nucleotide sequenceof the streptothricin acetyltransferase...

JOURNAL OF BACTERIOLOGY, May 1987, p. 1929-19370021-9193/87/051929-09$02.00/0Copyright C 1987, American Society for Microbiology

Vol. 169, No. 5

Nucleotide Sequence of the Streptothricin Acetyltransferase Genefrom Streptomyces lavendulae and Its Expression in

Heterologous HostsSUEHARU HORINOUCHI,* KAORU FURUYA,t MAKOTO NISHIYAMA, HIDEKI SUZUKI, AND

TERUHIKO BEPPUDepartment ofAgricultural Chemistry, The University of Tokyo, Bunkyo-ku, Tokyo 113, Japan

Received 20 August 1986/Accepted 30 January 1987

The nucleotide sequence of the streptothricin acetyltransferase (STAT) gene from streptothricin-producingStreptomyces lavendulae predicts a 189-amino-acid protein of molecular weight 20,000, which is consistent withthat determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme. Theamino acid composition and the NH2-terminal sequence determined by using the purified protein are in goodagreement with those predicted from the nucleotide sequence, except for the absence of the NH2-terminalmethionine in the mature protein. High-resolution S1 nuclease protection mapping suggests that transcriptioninitiates at or near the adenine residue which is the first position of the translational initiation triplet (AUG) ofSTAT. Another open reading frame located just upstream of the STAT gene was detected and contains a regionbearing a strong resemblance to DNA-binding domains which are conserved in known DNA-binding proteins.By addition of promoter signals and a synthetic ribosome-binding (Shine-Dalgarno) sequence at an appropriateposition upstream of the STAT translational start codon, the STAT gene confers streptothricin resistance onEscherichia coli and BaciUus subtilis. The STAT coding sequence with both the promoter of a B. subtilisceliulase gene and a synthetic Shine-Dalgarno sequence was functionally expressed in Streptomyces lividans,which suggests that the addition of an artificial leader upstream of the translational initiation codon (AUG) doesnot significantly influence the translation of STAT.

Various antibiotic resistance genes cloned from strepto-mycetes have served as selection markers in the develop-ment of plasmid and bacteriophage cloning vectors forStreptomyces spp. (3, 9, 33). They have also providedinformation on transcriptional and translational signals of themycelial gram-positive genus Streptomyces with an ex-tremely high guanine-plus-cytosine DNA composition (aver-age, 73 mol%). To date, the promoter regions and codingregions of several resistance genes in Streptomyces spp.,including the aminoglycoside phosphotransferase (aph) genein Streptomyces fradiae (2, 32), the 23S rRNA methylasegene mediating thiostrepton resistance (tsr) in S. azureus (2),the 23S rRNA methylase gene mediating erythromycin re-sistance (ermE) in S. erythraeus (6, 34), the viomycinphosphotransferase (vph) gene in S. vinaceus (2), and thehygromycin B phosphotransferase (hyg) gene in S.hygroscopicus (37), have been determined. The promotersignals of all these genes are different from those in otherprocaryotes, and the codon usage feature is highly biased,reflecting the high G+C composition.

Streptothricin is currently not used clinically or in veteri-nary work and therefore is useful as a selection marker inrecombinant DNA work in various species. We have clonedthe streptothricin acetyltransferase (STAT) gene (sta) fromstreptothricin-producing S. lavendulae; this gene probablyfunctions in self-protection in this organism (19). The STATencoded by sta adds an acetyl group from acetyl coenzyme

* Corresponding author.t Present address: Pharmaceutical Research and Development

Department, Asahi Chemical Industry, Kawanarushima 100, Fuji-shi, Shizuoka 416, Japan.

A at the p-amino group of the P-lysine moiety ofstreptothricin, as a result ofwhich streptothricin results in aninactive form (19; T. Kobayashi and T. Beppu, manuscript inpreparation). In this paper, we describe the determination ofthe nucleotide sequence of sta along with the NH2-terminalamino acid sequence of the purified STAT. A biased codonusage pattern and a promoter sequence different from theconsensus sequences in other procaryotes are also found inthe sta gene, as observed with other Streptomyces genesdescribed above. Moreover, a striking feature of this gene isthat the transcriptional start point is at or near the firstposition of the translational initiation codon. The construc-tion of plasmids which confer streptothricin resistance onEscherichia coli and Bacillus subtilis is also described.

MATERIALS AND METHODS

Bacterial strains and plasmids. S. lividans TK21 (14),obtained from D. A. Hopwood, John Innes Institute, En-gland, was used as the recipient strain for subcloning of theSTAT gene. E. coli 5131-5 (ade thi mdh gal hsdR; 17) and B.subtilis RM141 (leuB8 arg-15 his hsdR hsdM recE4; 20) werestock cultures in this laboratory and were used for expres-sion of sta. E. coli JM105 was purchased from Amersham,Co., Ltd., and used as the host for phage M13 propagation.Plasmids pIJ41 (neomycin and thiostrepton resistance; 33)and pIJ702 (thiostrepton resistance, Mel'; 18) provided byD. A. Hopwood, were used as Streptomyces cloning vec-tors. A thiostrepton resistance plasmid pIJ487 was providedby M. J. Bibb, John Innes Institute (35). The promoter-probevector pARC1, containing brown pigment production genesas the probe (15), was used for the detection of sta promot-

1929

on June 19, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

1930 HORINOUCHI ET AL.

A(Kilobase pairs)

0 0.O 0.5 1 1.5 1.6

Bam Sau3A SmaI

Sph Bam

ORF372 STAT

I- _p

Pmel-

Paph

I -Pme/nt 280

Paph

-PapA

pig -I

pig

Resistance PigmentVector ( jig/mil) production

'aph Bam-plJ41 >200

Bgl-pIJ702 >200

Bam/Sph-piJ41 100

Bgl/Sph-pIJ702 50

Bam-pIJ41 >200

h Bam-piJ41 >200

pig Bam-pARCI >200 +

Bam-pARCI >200

pig Bam-pARCI >200 +

Bam-pARC1 >200

Bam-pARCI 0 ++

B Bam Sal Sau Nae Nae EcoN . .

Nae Hinc Sph Apa

. Iz I_ Iz

FIG. 1. Schematic representation of plasmids (A) and sequencing strategy (B). These include pSR51, containing the 1.6-kb BamHIfragment in the BamHI site of pIJ41 and conferring resistance to streptothricin at more than 200 ,ug/ml; pSR511, containing the 1.6-kb BamHIfragment in the BglII site of pIJ702; pSR53, containing the 1,087-bp BamHI-SphI fragment in pIJ41 digested with BamHI plus SphI; pSR531,containing the BamHI-SphI fragment in pIJ702 digested with BglII plus SphI; and pSR54 and pSR55, obtained by digestion of the 1.6-kbBamHI fragment with BAL 31 nuclease, attachment ofBamHI linkers 8 nt in length at both ends, and ligation of the BamHI linker-attachedfragment with pIJ41 digested with BamHI. The left end of the fragment on pSR54 and pSR55 was at nt 280 as determined by nucleotidesequencing. Plasmids pST1 through pST4 were constructed by ligation of the indicated fragments into pARC1 digested with BamHI. Forconstruction of pST6, BamHI linkers were attached to the SmaI end of the small BamHI-SmaI fragment and digested with Sau3A to generatethe Sau3A-SmaI segment with a BamHI linker at the SmaI end. The segment was purified by agarose gel electrophoresis and ligated withBamHI-digested pARC1. Abbreviations: Paph, promoter signal of aminoglycoside phosphotransferase gene (2); Pmel, promoter signal of thetyrosinase gene (1); and pig, brown pigment production genes on pARC1 (15).

ers. Plasmids pSR51 and pSK7 containing the STAT genewere described previously (19). Plasmid pYEJ001 (ampicillinand tetracycline resistance), a pBR327 derivative containingthe E. coli consensus promoter, was purchased fromPharmacia P-L Biochemicals. Plasmid pBC501 (kanamycinresistance), a pUB110 derivative containing a B. subtiliscellulase gene, was obtained from A. Nakamura (20).

Chemicals and enzymes. The restriction endonucleases,DNA-modifying enzymes, synthetic linkers, and an M13-sequencing kit were purchased from New England BioLabs,Inc., and Takara Shuzo, Co., Ltd. Thiostrepton andstreptothricin F were kindly supplied by Asahi ChemicalIndustry and Sanraku Ocean Co., Ltd., respectively.Recombinant DNA studies. Plasmid DNA from Streptomy-

ces spp., E. coli and B. subtilis was isolated by CsCl-ethidium bromide density gradient centrifugation. Recombi-nant DNA work and protoplast transformation of Strepto-myces spp. were performed as described previously (15). E.coli and B. subtilis were grown in L broth or on L agar (27)and transformed by the method of Lederberg and Cohen (21)and Dubnau and Davidoff-Abelson (11), respectively. E. colitransformants carrying pBR322- and pYEJ001-derived plas-mids were selected on L agar containing 50 ,ug of ampicillinper ml. B. subtilis transformants carrying pBC501-derived

plasmids were selected on L agar containing 10 ,ug ofkanamycin per ml.DNA sequence studies. A 1.6-kilobase (kb) BamHI frag-

ment was purified from pSR51 by agarose gel electrophore-sis. Various subfragments obtained by digestion of theBamHI fragment with restriction enzymes were cloned inM13mpl8 and M13mpl9 (26). DNA was sequenced with[a-32P]dCTP by the dideoxynucleoside triphosphate chaintermination method (29). Because of the high G+C compo-sition, we used dITP instead of dGTP as follows. Theconcentrations ofdITP in the reaction mixtures for the A andT lanes, the C lane, and the G lane were 0.15 mM, 0.11 mM,and 0.73 ,uM, respectively. Efficient chain elongation wasobtained by the following two modifications: first, the con-centration of ddGTP was reduced to 1/10, and second, thereaction temperature with the Klenow fragment was usually42°C (in some cases, 50°C) to avoid sudden chain termina-tion, probably at positions forming tight secondary struc-tures.

Si nuclease mapping. Total RNA was prepared from S.lividans TK21 carrying pSR51 or pIJ41 by a previouslydescribed procedure (16). RNA (30 ,ug) was hybridized witha SalI-EcoRI fragment with 32P at the 5' end of the EcoRIsite at 45°C for 12 h and with a Sau3A-SmaI fragment with

Plasmid

pSR51

pSR5 11

pSR53

pSR531

pSR54

pSR55

pST1

pST2

pST3

pST4

pST6

J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/

STAT GENE FROM S. LAVENDULAE 1931

BauelGGATCCGCGATGCGGTGGAGACGTCCAGCCCTCACCGACTTCCGCGAGGAGTACCCATGTACGCCCACCCCGACGACCTCCACCGCGCCCGCTCCGTAGG 100

MetTyrAlaHlsProAspAspLeuHisArgAlaArgSerValGly

AvaI. * SalI Sau3ACGCCGCCGCGGCGCCCGAGTTCGCGGCCTGGCTCGCTTTCCAGAACGCGGT CGACCGCCAGGACGGCGCCGTCCCGCGCCGCTACCGCGAGCTGATCTCC 2200AlaAlaAlaAlaProGluPheAlaAlaTrpLeuAlaPheGlnAsnAlaValAspArgGlnAsPGlYAlaValProArgArgTyrArgGluLeul leSer

GTGGCCGTGGCCCTCGTCACCCAGTGCGCGTACTGCCTCGACGTCCACACCGAGGCCGCCCGCAGGCACGGCGTCACCGCCGAGGAACTCGCCGAGACCG 300ValAl aVal A1aLeuVal1ThrGl nCysAl aTyrCysLeuAspVal H IsThrGl uAl aAl aArgArgH IsGl yValThrAl1aGluGl uLeuAlaGluThrAl1a

CGTTCGTCACCGCCTCGGTCCGGGCCGGCGGAACCCTCGC,CCACGCCCTCCTCGCCGACCGCCTCTACGAACAGCACAGC,CACCACGGGCCGTCCGCCAC 40 0PheValThrAlaSerValArgAlaGlyGlyThrLeuAlaHisAlaLeuLeuAlaAspArgLeuTyrGluGlnHIsSerHisHisGlyproserAlaThr

* * * NaeI . . ApaICCCCGCGAGCGCGGCAACC~CCCTCCGGCT'GACGTCACGCCGGCCCGCCACGACCCCCAACCTTGGGGCCCCGTGGCACATCCGGCTGAAACCAGACCTCA 500ProAlaSerAlaAlaThrProSerGlYTRM ** * ''.'.'

* * AvaI N .gooR . SmaI.CCGGGGCAGGCCGGGCATAGCCTCGGGTCATGACCACGACCCATGGCAGCACGTACGAATTCCGCAGCGCACGACCCGGGGACGCCGAGGCCATCGAGGG 6600

MetThrThrThrHisGlyserThrTyrGluPheArgSerAlaArgProGlyAspAlaGluAlal leGluGly

CCTCGACGGCTCCTTCACCACCAGTACCGTiCTTCGAAGTGGACGTCACCGGAGACGGGTTCGCCCTGCGCGAGGTCCCGG~CGGACCCGCCGCTGGTGAA'G 700LeuAsPGlYSerPheThrThrSerThrvalPheGl uValAspValThrGl yAspGlyPheAl aLeuArgGluVal ProAl aAspProProLeuVa 1Lys

*a! . . . . ...

GTCTTCCCCGACGACGGCGGAAGCGACGGGGAGGACGGCGCGGAGGGCG'AGGACGCCGACAGCCGTACGTTCGTGGCCGTCGGCGCCGACGGCGACCTCG 800Val PheProAspAspGl YGl ySerAsPGl YG1 uAspGl yAlaGl uGl yGl uAspAl aAspSerArgThrPheVa 1A1 aValG1lyAl1aAsPGlyAspLeuAl a

CCGGCTTCGCCGCAGTGTCCTACTCGGCGTGGAACCAGCGGCTGACCATCGAGGACATCGAGGTCGCCCCCGGTCACCGCGGCAAGGGCATCGGCCGTGT 900Gl YpheAl aAl aValSerTyrSerAl aTrpAsnGI nArgLeuThr Il eGl uAspIlleGl uVal A laProGl YH IsArgGl YLYsGl yI leGl yArgVaI1

GCTGATGCGTCACGCGGCGGACTTCGCCCGTGAACGCGGCGCCGGGCACCTGTGGCTGGAGGTGACGAACGTCAACGCCCCGGCCATCCACGCCTACCGT 1000LeuMetArgH IsAl aAl aAspPheAl aArgGl uArgGl yAl aGl yH IsLeuTrPLeuGl uVal ThrAsnVal AsnAl aProAl a I1eH tsAl aTYrArg

1100

ApalCCGTCAGCAGACGCGTG;ACGACGGGGGCCC

FIG. 2. Nucleotide sequence of sta is shown together with the STAT protein and ORF372 deduced from the nucleotide sequence. Thethick arrow indicates the 5' end of the mRNA as determined by S1 mapping. The thick line below the amino acid sequence of ORF372indicates the region bearing a strong resemblance to DNA-binding domains in known DNA-binding proteins. The two arrows below thenucleotide sequence (nt 434 to 488) indicate an inverted complementary repeat sequence (AG = -44.8 kcal/mol).

32P at the 5' end of the SmaI site at 46°C for 12 h, in a sealedglass capillary. The RNA-DNA mixture in 30 RI of 80%formamide-0.4 M NaCl-50 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES; pH 6.4)-i mM EDTA was firstdenatured at 100°C for 5 min and hybridized. The hybridiza-tion mixture was then diluted with 200 ,ul of 30 mM sodiumacetate (pH 4.6)-i mM ZnSO4-0.25 M NaCl-20 ,ug ofdenatured calf thymus DNA per ml and digested with Sinuclease at 32°C for 1 h. Protected DNA fragments wereanalyzed on DNA sequencing gels by the method of Maxamand Gilbert (24).

Purification and characterization of the STAT. STAT waspurified from S. lividans carrying pKS7 by the method ofKobayashi (T. Kobayashi, unpublished results). Briefly, acrude extract from a 10-liter culture was concentrated byammonium sulfate precipitation, and STAT was purified bysuccessive chromatography on a DEAE-cellulose (WhatmanDE52) column, an affinity column of Blue Sepharose CL-6B,and a gel filtration column of Sephadex G-75. STAT obtainedin this way gave a main single band on sodium dodecylsulfate-polyacrylamide gel electrophoresis. The NH2-terminal amino acid sequence was determined with a model890D Beckman Protein/Peptide Sequencer. The amino acidcomposition was determined with a Hitachi 835 Amino AcidAnalyzer.

Site-directed mutagenesis. A nucleotide 37 base pairs (bp)in length (5'-AATTCGAGCTCAAGGAGGAT-CCATCATGACTACGACC) was synthesized with a System1 Plus Beckman DNA Synthesizer. By essentially themethod of Zolier and Smith (38) throughout, we isolatedsingle-stranded DNA by using phage M13mp19, annealed itto the synthetic 37-mer nucleotide, converted it to thedouble-stranded form with the Klenow fragment of DNApolymerase I and T4 DNA ligase, and then introduced it into

E. coli JM105. Phage replicative form DNA isolated fromplaques was first tested for the presence of a new BamHlsite, because the synthetic nucleotide contained a BamHIsite. The nucleotide sequence was then determined from theEcoRI site near the region.

RESULTS AND DISCUSSIONTrimming of the cloned fragment. The sta gene from S.

lavendulae has been cloned, and its location has beennarrowed to a ca. 1.6-kb BamHI fragment (19). For furthertrimming of the BamHI fragment, we constructed a set of

TABLE 1. Amino acid composition of STAT

No. of residuesAmino acid Predicted from Found by amino

nucleotide sequence acid analysis

Ala 25 26Arg 12 10Asp/Asn 19 19Cys 2 1Glu/Gln 16 19Gly 24 30His 6 5Ile 5 3Leu 11 11Lys 2 3Phe 10 9Pro 9 10Ser 11 18Thr 12 12Tyr 5 5Val 13 11Met 4 3

sphi .CGGATGGGL-iTCGCCTTCT6CGGCCTGGA.AGCGCCCTdACCAGGGCA.CGCGTCCGAiGGCGAGCAC.CGCTCTACATGAGCATGCCCTGCCCCTGAG

VOL. 169, 1987

1130


.org/D

ownloaded from

http://jb.asm.org/


TABLE 2. Codon usage of ORF372 and STAT

No. in: Amino No. in:Acid Codon Acid Codonacid CodonORF372 STAT acid ORF372 STAT

Phe TlT- 0 0 Tyr TAT 0 0TTC 3 10 TAC 4 5

Leu TTA 0 0 Term TAA 0 0TTG 0 0 TAG 0 0

Leu CTT 0 0 His CAT 0 1CTC 9 3 CAC 8 5CTA 0 0 Glu CAA 0 0CTG 1 8 CAG 4 2

Ile ATT 0 0 Asn AAT 0 0ATC 1 5 AAC 1 3ATA 0 0 Lys AAA 0 0

Met ATG 1 5 AAG 0 2

Val GTT 0 0 Asp GAT 0 0GTC 7 7 GAC 6 16GTA 1 0 Glu GAA 2 4GTG 2 6 GAG 5 10

Ser TCT 0 0 Cys TGT 0 0TCC 4 3 TGC 2 2TCA 0 0 Term TGA 1 1TCG 1 1 Trp TGG 1 2

Pro CCT 0 0 Arg CGT 0 5CCC 4 5 CGC 8 4CCA 0 0 CGA 0 1CCG 2 4 CGG 1 2

Thr ACT 0 0 Ser AGT 0 1ACC 8 8 AGC 2 6ACA 0 0 Arg AGA 0 0ACG 0 4 AGG 1 0

Ala GCT 1 2 Gly GGT 0 1GCC 18 16 GGC 5 17GCA 1 0 GGA 1 2GCG 8 7 GGG 1 4

residues (Mr, 20,000) was found. The highly biased codonusage in the coding region, as described below, was inagreement with the general tendency of Streptomyces geneswith the extremely high G+C content (3, 5).The molecular weight of STAT purified from S. lividans

carrying pKS7 was about 23,000 on the basis of sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (data notshown), which was slightly higher than that predicted fromthe nucleotide sequence, possibly because STAT is a rela-tively acidic protein. The NH2-terminal sequence of thepurified enzyme was determined by the automated Edmandegradation procedure to be X-X-X-His-Gly-X-X-Tyr-Glu-Phe-X-X-Ala-X-Pro-Gly-Asp-Ala-Glu-Ala-Ile-Glu-Gly-Leu-Asp-X-X-Phe-X-X-X-X-Val-Phe-Glu-Val-Asp-Val-X-Gly.(X corresponds to Thr, Ser, or Arg, which could not beidentified by the method used. Amino acid 26 corresponds toGly from the nucleotide sequence, but we could not identify

C

A

am _ P .......I.-

B

_f .o_-

recombinant plasmids by using pUI41 and pIJ702 as thevectors in S. lividans (Fig. 1). Plasmids pSR51 and pSR511,containing the whole BamHI fragment on pIJ41 and pIJ702,respectively, and plasmid pST4, containing a 1.4-kb frag-ment, conferred resistance to streptothricin at more than 200,ug/ml when tested in liquid YMPG medium. Plasmids pSR53and pSR531, both of which lacked a small SphI-BamHIsegment in the 1.4-kb fragment, conferred lower resistance(100 ,ug and 50 ,ug/ml, respectively). The distinctly lowerresistance conferred by pSR531 with a high copy numberwas later explained by a small deletion of the COOH-terminal end of the coding region as described below.Plasmids pST3 and pST4 containing the 1.4-kb fragment inthe opposite orientation with respect to the vector sequenceconferred the same level of resistance to streptothricin.These results suggest that the 1.4-kb Sau3A-BamHI frag-ment contained the promoter and coding sequences of thesta gene.

Nucleotide sequence of sta. We determined the nucleotidesequence of the 1.6-kb fragment by the M13 dideoxy method(Fig. 2) by using the strategy shown in Fig. 1B. Because ofthe high G+C composition, we used dITP instead of dGTPto confirm the nucleotide sequence. An open reading frame(nucleotide [nt] 530 to 1096) consisting of 189 amino acid

FIG. 3. Position of the 5' terminus of the sta mRNA as based onSi nuclease mapping. The 380-bp Sau3A-SmaI fragment with 32P atthe 5' end of the SmaI site (A and B) and the 407-bp SalI-EcoRIfragment with 32P at the 5' end of the EcoRI site (C) were used as theprobes. Cellular RNA was prepared from S. lividans containingpSR51 or pIJ41. The Sl-treated DNA was analyzed in parallel withthe sequencing ladders (lanes G+A, T+C) by the method of Maxamand Gilbert (24). Lane 1, untreated 380-bp probe; lane 2, RNA (20,ug) from S. lividans containing pIJ41 was hybridized with the 380-bpprobe, and the hybridization mixture was digested with 220 U of S1nuclease; lane 3, RNA (30 ,ug) from S. lividans containing pSR51was hybridized with the 380-bp probe and digested with 55 U of S1nuclease; lane 4, same as lane 3, except that the hybridizationmixture was treated with 330 U of S1 nuclease; and lane 5, RNA (20,Lg) from S. lividans containing pSR51 was hybridized with the407-bp probe and digested with 200 U of S1 nuclease. The arrow-heads indicate the positions of the protected fragments. The thickarrow indicates the 5' terminus of sta mRNA, since the Sl-treatedDNA labeled at the 5' end migrates 1.5 bases slower than thecorresponding DNA on the sequence ladder.

J. BACTERIOL.

.......

4, :,

.i I


.org/D

ownloaded from

http://jb.asm.org/


-45 to -25 region -10 region

* * * ** * * * *

Ctc T T T C G A G G T T T A ;1A T C C T T A T C G T T ATGG T G T T T G T A A T A G

ata AAAC C A G A C C T C A C GGG G C A GGCG G G CAT A G C C T[C G G G T C A

endo H AT T GA C T G A TLT G G CGC TT C C[ G G G C A GLGJG AG G C A C G G

FIG. 4. Alignment of the promoter sequences of sta, B. subtilis ctc, and S. plicatus endo H genes. Identical nucleotides are enclosed byboxes. The underlined nucleotides indicate transcriptional start points. Nucleotides of the ctc promoter marked with asterisks are importantfor utilization by B. subtilis RNA polymerase with a37, shown by methylation protection experiments (31).

the exact amino acid by this particular sequencing experi-ment). It corresponded precisely to the sequence predictedfrom the nucleotide sequence, except for the NH2-terminalfMet, which might be processed in the mature enzyme. Theamino acid composition obtained with the purified STATwas also in agreement with that of the reading frame (Table1). All these results clearly show that the 189-amino-acidsequence represents the STAT enzyme. The codon usagepattern is listed in Table 2. The overall average G+C contentof the coding sequence of STAT is 70.3 mol%, and those forcodon positions 1, 2, and 3 are 69.8, 51.3, and 91.0 mol%,respectively.The SphI site was located proximal to the COOH-terminal

end within the coding region, which probably explained thelow-level resistance specified by pSR53 and pSR531. Thismeans that STAT does not require intactness of the COOH-terminal region for its activity. The difference in the level ofresistance between pSR53 and pSR531 seems to be ascribedto the different amino acid sequences which are fuseddownstream of the Met residue coded by the SphI recogni-tion sequence.

Detection of the promoter signal of sta. To identify pro-moter signals of the STAT gene, we used the promoter-probe plasmid pARC1, allowing chromogenic identification.Various restriction fragments were connected upstream ofthe brown pigment production gene, and pigment productionby S. lividans TK21 carrying the plasmids was tested onBennett agar medium containing 40 ,ug of thiostrepton per ml(Fig. 1A). From the results with plasmids pST1 and pST2,the 1.6-kb BamHI fragment was found to contain only arightward promoter signal. To map the promoter regionmore precisely, subfragments were cloned into pARC1,resulting in plasmids pST3 through pST6. These resultsclearly show the presence of a promoter on the Sau3A-SmaIsegment (nt 194 to 577). Plasmid pST6 containing the Sau3A-SmaI segment caused a higher level of pigment productionthan pST1 and pST3 did, presumably because in pST1 andpST3, the promoter was located far from the probe gene orbecause there might be a transcriptional terminator down-stream of the STAT coding region.We next determined the transcriptional start point of the

promoter by S1 nuclease mapping. The SalI-EcoRI fragment(nt 151 to 561) with 32P at the 5' end of the EcoRI site and theSau3A-SmaI fragment (nt 194 to 577) with 32P at the 5' endof the SmaI site were used in the high-resolution S1 protec-tion mapping with RNA with S. lividans TK21 containingpSR51 (Fig. 3). Even though the S1 mapping data obtainedwith different 32p probes and under different S1 digestionconditions indicated that the transcripts started at severalnucleotides around nt 530, it is most likely that transcriptionwas initiated at or near nt 530, which corresponds to theadenine residue of the translational initiation codon. Fromthe data in Fig. 3, lanes 3 and 4, with decreased concentra-tions of S1 nuclease, there remain the following two possi-bilities: first, the sta transcript may have a heterologous 5'

end with a 0- to 5-nt leader, and second, the S1-resistanthybrids near nt 530 may represent a major degradationproduct of a transcript that initiated upstream of nt 525 to530. Depending on the result in lane 5, we may assume thatthe additional bands with higher molecular weights wereproduced as a result of incomplete S1 digestion, probablyowing to some secondary structures and to enzymatic prop-erties of S1 nuclease. However, it is not clear to us why suchbands did not appear by S1 digestion of the hybridizationmixture between the probe and nonhomologous RNA fromS. lividans carrying pIJ41. Some other data with RNAs fromdifferent origins, such as a strain containing the sta gene ona multicopy plasmid and the original S. lavendulae strain,seem to be necessary to make these points clear.The erythromycin resistance gene from S. erythraeus (6)

and the aminoglycoside phosphotransferase gene from S.fradiae (M. J. Bibb, personal communication) also appear toinitiate transcription at the translational initiation codon.These findings suggest the presence of a specific feature inthe translation of a leaderless Streptomyces transcript. Thisfeature presents a striking contrast to the conventionalribosome-Shine-Dalgarno (SD) sequence contact in transla-tional initiation in other procaryotes (13, 25).The promoter sequence of sta is different from the con-

sensus sequence found in other procaryotes. However,alignment of the promoters of sta and the S. plicatusendoglycosidase H gene (endo I) showed significant homol-ogy (Fig. 4). Westpheling et al. (36) reported that a sigmafactor (aJ49) from S. coelicolor is responsible for in vitrotranscription of the endo H gene as well as the B. subtilis ctcpromoter. Of nine nucleotides of the ctc promoter whichwere shown to be important for utilization by B. subtilisRNA polymerase with a'37 by methylation protection exper-

xCICro

Lac IGalR

HtpRaHtpRbLexACRP

ORF372

Gln Glu Ser ValGln Thr Lys ThrLeu Tyr Asp ValIle Lys Asp ValVal Glu Met ValLeu Gln Glu LeLAla Ala Glu IleArg Gln Glu Ile

AlaAlaAlaAlaAlaAlaAlaGly

Asp Lys MetLys Asp LeuGlu Tyr AlaArg Leu AlaArg Glu LeuAsp Arg TyrGln Arg LeuGln Ile Val

His Thr Glu AlatAaArg Arg His

GlyGlyGlyGlyGlyGlyGlyGly

Gly

Met Gly Gln Ser GlyVal Tyr Gln Ser AlaVal Ser Tyr Gln ThrVal Ser Val Ala ThrVal Thr Ser Lys AspVal Ser Ala Glu ArgPhe Arg Ser Pro AsnCys Ser Arg Glu Thr

Val Thr Ala Glu Glu

ValIleValValValValAlaVal

Gly Ala LeuAsn Lys AlaSer Arg ValSer Arg ValArg Glu MetArg Gln LeuAla Glu GluGly Arg Ile

Leu Ala Glu Thr

a-helix

FIG. 5. Alignment of DNA binding-domains. The alignment ofthese sequences was adapted from references 23 and 30. Theseinclude XCI, the repressor of phage X; XCro, the Cro protein ofphage X; LacI, the repressor of lactose operon; GaIR, the repressorof gal; HtpRa and HtpRb, the two DNA-binding domains of thesigma factor for E. coli heat shock proteins; LexA, the lexA geneproduct; CRP, the cyclic AMP receptor protein; and ORF372, an

open reading frame upstream of STAT. Highly conserved aminoacids are boxed.

VOL. 169, 1987


.org/D

ownloaded from

http://jb.asm.org/


22-QAva-Sal Bam Eco Sh Ba

Ava digest, Si nuclease & 9Hind (Sac) linker insertion

Pst/Bam-pBR322

7L"-ow

Sac/Bam-pBC501Sac W t

CGAGCTCGGTC ATG

Ba Ec Sph BamH--

Hind MetCAAGCTTGGTC ATG

Ba Ecam

Hind/Bam-pYEJOOI

AATTCGAGCTCAAG GATCCATCATGACTACGACCTTAAGCTCGAG CCAGTACTGGTGCTGG

FIG. 6. Construction of plasmids conferring streptothricin resistance on E. coli and B. subtilis. The BamHI-EcoRI fragment (nt 1 to 561)was inserted in pBR322-A Ava-Sal. Plasmid pBR322-A&Ava-Sal was constructed by digestion of pBR322 (7) with AvaI plus SalI, Si digestion,and recirculization. To attach a HindIII (or SacI) linker at the AvaI site, the plasmid containing the BamHI-EcoRI fragment was digested with

pBR3,

J. BACTERIOL.

0% 0% . a o- 1%


.org/D

ownloaded from

http://jb.asm.org/


iments (31), eight nucleotides of the sta promoter are iden-tical in this alignment. From these observations, we inferthat sta was transcribed by the RNA polymerase containing49

An open reading frame upstream of sta. A search forprotein-coding sequences by the method of Bibb et al. (5)identified an additional open reading frame, ORF372, thatstarted with ATG (nt 57) and terminated with TGA (nt 429)(Fig. 2). In front of the ATG codon, a possible ribosome-binding site (SD sequence), GAGGAG (nt 46 to 51), waspresent. The codon usage pattern of ORF372 with a similarcharacteristic of coding sequences observed for other Strep-tomyces genes is shown in Table 2. The overall averageG+C content of the coding sequence of 0RF372 is 77.6mol%, and those for codon positions 1, 2, and 3 are 76.0,62.4, and 94.4 mol%, respectively. The most striking featureof ORF372 is the presence of a region bearing a strongresemblance to DNA-binding domains in known DNA-binding proteins such as repressors and Cro proteins ofphages X and P22 (30) (Fig. 5). Chou-Fasman analysis (10) onthis region predicted that the region formed two a-helicesconnected by a turn at the conserved glycine, as observedwith other DNA-binding proteins (23).The presence of the open reading frame just upstream of

sta led us to assume that it may have some function in theexpression of sta, although ORF372 seemed not to beassociated with the expression of sta because pST3 andpST4 lacking about one-third of ORF372 still conferred thesame level of streptothricin resistance as pSR51 did. To testthis, we constructed pSR54 and pSR55 in which more thanhalf of ORF372, including the potential DNA-binding do-main, was deleted (Fig. 1A). S. lividans containing eitherpSR54 or pSR55 showed resistance to streptothricin at thesame level as S. lividans containing pSR51, when tested bystreaking spores of the strains on a gradient plate (O to 500 ,ugof streptothricin per ml). These results indicate that ORF372is not required for expression of the STAT gene.

Biosynthetic genes, including regulatory and resistancegenes for secondary metabolites, are usually clustered (8, 12,22, 28). ORF372 with the region having a strong resemblanceto DNA-binding domains could therefore have a regulatoryrole in streptothricin biosynthesis. ORF372 is not associatedwith the phenotypic expression of sta at least in S. lividans.Determination of the phenotype of mutants with mutationsin ORF372 will provide detailed information on the role ofthis product.

Expression of the STAT gene in E. coli and B. subtilis. The1.6-kb BamHI fragment, when cloned into the BamHI site of

u

0~~~~~

Sph

PSTB2

OFKm

r~

FIG. 7. Construction of pSR56. The STAT coding sequence,together with the promoter of the B. subtilis cellulase gene and thesynthetic SD sequence, was excised by digestion of pSTB2 withHindIlI completely plus EcoRI partially, ligated with pIJ487 di-gested with HindIII plus EcoRI, and introduced by transformationinto S. lividans TK21. Transformants carrying pSR56 were selectedon Bennett agar medium containing thiostrepton (40 ,ug/ml) andstreptothricin (10 ,ug/ml). The structure of pSR56 was confirmed byrestriction mapping. The terminator on pIJ487, an efficient transcrip-tional terminator derived from E. coli phage fd, prevents significanttranscriptional readthrough from vector promoters (35). Other ab-breviations and symbols are as in the legend to Fig. 6.

pBR322 in two orientations, did not confer streptothricinresistance on E. coli, probably because the sta promoter didnot function in E. coli and because there was no ribosome-binding site for the STAT coding sequence. We thereforeattached a functional promoter and a ribosome-binding siteupstream of sta (Fig. 6). The resultant plasmid, pSTE1,containing the E. coli consensus promoter derived from

AvaI, trimmed with S1 nuclease, ligated to HindIII (or Sacl) linkers, digested with HindIlI (or Sacl) and then recircularized with T4 DNAligase, resulting in pBRH (or pBRS). Plasmid pBRHT (or pBRST) containing a HindIlI (or Sacl) linker at the original AvaI site and the wholecoding sequence (solid bar) downstream of the linker was constructed by ligation of three fragments, i.e., the large PstI-EcoRI fragment frompBRH (or pBRS), the EcoRI-BamHI fragment (nt 562 to 1600) from pSR51 containing the rest of the STAT gene, and the small PstI-BamHIfragment from pBR322. The nucleotide sequences around the linkers were determined from the BamHI site close to the region. TheHindIII-BamHI fragment from pBRHT and the SacI-BamHI fragment from pBRST were inserted downstream of the E. coli consensuspromoter on pYEJ001 and the promoter of a cellulase gene from B. subtilis on pBC501, respectively. Plasmids pSTE1 and pSTB1 constructedin this way were introduced by transformation into E. coli and B. subtilis, respectively. For generation of a strong SD sequence in front ofthe AUG translational initiation codon, the SacI-BamHI fragment from pSTB1 was first cloned into M13mp19, and the single-stranded DNAwas purified. The large EcoRI-HindIII fragment ofM13mpl9 (100 ng) was annealed with the purified single-stranded DNA (500 ng) by incubationat 100°C for 2 min, 65°C for 3 min, 37°C for 30 min, 4°C for 30 min, and 0°C for 10 min. The gapped circular DNA was purified by polyacrylamidegel electrophoresis and then annealed with a synthetic DNA 37 nt long. The gap was filled in and ligated with the Klenow fragment of DNApolymerase I and T4 DNA ligase. The double-stranded molecules obtained in this way were introduced into E. coli, and the plaques werescreened for plasmids containing an additional BamHI site derived from the 37-mer nucleotides. The nucleotide sequence around the 37-mernucleotides was checked by sequencing. The SacI-HindIll fragment containing the SD sequence and the whole STAT coding sequence,obtained in this way, was inserted downstream of the promoter of the cellulase gene, resulting in pSTB2. The arrow together with + 1 on pSTB1and pSTB2 indicates the transcriptional start point (A. Nakamura, unpublished data).

VOL. 169, 1987


.org/D

ownloaded from

http://jb.asm.org/


pYEJ001 and a sequence AAG 7 nt upstream of the transla-tional initiation codon, whose structure was confirmed bynucleotide sequence determination, conferred resistance to20 ,ug of streptothricin per ml when tested on L-agar me-dium. Under the same conditions, E. coli without the plas-mid was unable to grow in the presence of 2 ,ug ofstreptothricin per ml.For the expression of sta in B. subtilis, plasmid pSTB1

with the pUBilO replicon and the STAT coding sequencewas constructed and introduced into B. subtilis (Fig. 6). Inthis construction, the STAT gene with a sequence GAG 7 ntupstream of the initiation codon was connected downstreamof the promoter signal of a B. subtilis cellulase gene. Theunique SacI site of pBC501 separates the transcriptionalstart site from the SD sequence for the cellulase gene (A.Nakamura, unpublished data). B. subtilis containing pSTB1was resistant to 10 ,ug of streptothricin per ml, whereas B.subtilis without the plasmid was unable to grow in thepresence of 7.5 jig of streptothricin per ml. Apparently lowexpression of sta on pSTB1 was probably ascribable to theweak SD sequence, since, as McLaughlin et al. (25) pointedout, B. subtilis requires a sttong SD sequence for translation.We then constructed pSTB2 with a sequence AAGGAGGbefore the AUG initiation codon, which was perfectly com-plementary to the 3' terminal region of 16S rRNA, byoligonucleotide-directed mutagenesis with phage M13 (Fig.6). B. subtilis containing pSTB2 was resistant to 20 jLg ofstreptothricin per ml.The STAT coding sequence with the promoters and SD

sequences at the appropriate positions usable in E. coli andB. subtilis confers streptothricin resistance on these hosts.The STAT gene with the promoters can easily be isolated bydigestion with restrictioh enzymes and religated with othervectors able to replicate in various species. A broad antimi-crobial spectrum and no clinical application of streptothricinare advantages of using the STAT gene as a selection markerin cloning experiments.

Expression of the synthetic promoter plus STAT codingsequence in Streptomytes spp. We constructed pSR56 byusing pIJ487 as the vector to determine whether the STATcoding sequence with the promoter of the B. subtiliscellulase gene and the synthetic SD sequence was expressedin Streptomyces spp. (Fig. 7). When tested on Bennett agarmedium, S. lividans carrying pSR56 was resistant to morethan 200 ,ug of streptothricin per ml. The STAT gene with theBacillus promoter was inserted downstream of the E. coliphage fd transcriptional terminator located in pIJ487 (35).These results show that the promoter of the B. subtiliscellulase gene, or other Bacillus promoters upstream of thecellulase gene, were expressed in Streptomyces spp., con-sistent with previous observations (4, 15). In addition, theSTAT mRNA with an artificial leader was translated to aconsiderable extent, although at present we could not ex-clude the possibility that some ATG or GTG codon in-framewith the ATG start codon of STAT served as a translationalstart codon, leading to the production of a fused protein withthe enzyme activity.

ACKNOWLEDGMENTS

The amino acid composition of the STAT enzyme was determinedwith the aid of M. Kadowaki. We also thank A. Nakamura forallowing us to reproduce unpublished data. The reviewers of thismanuscript provided valuable comments and suggestions for im-provement.

LITERATURE CITED1. Bernan, V., D. Filpula, W. Herber, M. Bibb, and E. Katz. 1985.

The nucleotide sequence of the tyrosinase gene from Strepto-myces antibioticus and characterization of the gene product.Gene 37:101-110.

2. Bibb, M. J., M. J. Bibb, J. M. Ward, and S. N. Cohen. 1985.Nucleotide sequences encoding and promoting expression ofthree antibiotic resistance genes indigenous to Streptomyces.Mol. Gen. Genet. 199:26-36.

3. Bibb, M. J., K. F. Chater, and D. A. Hopwood. 1983. Develop-ments in Streptomyces cloning, p. 53-82. In M. Inouye (ed.),Experimental manipulation of gene expression. AcademicPress, Inc., New York.

4. Bibb, M. J., and S. N. Cohen. 1982. Gene expression inStreptomyces: construction and application of promoter-probeplasmid vectors in Streptomyces lividans. Mol. Gen. Genet.187:265-277.

5. Bibb, M. J., P. R. Findlay, and M. W. Johnson. 1984. Therelationship between base composition and codon usage inbacterial genes and its use in the simple and reliable identifica-tion of protein coding sequences. Gene 30:157-166.

6. Bibb, M. J., G. R. Janssen, and J. M. Ward. 1985. Cloning andanalysis of the promoter region of the erythromycin resistancegene (ermE) of Streptomyces erythraeus. Gene 38:215-226.

7. Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L.Heyneker, H. W. Boyer, J. H. Crosa, and S. Falkow. 1977.Construction and characterization ofnew cloning vehicles. II. Amultipurpose cloning system. Gene 2:95-113.

8. Chater, K. F., and C. J. Bruton. 1985. Resistance, regulatoryand production genes for the antibiotic methylenomycin areclustered. EMBO J. 4:1893-1897.

9. Chater, K. F., D. A. Hopwood, T. Kieser, and C. J. Thompson.1982. Gene cloning in Streptomyces. Curr. Top. Microbiol.Immunol. 97:69-95.

10. Chou, P. Y., and G. D. Fasman. 1978. Prediction of thesecondary structure of proteins from their amino acid sequence.Adv. Enzymol. Relat. Areas Mol. Biol. 47:45-148.

11. Dubnau, D., and R. Davidoff-Abelson. 1971. Fate of transform-ing DNA following uptake by competent Bacillus subtilis. I.Formation and properties of the donor-recipient complex. J.Mol. Biol. 56:209-221.

12. Feitelson, J. S., F. Malpartida, and D. A. Hopwood. 1985.Genetic and biochemical characterization of the red gene clusterof Streptomyces coelicolor A3(2). J. Gen. Microbiol. 131:2431-2441.

13. Gold, L., D. Pribnow, T. Schneider, S. Shinedling, B. S. Singer,and G. Stormo. 1981. Translational initiation in prokaryotes.Annu. Rev. Microbiol. 35:365-403.

14. Hopwood, D. A., T. Kieser, H. M. Wright, and M. J. Bibb. 1983.Plasmids, recombination and chromosome mapping in Strepto-myces lividans 66. J. Gen. Microbiol. 129:2257-2269.

15. Horinouchi, S., and T. Beppu. 1985. Construction and applica-tion of a promoter-probe plasmid that allows chromogenicidentification in Streptomyces lividans. J. Bacteriol. 162:406-412.

16. Horinouchi, S., H. Suzuki, and T. Beppu. 1986. Nucleotidesequence of afsB, a pleiotropic gene involved in secondarymetabolism in Streptomyces coelicolor A3(2) and Streptomyceslividans. J. Bacteriol. 168:257-269.

17. Ijima, S., T. Uozumi, and T. Beppu. 1986. Molecular cloning ofThermusflavus malate dehydrogenase gene. Agric. Biol. Chem.50:589-592.

18. Katz, E., C. J. Thompson, and D. A. Hopwood. 1983. Cloningand expression of the tyrosinase gene from Streptomycesantibioticus in Streptomyces lividans. J. Gen. Microbiol.129:2703-2714.

19. Kobayashi, T., T. Uozumi, and T. Beppu. 1986. Cloning andcharacterization of the streptothricin-resistance gene whichencodes streptothricin acetyltransferase from Streptomyceslavendulae. J. Antibiot. 39:688-693.

20. Koide, Y., A. Nakamura, T. Uozumi, and T. Beppa. 1986.Molecular cloning of a cellulase gene from Bacillus subtilis and

J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/


its expression in Escherichia coli. Agric. Biol. Chem.50:233-237.

21. Lederberg, E. M., and S. N. Cohen. 1974. Transformation ofSalmonella typhimurium by plasmid deoxyribonucleic acid. J.Bacteriol. 119:1072-1074.

22. Malpartida, F., and D. A. Hopwood. 1984. Molecular cloning ofthe whole biosynthetic pathway of a Streptomyces antibioticand its expression in a heterologous host. Nature (London)309:462-464.

23. Matthews, B. W., D. H. Ohlendorf, W. F. Anderson, R. G.Fisher, and Y. Takeda. 1982. Cro repressor protein and itsinteraction with DNA. Cold Spring Harbor Symp. Quant. Biol.47:427-433.

24. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

25. McLaughlin, J. R., C. L. Murray, and J. C. Rabinowitz. 1981.Unique features in the ribosome binding site sequence of thegram-positive Staphylococcus aureus P-lactamase gene. J. Biol.Chem. 256:11283-11291.

26. Messing, J. 1983. New M13 vectors for cloning. MethodsEnzymol. 101:20-78.

27. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

28. Ohnuki, T., T. Imanaka, and S. Aiba. 1985. Self-cloning inStreptomyces griseus of an str gene cluster for streptomycinbiosynthesis and streptomycin resistance. J. Bacteriol. 164:85-94.

29. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

30. Sauer, R. T., R. R. Yocum, R. F. Doolittle, M. Lewis, and C. 0.Pabo. 1982. Homology among DNA-binding proteins suggests

use of a conserved super-secondary structure. Nature (London)298:447-451.

31. Tatti, K. M., and C. P. Moran, Jr. 1984. Promoter recognitionby sigma-37 RNA polymerase from Bacillus subtilis. J. Mol.Biol. 175:285-297.

32. Thompson, C. J., and G. S. Gray. 1983. Nucleotide sequence ofa streptomycete aminoglycoside phosphotransferase gene andits relationship to phosphotransferases encoded by resistanceplasmids. Proc. Natl. Acad. Sci. USA 80:5190-5194.

33. Thompson, C. J., T. Kieser, J. M. Ward, and D. A. Hopwood.1982. Physical analysis of antibiotic-resistance genes fromStreptomyces and their use in vector construction. Gene20:51-62.

34. Uchiyama, H., and B. Weisblum. 1985. N-Methyl transferase ofStreptomyces erythraeus that confers resistance to themacrolide-lincosamide-streptogramin B antibiotics: amino acidsequence and its homology to cognate R-factor enzymes frompathogenic bacilli and cocci. Gene 38:103-110.

35. Ward, J. M., G. R. Janssen, T. Kieser, M. J. Bibb, M. J.Buttner, and M. J. Bibb. 1986. Construction and characteriza-tion of a series of multi-copy promoter-probe plasmid vectorsfor Streptomyces using the aminoglycoside phosphotransferasegene from Tn5 as indicator. Mol. Gen. Genet. 203:468-478.

36. Westpheling, J., M. Ranes, and R. Losick. 1985. RNA polymer-ase heterogeneity in Streptomyces coelicolor. Nature (London)313:22-27.

37. Zalacain, M., A. Gonzhlez, M. C. Guerrero, R. J. Mattaliano, F.Malpartida, and A. Jimenez. 1986. Nucleotide sequence of thehygromycin B phosphotransferase gene from Streptomyceshygroscopicus. Nucleic Acids Res. 14:1565-1581.

38. Zoller, M. J., and M. Smith. 1983. Oligonucleotide-directedmutagenesis ofDNA fragments cloned into M13 vectors. Meth-ods Enzymol. 100:468-500.

VOL. 169, 1987


.org/D

ownloaded from

http://jb.asm.org/

nucleotide sequenceof the streptothricin acetyltransferase...

Documents