ocean automation solutions cmr cargo systems
DESCRIPTION
CMR Cargo solutionsTRANSCRIPT
![Page 1: Ocean Automation Solutions Cmr Cargo Systems](https://reader036.vdocuments.net/reader036/viewer/2022062409/55cf9680550346d0338be572/html5/thumbnails/1.jpg)
NA
C 1
33
8 -
Ø -
08
/0
8
CMR 900
Cargo
Engineered to uncompromising standards. Yours. www .cmr-group . com
CONTRÔLE MESURE REGULATION - 7 Rue John Maynard Keynes -BP 85 -13381 Marseille Cedex 13 - France -
Tel : 33 (0)4 91 11 37 00 - Fax : 33 (0)4 91 11 37 02 - Email : [email protected]
Merchant Marine
Head Offi ce Subsidiaries Main Representatives
CMR GROUPMr P. Fouache Technopôle de Château Gombert7, Rue John Maynard Keynes BP 8513381 Marseille Cedex 13 - FRANCETel : 33 (0)4 91 11 37 00 Fax : 33 (0)4 91 11 37 02Email :[email protected] : www.cmr-group.com
FRANCE - CMR SAS Mr P. Flot Technopôle de Château Gombert7, Rue John Maynard KeynesBP 8513381 Marseille Cedex 13 - FRANCETel : 33 (0)4 91 11 37 00 Fax : 33 (0)4 91 11 37 02Email :[email protected] : www.cmr-group.com
UNITED KINGDOM - CMR UKMr N. WilkinsonUnit 4, New York WayNew York Industrial ParkWallsend – Tyne & Wear – NE27 0QF - ENGLANDTel : 44 191 258 52 22 Fax : 44 191 257 39 75Email :[email protected] : www.cmr-uk. com
FAR EAST (ASIA) CMR FAR EAST PTE LTDMr K.H.Choo9 Tuas View Crescent - Singapore 637612Tel : 65 6266 8311 Fax : 65 6265 7443Email : [email protected] : www.cmrfe.comCMR PRODUCTS PTE LTDMr S. Goh9 Tuas View Crescent - Singapore 637612Tel : 65 6268 8311 Fax : 65 6862 2747Email : [email protected] Web : www.cmrfe.com
KOREA - CMR KOREAMr E.B.Kim#307, Borim Factopia 37-10, Kumsa-dongKumjung-ku – BUSAN - KOREATel : 82 51 521 28 83 Fax : 82 51 521 28 86Email : [email protected] : www.cmrkorea.com
;
NORTH AND CENTRAL AMERICACMR USA, LLCMr. J. Gatto129 McCarrell LaneZelienople PA 16063 - U.S.A.Tel : 1 724 452 2200 Fax : 1 724 452 2203Email : [email protected] : cmr-us.com
GERMANYCMR AUTRONIC GmbHMr L. Gautier Poppenbütteler Bogen 82 D-22399 HAMBURG - GERMANYTel : 49 40 4840 2331 Fax : 49 40 4840 2337Email : [email protected]: www.cmr-autronic.de
TUNISIA - CMR TUNISIAMr B. Dumas33 rue de la Chimie ZI SIDI REZIG 2033Tel : 216 71426978 Fax 216 71 42 97 93Email : [email protected]
CHINA CMR SUZHOU Electronic DevicesMr S. JiangWorkshop A5, No. 9 Weixin Road, Suzhou Industrial Park, China P.C. 215122Email : [email protected] Phone: +86-512-6289 0311Fax: +86-512-6289 0312
CMR PACIFICElectrical Equipment Co., LtdMr L. FoongNo.2, 1188 Nan Liu RoadNan Hui Disctrict, ShanghaiP.R. China 201322Mob : +86 137 0171 9813Tel : +86 21 6816 0287Fax : +86 21 6816 0293Res : +86 21 6819 7588Email:[email protected]
Worldwide contacts
Contacts CMR France
Industry - Energy - Navy
Engine Manufacturer
Service
Gérard Baldellou : [email protected] Pierre-Yves Le Goanvic : [email protected] Nicolas Vaucquelin : [email protected]
José Da Silva : [email protected] Roulier : [email protected]
Alain Meslati : [email protected] François Olivier : [email protected]
Laurent Serra : [email protected]
An innovative Integrated Alarm, Control and Monitoring System for a dedicated application : Yours.
Mar
ine
app
licat
ion
Head Offi ce SubsidiariesMain Representatives
Worldwide contacts
Engineered to uncompromising standards. Yours.www .cmr-group . com
CONTRÔLE MESURE REGULATION - 7 Rue John Maynard Keynes -
for aa ddeeeeeeddddddddiiiiiiiicccccccaaaaaaattttttteeeeeeeddddddd aaaaaaapppppppppliiccatiioonn :: em Yours.
![Page 2: Ocean Automation Solutions Cmr Cargo Systems](https://reader036.vdocuments.net/reader036/viewer/2022062409/55cf9680550346d0338be572/html5/thumbnails/2.jpg)
All CMR equipment and systems are fully type approved by Major Classification Socie-ties and we maintain numerous references with Ship owners, operators and shipyards. CMR facilities are strategically located to best serve the needs of Ship owners and Shi-pyards. These shore bases for our Field Ser-vice Teams are able to provide Your Vessel the assistance and the service you deserve on board.
Optional :Considering the specific requirements of your Vessel, CMR can ensure the integra-tion of the following subsystems within our IACMS :
- AUT-UMS Class notation acceptan-ce including Alarm Report Panels for Cabins and Mess room, Dead Man System and ‘En-gineer on duty’ Management. - Power Management System from A to Z including auto-synchronisation of the ge-nerators, shore connection management and anti black-out system. - Cargo Handling and Ballast Systems (Monitoring and/or Control) - Communication to VDR - Remote Alarm System thru Inmarsat or GSM systems such as Fleet Maintenance Softwares
An innovative Integrated Alarm, Control and Monitoring System for a dedicated applica-tion: Yours.
Standard Features :Integrated Alarm, Control and Monitoring System :
The CMR900 is reliable and competitive tech-nology under development the last 15 years, demonstrating experience on various cargo applications. CMR900 is the best compro-mise between last high-tech updates, value engineering and competent production.CMR ensures design, engineering, production and software development of this system. CMR is the first choice for turnkey supply of products and systems designed to your high-level expectations. CMR is prepared to mana-ge all aspects of system integration including our dedicated solutions for new construction or retrofit.
This IACMS will handle all the functions rela-ted to Alarm, Control and Monitoring for the following ship systems : - Main Engines - Propulsion and Steering Systems - Gas oil Tanks / Fresh Water Tanks / Black & Grey Water Tanks - Navigation and Ancillary Lighting - Bilge sensors and Flood Detection System - Air Conditioning and Fresh Water Plant Units
Some mimic pages :
•••