H. A novelinflammation-related mouse colon carcinogenesis model induced byazoxymethane and dextran sodium sulfate. Cancer Sci 2003;94:965–73.

26. Takahashi M, Fukuda K, Sugimura T, Wakabayashi K. Beta-catenin isfrequently mutated and demonstrates altered cellular location in azox-ymethane-induced rat colon tumors. Cancer Res 1998;58:42–6.

27. Kaiser S, Park YK, Franklin JL, Halberg RB, Yu M, Jessen WJ, et al.Transcriptional recapitulation and subversion of embryonic colondevelopment bymouse colon tumor models and human colon cancer.Genome Biol 2007;8:R131.

28. Sekine S, Shibata T, SakamotoM,Hirohashi S. Target disruption of themutant beta-catenin gene in colon cancer cell line HCT116: preser-vation of its malignant phenotype. Oncogene 2002;21:5906–11.

29. Bottomly D, Kyler SL, McWeeney SK, Yochum GS. Identification of{beta}-catenin binding regions in colon cancer cells using ChIP-Seq.Nucleic Acids Res 2010;38:5735–45.

30. Manning AL, Dyson NJ. RB: mitotic implications of a tumour suppres-sor. Nat Rev Cancer 2012;12:220–6.

31. Morris EJ, Ji JY, Yang F, Di Stefano L, Herr A, Moon NS, et al. E2F1represses beta-catenin transcription and is antagonized by both pRBand CDK8. Nature 2008;455:552–6.

Han et al.





2013;11:207-218. Published OnlineFirst January 21, 2013.Mol Cancer Res Jinbo Han, Rossana C. Soletti, Anil Sadarangani, et al. Resistance to TNF-Induced Apoptosis in Colon Cancer Cells

-Catenin Promotes RB Stability andβNuclear Expression of

Updated version

10.1158/1541-7786.MCR-12-0670doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2013/01/21/1541-7786.MCR-12-0670.DC1

Access the most recent supplemental material at:

Overview

Visual

http://mcr.aacrjournals.org/content/11/3/207/F1.large.jpgA diagrammatic summary of the major findings and biological implications:

Cited articles

http://mcr.aacrjournals.org/content/11/3/207.full#ref-list-1

This article cites 31 articles, 7 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://mcr.aacrjournals.org/content/11/3/207To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-12-0670

http://mcr.aacrjournals.org/content/suppl/2013/01/21/1541-7786.MCR-12-0670.DC1

http://mcr.aacrjournals.org/content/11/3/207/F1.large.jpg

http://mcr.aacrjournals.org/content/11/3/207.full#ref-list-1

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/11/3/207


nuclear expression of b-catenin promotes rb stability...

Documents