of a mutation in the initiator aug codon of the x cl gene

Copyright 0 1987 by the Genetics Society of America

Translational Polarity of a Mutation in the Initiator AUG Codon of the X c l Gene

Gary N. Gussin,’ Susan Brown and Karen Matz Department of Biology, University of Iowa, Iowa City, Iowa 52242

Manuscript received January 10, 1987 Accepted June 29, 1987

ABSTRACT A P-cI-lac2 fusion inserted into the 62 region of bacteriophage X was used to isolate mutations

affecting expression of both the X cI gene and the lac2 gene. One such mutation, a change in the CI initiator codon from AUG to AUA, reduces immunity of a X prophage to superinfection, and causes a 60-70% reduction in &galactosidase synthesis, even when repressor is supplied in trans. The effect of the mutation on lac2 gene expression is eliminated in a rho- bacterial strain, and the mutation has no effect on transcription initiated at P m in vitro. Therefore, the effects of the mutation are due to premature p-dependent termination of transcription in the absence of translation of the CI gene, as if the mutation were a nonsense polar mutation.

RANSLATIONAL polarity was first character- T ized in studies of the lac operon (NEWTON et al. 1965): nonsense mutations in the lac2 gene significantly reduced the expression of downstream genes (lacy and lacA). Subsequently, it was shown that polarity of nonsense mutations was suppressed by mutations in the rho gene (MORSE and PRIMAKOFF 1970; RATNER 1976). That is, when transcription termination factor p (ROBERTS 1969) is inactive, nonsense mutations in lac2 still terminate translation, but expression of lacy and lacA is normal. These phenomena are explained in the following way [see ADHYA and GOTTESMAN (1 978) for review]. Translation (ribosome movement) through p-dependent transcription termination signals in mRNA prevents p factor from acting. Since premature termination of translation at a nonsense codon exposes a region of untranslated mRNA, p factor gains access to the RNA with greater probabil- ity. Thus, transcription may be terminated at other- wise weak or inactive p-dependent termination sites.

Consistent with this model, inhibition of translation by other mechanisms also causes premature transcription termination, which in some cases produces a polar effect similar to that caused by nonsense mutations (MORSE 1970; BUSBY and DREYFUS 1983; STANSSENS, REMAUT and FIERS 1986). We report here that a (missense) mutation in the AUG initiation codon for the X c I gene is polar with respect to expression of a downstream gene (lac2) in an artificially constructed operon.

Normally, the X Pm promoter directs the synthesis of X repressor, which acts in two ways to maintain a X prophage: it binds at the right and left operators, OR and Or. to prevent expression of X lytic genes (PTASHNE

’ To whom communications should be addressed.

Genetics 117: 173-179 (October, 1987)

et al. 1976); and in binding to OR it activates P-, thereby stimulating its own synthesis (REICHARDT and KAISER 1971; EISEN, PEREIRA DA SILVA and JACOB 1968). In order to identify new prm- mutations, we isolated and characterized mutations affecting expression of both the cI (repressor) and lac2 genes in an “operon” under the control of PRM (MAURER, MEYER and PTASHNE 1980). Unexpectedly, one such mutation was found to change the AUG initiator codon for the CI gene to AUA. Because of the unusual location of this AUG codon at the 5’ terminus of CI mRNA (PTASHNE et al. 1976; see Figure l), the mutation could affect lac2 gene expression for either or both of the following reasons: (1) the alteration (at +3 with respect to the transcription startpoint) could cause a defect in P-; (2) failure to initiate translation of CI could be polar with respect to lac2 gene expres- sionjust as a nonsense mutation would be. Data presented here exclude the former possibility and support the latter.

MATERIALS AND METHODS Bacterial and phage strains: Mutations were isolated in

phage 112 (MAURER, MEYER and PTASHNE, 1980), a derivative of Ximm21 containing the fusion “operon” P-cI- (rexA’)-(trpB’)-trpA-lac2. The fusion is substituted for part of the X b 2 region. Because controlling regions for lac2 are deleted (MITCHELL, REZNIKOFF and BECKWITH 1975), synthesis of both repressor and 8-galactosidase is dependent on Pm. The parental phage, a derivative of 1 12 containing the mutation clam14 in the fusion operon, is designated 112::clam14. Bacterial strains: NK5031, an SuIII+ lac2 deletion strain (from N. KLECKNER); RV308, an Su-lac2 deletion strain (from R. MAURER) (see MAURER, MEYER and PTASHNE 1980); SA1030 (his-rpsL-relA-galP3rho+) and AD1600 (SA1030 rh015~‘) (DAs, COURT and ADHYA 1976) (from S. ADHYA and R. HABER).

Isolation of mutants: A 1 12::cIam14 was mutagenized by

174 G. N. Gussin, S. Brown and K. Matz

infection of the mutD bacterial strain KD1087 (DEGNEN and Cox 1974). On Macconkey lactose indicator plates, X112::cZam14 forms red plaques on NK5031; mutants defective in lacZ expression form colorless plaques. Lysogens of potential mutants were screened for the ability to synthe- size repressor by assaying for immunity to X in spot tests. To facilitate isolation of phage DNA, Sam7 derivatives of confirmed mutants were constructed by standard genetic methods.

DNA sequence determination: Mutant DNA sequences were determined using the method of MAXAM and GILBERT (1980). Sequences of both strands of the DNA in the region of PRM were determined. DNA fragments used were a 303- bp Hinfl-EcoRI fragment labeled at the EcoRI site and a 232-bp Fnu4HI-EcoRI fragment labeled at the Fnu4HI site. Radioactive label was incorporated by using DNA polymerase I (Klenow) to fill in the single-stranded “sticky ends” at each site. The EcoRI site is at the right-hand boundary (with respect to the genetic map) of the inserted fusion operon; it was derived from a modified Hue111 site in the X cro gene (MAURER, MEYER and PTASHNE 1980).

Measurements of PRM activity in vivo: The ability of mutant promoters to direct the synthesis of @-galactosidase was determined in either of two ways: by assaying lysogens of each mutant after several generations of exponential growth; by following the time course of 8-galactosidase synthesis after infection of RV308 or NK5031 at low moi (0.05-0.3) under conditions in which replication of the infecting mutant phage would be repressed (ROSEN and GUSSIN 1979). Enzyme assays were performed as described by MILLER (1 972); units of enzyme activity are presented in terms of the activity per lo9 cells in the first assay, or lo9 infecting phage in the second assay.

Transcription assays: Conditions for runoff transcription assays were those described previously (SHIH and GUSSIN 1984) except that the concentration of radioactive substrate, [a’*P]UTP, was 40 p~ rather than 20 p ~ . Transcripts were detected by autoradiography following electrophoresis on 5% acrylamide/7 M urea gels. Final concentrations of DNA and RNA polymerase (active enzyme) were 2 nM and 30 nM, respectively, except where indicated. For transcription in the presence of repressor, 0.26 ng of repressor, which fully activated PRM and repressed PR, was added to template DNA in a total volume of 10 pl and incubated for 10 min at 37 O for 10 min; RNA polymerase and transcription buffer were then added to bring the total volume to 20 pl. Follow- ing a second 1 O-min incubation, substrates and heparin were added, and transcription was allowed to proceed for 15 min. The final reaction volume was 25 pI. The template for in vitro transcription was a 678-bp HindIII-EcoR1 restriction fragment extending from the middle of the c l gene to a Hue111 site in the cro gene, which had been modified previously to an EcoRI site (MAURER, MEYER and PTASHNE 1980).

Materials: Escherichia coli RNA polymerase was isolated by the procedure of BURGESS and JENDRISAK (1975) with modifications of LOWE, HAGER and BURGESS (1979). En- zyme preparations were about 90-95% pure as judged by SDS-acrylamide gel electrophoresis and about 95% satu- rated with sigma subunit. Promoter titration assays (CECH and MCCLURE, 1980) indicated that purified RNA polymerase was about 50% active. A Repressor was a gift from R. T. SAUER. Enzymes used in DNA sequencing or fragment isolation were purchased from New England Biolabs, Inc. (Beverly, Massachusetts) or Bethesda Research Laboratories (Gaithersburg, Maryland), and used according to proce- dures outlined by the suppliers. Radioactive substrates for transcription or DNA sequence determination were purchased from Amersham/Searle Corp. (Chicago).

RESULTS

Isolation of the mutant KM3: Phage 112 contains the fusion “operon” Pu-cl-rexA ’ -trpB ‘ -trpA-lac2 inserted into the b2 region of Ximm2 1 (MAURER, MEYER and PTASHNE 1980). A derivative of this phage, A 1 12::cZam14, was mutagenized by infection of a MutD mutator strain (DEGNEN and COX 1974). Since the control elements for lac2 are deleted in the fusion (MITCHELL, REZNIKOFF and BECKWITH 1975), mutants with defects in Pm-directed gene expression should produce reduced levels of &galactosidase as well as repressor. One such mutant, KM3, formed colorless plaques on McConkey agar when plated on the lac2 deletion strain NK5031 and as a prophage yielded reduced immunity to X superinfection. In addition, it formed colorless plaques on NK503 1(X), which can supply repressor necessary to activate P m in trans. This test excludes c T missense mutants, which would fail to turn on Pm due to the absence of active repressor (EISEN, PEREIRA DA SILVA and JACOB 1968; REICHARDT and KAISER 1971; MEYER, KLEID and PTASHNE 1975). In addition, since NK5031 is SuIII’, clamber mutations should have no polar effect on lac2 expression.

T h e nucleotide sequence of both DNA strands of KM3 in the region of P R ~ was determined by the method of MAXAM and GILBERT (1980). T h e sequence alteration is a change in the c l initiator codon, from ATG to ATA (Figure 1). Because the initiator AUG is located at the 5’ terminus of CZ mRNA, the mutation is located at +3 relative to the Pm transcription startpoint; therefore, it conceivably could affect both transcription and translation of the c l gene.

Effect of the mutation on lac2 gene expression in vivo: P-directed &galactosidase synthesis was assayed by infecting RV308 (A, Ximm21) lysogens with the mutant fusion phage, A 1 12::cZaml4,KM3, at low multiplicities of infection. In these experiments, most cells are infected with only one phage, which is pre- vented from replicating by the Ximm2 1 prophage; Pm is activated by repressor supplied by the X prophage, Results of this assay are illustrated in Figure 2A. For each time point, enzyme levels in RV308 (Ximm21) lysogens were subtracted from those in RV308 (A, himm2 1) lysogens to reflect repressor-dependent synthesis. [Note that the amber mutation in c l is nonpolar with respect to lac2 (MAURER, MEYER and PTASHNE 1980), and therefore should not affect @-galactosidase levels in these experiments.]

As expected, the mutant KM3 produces less j3- galactosidase than the wild-type parent. However, the reduction in enzyme synthesis (to 30-40% of the wild- type level 120 min after infection) is not so great as that observed for prm- mutants (ROSEN and GUSSIN 1979). For comparison, typical data for prmE37 are presented in Figure 2B. This mutation sharply re-

Translational Polarity 175

K M 3

T I

prmup-1 I G -

A OR3 C OR2 OR1 I I 1 I r 1 I 1 I CATACGTTAAATCTATCACCGCAAGGGATAAAT~TCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATG

T A A T A T A C A G T T T T G A C A r A r A A r

GTATGCAATTTAGATAGTGGCGTTCCCTATTTATATAGATTGTGGCACGCACAACTGATAAAAT GAGACCGCCACTATTACCAACGTAC I ci

-60 I I I

- 4 5 I

-101 I - 2 0 - 3 0 I I C T T C PRM

G A A G I I I I GUAPPP

K M ~ I E 3 7 176 E104 FIGURE 1.-Nucleotide sequence of wild-type and mutant derivatives of P-. The sequence spans the region that includes both P- and

PR (PTASHNE et al. 1976); nucleotides are numbered relative to the PRM transcription startpoint. The 5' termini of cZ (P-) and cro (PR) mRNAs are indicated at the far left and far right, respectively. The mutation KM3 alters the AUG initiation codon for c l , which is located at the 5' terminus of the P- transcript (PTASHNE et al. 1976). The consensus sequences found at -10 and -35 in E. coli promoters (SIEBENLIST, SIMPSON and GILBERT 1980; HAWLEY and MCCLURE 1983) are indicated between the two DNA strands in the corresponding regions of PR and P-. Mutations in P- have been described previously (YEN and GussIN 1973; ROSEN et al. 1980; MEYER, MAURER and PTASHNE 1980; GUSSIN et al. 1987).

2000 4000

Time (mln) FIGURE 2.-Effects of mutations on PRM activity in vivo. RV308

(A, Ximm21) and RV308 (Ximm21) were infected by the phages indicated at low multiplicity of infection at 32" (see MATERIALS AND

METHODS). Repressor-dependent lacZ expression is obtained by subtracting data for infection of RV308 (Ximm2 1) from corresponding data for infection of RV308 (A, Ximm21). (A) Infecting phages are Ximm21::cZaml4 and Xzmm2lcIam14,KM3. Results of two independent experiments are averaged. Vertical lines indicate the range of the data at 120 min. (B) Infecting phages are A1 12::cI857prm+and XI 12cI857prmE37. Results of a single repre- sentative experiment are presented.

duces repressor and @-galactosidase synthesis in vivo (ROSEN and GUSSIN 1979) and reduces transcription from Pm in vitro about 10-fold (SHIH and GUSSIN 1983). In the experiment shown in Figure 2B, prmE37 reduces lac2 expression to about 5% of the wild-type level. (In Figure 2B, levels of lac2 expression are about twice as high as those in Figure 2A due to the fact that the infecting phage are able to make active repressor at 32 O , which apparently increases their ability to turn on Pm.)

Considering the relatively small effect of KM3 on lac2 expression in these infection assays (Figure 2A), it might seem surprising that the mutation could have been detected in a plaque color test. However, these experiments assay P-directed lac2 expression when repressor is provided in trans by a prophage. A some- what different result is obtained in assays of @-galac-

tosidase levels in lysogens of A1 12::cZam14 and A1 12::cZam14,KM3. In this case, repressor necessary to activate PRM can be provided only by the mutant prophage. Therefore, the host strain for these experiments was NK5031, which can suppress the amber mutation cZam14. In this assay, enzyme levels could be low in a mutant lysogen both because of a direct effect of the mutation on expression of the operon and because the amount of repressor available to activate PRM is low.

As Table 1 shows, in lysogens, the effects of KM3 and prmE37 on @-galactosidase synthesis are compa- rable-both mutations reduce enzyme levels to less than 5% of the wild-type level. Thus, in the absence of repressor supplied in trans, the effect of KM3 on l a d expression is about the same as the effect of the strong promoter mutation, prmE37. The difference between the results of the infection assays and the prophage assays suggests that the main (direct) effect of KM3 may be on translation of the CZ gene, rather than on transcription initiation at PM. In vitro transcription: To address this question, the

effect of KM3 on transcription initiation was investi- gated in vitro in the presence and absence of repressor (Figure 3). In these experiments, two P-specific transcripts appear in the autoradiogram of the wild- type reaction (Figure 3, lane 2). The upper band is a runoff transcript (48 1 bases long); the lower (fainter) band is a prematurely terminated transcript approximately 300 bases long. Both bands are significantly less intense or missing when repressor is absent (Fig- ure 3, band 1). [The latter transcript was the predom- inant product in earlier studies of P-directed transcription in vitro (MEYER, KLEID and PTASHNE 1975).] In addition to these bands, a band corresponding to the 115-base P R transcript is a major product in the absence of repressor, but not in its presence.

Figure 3 indicates that there is little or no difference between transcription initiated at wild-type Pm (lanes

176 G. N. Gussin. S. Brown and K. Matz

TABLE 1

In vim "~rements &galactosidase produced by wild-type and mutant derivatives of PN-

@-Galactosidase levels' (units/lOP cells)

Genotype of fusion operon' Expt. I EXPI. 2

1. clam14 (n = 3) 2 2 2 0 f 113 2197 f 281 2. clamI4.KM3 (n = 2) 3. c1857pm+ (n = 4) I377 f 132

60 f I (2.7%) 53 f 3 (2.4%) 1261 f 183

4. cl857pnnE37 (n = 2) 61 f I(4.8%) 54 f 5 (3.9%)

Exponentially dividing NK503 I lysogens were grown and assayed at 32" (lines 3 and 4) or 37°C (lines 1 and 2). 'Phage genotypesare X I 12::clam14, X I 12::clam14,KM3. X I 12~1857 and X I 12cl857pmE37. in lines 1-4, respectively.

Data are means f SD for n independent single lysogens (or f range for n = 2). with percentage of the wild-type level indicated in parentheses. Single lysogens were identified as described by Ram and W S I N (1979).

prm+ K M 3 E 37 - + - + - +

* PRM

'R

FIGURE 3.-Effects of mutations on Pw activity in uifro. A 678- bpHindlII-EcoRI DNA fragment (2 nM)and RNA polymerase were incubated in the presence (+) or absence (-) of repressor for IO min prior to the addition of NTPs and heparin (50 rg/ml). DNA templates were pm+ (lanes I and 2). K M 3 (lanes 3 and 4) and pnnE37 (lanes 5 and 6). Position of transcripts initiated at PR and P m are indicated. RNA polymerase concentration was 30 nM for reactions 1-4. and 50 nM for reactions 5 and 6. A prematurely terminated 300-base transcript initiated at Pw and designated Pm' shows up as a faint band in these experiments.

1 and 2) and that initiated at the K M 3 promoter (lanes 3 and 4) either in the presence or absence of repressor. For comparison, lanes 5 and 6 present results of a similar experiment, which illustrates the strong effect of pmE37 on transcription from P R M . Based on these results, we conclude that K M 3 does not affect PRM.

Effect of rho factor on ZmZ expression: If K M 3 does not alter P R M , how does it affect expression of lacz! In lysogen assays, failure to initiate translation indirectly affects transcription because of the inability to activate PRM. However, results of infection assays in which repressor is supplied in trans require a different explanation. In this case, failure to initiate translation of the cf gene appears to exert the same effect on expression of downstream genes as would a polar nonsense mutation. That is, failure to translate the cf message might permit premature termination of transcription in vivo, thereby reducing transcription of lac2 and other downstream genes. In this case, polarity should be relieved by a mutation in the gene specifying termination factor p (ROBERTS 1969; AD HYA and CO-ITESMAN 1978). To test this hypothesis, &galactosidase assays were

conducted after infection of rho- (temperature-sensitive) and rho+ strains lysogenic for Ximm21 and X at 32" and 42°C (Figure 4). At both temperatures, KM3 reduced &galactosidase levels to 40-50% of the wild- type level in the rho+ strain, but had virtually no effect on 8-galactosidase synthesis in the rho- strain. These results are consistent with the idea that the effect of K M 3 on lac2 gene expression is a polar effect that results from one or more pdependent termination signals located between PRM and lac2. Relief of polarity is seen at both 32" and 42" because p is partially defective in the mutant strain even at low temperature ( S . ADHYA, personal communication). Data in Figure 4 show that the rho- mutation has virtually no effect on the phenotype of an isogenic promoter mutant, p m K M 3 (GUSSIN et al. 1987).

DISCUSSION

Mutation of the initiator codon in the X cf gene from ATG to ATA not only affects expression of the cf gene itself, but also reduces expression of a downstream gene, lad?. T h e reduction in lac2 expression is due to translation polarity, which is reflected in a 2- to %fold reduction in &galactosidase synthesis after infection by A1 12::cfam 14.KM3 (Figures 2A and 4).


32 , rho15

L prmKM7l

32". rho+ 42",rhO+

30 60 90 120 30 60 90 120

Time (min) FIGURE 4.-Effect of rho15 on lacZ expression following infec-

tion by KM3 mutant phage. Cultures of SA1030 (rho+) and AD1600 (rhol5), lysogenic for Ximm21 and X were grown to mid-log phase at 32"C, and then infected at low moi at 32" or 42°C with the following phages: X 1 12::clam14, A 1 12::clam14,KM3 and A 1 12:: claml4prmKMll. Data were corrected by subtraction of data obtained after infection of himm21 lysogens of the same strains to obtain repressor-dependent @-galactosidase levels. Each figure pre- sents the average of data obtained in three independent experiments.

The polar effect of KM3 is completely suppressed in vivo by a mutation in the rho gene (Figure 4), indicat- ing that the mutation does not affect transcription initiation at P m .

According to current models for the role of ribo- somes in masking p-dependent transcription termination signals (ADHYA and GOTTESMAN 1978), inhibition of translation by any mechanism could produce a polar effect similar to that produced by nonsense mutations. For example, a polar effect was produced in the trp operon by the addition of the protein synthesis inhib- itor chloramphenicol (MORSE 1970). In addition, BUSBY and DREYFUS (1983) identified several galE translation initiation mutations that reduced lac2 gene expression in a galP-ga1E'-lacZ fusion operon similar to the P-fusion we used in the isolation of KM3. A change in the galE initiation codon from AUG to AUA reduced P-galactosidase levels approximately 2- fold. Presumably, the reduction in &galactosidase synthesis was due to translational polarity, but the possi- ble role of p factor was not explored. In a recent study, deletion of sequences in the region of the message upstream from the lac2 ribosome binding site (SHINE and DALGARNO 1974) reduced transcription

and translation of ZacZ in vivo (STANSSENS, REMANT and FIERS 1986). Since the effect on transcription was mitigated to some extent by X N protein, an antagonist to p factor (FRIEDMAN and GOTTESMAN 1983), it was proposed that the deletions affected ribosome loading and translation initiation, which thereby permitted transcription termination at a putative p-dependent terminator in l a d .

The polar effect we observe indicates that normal translation of the c l gene blocks the action of p at a transcription terminator located between the altered AUG codon and the next translation initiation site (in the rexA gene) in the polycistronic mRNA. That is, the transcription termination signal must be within the cZ gene. We and others (MEYER, KLEID and PTASHNE 1975) have observed that Pm transcription is prematurely terminated in vitro approximately 300 nucleotides following the transcription startpoint (Fig- ure 3). Termination in this region yields a transcript coding for repressor's N-terminal domain. However, the fact that termination is observed at this site in the absence of p in vitro suggests that it is probably not a p-dependent termination site in vivo.

Since KM3 is a mutation at +3 relative to the Pm transcription startpoint, it could have affected transcription as well as translation of cl. However, in vitro transcription experiments indicate that initiation of transcription at P m is not affected by the mutation. This observation is in agreement with the fact that the effect of the mutation on lac2 expression in vivo can be suppressed completely by a mutation in the rho gene. Thus, the mutation does not directly affect Pm.

Although cross-linking experiments revealed a pos- sible contact between the f i subunit of RNA polymerase holoenzyme and a T at +3 in the LacUV5 promoter (SIMPSON 1979), formation of a cross-link does not prove that a specific nucleotide is required for promoter function. Furthermore, there is no evidence for a preferred nucleotide at +3 in E. coli promoters (HAWLEY and MCCLURE 1983). The properties of KM3 provide further evidence that there is little or no nucleotide specificity at this site.

Since we have not determined the DNA sequence of the entire (7 kb) fusion operon in X112:: clam 14,KM3, we cannot rigorously exclude the possibility that reduced expression of lacZ results from an additional mutation that creates a new p-dependent terminator elsewhere in the operon. However, this possibility seems unlikely for two reasons. First, the overall frequency of mutants forming colorless plaques in these experiments was about 1 in 100; thus, the isolation of a double mutant is improbable. Sec- ond, restriction enzyme digests of the mutant phage DNA are identical to those of parental. DNA; this indicates that a p-dependent termination signal has

178 G. N. Gussin, S. Brown and K. Matz

not arisen due to insertion of a transposon or IS element.

A comparison of the levels of P-galactosidase produced in the infection and lysogen assays (Figure 2 and Table 1) suggests that KM3 has roughly a 1 0-fold effect on translation initiation, coupled with a 2- to 3- fold effect on EacZ expression due to polarity. Because of the requirement for repressor in the activation of Pa, this estimate is necessarily imprecise. A better estimate could be obtained with a cl-lac2 protein fusion with repressor supplied in trans to activate PRM. We are now in the process of constructing such a fusion. Lack of an upstream ribosome binding site (SHINE and DALGARNO 1974) in Pa-initiated c l mRNA makes it an inefficient messenger (PTASHNE et al. 1976). In mRNAs that contain upstream SHINE- DALGARNO sequences, changes from AUG to AUA significantly reduce, but do not always abolish translation (GOLD et al. 1981). The efficiency of initiation has been measured directly only for an AUG-to-AUA mutation in the T 4 rIIB gene (BELIN et al. 1979). In that case, translation was temperature-sensitive. At 25”, 10-15% of the wild-type level of rIIB protein was synthesized, while at 36”, no rIIB protein synthesis was detectable. In a rho+ strain (Figure 4), we observed no significant difference in relative P-galactosidase levels at 32 O and 42 ” . However, this is only an indirect measure of initiation, which could be con- founded by effects of temperature on other processes including transcription initiation and/or termination.

During infection of a sensitive cell by wild-type A, high levels of repressor are produced under the direc- tion of the P R E promoter, located 402 nucleotides upstream from P a (WULFF and ROSENBERG 1983); the P R E transcript contains a normal SHINE-DALGARNO sequence (PTASHNE et al. 1976). Conceivably, the effects of mutations in the initiator AUG on translation of the Pa-initiated c l mRNA are different than the effects that would be observed with mRNAs that do contain a SHINE-DALGARNO sequence. P R M and P R E

provide an opportunity to investigate these differ- ences.

We thank JULIE FERM for technical assistance, JEN-JEN HWANG for RNA polymerase, and SANKAR ADYHA for bacterial strains and helpful discussion. This work was supported in part by NIAID grant AI 17508.

LITERATURE CITED

ADHYA, S. and M. GOTTESMAN, 1978 Control of transcription termination. Annu. Rev. Biochem. 47: 967-996.

BELIN, D., J. HEDGPETH, G. B. SELZER and R. H. EPSTEIN, 1979 Temperature-sensitive mutation in the initiation codon of the rIIB gene of bacteriophage T4. Proc. Natl. Acad. Sci. USA 7 6 700-704.

A procedure for the rapid, large scale purification of E. coli DNA-dependent RNA polymerase involving polymin P precipitation and DNA-cellu- lose chromatography. Biochemistry 14: 2440-2447.

BURGESS, R. R. and J. J. JENDRISAK, 1975

BUSBY, S. and M. DREYFUS, 1983 Segment-specific mutagenesis of the regulatory region in the Escherichia coli galactose operon: isolation of mutations reducing the initiation of transcription and translation. Gene 21: 121-131.

CECH, C. L. and W. R. MCCLURE, 1980 Characterization of RNA polymerase-T7 promoter binary complexes. Biochemistry 19:

Isolation and characterization of conditional lethal mutants of Escherichia coli defective in transcription termination factor rho. Proc. Natl. Acad. Sci.

Conditional mutator gene in Escherichia coli: Isolation, mapping, and effector studies. J. Bacteriol. 117: 477-487.

Sur la rkgu- lation prkcoce du bactbriophage A. C. R. Acad. Sci. Ser. D 266

Lytic mode of lambda development. pp. 21-51. In: Lambda II, Edited by R. W. HENDRIX, J. W. ROBERTS, F. W. STAHL and R. A. WEISBERG. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

GOLD, L., D. PRIBNOW, T. SCHNEIDER, S. SHINEDLING, B. S. SINGER and G. STORMO, 198 1 Translational initiation in prokaryotes. Annu. Rev. Microbiol. 3 5 365-403.

GUSSIN, G. N., J.-J. HWANG, S. BROWN, J. FERM and K. MATZ, 1987 Effects of mutations in the PM promoter on expression of the GI gene of bacteriophage lambda. Gene 54: 291-297.

Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11: 2237-2255.

Purification and properties of the U subunit of E. coli DNA-dependent RNA polymerase. Biochemistry 18: 1344-1352.

Gene regulation at the right operator (OR) of phage X. I. 083 and autogenous negative control by repressor. J. Mol. Biol. 139: 147-161.

Sequencing end-labeled DNA with base-specific chemical cleavage. Methods Enzymol. 65:

X Repressor turns off transcription of its own gene. Proc. Natl. Acad. Sci.

Gene regulation at the right operator (0,) of phage A. 11. OR1, OR2, and OR3: Their roles in mediating effects of repressor and cro. J. Mol. Biol. 139 195-205.

MILLER, J. H., 1972 Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

MITCHELL, D. H., W. S. REZNIKOFF and J. R. BECKWITH, 1975 Genetic fusions defining trp and lac operon regulatory elements. J. Mol. Biol. 93: 331-350.

“Delayed-early” mRNA for the tryptophan operon? An effect of chloramphenicol. Cold Spring Harbor Symp. Quant. Biol. 35: 495-496.

MORSE, D. E. and P. PRIMAKOFF, 1970 Relief of polarity in E. coli by “SUA.” Nature 226: 28-3 1 .

NEWTON, A., J. BECKWITH, D. ZIPSER and S. BRENNER, 1965 Nonsense mutants and polarity in the lac operon. J. Mol. Biol. 14: 290-296.

PTASHNE, M., K. BACKMAN, M. Z. HUMAYUN, A. JEFFREY, R. MAURER, B. MEYER and R. T. SAUER, 1976 Autoregulation and function of a repressor in bacteriophage lambda. Science 199: 156-161.

RATNER, D., 1976 The rho gene of E. coli maps at SUA. pp. 645- 656. In: RNA Polymerase, Edited by R. LOSICK and M. CHAM- BERLIN. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

Control of A repressor

2440-2447. DAS, A., D. COURT and S. ADHYA, 1976

USA 73: 1959-1963. DEGNEN, G. E. and E. C. Cox, 1974

EISEN, H., L. PEREIRA DA SILVA and F. JACOB, 1968

1176-1 178. FRIEDMAN, D. I. and M. GOTTESMAN, 1983

HAWLEY, D. K. and W. R. MCCLURE, 1983

LOWE, P. A., D. A. HAGER and R. R. BURGESS, 1979

MAURER, R., B. J. MEYER and M. PTASHNE, 1980

MAXAM, A. and W. GILBERT, 1980

499-560. MEYER, B. J., D. G. KLEID and M. PTASHNE, 1975

USA 72: 4785-4789. MEYER, B. J., R. MAURER and M. PTASHNE, 1980

MORSE, D. E., 1970

REICHARDT, L. and A. D. KAISER, 1971


synthesis. Proc. Natl. Acad. Sci. USA 6 8 2185-2189. Termination factor for RNA synthesis.

Nature 224 1 168-1 17 1 . Clustering of Prm- muta-

tions of bacteriophage X in the region between 33 and 40 nucleotides from the cI transcription startpoint. Virology 98:

ROSEN, E. D., J. L. HARTLEY, K. MATZ, B. P. NICHOLS, K. M. YOUNG, J. E. DONELSON and G. N. GUSSIN, 1980 DNA sequence analysis of pm- mutations of coliphage lambda. Gene

Mutations affecting two different steps in transcription initiation at the phage X P- promoter. Proc. Natl. Acad. Sci. USA 80: 496-500.

Role of cII protein in stimulating transcription initiation at the X P R E promoter. J. Mol. Biol. 172: 489-506.

SHINE, J. and L. DALGARNO, 1974 The 3'-terminal sequence of

ROBERTS, J. W., 1969

ROSEN, E. D. and G. N. GUSSIN, 1979

393-410.

11: 197-205. SHIH, M.-C. and G. N. GUSSIN, 1983

SHIH, M.-C. and G. N. GUSSIN, 1984

Escherichia coli 16s ribosomal RNA: Complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA 71: 1342-1346.

SIEBENLIST, U., R. B. SIMPSON and W. GILBERT, 1980 E. coli RNA polymerase interacts homologously with two different promoters. Cell 2 0 269-28 1 .

SIMPSON, R. B., 1979 The molecular topography of RNA polymerase-promoter interaction. Cell 1 8 277-285.

STANSSENS, P., E. REMAUT and W. FIERS, 1986 Inefficient translation initiation causes premature transcription termination in the lac2 gene. Cell 4 4 7 1 1-7 18.

WULFF, D. L. and M. ROSENBERG, 1983 Establishment of repressor synthesis. pp. 53-73. In: Lambda I I , Edited by R. W. HENDRIX, J. W. ROBERTS, F. W. STAHL and R. A. WEISBERG. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

YEN, K-M. and G. N. GUSSIN, 1973 Genetic characterization of a prm- mutant of bacteriophage A. Virology 5 6 300-3 12.

Communicating editor: J. ROTH

of a mutation in the initiator aug codon of the x cl gene

Documents