omega-3 fatty acids and zinc in neuronal cell homeostasis...
TRANSCRIPT
Omega-3 Fatty Acids and Zinc in Neuronal Cell
Homeostasis and Survival
by
Vidanelage Damitha de Mel Biological Science (Hons)
Submitted in fulfilment of the requirements for the degree of
Doctor of Philosophy
Deakin University
December, 2014
In memory of Auguste Deter and Millions others…
Table of Contents
Abstract i
Acknowledgements v
A list of publications during the course of candidature viii
Abbreviations ix
CHAPTER 1: LITERATURE REVIEW
1.1 Omega -3 (ω-3) Fatty Acids …………………………………………………………………………... 1
1.2 Docosahexenoic acid (DHA) …………………………………………………………………………... 4
1.3 Zinc and life 6
1.3.1 Zinc 6
1.3.2 Zinc in the brain 8
1.3.3 Alterations of zinc metabolism 9
1.4 Zinc transporters …………………………………………………………………………………………………. 10
1.4.1 SLC30 (ZnT) family 12
1.4.2 SLC39 (ZIP) family 15
1.5 Alzheimer’s disease (AD) ………………………………………………………………………………….…. 17
1.5.1 History and pathology of AD 17
1.5.2 The future of Alzheimer’s disease 18
1.5.3 Predicted mechanisms for AD 19
1.5.4 Omega-3 FA and AD 20
1.5.5 Zinc and AD 20
1.5.6 Hypothesis of the study 24
1.5.7 Aims of the study 24
1.5.8 Project outline 25
1.5.9 Significance of the study 26
CHAPTER 2: DHA effect on zinc transporters and cell survival 28
2.1 Introduction ………………………………………………………………………………………………… 28
2.1.1 DHA effect on zinc transporters and cell survival 28
2.2 Materials and Methods ………………………………………………………………………………………… 31
2.2.1 Cell culture and treatments 31
2.2.1.1 Cell line and cell culture 31
2.2.1.2 Omega-3 fatty acid (DHA) and zinc treatments 34
2.2.1.3 Harvesting of cells 38
2.2.2 Quantification of zinc transporter gene levels 38
2.2.2.1 Total RNA isolation 38
2.2.2.2 cDNA synthesis 40
2.2.2.3 Quantitative PCR (QPCR) 40
2.2.3 Quantification of zinc transporter protein levels 43
2.2.3.1 Total protein isolation 43
2.2.3.2 Total protein quantification 43
2.2.4 Gel electrophoresis of proteins 44
2.2.4.1 Preparing the gels 44
2.2.4.2 Protein loading 45
2.2.4.3 Nitrocellulose membrane transfer 47
2.2.4.4 Membrane protein detection 47
2.3 Results …………………………………………………………………………………………………………….. 50
2.3.1 Zinc transporters and their expression pattern in neuronal cells 50
2.3.1.1 Basal zinc transporter levels in human neuronal cells 50
2.3.1.2 Relative zinc transporter levels in human cell lines 50
2.3.2 Effects of DHA and zinc on zinc transporter expression levels 51
2.3.2.1 hZnT1 55
2.3.2.2 hZnT2 56
2.3.2.3 hZnT3 60
2.3.2.4 hZnT4 and hZnT5 61
2.3.2.5 hZnT6 65
2.3.2.6 hZnT7 65
2.3.2.7 hZIP1 69
2.3.2.8 hZIP2 69
2.3.2.9 hZIP3 and hZIP4 72
2.3.3 DHA effect on cell survival 76
2.3.4 Effects of DHA on ZnT3 protein levels 80
2.3.4.1 ZnT3 protein expression levels in M17 cells following
DHA treatments 80
2.3.4.2 ZnT3 protein expression levels in SY5Y cells following
DHA treatments 82
2.3.4.3 ZnT3 protein expression levels in HaCaT cells following
DHA treatments 82
2.3.4.4 ZnT3 protein expression levels in NT2 cells following
DHA treatments 85
2.3.5 DHA effect with and without vitamin E on the ZnT3 transporter 87
2.3.5.1 Vitamin E working concentration 87
2.3.5.2 ZnT3 mRNA expression levels with DHA and vitamin E 87
2.3.5.3 ZnT3 protein levels with DHA and vitamin E 91
2.4 Discussion ..………..……………………………………………………………………………………………... 93
2.4.1 Effects of DHA and zinc on zinc transporter expression levels 94
2.4.1.1 hZnT1 94
2.4.1.2 hZnT2 96
2.4.1.3 hZnT3 97
2.4.1.4 hZnT4 99
2.4.1.5 hZnT6 100
2.4.1.6 hZnT5 and hZnT7 101
2.4.1.7 hZip 1-4 101
2.4.2 Effects of DHA and zinc on neuronal cell survival 103
2.4.3 Vitamin E and DHA effect on ZnT3 expression level 104
CHAPTER 3: DHA effect on zinc fluxes and labile zinc levels 106
3.1 Introduction ……………………………………………………………………………………………………….. 106
3.1.1 DHA effect on zinc fluxes 106
3.1.2 DHA and Zinc 108
3.1.3 Zinc Fluorophores 108
3.2 Materials and Methods ………………………………………………………………………………………. 111
3.2.1 Cell culture 111
3.2.2 Compatibility study of four different zinc fluorophores 111
3.2.3 DHA effect on zinc fluxes across the cell membrane 112
3.2.4 LA effect on zinc fluxes across the cell membrane 113
3.2.5 DHA treatment - timepoint study 114
3.2.6 Serum starvation study with DHA enrichment 114
3.3 Results ………………………………………………………………………………………………………………… 116
3.3.1 Compatibility study of four different zinc fluorophores 116
3.3.2 DHA effect on zinc fluxes across the cell membrane 117
3.3.3 LA effect on zinc fluxes across the cell membrane 121
3.3.4 DHA treatment - timepoint study 122
3.3.5 Serum starvation study with DHA enrichment 126
3.3.6 DHA effects on zinc fluxes across the cell membrane in NT2 cells 127
3.3.7 LA effect on zinc fluxes across the cell membrane in NT2 cells 129
3.3.8 DHA treatment - timepoint study with NT2 cells 131
3.3.9 DHA and Serum starvation study with NT2 cells 132
3.4 Discussion .…………………………………………………………………………………………………………. 137
3.4.1 Compatibility study of four different zinc fluorophores 138
3.4.2 DHA effect on zinc fluxes across the cell membrane 139
3.4.3 LA effect on zinc fluxes across the cell membrane 140
3.4.4 DHA treatment - timepoint study 142
3.4.5 Serum starvation study with DHA enrichment 143
3.4.6 Conclusion 144
CHAPTER 4: Differentiation of human cells into more primary neuronal type cells 146
4.1 Introduction ……………………………………………………………………………………………………….. 146
4.1.1 Cell culture models in neuro-research 146
4.1.2 Differentiation agents 148
4.1.3 Traditional culture system versus 3D system 149
4.1.4 Outline of the study 151
4.2 Materials and Methods ………………………………………………………………………………………. 152
4.2.1 Cell culture 152
4.2.2 M17 cell differentiation using a conventional 2D cell culture system 153
4.2.3 M17 cell differentiation using 3D culture system 153
4.2.4 Modified 3D culture system for differentiation 154
4.2.5 Protein isolation and Western blot analysis 156
4.2.6 Immunocytochemistry experiments 157
4.3 Results ………………………………………………………………………………………………………………. 159
4.3.1 M17 cells are resistant to RA in a conventional 2D cell culture system 159
4.3.2 M17 cells acquire expression of neuronal markers when cultured in the
presence of RA in a 3D cell culture system 163
4.3.2.1 Immunocytochemistry results revealed a clear difference
between 2D and 3D culture systems 163
4.3.2.2 Analysis of protein expression levels in RA treated M17
cells using a 3D culture system 166
4.3.3 Modified 3D culture method with reduced differentiation time 170
4.3.3.1 Filter Method 171
4.3.3.1.1 M17 Cells 171
4.3.3.1.2 SY5Y Cells 172
4.3.3.1.3 NT2 Cells 173
4.3.3.2 Suspension Filter Method 175
4.3.3.2.1 M17 Cells 175
4.3.3.2.2 SY5Y Cells 176
4.3.3.2.3 NT2 Cells 177
4.3.3.3 Suspension Flask Method 179
4.3.3.3.1 M17 Cells 179
4.3.3.3.2 SY5Y Cells 180
4.3.3.3.3 NT2 Cells 180
4.3.4 Analysis of protein expression levels in RA treated cells using
the modified 3D culture systems 183
4.4 Discussion ……………………………………………………………………………………………………………… 190
4.4.1 M17 cells are resistant to RA in a conventional 2D cell culture system 190
4.4.2 M17 cells acquire expression of neuronal markers when cultured
in the presence of RA in a 3D cell culture system 192
4.4.3 Modified 3D culture methods 195
4.4.4 Conclusion 197
CHAPTER 5: GENERAL DISCUSSION 199
5.1 DHA effect on neuronal cell survival and zinc homeostasis …………………………………. 201
5.1.1 DHA effect on apoptosis levels 201
5.1.2 DHA and zinc transporter levels 201
5.1.3 DHA and free zinc availability 202
5.2 Cellular differentiation …………………………………………………………………………………………. 204
5.2.1 Differentiating M17 cells 206
5.2.2 Novel differentiation method 207
5.3 Limitations of the present study ………………………………………………………………………….. 208
5.4 Future Directions …..…………………………………………………………………………………………….. 209
5.5 Significance of the current findings ….…………………………………………………………………… 211
5.6 Conclusion ……………………………………………………………………………………………………………. 213
CHAPTER 6: Bibliography 215
i
Abstract
Omega-3 fatty acids are one of the two main families of long chain polyunsaturated
fatty acids. Polyunsaturated fatty acids are in general considered to be one of the
most essential nutrients for humans. The human body is not capable of synthesizing
omega-3 or omega-6 fatty acids efficiently. Thus, it must be obtained through diet or
supplementation. The main omega-3 fatty acids in the mammalian body are α-
linolenic acid (ALA), docosahexenoic acid (DHA) and eicosapentaenoic acid (EPA).
Central nervous tissues of vertebrates are characterized by high concentration of
omega-3 fatty acids. Moreover, in the human brain, DHA is considered as the main
structural omega-3 fatty acid, which comprises about 40% of the PUFAs in total. DHA
deficiency is related with many disorders such as depression, inability to concentrate,
excessive mood swings, anxiety, cardiovascular disease, type 2 diabetes, dry skin and
so on. Animal model studies have shown a link between omega-3 rich diet and the
neuronal cell survival. Like DHA, zinc is the most abundant trace metal in the human
brain. There are much scientific evidence linking zinc, especially excess amounts of
free zinc, to cellular death. Neurodegenerative diseases such as Alzheimer’s disease
is characterised by the altered zinc metabolism. Studies conducted with rats have
shown increased expression of ZnT3 zinc transporter levels and increased
hippocampal levels of zinc when treated with a DHA deficient diet.
ii
Therefore, this study was designed to explore the concept of “Omega-3 fatty acids
and zinc in neuronal cell homeostasis and survival” in a holistic context. The main
focus of the research was to investigate possible link between zinc, DHA, apoptosis
and cell survival. The research also investigates many aspects of “omega-3 fatty acids
and its benefits at the cellular level”. The project attempts to gauge omega-3 effects
on neurodegenerative conditions such as Alzheimer’s disease. This study describes
various factors which are responsible for neurodegeneration and a possible link
between free zinc availability at the cellular level to neurodegeneration. To elucidate
the link between DHA, zinc and brain cell death, we cultured human neuronal M17,
SY5Y and NT2 cells in DHA-deficient or DHA-enriched culture medium. Exposure of
cells to DHA-deficient medium reduced the levels of active caspase-3 and increased
the levels of Bcl-2, relative to levels in DHA treated cells, confirming the adverse
effects of DHA deficiency in promoting neuronal cell death. To investigate the role of
zinc in DHA-induced apoptotic cell death, we grew cells in DHA-deficient and DHA-
enriched culture medium and measured zinc uptake using zinc fluorophores. In DHA
treated cells, zinc fluorescence signalling was almost invisible compared to the strong
fluorescence labelling which could be seen with the DHA deficient cells. Furthermore,
in DHA-treated cells, ZnT3 mRNA and protein levels were significantly down-
regulated compared to levels in DHA-deficient cells. Previous studies have shown
free zinc can mediate brain cell death through apoptosis. In conclusion, observations
reported by this this study suggests that DHA acts as a neuro-protective compound
trough a reduction in free cellular zinc levels that in turn protect cells from apoptosis.
iii
Despite the increasing demand, neuroscience research is limited due to the high cost
associated with the research and lack of a suitable in vitro model that can mimic the
structural and functional characteristics of human mature neurons. Many research
uses cheaper and readily available substitutes such as animal models or rodent
neurons or other different immortalized human cells such as neuroblastoma cells.
Though, these alternatives have been widely used in common practice, the
resemblance to the actual physiological conditions can vary substantially. Second
component of this study was to address this issue and was focused in developing a
better human cell culture model for neurobiology research. Human neuroblastoma
cell lines M17 and SY5Y, along with human tetra carcinoma cell line NT2, were used
in this study and differentiated using retinoic acid. Past studies have shown that M17
cells are resistant to retinoic acid and continued to proliferate under the normal
conditions when treated with retinoic acid. However, during this study, cells were
grown on a 3D structure instead of the conventional 2D method and then treated
with retinoic acid. With the combination of these improved methods, we managed
to differentiate all the three cell lines and cellular differentiation was tested with
neuronal specific markers using immunocytochemistry and Western blotting
techniques.
In conclusion, the current study provides two key significant contributions towards
the advancement of neuroscience research. Firstly by elucidating a possible link
between free zinc availability, DHA levels and apoptosis, thus suggesting a possible
neuroprotective pathway following DHA treatment at the cellular level. Secondly
iv
thist study was able to develop a better cell culture model to generate terminally
differentiated neuronal cells. The current method provides an economical, effective
and simple method of differentiating neuronally committed cells into primary
neuronal cells.
v
Acknowledgements
First and foremost, I would like to thank my supervisor Associate Professor Cenk
Suphioglu. It was a great pleasure and honour to be one of your very first Honours
students at Deakin and then go on to complete my PhD. Thank you for all the
knowledge you have passed on and your guidance over the years. Most of all thank
you for always believing in me and letting me complete my PhD journey and giving
me the strength and the support when I needed it most. Without your unconditional
care and support over the years, pursuing my career goal wouldn’t have been
possible.
To Professor Leigh Ackland,, for sharing your specialised knowledge in the field, for
guiding and helping me to design this project and many of the experiments, and for
giving me the opportunity to work with you for many years.
To Dr Agnes Michalczyk, for your outstanding knowledge and expertise in many
different techniques and fields, and for the solutions you have provided for my
project.
Thank you to Dr. Phil Taylor and Dr. Sarah Shigdar for sharing your outstanding
confocal knowledge with me and Thank you to Professor Wei Duan for allowing me
to use your Chemidoc.
vi
To the most wonderful scientists I have worked with so far, the NARL team. You guys
were a breath of fresh air to me. The warmness and support you all have shown me
from day one was immense and truly appreciated. Special thanks to Pathum, Nayyar,
Chamika, Justin and Lauren for simply being awesome.
To all my dear friends outside the lab, too many to name. Over the years you have
been there for me and made my journey more enjoyable and easy. Especially, Bope,
Prabhath, Charaka, Malinda, Nishantha and Sancha. Not forgetting my science
buddies Arash and Damon. We got to know each other at Deakin, and ten years later
we still share the same passion and interests. Thank you for all the memories at CCMB
and beyond.
To my dearest two brothers, darling sister (in-law), Junior & Hinnie. Thank you for
being such a wonderful family and the never-ceasing love and support you have all
given me.
To my second set of parents, Uncle and Aunty. Thank you for all the love and care
you have given to me. For your encouragement and strength over the past few years.
To the newest and the most precious addition to my life. My dear little princess,
Venya. I would like to dedicate this thesis to you, as an inspiration for you to achieve
your life goals despite all the hardships and difficulties you may come across. Always
remember to get up one more time than you fall.
vii
To my Darling wife, Vinali. Thank you for being part of my life. Without you this
journey wouldn’t have been possible. Thank you for all your tireless efforts in proof
reading and correcting my mistakes. Above everything for your love, care and for
being the strength behind me to complete my PhD journey.
Last but not least, to my dear parents. Without your hard work I wouldn’t be here.
Thank you very much for all the sacrifices you have made to make our lives better.
Thanks for giving us the best and for encouraging me to achieve the highest in my
life. Thanks for igniting the passion and the dream to pursue a PhD and for making
sure that I get there. I know both of you are proud of what I have achieved.
Thank You!
viii
A list of publications during the course of candidature
Suphioglu, Cenk, De Mel, Damitha, Kumar, Loveleen, Sadli, Nadia, Freestone, David,
Michalczyk, Agnes, Sinclair, Andrew and Ackland, M. Leigh (2010) The omega-3 fatty
acid, DHA, decreases neuronal cell death in association with altered zinc transport,
FEBS letters, vol. 584, no. 3, pp. 612-618.
De Mel, Damitha, and Suphioglu, Cenk. “Fishy Business: Effect of Omega-3 Fatty Acids
on Zinc Transporters and Free Zinc Availability in Human Neuronal Cells.” Nutrients
6.8 (2014): 3245–3258. PMC. Web. 18 Dec. 2014.
ix
Abbreviations
2D 2 Dimensional
3D 3 Dimensional
ABC ATP-binding cassette
Aβ Amyloid beta
AD Alzheimer’s disease
ALS Amyotrophic lateral sclerosis
APP Amyloid precursor protein
APS ammonium persulphate
ARA Arachidonic acid
BDNF Brain-derived neurotrophic factor
βME beta- mercaptoethanol
CaEDTA Edetate calcium disodium
CDF Cation diffusion facilitator
cDNA Complementary deoxyribonucleic acid
CNS Central nervous system
DCT1 Divalent cation transporter1
DHA Docosahexenoic acid
dATP deoxyadenosine Triphosphate
dH20 distilled H20
DMEM Dulbecco’s Modified Eagle’s Medium
DNA Deoxyribonucleic acid
dNTP deoxythymidine triphosphate
ECM Extracellular matrix
EDTA Ethylenediaminetetraacetic Acid
EPA Eicosapentaenoic acid
FA Fatty acid
FBS Fetal bovine serum
G Gauge
x
g Gravity
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
HCl Hydrochloric Acid
HRP Horseradish-peroxidase
IR Infrared
IGF Insulin like growth factors
IRT1 Iron-regulated transporter 1
LA Linoleic acid
LTB4 Leukotriene B4
mRNA Messenger ribonucleic acid
milliQ ultrapure water
NGF Nerve growth factor
Opti-MEM Modified Eagle's Minimal Essential Medium
PAGE Polyacrylamide gel electrophoresis
PBS Phosphate-Buffered saline
PCR Polymerase chain reaction
PUFA Polyunsaturated fatty acid
QPCR Quantitative PCR
RA Retinoic acid
RNA Ribonucleic acid
RNase Ribonuclease
ROS Reactive oxygen species
RPMI Roswell Park Memorial Institute Medium
SDS Sodium Dodecyl Sulphate
SLC Solute Linked Carrier
ST Staurosporine
TBS Tris Buffered Saline
TBST Tris Buffered Saline with 0.1% (v/v) Tween 20
TEMED - N,N,N’ Tetramethylethylenediamine
TNF Tumour necrosis factor
TPA 12-O-tetradecanolyphorbol-13-acetate
xi
TXA2 Thromboxane A2
UV Ultraviolet
V Volts
ZIP Zinc-regulated transporters, Iron-regulated transporter-like
proteins
ZnT Zinc transporter
Chapter 1: Literature Review
1 | P a g e
CHAPTER 1: Literature Review
1.1 Omega -3 (ω-3) Fatty Acids
Fatty acids (FAs) in general are naturally occurring molecules consisting of a
hydrocarbon chain of varying length, with a carboxyl group (COOH) and a methyl
(CH3) group at either end. Fatty acids are classified according to the number of
carbon atoms and the number and the type of bond between the carbons. Saturated
FAs only have single bonds between carbon-carbon atoms, which are fully saturated
with hydrogen atoms. In contrast, unsaturated FAs have at least one or more
unsaturated carbons. Monounsaturated FAs contain a single carbon-carbon double
bond, while polyunsaturated FAs contain at least two or more double bonds. The
most common confirmation for these double bonds are in cis, however the trans
confirmation is also present as intermediates in the bio-hydrogenation of FAs in some
plant lipids (Christy et al., 2003).
Polyunsaturated fatty acids (PUFAs) in general are considered to be one of the most
essential nutrients for humans and are well known to be important as a structural
and functional component of the mammalian body. Omega-3 and omega-6 are the
two main families of PUFAs. High concentration of PUFAs can be found in the human
central nervous system (Salem et al., 1976) and eyes (Benolken et al., 1973). A huge
20% of the dry matter of the brain (Logan, 2004) and 6% of the dry matter of the
Chapter 1: Literature Review
2 | P a g e
cerebral cortex is made up of PUFAs (Svennerholm, 1968). Many biochemical
processes especially in early postnatal development, such as cellular differentiation,
active synaptogenesis, and photoreceptor membrane biogenesis are extensively
dependent on PUFAs (Longo et al., 2003). However, despite of all these essentialities,
mammals cannot synthesize PUFAs de novo, and must attain it through their dietary
sources.
Both Omega-3 and omega-6 are very important in many biochemical functions, but
still metabolically and functionally distinct and have opposing physiological effects
(Simopoulos, 2002). As an example, at high concentrations, omega-6 FAs can increase
the formation of prostaglandins and thereby increase inflammatory processes. In
contrast, the reverse process can be seen with increased omega-3 in the body. Many
other factors such as thromboxane A2 (TXA2), leukotriene B4 (LTB4), IL-1, IL-6,
tumour necrosis factor (TNF), and C-reactive protein, which are related to varies
health conditions have been shown to increase with high omega-6 FAs, but decrease
with omega-3 FAs (Simopoulos, 2002).
In recent years, evidence supporting the essential nature of PUFA’s for better health
has increased. As a result, the recommended level of dietary PUFA intake has gone
through extreme scientific scrutiny over the last few years. As an example, over the
last few years the recommended levels for two main omega-3 FAs (eicosapentaenoic
acid and docosahexaenoic acid) have increased four-fold from 0.15 to 0.6 g/day (Kris-
Etherton et al., 2000). The essential nature of FAs are well documented in a study
performed with rats, where rats on a fat-free diet showed no growth or reproduction
Chapter 1: Literature Review
3 | P a g e
(Holman, 1971). Both linoleic acid (omega-6 fatty acid) and α-linolenic acid (omega-3
fatty acid) have been classified as essential for humans (Burr and Burr, 1930). More
recently, arachidonic acid and docosahexaenoic acid have also been recognised for
their importance in human development (Connor et al., 1992). Docosahexaenoic acid
(DHA) is one of the major omega-3 FAs in the mammalian body along with α-linolenic
acid and eicosapentaenoic acid (EPA). Two of the major omega-6 PUFAs in the human
body are linolenic acid and arachidonic acid (ARA) (Simopoulos, 2002; Solfrizzi et al.,
2005). Linolenic (18:2n6) and α-linolenic (18:2n3) acids can be metabolized into
longer chain polyunsaturated versions such as ARA (20:4n6) and DHA (22:6n3),
respectively. However, it has been reported that this biosynthesis or inter-conversion
does not provide an adequate amount for optimal neural development (Salem et al.,
1996), indicating the importance for sufficient dietary intake. In fact, no more than
0.2% of C-18 PUFA is effectively biosynthesised into C-22 PUFA (Pawlosky et al.,
2001). Furthermore, this very low inter-conversion rate of omega-3 has been linked
to three other major factors: high omega-6 to omega-3 ratio, excess amounts of trans
FAs in the diet, and enzyme cofactor deficiencies such as zinc deficiency (Hobbeln,
2001).
Chapter 1: Literature Review
4 | P a g e
1.2 Docosahexenoic acid (DHA)
Docosahexaenoic acid (DHA) is a carboxylic acid with a 22-carbon chain with six cis
carbon-carbon double bonds (Figure 1.1). DHA is the longest and most unsaturated
fatty acid. Its third carbon from the omega end contains the first double bond, hence
the fatty acid nomenclature 22:6 (n-3). The trivial name of DHA is cervonic acid and
its systematic name is all-cis-docosa-4,7,10,13,16,19-hexaenoic acid. DHA is one of
the main omega-3 FAs and its well conserved throughout the mammalian species
despite dietary differences (Neuringer et al., 1988). DHA is commonly found in the
phospholipids of biological membranes and it is a primary structural component of
membrane phospholipids at synapses, in retinal photoreceptors (Lukiw et al., 2005),
and also in testis and sperm (Neuringer et al., 1988). In adult rats’ brain, DHA
comprises approximately 17% of the total FA weight and in the retina it’s as high as
33% (Hamano et al., 1996). DHA is believed to have played a major role in the
evolution of the modern human, and in particular the well-developed brain (Crawford
et al., 1999).
The effects of dietary FAs and their deficiencies have been well studied and
documented. Furthermore, a potential protective effect from coronary heart disease
(McLennan PL, 1992), and a critical role in immune response, gene expression, and
intercellular communication have also been linked to PUFA levels (Hobbeln, 2001).
Mainly, omega-3 FAs are known to be vital in prevention of fatal ventricular
arrhythmias (Nair et al., 1997).
Chapter 1: Literature Review
5 | P a g e
Figure 1.1: DHA Structure
DHA's structure is a carboxylic acid with a 22-carbon chain and six cis double bonds
with the first double bond located at the third carbon from the omega end.
Chapter 1: Literature Review
6 | P a g e
Omega-3 FAs are also known to reduce thrombus formation propensity by decreasing
the platelet aggregation, blood viscosity and fibrinogen levels (Simopoulos, 1991).
Many brain related disorders such as depression (Hibbeln, 1998), bipolar (Stoll, 1999)
and unipolar (Nemets et al., 2002) disorders, impairments in learning ability
(Yamamoto et al., 1987), schizoaffective disorders (Fenton et al., 2001), dementia
(Sandra Kalmijn, 1997) and Alzheimer’s disease (Conquer et al., 2000) have all been
linked to omega-3 deficiency, suggesting its importance in cognitive functions and
health. Furthermore, conditions such as vision impairment, diabetes, arthritis, cancer
proliferation (Connor, 2000), dermatitis, growth retardation, and reproductive failure
(Holman, 1971) have also been shown to correlate with omega-3 deficiency.
1.3 Zinc and life
1.3.1 Zinc
Zinc is a trace element indispensable for life and is the second most abundant trace
element in the body (Weiss et al., 2000). Zinc is known to be related to growth,
development, differentiation, immune response, receptor activity (Vallee and
Falchuk, 1993), gene expression, DNA synthesis, enzymatic catalysis, hormonal
storage and release, tissue repair, neurotransmission, memory, the visual process
(Chai et al., 1999) and many other cellular functions too numerous to list. The
indispensability of zinc to the body can be discussed in many other aspects; including
as a component of over 300 different enzymes (Wallwork, 1987), as an integral
Chapter 1: Literature Review
7 | P a g e
component of a metallithioneins (Kagi et al., 1961), or a gene regulatory protein
(Hanas et al., 1983). Approximately 3% of all proteins contain zinc binding motifs
(Frederickson et al., 2005a). The broad functional capability of zinc is thought to be
due to its usually stable chemical and physical properties (Vallee and Auld, 1990).
Zinc is thought to have three different functions in enzymes: catalytic, coactive and
structural (Vallee and Auld, 1992). Indeed, it is the only metal that can be found in
all six different subclasses of enzymes (Cai and Chou, 2005; Vallee and Falchuk, 1993).
In the mammalian body zinc is mainly localised in the brain where it is at around
150μM in concentration (Wallwork, 1987). However, free zinc in the mammalian
brain is calculated to be around 10 to 20nM (Frederickson et al., 2005a), and the rest
exist as either protein, enzymes or nucleotide bound (Vallee and Falchuk, 1993). The
brain and zinc relationship is thought to be mediated through glutamate receptors
(Smart et al., 1994), and zinc is known to inhibit both inhibitory and excitatory
receptors (Frederickson et al., 2005a). Vesicular localization of zinc in presynaptic
terminals is a characteristic feature of brain zinc and its release is dependent on
neural activity (Weiss et al., 2000).
Moreover, high zinc concentration is linked with neurodegenerative disorders such
as Alzheimer’s disease (AD) and amyotrophic lateral sclerosis (ALS) (Weiss et al.,
2000). The relationship between zinc and AD has been interpreted in several ways.
One of the studies has proposed that β-amyloid has greater propensity to form
insoluble amyloid in the presence of high physiological zinc levels (Bush et al., 1994b).
Insoluble amyloid is thought to promote plaque formation, which is a main
pathological feature of AD (Hyman, 2005). Further studies have shown that chelation
Chapter 1: Literature Review
8 | P a g e
of zinc ions can deform and disaggregate the plaque (Cherny et al., 2001; Stoltenberg
et al., 2005a). In AD, the most prominent injuries can be found in hippocampal
pyramidal neurons, acetylcholine containing neurons in the basal forebrain, and in
somatostatin-containing neurons in the forebrain (Weiss et al., 2000). All these
neurons are known to favour rapid and direct entry of zinc in high concentrations (Yin
HZ, 1994), allowing frequent exposure to zinc in high dosages. This is thought to
promote neuronal cell damage through oxidative stress and mitochondrial
dysfunction (Weiss et al., 2000).
1.3.2 Zinc in the brain
In the mammalian body, the highest concentration of zinc is found in the adult brain,
which is about 150μM (Wallwork, 1987). However, free zinc in the mammalian brain
is thought to be around 10 to 20nM (Frederickson et al., 2005b) and the rest exists
bound to either proteins, enzymes or nucleotides (Vallee and Falchuk, 1993). A major
role for zinc in the brain is to regulate glutamate receptors (Smart et al., 1994), where
zinc is able to increase the activity of both inhibitory and excitatory types of receptors
(Frederickson et al., 2005b). In the central nervous system, zinc has an additional role
as a neurosecretory product or cofactor. Vesicular localization of zinc in presynaptic
terminals is a characteristic feature of brain-zinc and its release is dependent on
neural activity (Weiss et al., 2000).
Chapter 1: Literature Review
9 | P a g e
1.3.3 Alterations of zinc metabolism
The importance of zinc for the human body is readily identified by studying the wide
range of pathological effects of zinc deficiency. Anorexia, embryonic and postnatal
growth retardation, alopecia, skin lesions, difficulties in wound healing, increased
haemorrhage tendency and severe reproductive abnormalities, emotional instability,
irritability and depression are just some of the many diseases linked to an altered zinc
metabolism in the body (Ackland and Michalczyk, 2006; Aggett, 1983; Halsted, 1972;
Smart et al., 1994; Vallee and Falchuk, 1993; Wallwork, 1987). Proper development
and function of the central nervous system is also dependent on zinc levels. Growth
retardation and impaired development of CNS tissues have been associated with low
levels of zinc (Dreostl, 1983). Peripheral neuropathy, spina bifida, hydrocephalus,
anencephalus (Hurley, 1981), epilepsy and Pick's disease (Frederickson, 1989), have
also been linked to zinc deficiency.
In addition to zinc deficiency causing much damage to the body, excessive amounts
of zinc can also lead to significant adverse effects. Neurotoxicity and neuro-
degeneration are widely seen with exposure to excessive amounts of zinc. Using
mouse neuronal cells, it has been shown that 24 hour exposure to 40μM of zinc was
sufficient to degenerate cells (Sheline et al., 2000b). The translocation of zinc from
presynaptic to postsynaptic neurons is the main mechanism suspected to be involved
in neurotoxicity (Weiss et al., 2000). This zinc translocation is responsible for inducing
the cell injuries encountered in conditions such as brain trauma (Suh, 2000), epilepsy
and transient global ischemia (Weiss et al., 2000). Using an intraventricular injection
Chapter 1: Literature Review
10 | P a g e
of metal chelator, it has been shown that edetate calcium disodium (CaEDTA) blocked
the postsynaptic accumulation of zinc, and thereby markedly reduced the neuronal
death (Koh et al., 1996; Suh, 2000). Excessive zinc is also capable of inhibiting Ca2+
and Na+ voltage gated channels (Akaike, 1989; Ravindran et al., 1991; Winegar and
Lansman, 1990). Moreover, prolonged exposure to higher concentrations of zinc has
been shown to induce cell necrosis (McGowan et al., 1994). Another mechanism
through which zinc toxicity may work is by inhibiting glyceraldehyde-3-phosphate
dehydrogenase (GAPDH), resulting in a decrease production of ATP in neuronal cells,
and ultimately cell death (Sheline et al., 2000b). Furthermore, increased levels of zinc
have been found to up-regulate cellular levels of reactive oxygen species (ROS) (Kim
et al., 1999a). Elevated ROS levels can be directly detrimental to cell survival by
damaging key macromolecules such as nucleic acids, proteins and lipids, and
subsequently cause rapid cell death. In a recent study, cultured mouse cortical and
cerebellar granule cells died via apoptosis in response to high zinc concentrations
(Kim et al., 1999c; Manev et al., 1997).
1.4 Zinc transporters
As described above, deficient or excessive amounts of zinc in the body can be
extremely catastrophic to the integrity of biochemical and biological systems. Thus,
this indicates the necessity of an appropriate and sophisticated homeostatic
mechanism. Primarily, this is done by the gastrointestinal system by controlling the
absorption, execration and the distribution of zinc (Krebs, 2000), though the
Chapter 1: Literature Review
11 | P a g e
hydrophilic and high charge molecular characteristics of zinc are not favourable for
passive diffusion across cell membranes (McMahon and Cousins, 1998). Thus, most
if not in all zinc movement across cell membranes are known to occur via inter-
membrane zinc transporter proteins (Kambe et al., 2004b). These transporters are
mainly categorized under two metal–transporter families; Zip (ZRT, IRT – like
proteins) and CDF/ ZincT (Cation diffusion facilitator) (Kambe et al., 2004b). Both
families are also known as SLC (Solute Linked Carrier) gene families: ZincT (SLC30) and
Zip (SLC39) (Liuzzi and Cousins, 2004b).
The SLC 30 family facilitates zinc efflux from the cytosol to the extracellular matrix or
into the lumen of intracellular compartments, thus decreasing intracellular zinc
availability. Conversely, the SLC39 family facilitates the opposite mechanism: Zinc
influx to the cytosol, either from the extracellular matrix or from intracellular
compartments. ZincT1 was the first mammalian zinc transporter to be identified, in
an experiment with rat kidney cDNA (Findley, 1995). Since then, more than 100
different members of at least 9 known zinc transporters, and around 86 members of
15 known Zip transporters have been identified in human cells (Liuzzi and Cousins,
2004b). In addition, a “Nramp” family of metal-ion transporter, divalent cation
transporter1 (DCT1), is also suspected to be involved in zinc transportation (Gunshin
H, 1997). Apart from the recent rapid enhancement in the knowledge of these
transporters, the exact molecular mechanism of zinc metabolism is yet to be
understood.
Chapter 1: Literature Review
12 | P a g e
1.4.1 SLC30 (ZnT) family
Members of the SLC30 family are putative facilitators of zinc efflux from the cytosol
to the extracellular environment or into luminal compartments such as secretory
granules, endosomes and synaptic vesicles, thus decreasing the intracellular zinc
availability (Figure 1.2). The predicted protein structure of this family consists of six
membrane-spanning domains, a large intracellular loop, and the amino and carboxyl
termini are both localized to the cytoplasmic side (Figure 1.3). Between the IV and V
transmembrane domains, there is a histidine rich intracellular loop, which is common
for this family. The predicted protein sizes are around 40 to 60 kDa (Palmiter, 1995b)
for this family. The ZnT1 gene cloned from a rat kidney cDNA library was the first
mammalian zinc transporter to be identified (Palmiter, 1995b). More than 100
different members have now been identified in the ZnT family (Gaither, 2001), and
out of these at least 9 are known to be present in human cells.
Chapter 1: Literature Review
13 | P a g e
Figure 1.2: Putative cellular localization of the different human zinc transporters.
Arrows indicate the direction of zinc (Zn2+) transport by the appropriate putative zinc
transporters (i.e. Zip1- Zip4 and ZnT1- ZnT7).
Chapter 1: Literature Review
14 | P a g e
Figure 1.3: Predicted structure of the SLC30 family members.
Key amino acid residues highlighted include leucine (L) on the amino or N-terminal
(NH2) half and the histidine (H) rich loop on the carboxyl or C-terminal half of the
molecule. Arrow indicates the direction of zinc movement from the membrane by
the putative zinc transporters.
Chapter 1: Literature Review
15 | P a g e
1.4.2 SLC39 (ZIP) family
Members of the SLC39 family facilitate zinc influx into the cytosol, either from the
extracellular environment or from intracellular compartments (Figure 1.2). The
identification of this transporter family was a result of gene alignment of known ZRT1,
IRT1-like protein transporters in plants, yeast and human GenBank sequences
(Gaither and Eide, 2000). Most members of this family contain eight trans-membrane
domains and a long cytoplasmic histidine rich loop between domains III and IV. This
loop is thought to facilitate zinc transportation by binding to zinc molecules. In the
ZIP family, both the amino and carboxyl termini are on the extracellular or luminal
side (Eide, 2004). Predicted protein sizes for this family are around 30 to 40 kDa (Eide,
2004). Currently, about 86 ZIP family members have been identified and 15 of these
are known be present in human cells (Liuzzi and Cousins, 2004a).
In addition to these two families, the “Nramp” family metal-ion transporters,
divalent cation transporter1 (DCT1) (Gunshin H, 1997), metallithioneins, ATP-binding
cassette (ABC) transporters (Dean, 2001), P-type ATPases (Thelwell et al., 1998) and
iron regulated-like proteins (IRT1) (Smith et al., 2006) are also suspected to be
involved in zinc transportation across organisms. Despite the recent rapid increase
in knowledge of these transporters, many aspects of the molecular mechanisms of
zinc metabolism are yet to be understood.
Chapter 1: Literature Review
16 | P a g e
Figure 1.4: Predicted structure of the SLC39 family members.
The amino acid residue highlighted on the diagram is histidine (H), which is rich in the
loop between domains III and IV of the molecule. Arrow indicates the direction of
zinc movement from the membrane by the putative zinc transporters.
Chapter 1: Literature Review
17 | P a g e
1.5 Alzheimer’s disease (AD)
1.5.1 History and pathology of AD
AD is a neurodegenerative disorder that was first described by the German physician,
Alois Alzheimer and his colleagues in 1906 (Rainulf, 1995). Studies done on Augusta
Deter, a patient who showed distinct behavioural changes, lead to this remarkable
discovery. As described by Dr. Alzheimer, AD is characterised by a progressive pre-
senile dementia with general cortical atrophy (Rainulf, 1995). Gradually increasing
memory loss is the first symptom in many cases, and from then onwards the brain
deterioration becomes more rapid until the patient loses their ability to perform
almost all of the cognitive functions. Finally, the brain stops functioning due to
significant neuronal loss, resulting in death (Shapiro et al., 1985). The pathological
changes of AD includes β-amyloid plaque formation, dystrophic neurites associated
with plaques and neuro-fibrillary tangles within nerve cell bodies (Vickers et al.,
2000). AD is known to be the most prevalent cause of progressive dementia,
accountable for 50 - 70% of cases (Katzman, 1986). Within 100 years of its discovery,
much research was conducted to find a cure or a specific cause for the disease,
however most of these studies failed to make the target, though a few made
significant contributions (Gracious et al., 2010; Kuratko and Salem, 2009; Lien, 2009;
Sadli et al., 2012; Shahdat et al., 2009; Suphioglu et al., 2010b).
Chapter 1: Literature Review
18 | P a g e
1.5.2 The future of Alzheimer’s disease
AD has been classified as a chronic brain disorder known to have a staggering impact
on both the health and economic prospect of the world. More than 1 in 10 people
over the age of 65 and almost half the population over 85 years is believed to suffer
from AD (Wall, 2007). Another study has estimated more than 26 million people
worldwide suffer from AD at present. Forecasts predict this number will more than
quadruple by 2050 from 26 million to 106 million and an estimated huge increase in
cost of 400% from 12.6 million to 62.8 million in Asia by 2050. In USA alone, the
incidence of AD is projected to rise from 5 million to 16 million. The forecast for other
regions are: Africa, 1.3 million cases today and 6.3 million by 2050; Europe, from 7.2
million to 16.5 million; Latin America and the Caribbean, 2 million to 10.8 million;
Oceania, from 200,000 to 800,000 (Wall, 2007). In USA, it’s considered to be the
fourth leading cause of death and third most expensive disease (Evans et al., 1989).
In addition to the huge monetary cost, the emotional and psychological impact
associated with AD for both patients and their families are even more devastating.
Therefore, AD is considered a significant health threat to the world, and since no
effective cure exists, mental health research has become a national priority for many
countries around the globe.
Chapter 1: Literature Review
19 | P a g e
1.5.3 Predicted mechanisms for Alzheimer’s disease
In the process of identifying the cause for AD, several mechanisms have been
suggested. These include the amyloid cascade hypothesis (Zlokovic et al., 2005),
neurovascular hypothesis (Zlokovic, 2005), and dysregulated protein hypothesis
(Xiao, 2005). Also, processes such as phosphorylation of microtubule-associated
protein τ (tau protein), oxidative stress, metal ion deregulation, inflammation and
dysregulation of the cell cycle (Webber et al., 2005) have been identified as
mechanisms by which the disease develops. In addition to the above mechanisms,
genetic links have been proposed to some cases of AD (de la Torre, 2005; Erçelen,
2005). However, none of these hypotheses have been proven conclusively. Despite
its different mechanisms, the pathological features of AD have been well
documented and the most prominent is the formation of senile plaques. Amyloid
beta (Aβ) is primarily responsible for the formation of these senile plaques. This
plaque is then thought to trigger a cascade of reactions resulting in neurotoxicity
(Patel, 2003). Fragmentation of the transmembrane protein APP (amyloid precursor
protein) by the enzymes α, β and γ secretase produces Aβ. The enzymatic cleavage
of APP by α- secretase followed by γ is non-amyloidogenic. In contrast, β and γ
cleavage produces β-amyloid by the amyloidogenic pathway (Wolozin, 2001). The
neurofibrillary tangles present in AD plaques also consist of tau protein (Robert
Adalberta, 2007). Hyper-phosphorylation of this tau protein has been listed as a
causative factor in AD, along with many other candidates.
Chapter 1: Literature Review
20 | P a g e
1.5.4 Omega-3 FA and Alzheimer’s disease
The absence of omega-3 FA in the diet has been linked with the onset of AD.
Epidemiology evidence suggests increased dietary omega-3 consumption can reduce
or delay the risk of AD. A recent experiment in rats has shown an increase in zinc
transporter 3 (ZnT3) expression levels with reduced consumption of omega-3 FA.
From this observation, the authors suggest this alteration can explain the link
between consumption of FA with the reduced risk of dementia and AD (Jayasooriya
et al., 2005a). Another study suggests that omega-3 FA can decrease β-amyloid
production, its accumulation and potential downstream toxicity, and therefore
reduce the onset of AD (Lim et al., 2005). In the same study, a DHA-enriched diet has
been shown to reduce the β-amyloid production in transgenic mice by approximately
70% and decrease the accumulation of plaques by approximately 40 to 50%.
Moreover, this study also demonstrated that both α and β APP C-terminal fragment
products and full length APP production was decreased due to DHA. Short term
administration of DHA into rats was shown to increase the transcription of a gene
responsible for scavenging the β – amyloid proteins (Puskas et al., 2003).
1.5.5 Zinc and Alzheimer’s disease
The relationship between zinc and AD has been interpreted in several ways. The
presence of zinc in neurofibrillary tangles has been well documented and studied.
Chapter 1: Literature Review
21 | P a g e
One study has proposed that β-amyloid has a greater propensity to form insoluble
amyloid in the presence of high physiological zinc levels. Insoluble amyloid is thought
to promote the plaque formation, the main pathological feature of AD (Hyman,
2005). In addition, in vitro studies conducted with zinc and β-amyloid (Aβ) has shown
that zinc can precipitate soluble Aβ into protease resistant amyloid aggregates (Bush
et al., 1994b; Bush, 1994b). Zinc chelation from post-mortem AD brains was shown
to increase the solubility of Aβ proteins (Cherny R. A., 1997). Another study
performed using Tg2576 transgenic mice have shown the release of zinc during
synaptic transmission to stimulate cerebral Aβ deposition (Bush, 2003). Further
studies have revealed that chelation of zinc ions can cause the plaque to deform and
disaggregate (Cherny et al., 2001; Stoltenberg et al., 2005b). These studies
conducted using human AD brains and transgenic Tg2576 mice brains have exhibited
high level of zinc and a link between excess amounts of zinc and the formation of
amyloid plaques (Huang et al., 2000). Moreover, ZnT-3 knockout transgenic Tg2576
mice have demonstrated substantially reduced levels of insoluble Aβ and reduced
amyloid plaque formation (Lee, 2002). These findings confirm the link between high
levels of cytoplasmic zinc and AD.
In AD, the most noticeable damage can be found in hippocampal pyramidal neurons,
acetylcholine containing neurons in the basal forebrain and in somatostatin-
containing neurons in the forebrain (Weiss et al., 2000). These neurons are highly
permeable to zinc (Yin HZ, 1994), leaving neurons exposed to frequent and high
fluctuations in zinc. This is thought to promote neuronal cell damage through
oxidative stress and mitochondrial dysfunction (Weiss et al., 2000). Zinc has also
Chapter 1: Literature Review
22 | P a g e
been shown to specifically inhibit the α-secretase cleavage of APP, which is the non-
amyloidogenic pathway, thereby increasing the propensity for AD (Roberts et al.,
1994). In addition, a specific and saturable binding site for zinc (KA = 750 nmol/L) has
been identified within the cysteine-rich region on the ectodomain of amyloid
precursor proteins (Bush, 1994a). Zinc is well conserved throughout all members of
the APP super-family (Bush et al., 1993), and considered as being one of the most
conspicuous metals available at physiological pH levels to precipitate Aβ (Bush et al.,
1994b). On the other hand, metals such as copper tend to be more active in acidosis
conditions (Atwood, 1998). A series of studies conducted with early and late AD
brains have shown significantly elevated levels of ZnT-1, ZnT-4 and ZnT-6 proteins
(Lovell et al., 2006; Lovell et al., 2005; Smith et al., 2006). These findings further
strengthen the link between altered zinc levels in the brain and development of AD.
Recently, a link between DHA dietary levels and zinc homeostasis has been revealed
for the first time. A study using rats has shown that dietary deprivation of DHA levels
caused abnormal zinc metabolism via overexpression of ZnT-3 (Jayasooriya et al.,
2005a), suggesting a possible relationship between zinc levels and omega-3
consumption in AD cases. In summary, the studies mentioned above highlight links
between zinc metabolism and AD; dietary omega-3 FA levels with the onset of AD;
and also an association between DHA levels and zinc metabolism (Figure 1.5). Thus,
these findings suggest a possible synergistic effect, which may be present in AD.
Chapter 1: Literature Review
23 | P a g e
Figure 1.5: Summary of key findings from literature to establish a possible link
between DHA, zinc and AD.
The figure indicates all the major findings from literature to establish a possible link
between DHA, zinc and AD. The project was based on these major findings and the
fourth point forms the basis of the hypothesis, the increase in DHA affects zinc
transporter expression levels in human neuronal cell cultures.
Chapter 1: Literature Review
24 | P a g e
1.5.6 Hypothesis of the study
The study is based on the hypothesis that the manipulation of DHA levels available to
human neuronal cells will influence the zinc homeostasis through altering the zinc
transporter expression levels. The link between DHA levels and zinc will be examined
using cultured human neuronal cells (SY5Y and M17), the human tetracarcinoma cell
line (NT2) and the human skin cell line (HaCaT) as the control.
1.5.7 Aims of the study
The aims of this project are outlined as follows:
To investigate the changes in gene expression levels of zinc transporters in
neuronal cells in response to different concentrations of omega-3 FAs and zinc
availability using quantitative PCR (QPCR);
To determine the changes in levels of zinc transporter proteins with different
doses of omega-3 and zinc levels using SDS-PAGE and immunoblotting, and
thereby confirm the PCR results;
To assess the free zinc availability following DHA treatment in human cells using
M17 and NT2. Thus, to determine the effect of DHA on cell survival and
homeostasis;
Assess the importance of these zinc transporters on cell survival and apoptosis by
using different levels of DHA and zinc;Develop a better cell culture model for
Chapter 1: Literature Review
25 | P a g e
neuronal research by differentiating human cell lines to display more neuronal
properties.
1.5.8 Project outline
Four different cell lines: HaCaT, SY5Y, M17 and NT2 will be used in this study. HaCaT
is a skin cell line, which will be used as the control cell line. SY5Y and M17 cell lines
are both derived from human bone marrow neuroblastoma and both exhibit
epithelial and neuroblast morphologies (Biedler et al., 1978; Ciccarone et al., 1989).
NT2 cells are neuronally committed human teratocarcinoma cell line (Andrews,
1984). The experimental plan will be to culture these four cell lines to a fully
confluent stage and treat with 12 different treatment regimens for 4 days. Cell-
specific media supplemented with different concentrations of DHA (0, 5, 10, 20 & 40
μg/ml) with or without zinc will be used. All the different cell samples will be
collected and then total RNA and total protein will be isolated. cDNA will be
synthesised through reverse transcription of RNA, which will be used in QPCR to
measure any up-regulation or down-regulation of zinc transporter genes using gene
specific primers (hZnT1 - hZnT7 & hZIP1 - hZIP4). After this initial step, all results will
be analysed to choose 1 zinc transporter for further studies in this project.
In the second half of the project, DHA effects on human cells will be investigated.
Excessive amount of free zinc is considered as a biomarker for neurodegeneration.
Thus, DHA effect on labile zinc will be assessed following DHA treatments (20 μg/ml).
Chapter 1: Literature Review
26 | P a g e
Linoleic acid will be used to compare the specificity of the results obtained using DHA.
The purpose of this part of the study is to analyse any neuroprotective properties
DHA may have thus to identify a possible pathway for neuroprotection through
omega-3 FAs.
Third part of the project is to develop a methodology to differentiate human neuronal
cells to give more neuronal properties so that it can be used in neuronal research. RA
will be used as the differentiation agent. Traditional monolayer method of cell
differentiation will be tested against the novel 3D differentiation to evaluate the pros
and cons of each method.
1.5.9 Significance of the study
The experiments are planned to established the effects of DHA and zinc on zinc
transporter expression levels and ultimately on neuronal cell survival. In conclusion,
this study is intended to elucidate the link between dietary omega-3 FA levels and AD
onset. In the future, it may be possible that these results will assist in finding a
prevention or therapeutic treatment for this debilitating disease.
In addition, by establishing a method to differentiate human cells to give more
neuronal properties will greatly benefit neurobiology research in general. A cost and
Chapter 1: Literature Review
27 | P a g e
time efficient method for cell differentiation translates to improved productivity and
affordability in the research area in general.
Chapter 2. 1: Introduction
28 | P a g e
CHAPTER 2.1: Introduction
2.1 DHA effect on zinc transporters and cell survival
The hydrophilic and high charge atomic nature of zinc is not very compatible with
passive diffusion across the cell membrane (McMahon, 1998). Thus, in most if not in
all these cases, zinc movement is known to be mediated by intra-membrane proteins
termed zinc transporters (Kambe et al., 2004a). These transporters can be
categorized into two main metal transporter families, ZnT (Zinc transporters) family
and ZIP (ZRT, IRT – like proteins) family. Members of the ZnT family are putative
facilitators of zinc efflux from the cytosol to the extracellular environment or into
luminal compartments such as secretory granules, endosomes and synaptic vesicles,
thus decreasing intracellular zinc availability (Kambe et al., 2004a). ZIP transporters
facilitate zinc influx into the cytosol, either from the extracellular environment or
from intracellular compartments (Liuzzi and Cousins, 2004a). In addition to these two
main families, the “Nramp” family metal-ion transporters, divalent cation
transporter1 (DCT1) (Gunshin H, 1997), metallithioneins, ATP-binding cassette (ABC)
transporters (Dean, 2001), P-type ATPases (Thelwell et al., 1998), and iron regulated-
like proteins (IRT1) (Smith et al., 2006) are also supposed to be involved in zinc
transportation across organisms.
Chapter 2. 1: Introduction
29 | P a g e
DHA is an omega-3 PUFA found predominantly in marine and plant oils. Mammals
cannot produce adequate amounts of omega-3 FAs through biosynthesis or inter-
conversion (Salem et al., 1996). Thus, sufficient dietary intake is vital for many
biological processes such as brain development, brain function and vision (Connor et
al., 1990; Gamoh et al., 2001; Ikemoto et al., 2001; Kyle et al., 1999; Mitchell et al.,
1998; Suzuki et al., 1998). Effects of DHA deficiency are well studied and
documented. Hearing and vision impairments (Bourre, 2004), depression (Logan,
2004), deficits in learning ability, cystic fibrosis, unipolar depression and
cardiovascular diseases (Horrocks and Yeo, 1999) are just some disorders known to
be associated with DHA deficiency. Neurodegenerative disorders such as AD and
Parkinson are also linked with DHA deficiency (Bousquet et al., 2011; Bousquet et al.,
2008; Calon and Cole, 2007). Studies done with rats have shown a link between zinc
homeostasis and DHA intake. DHA deficient rats have shown a decrease in plasma
zinc levels and modified brain zinc distribution (Jayasooriya et al., 2005b). More
importantly, DHA deficient rats also exhibit increased ZnT3 zinc transporter
expression levels (Jayasooriya et al., 2005b).
Both labile Zn2+ levels in a cellular system and DHA availability are linked with
neuronal cell death. Increased free zinc levels are associated with
neurodegeneration (Mocchegiani et al., 2005). When cortical neurons were exposed
to zinc, cells displayed widespread degeneration within 15 minutes (Koh and Choi,
1994). DHA on the other hand had a protective effect on serum-starved rodent
neural cells (Kim et al., 2000).
Chapter 2. 1: Introduction
30 | P a g e
Though, a possible link between DHA and zinc is widely discussed the molecular basic
of this link remains unknown. Hence, this study intends to establish the effects of
DHA and zinc on zinc transporter expression levels and zinc metabolism, specifically
in relation to cell death through apoptosis.
Chapter 2.2: Materials & Methods
31 | P a g e
CHAPTER 2.2: Materials & Methods
2.2.1 Cell culture and treatments
2.2.1.1 Cell line and cell culture
The human neuroblastoma cell lines BE(2)-M17, SH-SY5Y, human teratocarcinoma
cell line NT2 and human skin (keratinocyte) cell line HaCaT, which were used in these
experimental studies, were obtained from Professor Leigh Ackland, Centre for
Cellular and Molecular Biology, Deakin University, (VIC, Australia).
HaCaT, the skin cell line was used as a control cell line to validate the neuronal
specificity of the results obtained from this study. HaCaT cells were originally isolated
from a melanoma of a sixty two year old male patient, and display an aneuploid
karyotype with distinctive stable marker chromosomes indicating monoclonal origin
(Boukamp, 1988). HaCaT cells were grown in Dulbecco’s Modified Eagle’s Medium
(DMEM) with 10% heat inactivated foetal bovine serum (FBS). SH-SY5Y is a thrice-
cloned sub line originally derived from a bone marrow biopsy from a four year old
female in 1970 (Biedler et al., 1978). This cell lines was grown in Roswell Park
Memorial institute 1640 (RPMI) medium supplemented with 20% heat inactivated
FBS. BE(2)-M17 is a twice cloned cell line, which originated from a bone marrow of a
two year old male patient with disseminated neuroblastoma (Ciccarone et al., 1989).
Chapter 2.2: Materials & Methods
32 | P a g e
These cells were cultured in OPTI-MEM (modified Eagles Minimum Essential
Medium) with 2.5% heat inactivated FBS. The Ntera 2/D1 (NT2) is a neuronally
committed human teratocarcinoma cell line and was grown in Dulbecco's modified
Eagle medium (DMEM) with 10% heat inactivated FBS.
All four cell lines were grown as monolayers in 75 cm2 Nunc® EasYFlasks™ (Invitrogen,
Melbourne, Australia) and incubated at 37ºC in a humidified atmosphere of 5% CO2.
When monolayers reached confluence, cells were rinsed once with phosphate-
buffered saline (PBS), then rinsed again with 0.05% Trypsin
/ethylenediaminetetraacetic acid (EDTA) solution (Sigma-Aldrich, Sydney, Australia),
and finally incubated with Trypsin/EDTA at 37ºC for approximately 5 minutes (min)
for cells to be detached from the flask and from each other, and viewed under light
microscopy (Olympus CK40). Suspension was pipetted up and down, to further break
up cells, and divided into fresh media containing flasks, according to divisional needs
(Table 2.1).
Chapter 2.2: Materials & Methods
33 | P a g e
Table 2.1: Cell culture media and divisional needs.
RPMI (Roswell Park Memorial Institute 1640 medium), was supplemented with 20%
of heat inactivated foetal bovine serum (FBS). DMEM (Dulbecco's Modified Eagle's
Medium), was supplemented with heat inactivated FBS at 20%. OPTIMEM is a
modified MEM (Eagle’s) media, supplemented with 2.5% heat inactivated FBS.
Cell line
Media % FBS
Passages (per
week)
Feeds (per
week)
%Trypsin
Proportion of cells to split in new
flaskHaCat DMEM 10 1 1 0.05 1:20SY5Y RPMI 20 1 - 0.025 1:20M17 OPTI-MEM 2.5 1 - 0.025 1:20NT2 DMEM 10 1 - 0.025 1:20
Chapter 2.2: Materials & Methods
34 | P a g e
2.2.1.2 Omega-3 fatty acid (DHA) and zinc treatments
Cells were treated with five different doses of DHA and with or without Zinc (Figure
2.1) therefore, for each cell line 10 flasks were used. First of all, 4 flasks from each
cell lines were grown to confluence, and then harvested into 50 mL Falcon tubes and
diluted with five times the volume of appropriate media. Then 50 μL of this cell
suspension was combined with equal volume of trypan blue and cells per a unit
volume were counted using a haemocytometer under light microscope using Hoskins,
Meynell and Sanders (1956) method. Following that, for each cell line 10 flasks were
seeded with one million of cells and allowed to grow to confluence (approximately 2
to 3 days). While waiting, DHA and with or without zinc containing stock solutions of
media were made according to Table 2.2. The stock solutions were incubated at 37ºC
overnight on an orbital rotator. This was to allow DHA to conjugate with proteins in
the media to ensure maximum delivery into the cells. These stock solutions were
then used to make each treatment regime (Table 2.3) and were refrigerated until
further use.
When cells were about 100% confluent, old media was replaced by 20 mL of
appropriate media and left for two days before harvesting.
Chapter 2.2: Materials & Methods
35 | P a g e
Figure 2.1: Cell culture treatment regimes.
Cells from each cell line were grown to 100% confluence and then treated with
different doses of DHA (0, 2.5, 5, 10, 20 and 40μg/mL) and with or without zinc
treatments for two days. This treatment was repeated for twice and then cells were
harvested for further studies. The cell specific media which cells were grown in are
indicated in the figure as well: (HaCaT – DMEM, SY5Y – RPMI, M17 – OPTI MEM).
Chapter 2.2: Materials & Methods
36 | P a g e
Table 2.2: Stock solutions for DHA treatments
Stock solutions for DHA treatments were prepared according to the table prior
dividing to each treatment regimes
Volume (mL)
DHA stock (μg/mL)
ZnCl2(μM)
DMEM 90 160 -90 160 10
RPMI 45 80 -45 80 5
OPTI-MEM 45 80 -45 80 5
Chapter 2.2: Materials & Methods
37 | P a g e
Table 2.3: Different DHA regimes
The treatment regime indicated in the table is for one cell line. As it shows each cell
line had 10 different treatment regimes, therefore altogether 40 regimes for 4 cell
lines.
Treatment Number
DHA(μg/mL) Zn
1 0 -2 2.5 -3 5 -4 10 -5 20 -6 0 +7 2.5 +8 5 +9 10 +10 20 +
Chapter 2.2: Materials & Methods
38 | P a g e
2.2.1.3 Harvesting of cells
Cells were harvested using the method stated in “cell line and cell culture” (2.1.1)
section described above. Then, each of the cell-trypsin solutions was poured into 15
mL Falcon tubes and diluted with five times the volume of appropriate media. Cell
count was performed using 50 μL of cell suspension and trypan blue. Rest of the
samples were then centrifuged for 5 mins at 1,000 X g. The pellet was resuspended
in 3 mL of PBS, pipetted up and down to homogenise, and separated into three 1 mL
aliquots. These aliquots were centrifuged for 5 mins at 16,000 X g, the supernatant
was discarded and the cell pellets drained and stored at -80° C.
2.2.2 Quantification of zinc transporter gene levels
2.2.2.1 Total RNA isolation
Total RNA isolation was performed from cell pellets from all the four cell lines using
Silica Membrane RNeasy Mini Kit (QIAGEN, Doncaster, VIC) following the
manufacturer’s instructions. During the whole process, extreme care was taken to
prevent any contamination (i.e. RNase contamination) with the use of gloves,
goggles, aerosol barrier tips, dedicated RNA bench and pipettes.
In brief, cells were first disrupted by adding 350 μL of reducing agent β-
mercaptoethanol (β-ME) and buffer RLT mix (10 μL of β-ME for every 1 mL of RLT).
Chapter 2.2: Materials & Methods
39 | P a g e
Samples were first mixed thoroughly by pipetting up and down. Then, the samples
were homogenized using 21G (gauge) needles with an RNase free syringe. After
that, 350 μl of 70% ethanol was added to each sample and mixed by pipetting. Whole
mixture from each sample was then transferred to RNeasy silica gel membrane mini
columns, which were placed in 2 mL collection tubes. Tubes were centrifuged at
10,000 X g for 15 seconds (s) and the flow through was discarded. Then 350 μl of
buffer RW1 was added to the columns and again spun for 15 s at 10,000 X g. The flow
through was again discarded and then this was followed by another centrifugation
for 15 s at 10,000 X g. The flow through was discarded. An additional step of on-
column DNase-I digestion was carried out according to the instructions listed in the
same protocol to ensure the removal of all contaminating DNA. First, DNase stock
solution was prepared by adding 550 μL of RNase free water to DNase-I powder.
Then, 10 μL of this DNase stock solution and 70 μL RDD buffer was delivered directly
onto each RNeasy silica membrane and incubated at room temperature for 15 mins.
After the incubation, 350 μL of buffer RW1 was added to each tube and centrifuged
for 15 s at 10,000 X g, and the flow through was discarded. 500 μL of RPE solution
was added to the columns and then centrifuged for 2 mins at 10,000 X g, the flow
through was discarded. The columns were centrifuged for a further 1 min at 10,000
X g to dry. The RNeasy columns were then transferred to a new 1.5 mL collection
tube and 50 μL of RNase free water was delivered to the membrane. The tubes were
centrifuged for 1 min at 10,000 X g to elute RNA. RNA concentrations and quality
were estimated using a DU 530 Life Science UV spectrophotometer (Beckman,
Melbourne, Australia) at 260/280 wavelengths. Total RNA was standardised to 5,000
ng/μL for cDNA synthesis.
Chapter 2.2: Materials & Methods
40 | P a g e
2.2.2.2 cDNA synthesis
Total RNA was reverse transcribed to cDNA using StrataScript Reverse Transcriptase
kit (Stratagene, La Jolla, California) following the manufacturer’s instructions. In
brief, into nuclease-free microcentrifuge tubes, 10 μg of total RNA from each sample,
3 μL of 100 ng/μL random primers and diethylpyrocarbonate (DEPC) treated water to
a final volume of 50 μL were added. Then the tubes were placed into heat block set
at 65ºC for 5 min, and then allowed to cool to room temperature. Subsequently into
each tube, 5 μL of 10× StrataScript buffer, 1 μL of 40 U/μL RNase Block (ribonuclease
inhibitor), 2 μL of 100 mM dNTP mix and 1-2 μL of 50 U/μL StratScript reverse
transcriptase were added. The tubes were mixed gently by inversion and then
incubated for 1 h at 42ºC, followed by 5 min at 90ºC. The transcribed cDNA was then
frozen away at -20ºC until needed.
2.2.2.3 Quantitative PCR (Q-PCR)
Reverse transcribed cDNA from each cell line and treatment were used in real time
PCR. Amplification reactions were performed with 1 × SYBR Green PCR Master Mix
(Applied Biosystem, Warrington, UK), 3 μM of forward and reverse primers for Znt 1-
7, Zip 1-4 and GAPDH (Table 2.4) and 20ng cDNA from each sample. Samples were
analysed in triplicate in 20μl total volume per well using GeneAmp 5700 Sequence
Detection System (PE Biosystems, Foster City, CA). GAPDH was the internal control
Chapter 2.2: Materials & Methods
41 | P a g e
used to normalize RNA quantities and efficiency of reverse transcription.
Amplification was performed as follows: One cycle at 50°C for 2 minutes and 95°C for
10 minutes, 45 cycles at 95°C for 15 minutes and 60°C for 60 s. Incorporation of SYBR
green dye into double stranded DNA produce fluorescence which would be then
automatically detected and recorded after the elongation phase of each repetitive
cycle. The specificity of each reaction was determined by analysis of the melting
point dissociation curve produced at the end of each PCR. The abundance of each
mRNA was measured as the cycle threshold (Ct) value, which is the cycle number
when fluorescence level exceeds the threshold value. The Ct values were
automatically recorded after each reaction. The Ct value of GAPDH was subtracted
from the Ct value of the target gene to produce ∆Ct for each sample. The relative
RNA expression level of each sample was calculated using the equation 2-∆∆Ct,
where ∆∆Ct is a difference between the treated ∆Ct and control ∆Ct. Two types of
PCR controls were performed to assure correct and acuate results. First one was a
“no-amplification control”, in which water replaced the volume of the primers. The
other one was a “no-template control”, which was with no cDNA. Also all the reaction
mixtures were prepared in bulk (master mixtures) in order to minimize pipetting
steps therefore reducing the risk of DNA contamination and also for better accuracy.
Chapter 2.2: Materials & Methods
42 | P a g e
Table 2.4: List of QPCR primers
All the forward and reverse primers used in QPCR analysis of human zinc transporters.
Transporter Forward primer Reverse primer
hZnT1 hZnT1-1 (20-mer) CTGGTGAACGCCATCTTCCT hZnT1-2 (19-mer) CAATCTCGTGCGGCTCGAT
hZnT2 hZnT2-1 (19-mer) GCGCTGTGGCTGTGAACAT hZnT2-2 (20-mer) GGGTTCTCCTCCTGCTGGTT
hZnT3 hZnT3-1 (18-mer) TTTGGCTGGCACCGTTCA hZnT3-2 (18-mer) GCGGACGAAGGCCAGGTA
hZnT4 hZnT4-1 (22-mer) AACCAGTCTGGTCACCGTCACTh hZnT4-2 (20-mer) CTATCCTGCCCATGGTTACG
hZnT5 hZnT5-1 (22-mer) CATGGAGCTTCTCAAGGAAGCT hZnT5-2 (23-mer) ACACCCCTCATGTTAGCATTCAT
hZnT6 hZnT6-1 (23-mer) TCCTTTTTTGGCAAGTTGTTACG hZnT6-2 (25-mer) AAGCAGGAAGCCAGTACATATCAAG
hZnT7 hZnT7-1 (19-mer) TTGCCCCTGTCCATCAAAG hZnT7-2 (22-mer) AGACCTAAACCAGCCCGAGATC
hZIP1 hZIP1-1 (22-mer) GCCCTGAGCCTAGTAAGCTGTT hZIP1-2 (23-mer) TCATCTATGGCAGCCAGGTAGTC
hZIP2 hZIP2-1 (18-mer) ATGGAGTCGCTGGCATTG hZIP2-2 (23-mer) GGCTGTGGAGTTCGAAGATATGA
hZIP3 hZIP3-1 (19-mer) GAGCCTCGGCCACATCAGC hZIP3-2 (20-mer) CTGATCCTGACCTTCCGCAA
hZIP4 hZIP4-1 (18-mer) TCAGGAGCGGGTCTTGCT hZIP4-2 (19-mer) TGCTGTGCTGCTGGAACAC
GAPDH GAPDH-1 (18-mer) CCACCCATGGCAAATTCC GAPDH-2 (21-mer) TGGGATTTCCATTGATGACAA
Chapter 2.2: Materials & Methods
43 | P a g e
2.2.3 Quantification of zinc transporter protein levels
2.2.3.1 Total protein isolation
Cell pellets harvested as described in section 2.1.3 above, were re-suspended in 500
Lysis buffer (1% sodium dodecyl sulfate (SDS) in 10 mM Tris-hydrochloric acid (HCl),
at a pH of 6.8). One Mini EDTA-free protease inhibitor cocktail tablet (Roche Applied
Science, Castle Hill, NSW, Australia) was added for every 10 mL of lysis buffer prior to
pipetting onto pellet, to prevent protein degradation. Cells were placed on ice and
homogenized by passaging through a Terumo 21G needle for approximately 10 times.
Cell samples were then sonicated (40% power output, 30% duty cycle) thrice for 15 s
with 30 s break between each sonication, using a Microson ultrasonic cell disrupter
(Misonix Incorporated, New York, USA). The homogenate was centrifuged at 16,000
X g at room temperature for 10 mins, and the supernatant was collected and
transferred to a new tube.
2.2.3.2 Total protein quantification
The supernatant was quantified using the Pierce BCA Protein Assay Reagent Kit
(Perbio, Rockford, USA), according to the manufacturer’s Microplate Procedure
instructions, adapted from Smith et al. (Smith, 1985). Changes from this protocol
included, reading the samples at a wavelength of 595 nm, instead of the specified
Chapter 2.2: Materials & Methods
44 | P a g e
562 nm, and only using 10 μL of each unknown sample, hence the sample to working
reagent ratio was 1:20 (v/v), which minimises the effects of interfering substances.
Absorbance readings were obtained by Labsystems Multiscan Plate Reader and
Genesis Lite 3.03 computer Software. A standard curve was constructed using
Microsoft Excel 2007 computer software, from the absorbance of the known bovine
serum albumin (BSA) standards, a trendline was added and a linear equation
calculated. The protein concentration for each sample was then calculated using this
equation.
2.2.4 Gel electrophoresis of proteins
2.2.4.1 Preparing the gels
Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) technique
was used to separate proteins according to their size. 12% SDS-Acrylamide gel
mixture was prepared according to Table 2.5 and poured into upright gel cassettes
(Invitrogen, Melbourne, Australia). First, three quarters of the cassettes were poured
with the resolving gel mixture and the top quarter was filled with deionised water
(dH2O) and left to set for about 1 hour (hr). Once set, the water layer was displaced
with the stacking gel mixture up to the top. A comb was then inserted, into each
cassette and the gel left to set for another 1 hr. Then the gels were sealed in airtight
Chapter 2.2: Materials & Methods
45 | P a g e
plastic bags, with a small volume of 1× running buffer (6 g Tris, 29 g Glycine, 2 g SDS
and dH2O water up to 2 L) to prevent dehydration and stored at 4oC until further use.
2.2.4.2 Protein loading
An aliquot of 40 μg of protein was loaded to each well, combined with 3.3 μL of 6×
loading buffer and milliQ water to a total volume of 15 μL. Before loading, each
sample was boiled for 10 mins, allowed to cool to room temperature, and
centrifuged for 15 s at 1,000 X g. The samples were separated, along with 5 μL of
Pageruler Prestained Protein Ladder Plus (Fermentas from Quantum Scientific, QLD,
Australia) using the XCell Surelock Mini-Cell (Invitrogen, Melbourne, Australia)
system and following the manufactures instructions. Tanks were connected to a
PowerPac300 (BIORAD, Gladesville, New South Wales) and protein electrophoresis
was performed for 90 mins at 125 volts (V) in 1 × running buffer. For each sample, 5
gels were prepared since there were 5 zinc transporter specific antibodies available
(hZnT1, 3 & 4, hZIP 1 & 3).
Chapter 2.2: Materials & Methods
46 | P a g e
Table 2.5: SDS-Acrylamide gel mixture
12% SDS- Acrylamide gel were prepared following the tabulated volumes and
guidelines.
Component 12% Resolving Gel (1.5 mm thick)
4% Stacking Gel (1.5 mm thick)
Milli Q 2.6 mL 2.3 mL0.5M Tris, pH 6.8 - 1.0 mL1.5M Tris, pH 8.8 1.9 mL -
10% SDS 77.1 μl 38.6 μl30% Acrylamide 3.1 mL 0.5 mL
10% APS 50.3 μl 25.6 μlTEMED 5.5 μl 6.2 μl
Chapter 2.2: Materials & Methods
47 | P a g e
2.2.4.3 Nitrocellulose membrane transfer
Following electrophoretic separation, proteins were transferred to nitrocellulose
blotting membrane (Pall, Life Sciences, Pensacola, Florida, USA) in 1× Novex Tris–
glycine transfer buffer (Invitrogen) and 10% methanol for 120 mins at 25 V using an
XCell Surelock Mini Cell (Invitrogen, Melbourne, Australia). Upon completion of the
transfer, membranes were stained briefly with 1× Ponceau red (0.2 (w/v) Ponceau
stain, 3% (w/v) trichloroacetic acid and 3% (w/v_ sulfosalicylic acid) to confirm the
integrity of protein transfer. Ponceau red was removed with a brief wash in 0.1 NaOH
followed by rinsing in dH2O.
2.2.4.4 Membrane protein detection
To detect specific protein bands, membranes were blocked for 12 hrs in 5% (w/v)
skim milk powder in Tris buffered saline (TBS) (50 mM Tris-HCL (pH 7.5), 150 mM
NaCl) at 4ºC with gentle agitation. Antibodies were then diluted appropriately (Table
2.6) in 0.1% skim milk in TBS. Membranes were then incubated with primary
antibodies for 2 hrs in sealed bags on an orbital rotator. Following that, membranes
were given 2×5 mins washes in 2× TBS, then 2×10 min washes with 1× TBS (with 0.1%
(v/v) Tween-20 (Sigma-Aldrich, St. Louis, USA) with gentle agitation. The membranes
were then incubated with horseradish peroxidase (HRP) conjugated anti-sheep
secondary antibody (1 in 2,000 diluted in 0.1% skim milk in TBS) for 1hr at room
temperature, again in sealed bags and on an orbital rotator. After incubation,
Chapter 2.2: Materials & Methods
48 | P a g e
membranes were given 4×10 mins washes in TBST prior to the exposure. Proteins
were detected using a chemiluminescence kit according to the manufacturer’s
instructions (Roche Applied Science, Castle Hill, NSW, Australia). Membranes were
developed using a Fujifilm Luminescent Image Analyser LAS-3000. Densitometry to
quantify results was performed using Fujifilm Multi Gauge V2.3 computer software.
Then the membranes were stripped for 5-10 mins (depending on band intensity) at
room temperature, using 1 mL of Re-Blot Plus-Strong (Chemicon International,
Temecula, CA, USA) diluted 1:10 in Milli Q water. In order to show equal protein
loading, all membranes were re-probed for β-actin. Membranes were re-blocked for
30 min in 5% (w/v) skim milk powder in TBS and incubated with β-actin primary and
then anti-mouse secondary and exposed, then quantified following the same
procedure as mentioned above.
Chapter 2.2: Materials & Methods
49 | P a g e
Table 2.6: Antibodies used in the study.
Dilution factors and the source of the antibodies used in the study and there
secondary antibodies and the dilution factors.
hZnT3
Chapter 2.3: Results
50 | P a g e
CHAPTER 2.3: Results
2.3.1 Zinc transporters and their expression pattern in neuronal cells
2.3.1.1 Basal zinc transporter levels in human neuronal cells
The expression level of zinc transporters (Zip1-4 & ZnT1-7) was tested using QPCR on
two different human neuronal cell lines (M17, SY5Y) and a neuronally committed
human tetra carcinoma cell line (NT2). Human skin cell line HaCaT was used to test
the neuronal specificity of the each transporter. Results obtained from QPCR was
normalised using GAPDH as the internal control. The expression levels of these
transporters are shown, relative to expression of hZnT3 (Figure 2.2). The four cell
lines expressed all the transporters tested.
2.3.1.2 Relative zinc transporter levels in human cell lines
In HaCaT cells (Figure 2.3A) the most highly expressed zinc transporters were hZnT6
and hZnT7. In M17 cells (Figure 2.3B), Zip3 and hZnT2 expression was very low
compared to hZnT3 expression. All the other transporters were about 5 to 10 fold
higher in their expression level compared to hZnT3 levels.
Chapter 2.3: Results
51 | P a g e
hZnT1 was the most expressed transporter in SY5Y cells (Figure 2.3C). hZip1, hZnT4,
hZnT6 & hZnT7 also showed high expression levels in SY5Y cells, whilst the expression
of the remaining transporters were very similar to the hZnT3 level with the exception
of hZip3. hZip3 expression was about 27 fold lower than hZnT3 levels in SY5Y cells.
NT2 cells (Figure 2.3D) exhibited a very interesting expression pattern in comparison
to other cell lines. Apart from hZnT1 & hZnT7, all the other transporter expression
levels were lower than hZnT3. Of these two transporters, only hZnT1 had a
considerable fold difference (approximately 50 fold lower) compared to ZnT3 levels.
2.3.2 Effects of DHA and zinc on zinc transporter expression levels
Real time PCR (QPCR) was performed to test the mRNA levels of zinc transporters
hZnT1 to hZnT7 and hZIP1 to hZIP4 following DHA treatment. The cDNA used in QPCR
was obtained from cells which were subjected to different doses of DHA (0, 2.5, 10,
20 & 40 μg/mL) in the presence (5 μM) or absence of zinc. Therefore, for each cell
line there were 10 different treatment regimes, totalling 40 for all the four cell lines.
The cycle threshold (Ct) values obtained were used in calculating the fold difference
and then plotted against the DHA dose. However, Ct values which were above 30
were not included in further calculations to ensure specificity and accuracy of the
results. Each experiment was repeated three times with independent sets of cells
and only the results which are most consistent with the other two experiments are
presented here. In literature, an increase or decrease of more than two-fold
Chapter 2.3: Results
52 | P a g e
difference is considered significant (Bubner et al., 2004) and the rest is considered as
non-specific. Therefore, the changes below two fold difference, is presented with
grey shading in the figures presented.
Chapter 2.3: Results
53 | P a g e
Figure 2.2: Expression levels of zinc transporters mRNA levels relative to ZnT3.
Fold-difference of mRNA levels of the different putative zinc influx (Zip1-Zip4) and
efflux (ZnT1-ZnT7) transporters measured relative to that of ZnT3 in M17, SY5Y, NT2
& HaCaT cells. Relative mRNA expression level is indicated according to the zinc
transporter.
Chapter 2.3: Results
54 | P a g e
Figure 2.3: Relative zinc transporter mRNA levels in HaCaT, M17, SY5Y and NT2 cells
compared to ZnT3 levels.
Fold-difference of mRNA levels of the different putative zinc influx (Zip1-Zip4) and
efflux (ZnT1-ZnT7) transporters measured relative to that of ZnT3 in M17, SY5Y, NT2
& HaCaT cells. Relative mRNA expression level is indicated according to the cell line.
Chapter 2.3: Results
55 | P a g e
2.3.2.1 hZnT1
In HaCaT cells, without zinc, the cell response to DHA doses was not significant with
only a slight increase in hZnT1 expression levels observed, and no obvious DHA dose
dependent pattern was seen (Figure 2.4A). However, in the presence of zinc the
increase was more dose dependent except for the maximum dose, and reaching
significance at the 20 μg/mL DHA dose (Figure 2.4B).
SY5Y and M17 cells reacted in a contrasting pattern to HaCaT cells, suggesting that
the hZnT1 expression change due to DHA is more neuronal cell specific. In SY5Y cells
with no zinc (Figure 2.4A), a downregulation could be seen in response to many DHA
doses, and when in the presence zinc (Figure 2.4B) this downregulation was even
more pronounced, being consistent across all three independent experiment sets.
Even though a downregulation pattern could be seen with M17 cells, dose
dependency and the consistency was lacking in comparison to SY5Y cells. Both with
(Figure 2.4A) and without (Figure 2.4B) zinc treatment, hZnT1 expression reached
significance at a very limited number of doses.
From the four cell lines, NT2 cells showed the most promising downregulation
pattern in the presence of DHA treatment with no zinc (Figure 2.4A). hZnT1
expression at all four DHA doses reached beyond the significance threshold, and the
changes were consistent across the triplicates. However, when zinc was present
(Figure 2.4B), the reaction was not consistent in response to DHA. Downregulation
Chapter 2.3: Results
56 | P a g e
was most commonly seen as a response to DHA treatment with the neuronal cell lines
and the tetra-carcinoma cell line.
2.3.2.2 hZnT2
The expression level of hZnT2 in all four cell lines showed a significant decrease with
different DHA doses in the absence of zinc (Figure 2.5A). In SY5Y cells, hZnT2
expression was decreased with the increase in DHA dose, apart from at the DHA 40
μg/mL dosage. HaCaT cells showed a similar pattern of hZnT2 downregulation,
although to a much lower extent than in SY5Y cells. Similarly, M17 cells showed
significant downregulation of hZnT2 at DHA 10 μg/mL dosage, but this was much
lower than what was seen with SY5Y cells. A dose dependent pattern was also not
visible in SY5Y cells. Though the levels were much lower than in SY5Y cells, NT2 cells
showed a consistent dose dependent downregulation when treated with DHA in the
absence of zinc.
In the presence of zinc (Figure 2.5B), the downregulation of hZnT2 was more
pronounced and higher for HaCaT cells when compared with no zinc treatment.
However, in NT2 cells the downregulation became much less consistent and less dose
dependent, while in SY5Y cells the downregulation was reduced. Similarly, in M17
cells the downregulation was reduced with the addition of zinc, resulting in an
upregulation of hZnT2. However, most of the Ct values for hZnT2 were relatively
Chapter 2.3: Results
57 | P a g e
higher than that of other transporters, and for the entire second set of experiments
it did not produce any conclusive data. Therefore, interpretation of hZnT2 results
should be done with caution. The large error bars seen in M17 cells treated with zinc
is a result of these high Ct values.
Chapter 2.3: Results
58 | P a g e
Figure 2.4: hZnT1 expression levels following DHA treatment in different cell lines.
Expression profile of hZnT1 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A)
and supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using
QPCR analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
59 | P a g e
Figure 2.5: hZnT2 expression levels following DHA treatment in different cell lines.
Expression profile of hZnT2 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A)
and supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using
QPCR analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
60 | P a g e
2.3.2.3 hZnT3
In HaCaT cells treated with DHA in the absence of zinc, the expression level of hZnT3
was significantly downregulated as much as 73 fold difference compared to the DHA
depleted cells. This down regulation was also consistent in all DHA treatment groups
(Figure 2.6A), where a dose dependent bell shaped curve could be seen, with the 10
μg/mL DHA dose giving the largest downregulation. Significant and dose dependent
downregulation could also be seen in M17 cells (Figure 2.6A) with up to 12 fold
difference in hZnT3 expression at the 40 μg/mL DHA dose. In SY5Y cells (Figure 2.6A),
the transporter expression level was not consistent or significant, except at the
highest DHA doses where significant upregulation was detected. In NT2 cells (Figure
2.6A), the downregulation was very similar to M17 cells, and dose dependent when
treated with DHA in the absence of zinc. With higher DHA concentrations there was
a significant downregulation in the expression levels of almost 16 fold difference.
DHA plus zinc treatment (Figure 2.6B) of HaCaT cells did not give a reliable pattern
for hZnT3 but a general upregulation trend could be seen across the triplicate
experiments. M17 cells followed a similar pattern (Figure 2.6B) to that of HaCaT
cells, and addition of zinc impaired the original downregulation seen with no zinc
treatment, to a significant upregulation with some DHA doses. SY5Y cells showed a
slight downregulation with the addition of zinc (Figure 2.6B), which is opposite to the
upregulation seen in the absence of zinc (Figure 2.6A). However, NT2 cells lost its
consistency in the hZnT3 expression pattern when treated with both zinc and DHA
(Figure 2.6B). In these cells, the two middle DHA doses showed gradually decreasing
Chapter 2.3: Results
61 | P a g e
downregulation, which was then followed by and an upregulation at the highest
dose. When the four cell lines treated with DHA and zinc were compared, the
expression patterns and levels of hZnT3 were not consistent. However, when
treated with DHA with no additional zinc, M17 and NT2 cells displayed a dose
dependent significant downregulation (Figure 2.6A). In contrast, HaCaT and SY5Y
cells were not consistent even in the absence of zinc, suggesting that SY5Y cells may
be behaving more like a keratinocyte cell line under these conditions with respect to
this transporter.
2.3.2.4 hZnT4 and hZnT5
In HaCaT and M17 cells, hZnT4 expression was almost consistently downregulated in
response to DHA treatment without zinc (Figure 2.7A). In HaCaT cells, fold
differences were significant only at 5 and 10 μg/mL DHA doses. However, the
downregulation seen in M17 cells were significant at 10, 20 and 40 μg/mL DHA doses
(Figure 2.7A). NT2 cells also showed a significant downregulation at 5, 10 and 20
μg/mL DHA doses, but at the highest dose the fold difference could not be calculated
due to the lack of consistency. With zinc treatment, a downregulation pattern could
still be seen in HaCaT cells, although the results lack a dose dependent pattern. In
M17 cells, compared to the no zinc treatment, the level of hZnT4 downregulation was
lower, which was closer to the non-significance threshold area in cells treated with
most doses of DHA plus zinc (Figure 2.7B). These changes were also seen in NT2 cells
Chapter 2.3: Results
62 | P a g e
apart from at one DHA dose (20 μg/mL), where a significant upregulation could be
seen (Figure 2.7B). SY5Y cells showed significant downregulation in hZnT4
expression in response to all DHA doses, however these changes were not dose
dependent (Figure 2.7B). Moreover, all the Ct values for hZnT4 were around the mid-
twenties, indicating a positive and specific amplification pattern throughout all the
three replicate experiments.
In all the three experiment sets, no reasonable Ct values could be obtained for hZnT-
5 in any of the cell lines, so a graph is not shown for this transporter. This may be
due to the primers used for this transporter or very low transcript levels in the cell
lines examined in this study.
Chapter 2.3: Results
63 | P a g e
Figure 2.6: hZnT3 expression levels following DHA treatment in different cell lines.
Expression profile of hZnT3 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A)
and supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using
QPCR analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
64 | P a g e
Figure 2.7: hZnT4 expression levels following DHA treatment in different cell lines.
Expression profile of hZnT4 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A)
and supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using
QPCR analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
65 | P a g e
2.3.2.5 hZnT6
In HaCaT and SY5Y cells treated without zinc (Figure 2.8A), DHA doses did not cause
much change in the expression level of hZnT6, with both cell lines being in the non-
significance zone. In contrast, a staggering change was detected in M17 cells, where
a significant downregulation was detected in a dose dependent manner, apart from
at the 40 μg/mL concentration, which was the toxic level. This downregulation was
consistent in replicates and Ct values were again closer to mid-twenties indicating
significance and accuracy. NT2 cells also showed downregulation of hZnT6 at some
DHA doses, although a consistent DHA dose dependent pattern could not be
identified.
Following zinc treatment (Figure 2.8B), downregulation of hZnT6 expression in M17
cells was significantly reduced and this was consistent between the replicate
experiments. HaCaT, SY5Y and NT2 cells also did not show a significant change,
though they showed a general downregulation pattern. At the maximum DHA dose,
NT2 cells reached significance where a 5 fold downregulation was observed (Figure
2.8B).
Chapter 2.3: Results
66 | P a g e
2.3.2.6 hZnT7
In HaCaT, M17 and SY5Y cell lines this transporter did not show a significant alteration
in its expression in response to DHA and with or without zinc treatment (Figure 2.9A
& 2.9B). However, there was a significant upregulation of hZnT7 in SY5Y cells at the
40 μg/mL DHA dose (without zinc), but this finding was disregarded as this dosage
was toxic to some cells. In contrast, in NT2 cells DHA treatment without zinc resulted
in a consistent downregulation of hZnT7 (Figure 2.9A). However, this
downregulation was not significant. When NT2 cells were treated with DHA plus zinc,
a downregulation pattern was also observed, although this was not prominent or
consistent as with the no zinc treatment group. In all cell lines, Ct values obtained for
this transporter were low, indicating significant and accurate amplification.
Chapter 2.3: Results
67 | P a g e
Figure 2.8: hZnT6 expression levels following DHA treatment in different cell lines.
Expression profile of hZnT6 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A)
and supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using
QPCR analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
68 | P a g e
Figure 2.9: hZnT7 expression levels following DHA treatment in different cell lines.
Expression profile of hZnT7 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A)
and supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using
QPCR analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
69 | P a g e
2.3.2.7 hZIP1
In general, M17 cells showed an upregulation of hZIP1 expression levels with (Figure
2.10A) and without zinc (Figure 2.10B) treatment. Cells treated without zinc
displayed a dose dependent pattern, although the results did not reach significance.
NT2 cells showed a significant downregulation pattern when treated with DHA in the
absence of zinc. When zinc was present, the effect was reversed and the transporter
showed an inconsistent upregulation pattern, but most of these values were not
significant. Likewise, HaCaT and SY5Y cells did not show any significant changes in
hZIP1 expression with or without zinc treatment.
2.3.2.8 hZIP2
In the absence of zinc, HaCaT, M17 and SY5Y cell lines demonstrated a
downregulation pattern for the expression of this transporter (Figure 2.11A). Once
again, M17 showed more significant downregulation than the other cell lines when
treated without zinc (Figure 2.11A), and the same pattern could be seen to a lesser
extent when treated with the combination of both zinc and DHA (Figure 2.11B).
However, SY5Y cells treated with zinc and DHA showed an upregulation of hZip2
(Figure 2.11B), which was the opposite of what was observed without zinc (Figure
2.11A). HaCaT cells did not show any significant difference in hZip2 expression in
response to DHA and zinc.
Chapter 2.3: Results
70 | P a g e
Figure 2.10: hZip1 expression levels following DHA treatment in different cell lines.
Expression profile of hZip1 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A) and
supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using QPCR
analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
71 | P a g e
Figure 2.11: hZip2 expression levels following DHA treatment in different cell lines.
Expression profile of hZip2 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A) and
supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using QPCR
analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
72 | P a g e
Moreover, the Ct values were substantially high for all these three cell lines indicating
possible non-specific amplification.
No reasonable Ct values could be obtained with the NT2 cell line for this transporter,
therefore a graph is not shown. This may be due to the absence or very low transcript
levels of this transporter in the NT2 cells used in this study.
2.2.9 hZIP3 and hZIP4
In M17 cells, a significant downregulation of hZip3 (Figure 2.12A) was identified in
two doses of DHA without zinc. However, this was not dose dependent or consistent
across all of the DHA doses. This downregulation was more pronounced in the
presence zinc (Figure 2.12B), and at the 20 μg/mL DHA dose a 2 fold downregulation
was detected. NT2 cells also showed a similar pattern to M17 cells in the DHA
without zinc treatment groups. However, this downregulation was more consistent
and significant compared to M17 cells. Results obtained for the zinc added treatment
groups of NT2 cells were not consistent (Figure 2.12B).
Although high error bars are present due to high Ct values, HaCaT cells showed an
upregulation of hZip3 expression in DHA treatment groups without zinc (Figure
2.12A). These error bars were much smaller in DHA plus zinc treatment groups (Figure
2.12B). SY5Y cells did not show any significant difference in hZip3 expression in
response to DHA over time with or without zinc.
Chapter 2.3: Results
73 | P a g e
In contrast, changes in the hZIP4 expression without zinc were similar in HaCaT, M17
and NT2 cell lines, with the exception of some DHA doses in M17 and NT2 cells (Figure
2.13A). In general, HaCaT, M17 and NT2 cell lines displayed downregulation without
zinc treatment (Figure 2.13A). With the combination of both zinc and DHA treatment
(Figure 2.13B), HaCaT, SY5Y and NT2 cells showed upregulation in hZIP4 expression,
but expression in M17 cells was consistently downregulated. In the absence of added
zinc SY5Y cells displayed an opposite trend to the other two cell lines, indicating a
possible cell specific importance for this transporter. However, in the presence of
zinc it behaved more like HaCaT and NT2 cells showing an upregulation of hZIP4,
though the values did not reach significance.
Based on the results obtained from these experiments, hZnT3 was selected as the
transporter of choice for further experiments.
Chapter 2.3: Results
74 | P a g e
Figure 2.12: hZip3 expression levels following DHA treatment in different cell lines.
Expression profile of hZip3 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A) and
supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using QPCR
analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
75 | P a g e
Figure 2.13: hZip4 expression levels following DHA treatment in different cell lines.
Expression profile of hZip4 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A) and
supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using QPCR
analysis. Fold differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
76 | P a g e
2.3.3 DHA effect on cell survival
The effect of DHA on cell survival was studied using four different DHA doses (0, 2.5,
10, 40 μg/mL). M17 cells were grown with or without supplements for 2 days and
then tested for apoptosis end marker caspase-3 and an apoptosis regulator protein
Bcl-2, using Western blotting.
M17 cells exposed to 20 μg/mL DHA for 2 days demonstrated a marked reduction in
caspase-3 protein levels when compared to untreated cells (Figure 2.14A). Equal
protein loading of the gel lanes was assessed by Western blot analysis for the
housekeeping gene, β-actin (Figure 2.14B). Caspase-3 protein levels were then
normalised against the β-actin protein levels and densitometry analysis was
performed to quantify the changes in the expression levels. Following densitometry
analysis, it was revealed that there was more than 66% reduction in caspase-3 protein
levels with the 20 μg/mL DHA treatment when compared to untreated cells (Figure
2.14C). This reduction in the caspase-3 protein levels was significant and consistent
across the replicates.
In contrast, Bcl-2 protein levels were upregulated following DHA treatment (Figure
2.15A) suggesting that DHA has initiated an apoptosis suppression mechanism in
these cells. Again, equal protein loading of the gel lanes was assessed by Western
blot analysis for the β-actin housekeeper gene (Figure 2.15B). Following
normalization to the house keeping gene, densitometric analysis was performed.
Densitometry analysis also confirmed the increase in Bcl-2 protein expression levels
Chapter 2.3: Results
77 | P a g e
(Figure 2.15C). DHA treated cell lysates showed a significant increase in band
intensity compared to untreated cells. Quantification through densitometric analysis
showed a 110% increase in Bcl-2 protein levels when subjected to 20 μg/mL DHA
treatment in comparison to untreated cells.
Chapter 2.3: Results
78 | P a g e
Figure 2.14: Western blot analysis of Caspase-3 protein levels following DHA
treatment in M17 cells.
Caspase-3 protein (A) and the housekeeping gene β-actin protein (B) levels of M17
cells cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were
detected with specific antibodies. (C) Densitometric analysis of caspase-3 protein
levels (normalised with the β -actin protein levels) are shown in arbitrary units (AU).
Molecular mass protein markers (Mr) are indicated on the left of each gel. This result
is representative of three similar independent experiments.
Chapter 2.3: Results
79 | P a g e
Figure 2.15: Western blot analysis of Bcl-2 protein levels following DHA treatment
in M17 cells.
Bcl-2 protein (A) and the housekeeping gene β-actin protein (B) levels of M17 cells
cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were detected
with specific antibodies. (C) Densitometric analysis of Bcl-2 protein levels (normalised
with the β -actin protein levels) are shown in arbitrary units (AU). Molecular mass
protein markers (Mr) are indicated on the left of each gel. This result is representative
of three similar independent experiments.
Chapter 2.3: Results
80 | P a g e
2.3.4 Effects of DHA on ZnT3 protein levels
The expression level of ZnT3 was analysed in extracts from HaCaT, M17, SY5Y and
NT2 cells treated with different concentrations of DHA (0, 5, 10 and 20 μg/mL). A
ZnT3 transporter specific antibody was used to identify the proteins. The predicted
band size of the proteins were identified from ExPASy database
(http://au.expasy.org/) and by using the protein amino acid sequence from NCBI
database (http://www.ncbi.nlm.nih.gov/).
2.3.4.1 ZnT3 protein expression levels in M17 cells following DHA treatments
ZnT3 expression was identified in the lysates of all treated M17 cells by the presence
of a band of approximately 41.9 kDa in all lanes (Figure 2.16A). Protein levels showed
a dose dependent reduction when treated with DHA. ZnT3 protein levels were
markedly reduced in the cells exposed to 20 μg/ml DHA, when compared with the
untreated cells. To ensure equal lane protein loading of the gels, protein levels of the
β-actin housekeeping gene were assessed (Figure 2.16B). When the ZnT3 protein
levels were normalised with the β-actin protein levels, densitometry analysis
revealed more than 55% reduction in ZnT3 protein levels with the 20 μg/ml DHA
treatment when compared with the untreated cells (Figure 2.16C).
Chapter 2.3: Results
81 | P a g e
Figure 2.16: ZnT3 protein levels following DHA treatment in M17 cells.
ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of M17 cells
cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were detected
with specific antibodies. (C) Densitometric analysis of ZnT3 protein levels (normalised
with the β -actin protein levels) are shown in arbitrary units (AU). Molecular mass
protein markers (Mr) are indicated on the left of each gel. This result is representative
of three similar independent experiments.
Chapter 2.3: Results
82 | P a g e
2.3.4.2 ZnT3 protein expression levels in SY5Y cells following DHA treatments
ZnT3 expression was identified by the presence of a band approximately 41.9 kDa in
size in all lanes containing lysates of treated SY5Y cells (Figure 2.17A). The β-actin
housekeeping gene levels were assessed to ensure equal protein loading (Figure
2.17B), followed by a densitometric analysis to quantify the changes (Figure 2.17C).
Densitometric results obtained with SY5Y cells were not significant or consistent.
These protein results were in line with the QPCR results for SY5Y cells.
2.3.4.3 ZnT3 protein expression levels in HaCaT cells following DHA treatments
All treated HaCaT cells were identified to express ZnT3 by the presence of a band of
approximately 41.9 kDa in size (Figure 2.18A). Following normalisation using β-actin
as the housekeeping gene (Figure 2.18B), the results showed a decrease in ZnT3
expression with some DHA doses. Densitometric results also showed a decrease in
ZnT3 protein levels (Figure 2.18C) at 5 & 10 μg/mL DHA doses. However, this
decrease was reversed at the 20 μg/mL DHA concentration, where a similar level of
expression as the untreated cells was detected for ZnT3 protein. Changes in ZnT3
expression was not dose dependent between the replicates.
Chapter 2.3: Results
83 | P a g e
Figure 2.17: ZnT3 protein levels following DHA treatment in SY5Y cells.
ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of SY5Y cells
cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were detected
with specific antibodies. (C) Densitometric analysis of ZnT3 protein levels (normalised
with the β -actin protein levels) are shown in arbitrary units (AU). Molecular mass
protein markers (Mr) are indicated on the left of each gel. This result is representative
of three similar independent experiments.
Chapter 2.3: Results
84 | P a g e
Figure 2.18: ZnT3 protein levels following DHA treatment in HaCaT cells.
ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of HaCaT cells
cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were detected
with specific antibodies. (C) Densitometric analysis of ZnT3 protein levels (normalised
with the β -actin protein levels) are shown in arbitrary units (AU). Molecular mass
protein markers (Mr) are indicated on the left of each gel. This result is representative
of three similar independent experiments.
Chapter 2.3: Results
85 | P a g e
2.3.4.4 ZnT3 protein expression levels in NT2 cells following DHA treatments
ZnT3 expression was also identified in lysates of NT2 cells. All the lanes with different
DHA doses displayed a band of approximately 41.9 kDa in size (Figure 2.19A). A
reduction in the band intensity was visible with increasing DHA dose. The expression
levels were normalized to the house keeping gene β-actin and lane loading was also
normalized using the house keeper gene (Figure 2.19B). Results were quantified
using densitometric analysis (Figure 2.19C). Approximately a 9 fold decrease was
present in protein expression levels between untreated and 20 μg/mL DHA treated
cells. This decrease was significant and displayed a dose dependent pattern similar
to M17 cells.
Chapter 2.3: Results
86 | P a g e
Figure 2.19: ZnT3 protein levels following DHA treatment in NT2 cells.
ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of NT2 cells
cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were detected
with specific antibodies. (C) Densitometric analysis of ZnT3 protein levels (normalised
with the β -actin protein levels) are shown in arbitrary units (AU). Molecular mass
protein markers (Mr) are indicated on the left of each gel. This result is representative
of three similar independent experiments.
Chapter 2.3: Results
87 | P a g e
2.3.5 DHA effect with and without vitamin E on the ZnT3 transporter
DHA is known to be a highly oxidative substance. Thus, DHA effects on a culture
system may not be effective for the entire incubation time. In these instances,
vitamin E can be used as a free radical scavenger to enhance the effects of DHA on
cells.
2.3.5.1 Vitamin E working concentration
Firstly, three different vitamin E doses were tested to find the optimal working
concentration of vitamin E for further studies. M17 cells were incubated for 2 days
with vitamin E (0, 0.5, 0.05, 0.005 mol/L) and DHA (20 μg/mL). Following treatments,
QPCR was performed to test the influence on ZnT3 transporter levels. When there
was DHA present, ZnT3 expression was significantly downregulated at all three
vitamin E doses (Figure 2.20). However, at the 0.5 mol/L vitamin E concentration
some cells started dying suggesting this dosage is closer to the toxic level. Therefore,
the middle dose of 0.05 mol/L vitamin E was selected for further experiments.
2.3.5.2 ZnT3 mRNA expression levels with DHA and vitamin E
Following DHA treatment with vitamin E, ZnT3 mRNA levels in M17 cells were
analysed using QPCR. M17 cells were treated with four different DHA concentrations
Chapter 2.3: Results
88 | P a g e
(0, 5, 10, 20 and 40 μg/mL) for 2 days with 0.05 mol/L vitamin E and then tested for
changes in ZnT3 expression. Results obtained were normalised using the internal
control GAPDH and presented relative to expression level in untreated cells. Both 5
and 10 μg/mL DHA doses showed a significant downregulation of more than 80 fold
in ZnT3 expression (Figure 2.21). This downregulation was dose dependent apart
from at the 40 μg/mL dose and the results were consistent among three individual
sets of experiments.
Chapter 2.3: Results
89 | P a g e
Figure 2.20: Calculating vitamin E working concentration.
Three different Vitamin E (0, 0.5, 0.05, 0.005 mol/L) doses were analysed using with
QPCR to test optimal working concentration for vitamin E. Fold differences above
and beyond x5 is noted on the figure.
Chapter 2.3: Results
90 | P a g e
Figure 2.21: hZnT3 mRNA levels following DHA treatment in the presence of vitamin
E in M17 cells.
hZnT3 expression levels were analysed following DHA (0, 5, 10, 20 and 40 μg/mL)
treatment in the presence of vitamin E (0.05 mol/L), using QPCR analysis. Fold
differences above and beyond x5 is noted on the figure.
Chapter 2.3: Results
91 | P a g e
2.3.5.3 ZnT3 protein levels with DHA and vitamin E
Vitamin E (0.05 mol/L) and DHA (0, 5, 10,20 and 40 μg/mL) treated M17 cells were
collected, lysed and the protein was analysed using Western blotting. ZnT3 was
expressed in treated M17 cells indicated by a band of approximately 41.9 kDa in all
lanes (Figure 2.22A). ZnT3 protein levels were markedly reduced in cells exposed to
DHA and vitamin E, when compared to untreated cells. To ensure equal protein
loading across gel lanes, levels of the β-actin housekeeper gene was assessed (Figure
2.22B). Densitometric analysis also confirmed a significant reduction in ZnT3 protein
when treated with vitamin E and DHA (Figure 2.22C).
Chapter 2.3: Results
92 | P a g e
Figure 2.22: ZnT3 protein levels following DHA treatment in the presence of vitamin
E in M17 cells.
ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of M17 cells
cultured in the absence and presence (0, 5, 10,20 and 40 μg/mL) of DHA and vitamin
E (0.05 mol/L) were detected with specific antibodies. (C) Densitometric analysis of
ZnT3 protein levels (normalised with the β -actin protein levels) are shown in arbitrary
units (AU). Molecular mass protein markers (Mr) are indicated on the left of each gel.
This result is representative of three similar independent experiments.
Chapter 2.4: Discussion
93 | P a g e
Chapter 2.4: Discussion
Cellular zinc and omega-3 FA levels are both known to be vital in many biological and
biochemical pathways in the human body. Moreover, altered metabolism of zinc and
omega-3 FAs are known to cause diverse health effects. Thus, the human body
contains specific yet complex mechanisms to closely regulate the absorption and
excretion of these compounds. Both zinc and omega-3 FAs are present abundantly
in neuronal membranes and many neural cellular functions as well as the structural
integrity of the cells are greatly reliant on the presence of zinc and omega-3 FAs.
Thus, neurodegenerative disorders such as AD have been linked with their
deficiencies. Recent studies have revealed a link between DHA (an omega-3 FA)
levels and zinc metabolism in rats, indicating possible synergistic effects at the
cellular level (Jayasooriya et al., 2005b). Combined with many epidemiological
studies, this finding has opened up a new level of mental health research in regard to
DHA and zinc. However, there is a lack of studies conducted using human cell models
to investigate this relationship between DHA and zinc homeostasis. Thus, this study
aimed to understand a possible relationship between DHA and zinc in cultured
human neuronal cells. This was carried out in three major steps; first to investigate
the effects of DHA and zinc levels on zinc transporter gene expression levels in
neuronal cells. Then the zinc transporter protein levels were analysed in relation to
different DHA and zinc levels. Thirdly, to understand the effect of vitamin E as a free
radical scavenger and thus prevent oxidisation of DHA and increase the effects of
Chapter 2.4: Discussion
94 | P a g e
DHA at the cellular level.
2.4.1 Effects of DHA and zinc on zinc transporter expression levels
Cells treated with different doses of DHA (0, 5, 10, 20 and 40 μg/mL) in the presence
or the absence of zinc were used to isolate total RNA, and then RNA was reverse
transcribed to cDNA, and used in a QPCR assay to measure the changes in gene
expression levels. hZnT 1–7 and hZip 1–4 transporters along with GAPDH as the
internal control were analysed for any changes in expression. Overall, down
regulation of zinc transporters was prominent at mRNA level in all four cell lines
regardless of the treatment. However, some significant changes could be seen in the
expression levels of several transporters in response to different treatments.
2.4.1.1 hZnT1
Changes observed in hZnT1 expression levels were different between the control and
the neuronal cell lines (Figure 2.4). HaCaT, the control cell line showed an overall up-
regulation pattern in regard to hZnT1 expression levels (Figure 2.4A). With zinc
treatment NT2 cells also displayed some level of hZnT1 upregulation (Figure 2.4B). In
contrast, NT2 cells treated with DHA in the absence of zinc showed a significant
downregulation. However, these changes were not dose dependent. In addition, in
both neuronal cell lines SY5Y and M17, hZnT1 expression was mainly downregulated,
Chapter 2.4: Discussion
95 | P a g e
again more significant with zinc treatment than without. In general, hZnT
transporters have been identified as facilitators of zinc efflux from the cytosol to the
luminal compartments (Jayasooriya et al., 2005b). hZnT1 was the first zinc
transporter family member to be identified (Palmiter, 1995a) and it’s ubiquitously
expressed in tissues, with the highest expression in the cerebral cortex and
cerebellum (Sekler et al., 2002). A rat neuronal cell line (PC12) study with
overexpressed and negative dominant ZnT1 gene has shown that zinc induced
apoptosis in neuronal cells is influenced by ZnT1 transporter (Kim et al., 2000).
Another mouse study intended to knockout ZnT1 expression has failed due to the
embryonic lethality of knockout mice (Andrews et al., 2004), thus indicating the
importance of the ZnT1 transporter in cellular functions. Moreover, hZnT1 is
identified as one of the main zinc transporter proteins in human cells (Liuzzi et al.,
2004; Sekler et al., 2002). Cells highly sensitive to extracellular zinc concentration
normally have less hZnT1 expression levels (McMahon, 1998).
As discussed above, higher expression of hZnT1 levels facilitate more efflux of zinc
into extracellular matrix. Thus, this decrease in hZnT1 expression level in response
to high DHA doses can reduce internal zinc accumulation in extracellular matrix. In
neurodegenerative conditions such as AD a high level of zinc accumulation could be
seen (Huang et al., 2000). Moreover, zinc is closely related to the formation if
neurofibrillary tangles (Bush et al., 1994b). High levels of zinc have been linked with
Aβ aggregation and induced amyloid plaque formation (Bush et al., 1994a; Bush et
al., 1994b). Amyloid plaque is one of the main pathological features in AD (Vickers et
al., 2000). Thereby, this finding indicates a possible mechanism of DHA in preventing
Chapter 2.4: Discussion
96 | P a g e
neurodegenerative diseases. However, the dose dependent pattern could not be
seen with DHA treatments in any of the cell lines indicating that hZnT1 might not be
the most prominent or the most important pathway of DHA induced neuro-
protection in these cell lines.
2.4.1.2 hZnT2
hZnT2 mRNA levels were downregulated in all cell lines subjected to DHA treatment
in the absence of added zinc (Figure 2.5). In HaCaT cells this downregulation was not
significant. However, in the other three cell lines multiple DHA doses were able to
downregulate hZnT2 levels beyond the significance threshold. A similar
downregulation pattern to a lesser extent was seen in zinc treated cells, suggesting
the extra zinc availability has created a higher demand for this specific zinc
transporter. One study has shown a significant downregulation in hZnT2 levels in
response to low zinc availability (Liuzzi et al., 2003), which was also confirmed in this
study. In M17 cells, an upregulation of hZnT2 was detected when treated with DHA
and zinc. This suggests a possible specificity or importance of hZnT2 transporter in
M17 cells.
The ZnT2 transporter is known to be present in unique tissues where zinc
requirement is high, such as in mammary and prostate glands (Lopez and Kelleher,
2009). Immunohistochemistry studies conducted with ZnT2 transporter has
Chapter 2.4: Discussion
97 | P a g e
identified its vesicular localisation pattern (Kelleher and Lonnerdal, 2002). It has also
been reported that ZnT2 transporters exhibits transient regulation (Lopez and
Kelleher, 2009), localises to vesicles and functions in the sequestration of zinc into
vesicles. Studies performed with ZnT2 and mammary epithelial cells have shown a
link between the ZnT2 availability and zinc exportation across the cell membrane
(Chowanadisai et al., 2006). Though the exact mechanism by which ZnT2 works to
maintain the zinc homeostasis is yet unknown, intracellular localization and a positive
correlation between zinc exposure and ZnT2 presence has led to the suggestion that
this transporter participates in vesicular zinc sequestration and possible export or
secretion from the tissues (Liuzzi and Cousins, 2004a).
2.4.1.3 hZnT3
ZnT3 expression, like that of ZnT2, also shows a restricted distribution pattern. It has
been identifies in both the rodent brain and testis (Palmiter, 1995a), and in the
human breast epithelial cells (Michalczyk et al., 2002). Distribution of this transporter
in the rat brains is found to be limited to the synapses and axons of glutamatergic
neurons, indicating a possible role for this transporters in neuronal health (Liuzzi et
al., 2004). Vascularisation of zinc and the triggered zinc release from synaptic vesicles
is mainly controlled by ZnT3 transporters (Palmiter, 1995a).
Changes in the hZnT3 expression at the mRNA level was one of the most interesting
Chapter 2.4: Discussion
98 | P a g e
and important findings of this study. In response to DHA doses without zinc
treatment, M17 and NT2 cells showed a significant and dose dependent
downregulation in hZnT3 mRNA levels (Figure 2.6). HaCaT cells also showed a bell
shaped downregulation when treated with DHA in the absence of zinc, although this
downregulation was not dose dependent. hZnT3 mRNA expression levels in SY5Y
cells were not significant in the presence of DHA with no zinc treatment. When
treated with zinc and DHA, an upregulation pattern was prominent in HaCaT, M17
and NT2 cells (Figure 2.6). All four cell lines exhibited converse expression patterns
with zinc and without zinc, indicating a possible zinc responsive mechanism in the
expression of this transporter. Protein studies done with the ZnT3 also confirmed the
mRNA results in all the cell lines. In M17 cells, ZnT3 protein levels were significantly
downregulated in a dose dependent manner when treated with DHA and no zinc
(Figure 2.16). HaCaT cells and SY5Y cells displayed dissimilarities in the ZnT3 protein
levels when treated with different DHA doses (Figure 2.17 & 2.18). Protein results
obtained with NT2 cells also correlate with mRNA results, where a significant dose
dependent downregulation was seen (Figure 2.19). Observations made in this study
for this transporter expression was in line with the previous rat study done by
Jayasooriya and colleagues (2005). Altered ZnT3 expression levels in rat brains have
been linked to abnormal zinc metabolism, and moreover, the same study has
revealed a link between increased ZnT3 expression levels with the decrease DHA
consumption (Jayasooriya et al., 2005b). Thus, it can be postulated that this is the
key transporter in both humans and rats, which links DHA, zinc and AD. The human
ZnT3 protein has 388 amino acids and shares more than 85% homology with rat and
mouse ZnT3 proteins (Smidt and Rungby, 2012). Hence, the correlation seen
Chapter 2.4: Discussion
99 | P a g e
between the two transporters when treated with DHA can be understood. Another
study done with amyloid-β protein precursor (AβPP)/presenilin 1 (PS1) transgenic
mice has shown elevated levels of ZnT3 protein in these mice (Zheng et al., 2010).
These findings suggest a possible link between ZnT3 and amyloid-β at the cellular
level. Extracellular plaque deposits of the amyloid-β peptide are one of the hallmark
pathologies required for the diagnosis of AD (Murphy and LeVine, 2010). In addition,
ZnT3 knock-out mice display reduced synaptic localization of amyloid-β
oligomerization compared to its wild type counterpart (Deshpande et al., 2009). A
further study done with ZnT3 knock-out mice demonstrated a significant reduction in
the quantity and size of plaque build-up compared to the wild type mice (Lee et al.,
2002). Moreover, post-mortem AD brains has shown high expression of ZnT3 in the
zinc containing plaques and amyloidangiopathy diseased vessels (Zhang et al., 2008).
Collectively, these published data highlight the importance of the ZnT3 transporter,
especially in relation to neurodegeneration. Thus, an understanding of the decrease
in expression of ZnT3 in such conditions will be of vital importance to at least mange
if not cure these diseases. The findings of this study shed light on such a pathway,
where a DHA induced downregulation was prominent in two human cell lines.
2.4.1.4 hZnT4
Changes in hZnT4 expression levels were consistent in all cell lines (Figure 2.7), except
for NT2 cells treated with zinc, which showed a slight upregulation. However, the
changes in mRNA levels for hZnT4 was not dose dependent in many cases. In
neuronal cells, hZnT4 is mainly localised on the Golgi apparatus and endoplasmic
Chapter 2.4: Discussion
100 | P a g e
reticulum, hence sequestrating zinc into intracellular compartments (Wang et al.,
2005). Increased intercellular zinc accumulation is known to promote
neurodegenerative conditions. A study with mutant mice carrying pathogenic forms
of the human APP and deficient in intracellular zinc has shown less severe AD
pathological features than mice with normal zinc levels (Lee et al., 2002). Therefore,
the decrease in hZnT4 expression levels hZnT with high DHA doses again provides
evidence for a possible link between omega-3 FA availability and AD conditions.
2.4.1.5 hZnT6
Cells from liver, brain and small intestine has shown the highest concentration of
hZnT6 mRNA levels (Huang et al., 2002). Immunofluorescence studies conducted
with this transporter have identified a localisation, mainly concentrated in Golgi
network and in the cell periphery (Huang et al., 2002). hZnT6 transporter is known
to be vital in allocating cytoplasmic zinc into trans-Golgi network. In an experiment
with AD and early AD brain subjects, it has been shown that a significant (P<0.05)
increase in hZnT6 expression levels has occurred in hippocampus / parahippocampal
gyrus regions (Smith et al., 2006). Moreover, AD conditions are widely related to
decrease DHA consumption (Connor and Connor, 2007; Horrocks and Yeo, 1999).
Following the DHA treatment, a consistent downregulation at the mRNA level was
observed for hZnT6 transporter in all four cell lines. However, significance was only
reached with M17 cells, indicating a potential specificity of the behaviour or a
Chapter 2.4: Discussion
101 | P a g e
functional importance for this zinc transporter in M17 cells. No zinc treatment
resulted in a significant downregulation compared with zinc treatment, suggesting a
zinc dependent mechanism in gene regulation.
2.4.1.6 hZnT5 and hZnT7
With regard to hZnT7 expression levels, some changes could be observed when
treated with DHA. However, even with low Ct values most of the changes observed
were under the 2 fold significance level for hZnT7 mRNA in all four cell lines.
hZnT7 is mainly localised vascularly and found to have a function in accumulating zinc
into Golgi apparatus and is predominantly expressed in the small intestine, liver and
spleen and to a lesser extent in the kidney, lung and brain (Kirschke and Huang, 2003).
Thus, hZnT7 may not have a significant role in either neuronal cells or skin cells. The
Ct values for hZnT5 were extremely low (data not shown), indicating non-specific,
self-annealing or pair annealing of the primer had most likely occurred.
2.4.1.7 hZip 1-4
Analysis of hZip expression levels in general, did not produce significant or consisting
regulation patterns. However, in M17 cells a consistent downregulation was present
and this was more prominent in NT2 cells (Figure 2.10).
Chapter 2.4: Discussion
102 | P a g e
Zip family facilitates zinc movement into the cytosol, either from the extracellular
environment or intracellular compartments (Gaither and Eide, 2000). Thus, it could
be assumed that the expression levels would increase in the absence of zinc.
However, this phenomenon could not be clearly visible with any of the Zip
transporters during this study. In most cases a higher degree of downregulation was
seen without zinc than in the zinc treatment. If DHA has a down-regulatory effect on
Zip transporter family, this change could be interpreted as a zinc effect, which would
be consistent with the previous assumption. However, DHA effects on Zip
transporter family expression levels has not been adequately studied. Therefore,
there is a lack of information to support this observation. The changes in expression
of hZip mRNA levels in regards to zinc levels have been shown to be more efficient in
younger rats when compared with older rats (Wang et al., 2004a). This suggests a
possible age related discrepancy in zinc metabolism with this transporter. The same
phenomena of altered metabolism of zinc with the age is a common pathological
feature with AD conditions as well.
At the same time, the importance of the Zip family on zinc homeostasis is well
documented. Zip4 is the gene that is thought to be the most important for zinc
homoeostasis since it is responsible for a rare recessive-lethal human genetic
disorder Acrodermatitis enteropathica (Dufner-Beattie et al., 2003). Patients with
this genetic disease exhibit zinc malabsorption and suffer from a severe zinc
deficiency due to a mutation of the Zip4 gene. Moreover, translational and post-
translational modification processes are thought to affect Zip transporter expression
Chapter 2.4: Discussion
103 | P a g e
levels (Gaither and Eide, 2000). Zip family members have been found to transit
between the plasma membrane and intracellular compartments in zinc replete cells.
However, with zinc deprivation, Zip family members have been found to be localised
more on the plasma membrane, by decreasing their rate if endocytosis (Dufner-
Beattie et al., 2003; Wang et al., 2004a). Therefore, a putative link between the post-
translational control and zinc levels with Zip family members exist. However, this
study was more focussed on mRNA and protein levels, and not the protein
localisation patterns. Therefore, it is possible that no significant expression changes
had occurred, but the localisation patterns were different following the DHA
treatment. Such changes could not be deduced in this study. A localisation study
with different DHA and zinc levels would therefore, be beneficial to our
understanding of the behaviour if these Zip proteins.
2.4.2 Effects of DHA and zinc on neuronal cell survival
As discussed in published data, DHA treated M17 cells were tested for apoptotic
marker levels. Caspase-3 and Bcl-2 were used to assess the apoptosis levels after
treating the cells with relevant DHA doses for 48 hours. Caspase-3 is a frequently
activated death protease, and one of its main functions is to catalyse the specific
cleavage of many key proteins at the cellular level (Porter and Janicke, 1999).
Caspase-3 is also required in apoptotic chromatin condensation and DNA
fragmentation, thus making it essential in the apoptotic process (Porter and Janicke,
1999).
Chapter 2.4: Discussion
104 | P a g e
When treated with DHA, M17 cells display a clear reduction in caspase-3 protein
levels (Figure 2.14). More than a 60% reduction was seen at the 20 μg/mL DHA dose
when compared with control cells. On the other hand, a clear increase could be seen
with Bcl-2 protein levels when treated with DHA (Figure 2.15). The Bcl-2 family act
as either anti- or pro-apoptotic regulators and are mainly responsible for determining
whether a cell should live or die (Vaux et al., 1988). Bcl-2 protein is a member of the
Bcl-2 family of regulator proteins and is considered as an important anti-apoptotic
protein in human cells (Cory et al., 2003). Thus, the decrease seen in the Bcl-2 levels
when treated with DHA indicates a protective mechanism at the cellular level against
programmed cell death.
2.4.3 Vitamin E and DHA effect on ZnT3 expression level
DHA is well known for its susceptibility to spontaneous oxidation. A long chain of 22
carbons and 6 double bonds in its structure has given this extreme nature to DHA
(Stillwell and Wassall, 2003). Thus, many studies have shown the importance of using
a free radical scavenger such as vitamin E with DHA to minimize oxidation and also to
enhance the effects of PUFAs (Kubo et al., 1997; Piche et al., 1988; Wander et al.,
1996). Thus, M17 cells were used to test vitamin E effect when treated with DHA.
Firstly, the working concentration for vitamin E was established using three different
doses and by assessing ZnT3 expression levels after 48 hours of treatment. Though
the highest difference observed was with 0.5 mol/L vitamin E, this was not used in
subsequent experiments (Figure 2.20), due to some cells showing toxicity towards
Chapter 2.4: Discussion
105 | P a g e
the high vitamin E levels and undergoing cell death. 0.05 mol/L was selected as the
optimal dose and used in the following experiments. Use of vitamin E appeared to
have further reduced the hZnT3 expression level up to almost 10 fold than the control
where no vitamin E was used.
When treated with different DHA doses in the presence of vitamin E, M17 cells
showed a significant downregulation in hZnT3 at the mRNA levels. The dose
dependent pattern was similar to results obtained without vitamin E. However, the
downregulation appears to be greater than what was achieved without vitamin E
(Figure 2.21). When treated with only vitamin E, ZnT3 expression levels were
upregulated, however introduction of DHA reversed the upregulation significantly.
Both mRNA results and protein results (Figure 2.22) obtained from this study are in
line with the previous reported data in literature. In the presence of Vitamin E, DHA
effect on ZnT3 was amplified, suggesting prolonged DHA availability and a slower
depletion of DHA through oxidation, due to the presence of vitamin E.
Chapter 3.1: Introduction
106 | P a g e
CHAPTER 3.1: Introduction
3.1.1 DHA effect on zinc fluxes
Zinc is the second most abundant trace element in the human body, and considered
as one of the most essential trace elements for life (Weiss et al., 2000). Zinc serves
as a structural and functional element at the cellular level, including as a component
of over 300 different enzymes (Wallwork, 1987). Zinc is also essential in many cellular
functions such as growth, differentiation (Vallee and Falchuk, 1993), gene expression
and DNA synthesis (Chai et al., 1999). In addition to these functions, many cell types
are known to have stored labile Zn2+ pools for proper cellular functions. Relative
concentrations of this labile Zn2+ pools can vary from 1 nM in the cytoplasm of some
cell types to about 1 mM in some vesicles (Lippard, 1994). In neuronal cells, these
Zn2+ pools are believed to play an important role in synaptic plasticity (Li et al., 2001;
Sensi et al., 2000). Furthermore, the adult human brain has the highest concentration
of zinc (150 μM) compared to the other organs (Wallwork, 1987). This labile zinc in
the human brain is very tightly regulated, and in normal conditions is believed to be
around 10-20 nM (Frederickson et al., 2005b).
Although zinc is vital for life, excessive amount of zinc is known to be toxic to cells.
Under exposure to excessive amounts of zinc, neuronal cells exhibit neurotoxicity and
neuro-degeneration (Sheline et al., 2000a). The translocation of zinc from
Chapter 3.1: Introduction
107 | P a g e
presynaptic to postsynaptic neurons is the main mechanism suspected to be involved
in neurotoxicity (Weiss et al., 2000). This zinc translocation is responsible for inducing
the cell injuries encountered in conditions such as brain trauma (Suh, 2000), epilepsy
and transient global ischemia (Weiss et al., 2000). Excessive zinc is also capable of
inhibiting Ca2+ and Na+ voltage gated channels (Akaike, 1989; Ravindran et al., 1991;
Winegar and Lansman, 1990) and upregulating the cellular levels of reactive oxygen
species (ROS) (Kim et al., 1999b). Elevated ROS levels can be directly detrimental to
cell survival by damaging key macromolecules such as nucleic acids, proteins and
lipids and cause rapid cell death. Moreover, high levels of zinc is found in AD brains,
indicating a possible zinc related neuro-degeneration (Weiss et al., 2000). A study
conducted using mouse neuronal cells has shown that exposure to high levels of zinc
(40 μM) for just 24 hours is sufficient to degenerate the cells (Sheline et al., 2000b).
Thus, it’s reasonable to conclude the importance of having a proper and detailed
understanding of the localization and the availability of free zinc inside the cells.
Moreover, in a therapeutic aspect, it will be beneficial to understand and develop a
mechanism where the freely available zinc pool can be regulated.
Chapter 3.1: Introduction
108 | P a g e
3.1.2 DHA and zinc
A link between zinc and PUFAs has been widely discussed in scientific literature. Zinc
deficient pregnant rats have shown a whole-body depletion of the maternal stores of
both omega-3 and omega-6 PUFAs (Cunnane and Yang, 1995). Furthermore, studies
have shown DHA intake or absence can alter the zinc transporter expression levels,
which in turn modulate cellular zinc levels. Hence, a putative link between DHA and
zinc is thought to exist. For example, perinatal PUFA deficiency in rats resulted in
upregulated levels of zinc transporter 3 (ZnT3) in the brain. This was associated with
increased hippocampal and decreased plasma levels of zinc (Jayasooriya et al.,
2005b). Furthermore, DHA-treated human neuronal M17 cells showed a
downregulation in ZnT3 levels compared to untreated cells (Suphioglu et al., 2010a).
ZnT3 is a putative transporter of zinc into synaptic vesicles in human neuronal cells
(Palmiter et al., 1996) and thus a reduction in its levels following DHA treatment
allows for a reduction in free zinc levels in the cellular matrix.
3.1.3 Zinc fluorophores
As discussed above, due to the importance of zinc, especially labile zinc in cells and
tissues, it is vital to study and understand the concentration, distribution, localization,
kinetics and functions of free zinc. However, unlike its counterparts Fe2+, Mn2+ or
Cu2+, Zn2+ is not capable of producing many spectroscopic signals due to its 3d104s0
configuration (Dai and Canary, 2007). Thus, use of many spectral techniques such as
Chapter 3.1: Introduction
109 | P a g e
UV-vis or nuclear magnetic resonance (NMR) is either not possible or limited (Dai and
Canary, 2007; Zhang et al., 2005). Other techniques such as atomic absorption
spectrometry, synchrotron radiation X-ray (SRXRF) spectrometry (R. Ishihara et al.,
2003) and microparticle-induced X-ray emission (micro-PIXE) (Lovell et al., 1998) may
be useful in some applications, although they might be expensive and will require
special instrumentation. Thus, a more simple and economical fluorescent sensors of
free zinc have become a more popular and widely used technique among
researchers. Much of this work has focused on the use of zinc fluorophores as the
fluorescent sensor (Thompson, 2005). 6-methoxy-8-p-toluenesulfonamide-quinoline
(TSQ) is the first reported zinc fluorophore to be used as it binds to Zn2+ selectively
by the quinoline moiety (Frederickson et al., 1987). Few other commonly used zinc
fluorophores are Zinquin, Zinpyr, RhodZin and the ZnAF family (Thompson, 2005).
There are two main families of zinc fluorophores, one is membrane permeable and
the other is membrane impermeable. Membrane permeable fluorophores get
modified into a membrane impermeable derivative through an enzymatic
modification such as hydrolysis of an ethyl ester group by an esterase in the cell. This
modified derivative will then be able to bind the target cation, thus emitting its
signalling (Kimber et al., 2000).
This study was carried out to investigate the effects of DHA as a neuro-protective
agent by analysing free zinc availability. In the preliminary studies, four different zinc
fluorophores (Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) were tested for zinc fluxes
in human neuronal cells and the compatibilities were evaluated under living and fixed
conditions. Following this, the most compatible fluorophore was used to measure
Chapter 3.1: Introduction
110 | P a g e
free zinc availability following DHA treatment. A time-point study was performed to
gain a complete understanding of DHA effects and the specificity of DHA effects were
verified using linoleic acid (LA).
Chapter 3.2: Materials & Methods
111 | P a g e
CHAPTER 3.2: Materials & Methods
3.2.1 Cell culture
The human neuroblastoma cell lines BE(2)-M17 and neuronally committed human
teratocarcinoma cell line NT2 used in the present experimental study were obtained
from Professor Leigh Ackland, Centre for Cellular and Molecular Biology, Deakin
University, (VIC, Australia).
NT2 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10%
heat inactivated foetal bovine serum (FBS), while BE(2)-M17 cells were cultured in
OPTI-MEM (modified Eagles Minimum Essential Medium) with 2.5% heat inactivated
FBS. Both cell lines were grown as monolayers in 12 well disposable plates on glass
cover slips and incubated at 37°C in a humidified atmosphere of 5% carbon dioxide.
3.2.2 Compatibility study of four different zinc fluorophores
Free zinc availability was measured in M17 cells with four different fluorophores
(Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) to test their compatibility under fixed
and non-fixed conditions. All of the four fluorophores were maintained in DMSO
stock solution (1–5 mM) and diluted down to a final concentration of 1–5 μM in
appropriate culture media. M17 cells were grown on glass coverslips until they
Chapter 3.2: Materials & Methods
112 | P a g e
reached confluence. Media was replaced every 2–3 days. Once cells reached
confluence, one set was used as it was and the second set was permeabilized before
incubating with one of the fluorophores for 30 minutes. Fixing was performed
following the protocol as previously described (Hardman et al., 2007). Briefly, treated
cells cultured on glass coverslips or coated filters were rinsed 3 times with PBS, fixed
with 4% (w/v) paraformaldehyde (PFA/PBS) (Sigma-Aldrich, Sydney, Australia) for 5
minutes at room temperature and rinsed again with PBS 3 times. The cells were
permeabilised with 0.1% (v/v) Triton X-100/PBS (Amresco Inc. Solon, USA) for 10
minutes at room temperature and rinsed 3 times with PBS. Following the incubation,
cells were washed 3 times with PBS and mounted with Bio-Rad FluoroGuardTM Anti-
fade Reagent (Bio-Rad, Hercules, USA). Confocal images were obtained as previously
described (Hardman et al., 2007).
3.2.3 DHA effect on zinc fluxes across the cell membrane
Cells were tested for the zinc fluxes following DHA treatment using Znpyr-1 as the
zinc fluorophore. DHA (20 μg/mL) and control (0 μg/mL) media were incubated at
37oC overnight on an orbital rotator before treating the cells. This was to allow DHA
to conjugate with proteins in the media to ensure maximum delivery into the cells.
When cells were about 100% confluent, old media was replaced by 2 mL of
appropriate media per well and left for two days before harvesting, followed by
further 30 minutes incubation with Znpyr-1 and subsequently checked under the
Chapter 3.2: Materials & Methods
113 | P a g e
microscope. Following the incubation, cells were washed 3 times with PBS and
mounted with Bio-Rad FluoroGuardTM Anti-fade Reagent (Bio-Rad, Hercules, USA).
Confocal images were obtained as previously described (Hardman et al., 2007).
3.2.4 LA effect on zinc fluxes across the cell membrane
Cells were tested for the zinc fluxes following LA treatment using Znpyr-1 as the zinc
fluorophore. LA (20 μg/mL) and control (0 μg/mL) media were incubated at 37oC
overnight on an orbital rotator before treating the cells. This was to allow LA to
conjugate with proteins in the media to ensure maximum delivery into the cells.
When cells were about 100% confluent, old media was replaced by 2 mL of
appropriate media per well and left for two days before harvesting, followed by
further 30 minutes incubation with Znpyr-1 and subsequently checked under the
microscope. Following the incubation, cells were washed 3 times with PBS and
mounted with Bio-Rad FluoroGuardTM Anti-fade Reagent (Bio-Rad, Hercules, USA).
Confocal images were obtained as previously described (Hardman et al., 2007).
Chapter 3.2: Materials & Methods
114 | P a g e
3.2.5 DHA treatment - time point study
Cells were treated with DHA (20 μg/mL) and control (0 μg/mL) and tested for the zinc
fluxes using Znpyr-1 at different time points (0, 4, 8, 26, 24 & 48 hours) to identify
DHA effects at different stages. DHA (20 μg/mL) and control (0 μg/mL) media were
incubated at 37oC overnight on an orbital rotator before treating the cells. This was
to allow DHA to conjugate with proteins in the media to ensure maximum delivery
into the cells. When cells were about 100% confluent, old media was replaced by 2
mL of appropriate media per well and left for two days before harvesting, followed
by further 30 minutes incubation with Znpyr-1 and subsequently checked under the
microscope. Following the incubation, cells were washed 3 times with PBS and
mounted with Bio-Rad FluoroGuardTM Anti-fade Reagent (Bio-Rad, Hercules, USA).
Confocal images were obtained as previously described (Hardman et al., 2007)
3.2.6 Serum starvation study with DHA enrichment
Cells were cultured in serum free media (-FBS) for 48 hours, and then treated with
one of the following combinations for another 48 hours followed by a 30-minute
incubation with the zinc fluorophore Znpyr-1. (a) –DHA and –FBS, (b) –DHA and +FBS,
(c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS. Appropriate FBS
concentrations were used according to the cell line as described on the Section 3.2.1.
Treatment with –DHA and –FBS was just the relevant serum free media according to
Chapter 3.2: Materials & Methods
115 | P a g e
the cell line. All of the four treatment media were incubated at 37oC overnight on an
orbital rotator before treating the cells. This was to allow DHA to conjugate with
proteins in the media to ensure maximum delivery into the cells. When cells were
about 100% confluent, old media was replaced by 2 mL of appropriate media per well
and left for two days before harvesting, followed by further 30 minutes incubation
with Znpyr-1 and subsequently checked under the microscope. Following the
incubation, cells were washed 3 times with PBS and mounted with Bio-Rad
FluoroGuardTM Anti-fade Reagent (Bio-Rad, Hercules, USA). Confocal images were
obtained as previously described (Hardman et al., 2007)
Chapter 3.3: Results
116 | P a g e
CHAPTER 3.3: Results
3.3.1 Compatibility study of four different zinc fluorophores
The purpose of this study was to evaluate the compatibility of four different
fluorophores (Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) in M17 cells. Free zinc
availability of M17 cells was tested using these fluorophores under live or fixed
conditions and then samples were assessed by microscopy to determine the most
compatible fluorophore under the given conditions.
Cells were grown on cover slips for two days, then incubated with one of the
fluorophores for 30 minutes. Following incubation, one set was used as is and the
second one was permeabilized, fixed and tested for fluorescence signals. Live cells
incubated with FluoZin-3 displayed scattered and very minimal fluorescence labelling
(Figure 3.1.4-b). Conversely, all the other three fluorophores produced strong signals
in live M17 cells (Figure 3.1.b). Among these three fluorophores, Zinquin signalling
was weaker than that of Zinpyr-1 and RhodZin-3. However, fluorescence signalling
with these three fluorophores showed a very similar and specific staining pattern.
Signalling appeared to be confined mainly to the endoplasmic reticulum (ER), Golgi
and the nucleus. In contrast, the cytoplasmic region did not exhibit a strong
fluorescence signalling with these three fluorophores in live cells. Fluorescence
signalling in dead and fixed M17 cells incubated with Zinpyr-1, RhodZin-3 and Zinquin
Chapter 3.3: Results
117 | P a g e
appeared to be diffuse and weaker when compared to live cells, suggesting it is not
specific or confined (Figure 3.1.a). Cytoplasmic staining was also visible when
incubated with fixed cells. Interestingly, FluoZin-3 produced contrasting results with
the fixed cells in comparison to the live cells (Figure 3.1.4-a). Very strong ER and Golgi
labelling was present and the signalling appeared to be specific and confined. Three
independent replicates were performed for this experiment and the results obtained
were consistent across the three replicates. Thus, based on the results, Zinpyr-1 was
selected as the fluorophore of choice for non-permeabilized (live) cells. FluoZin-3
was selected as the fluorophore of choice for staining of permeabilized (dead) cells,
as it gave the best zinc specific results.
3.3.2 DHA effect on zinc fluxes across the cell membrane
M17 cells were tested for zinc fluxes following DHA treatment using Znpyr-1 as the
zinc fluorophore. M17 cells were incubated for 48hrs in the presence of DHA (20
μg/mL) or in its absence as the control, followed by a further 30 minutes incubation
with Znpyr-1, and subsequently assessed by microscopy. Control M17 cells displayed
very strong zinc labelling when incubated with Znpyr-1 (Figure 3.2.1-a). Signalling
was stronger close to the endoplasmic reticulum (ER) and the Golgi, and was
consistent among all the cells present. In contrast, DHA treated cells displayed
minimal labelling indicating a very low levels of free zinc in the cytoplasm, thus
producing low levels of fluorescence signalling compared to untreated cells. Bright
Chapter 3.3: Results
118 | P a g e
field imaging indicates the presence of cells, however, green fluorescence was almost
negligible and was limited to a few insignificant scattered spots (Figure 3.2.1-b).
These results were verified with three individual experimental sets and the results
were highly consistent.
Chapter 3.3: Results
119 | P a g e
Figure 3.1: Fluorescence signalling from four different zinc fluorophores in M17
cells.
Free zinc availability of M17 cells was tested using four different fluorophores
(Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) to evaluate the compatibility of them
under live (A) or fixed (B) conditions.
Chapter 3.3: Results
120 | P a g e
Figure 3.2: Comparison of zinc fluxes following DHA and LA treatments in M17 cells
using Znpyr-1.
M17 cells were tested for changes in free zinc levels using Znpyr-1 in the presence
(1-b) and absence (1-a) of DHA (20 μg/mL) treatments. M17 cells were also tested
for the fluorescence labelling in the presence (2-b) and absence (2-a) of LA to test the
DHA specificity.
Chapter 3.3: Results
121 | P a g e
3.3.3 Linoleic acid effect on Zn fluxes across the cell membrane
In this experiment, omega-3 fatty acid DHA was replaced by an omega-6 fatty acid LA
to test the DHA-specific results obtained in the previous study. M17 cells were
treated for 48hrs with either 20 μg/mL LA as the test sample, or without LA as the
control. Cells were then incubated for another 30 minutes with Znpyr-1 and
subsequently checked under the microscope.
Once again, the untreated control cells produced very strong green fluorescence
signalling when incubated with Znpyr-1 (Figure 3.2.2-a). This indicates the presence
of free zinc in the untreated cells. The red staining demonstrates ethidium bromide
staining of the nucleus. Green fluorescence signalling was mainly seen in the Golgi
and ER regions, and the strong staining pattern was universal in all cells present. In
comparison to the control sample signal, there was no substantial difference in the
staining pattern of cells treated with LA (Figure 3.2.2-b). The strong green
fluorescence signalling prominent in the Golgi and cell membrane regions were in
response to Znpyr-1 treatment, and the red signalling was from nuclear ethidium
bromide staining. This finding indicates that the free zinc availability in cells is not
affected by LA, as it was with DHA, suggesting DHA specificity in this mechanism.
Chapter 3.3: Results
122 | P a g e
3.3.4 DHA treatment - timepoint study
DHA treated M17 cells were tested for zinc fluxes using Znpyr-1 at different time
points to identify DHA effects at different stages. M17 cells were incubated with DHA
(20 μg/mL), followed by a further 30 minutes incubation with Znpyr-1 and
subsequently assessed under the microscope. M17 cells were tested at 0, 4, 8, 16,
24 and 48 hour timepoints to assess the effects of DHA.
At 0 hours, cells showed a very high concentration of free zinc which was visualised
by a strong green fluorescence signal (Figure 3.3.1-a). The magnified image shows
distinctive and specific labelling of free zinc around the ER and Golgi areas (Figure
3.3.1-b). This labelling pattern was consistent among experiment replicates and also
consistent with previous observations made in the preliminary studies. After 4 hours
of DHA incubation, M17 cells still illuminated very high levels of green fluorescence
when treated with Znpyr-1 (Figure 3.3.2-a). This suggests that at this timepoint there
is still a significant amount of free zinc available inside the cells, and the incubation
time is not sufficient for DHA to act upon the cells. The magnified image again shows
more detail of the zinc localisation pattern, which was very similar to the 0 hour time
point (Figure 3.3.2-b). The next time point was at 8 hours, which again did not show
any significant changes in the fluorescence labelling (Figure 3.3.3), or the labelling
pattern. However, after 16 hours of incubation the fluorescence signalling was
slightly reduced compared to the first three time points (Figure 3.4.1). Most of the
cells still displayed fluorescence signalling but there were some cells with almost no
specific or confined labelling pattern. This tendency was more prominent after 24
Chapter 3.3: Results
123 | P a g e
hours of incubation with DHA (Figure 3.4.2). The strength of the Znpyr-1 labelling was
reduced and more diffuse than the sharp and intense signalling patterns which were
visible with previous time points. By the 48 hour time point zinc signalling had almost
disappeared indicating the absence of free zinc in DHA treated M17 cells (Figure
3.4.3). These results were consistent across the replicates and with previous
observations.
Chapter 3.3: Results
124 | P a g e
Figure 3.3: Timepoint (0 – 8 hours) analysis of M17 cells with DHA treatment.
DHA (20 μg/mL) treated M17 cells were tested for free zinc availability using Znpyr-1
at different time points to identify DHA effects at different stages. M17 cells were
tested at 0 hour (1-a), 4 hours (2-a), 8 hours (3-a) for the green fluorescence labelling
by Znpyr-1 treatment, and the red signalling was from nuclear ethidium bromide
staining. Magnified image is presented next to the corresponding image to gain
better understanding of the zinc localisation pattern (1-b, 2-b & 3b).
Chapter 3.3: Results
125 | P a g e
Figure 3.4: Timepoint (16 – 48 hours) analysis of M17 cells with DHA treatment.
DHA (20 μg/mL) treated M17 cells were tested for free zinc availability using Znpyr-1
at different time points to identify DHA effects at different stages. M17 cells were
tested at 16 hour (1-a), 24 hours (2-a), 48 hours (3-a) for the green fluorescence
labelling by Znpyr-1 treatment, and the red signalling was from nuclear ethidium
bromide staining. Magnified image is presented next to the corresponding image to
gain better understanding of the zinc localisation pattern (1-b, 2-b & 3b).
Chapter 3.3: Results
126 | P a g e
3.3.5 Serum starvation study with DHA enrichment
M17 cells were cultured in serum free media (-FBS) for 48 hours, and treated with
one of the following combinations for another 48 hours followed by a 30-minute
incubation with the zinc fluorophore Znpyr-1. (a) –DHA and –FBS, (b) -DHA and +FBS,
(c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS.
When assessed under the microscope, M17 cells showed very strong zinc labelling
within the no zinc and no FBS treated cells (Figure 3.5-a). However, most of the cells
appeared to be dying and unhealthy after a total of 4 days of serum starvation. Zinc
labelling was also strong in the second treatment condition of FBS with no added
DHA, following 2 days of serum starvation (Figure 3.5-b). With this condition, cells
were healthier compared to the previous “no FBS and no DHA” treatment. More
specific localization patterns of zinc could be seen with this condition. The most
interesting results were produced with the next combination where cells were
treated with 20μg/mL of DHA but no FBS, after 2 days of serum starvation (Figure 3.5-
c). Even though there was no FBS present, cells appeared to be healthier compared
to the first experimental set with no FBS and no DHA. This suggests DHA alone can
promote cell survival, which validates our previous (Chapter 2) results obtained with
DHA treatment and caspase-3 and Bcl-2 studies. Green fluorescence signalling was
also very low in this experimental condition (Figure 3.5-c), suggesting lack of free zinc.
When cells were treated with both DHA and FBS after the serum starvation period,
once again the cells did not produce any green fluorescence labelling when incubated
Chapter 3.3: Results
127 | P a g e
with the zinc fluorophore (Figure 3.5-d). These results were consistent across the
replicates and validate previous studies done with DHA and zinc fluorophores.
3.3.6 DHA effects on zinc fluxes across the cell membrane in NT2 cells
NT2 cells were tested for zinc fluxes following DHA treatment using Znpyr-1 as the
zinc fluorophore. NT2 cells were incubated with DHA (20 μg/mL) for 48 hours
followed by a further 30 minute incubation with Znpyr-1, and then examined under
the microscope. NT2 cells displayed a very similar fluorescence signalling pattern to
M17 cells following DHA treatment. Cells treated with no DHA showed strong
signalling with the fluorophores (Figure 3.6.1-a), indicating high levels of free zinc
present in the cells. DHA treated NT2 cells had a lesser amount of free zinc, hence
produced a significantly less fluorescence signal in comparison to untreated cells
(Figure 3.6.1-b). This experiment was repeated independently three times and the
results were consistent.
Chapter 3.3: Results
128 | P a g e
Figure 3.5: Serum starvation study with DHA enrichment.
48 hour serum starved (-FBS) M17 cells were tested for free zinc levels in the cells
following DHA treatment with one of the following combinations for another 48
hours followed by a 30-minute incubation with the zinc fluorophore Znpyr-1.
(a) –DHA and –FBS, (b) -DHA and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA
and +FBS.
Chapter 3.3: Results
129 | P a g e
3.3.7 Linoleic acid effect on zinc fluxes across the cell membrane in NT2 cells
When NT2 cells were treated with 20 μg/mL LA instead of DHA, no significant
difference could be seen compared to the control sample. Untreated control cells
produced strong green fluorescence signalling in response to incubation with Znpyr-
1 (Figure 3.6.2-a). This result was in line with the observations made with M17 cells.
Strong green florescence labelling indicates the presence of free zinc in untreated
NT2 cells. Ethidium bromide was used as the nuclear stain and red fluorescence
signalling corresponds to this nuclear staining. Green fluorescence signalling was
mainly seen in the Golgi and ER regions and the strong staining pattern was universal
to all cells present. When cells were treated with LA there was no visible difference
in the staining pattern in comparison to the control sample (Figure 3.6.2-b). Strong
green fluorescence signalling was still present after LA treatment and was mainly
confined to the Golgi and cell membrane regions. The lack of change in fluorescence
labelling patterns following LA confirms that free zinc levels were not altered by the
treatment, and that the changes observed on zinc availability with DHA treatment
are DHA specific.
Chapter 3.3: Results
130 | P a g e
Figure 3.6: Comparison of zinc fluxes following DHA and LA treatment in NT2 cells
using fluorophores.
NT2 cells were tested for changes in free zinc levels using Znpyr-1 in the presence
(1-b) and absence (1-a) of DHA (20 μg/mL) treatments. NT2 cells were also tested for
the fluorescence labelling in the presence (2-b) and absence (2-a) of LA to test the
DHA specificity.
Chapter 3.3: Results
131 | P a g e
3.3.8 DHA treatment - timepoint study with NT2 cells
NT2 cells were tested at different timepoints following DHA treatment for zinc fluxes
using the zinc fluorophore Znpyr-1. NT2 cells were incubated with DHA (20 μg/mL)
and its effects on NT2 cells were tested at 0, 4, 8, 16, 24 and 48 hours with use of the
Znpyr-1 zinc fluorophore.
Similar to M17 cells, NT2 cells also showed a high fluorescence labelling with Znpyr-
1 at 0 hours indicating a high concentration of labile zinc (Figure 3.7.1). The
localisation patterns are visible on the magnified image, where a strong signal is seen
in the ER and Golgi areas (Figure 3.7.1-b). No significant changes could be seen after
the first 4 hours of DHA incubation, NT2 cells still illuminated very high levels of green
fluorescence when treated with Znpyr-1 (Figure 3.7.2-a). The magnified image
highlights the zinc location pattern and is also very similar to the 0 hour image (Figure
3.7.2-b). After 8 hours of DHA treatment NT2 cells showed a similar strength in
fluorescence labelling (Figure 3.7.3). No real changes could be seen with regard to
the signal strength or localisation at this time point. Other than a slight decrease in
fluorescence signalling, no significant changes were visible at the 16-hour (Figure
3.8.1) and 24-hour (Figure 3.8.2) timepoints either. This suggest that at these
timepoints there is still a significant amount of free zinc available inside the cells, and
the incubation time is not sufficient for DHA to act upon the cells. Following 48 hours
of DHA treatment, a significant change in the zinc fluorescence labelling could be
seen. At the 48 hour timepoint zinc signalling had almost disappeared indicating the
absence of free zinc in NT2 cells (Figure 3.8.3). Observations made in NT2 cells were
Chapter 3.3: Results
132 | P a g e
the same as with M17 cells, indicating a strong similarity between both cell types in
relation to the effect of DHA treatment on labile zinc.
3.3.9 DHA and serum starvation study with NT2 cells
The effect of DHA on NT2 cell survival was tested by a serum starvation study. In this
study, NT2 cells were cultured in serum free media (-FBS) for 48 hours, and then
treated with one of the following combinations for another 48 hours followed by a
30 minute incubation with the zinc fluorophore Znpyr-1: (a) –DHA and –FBS, (b) -DHA
and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS.
Though many cells were distressed and dying following the no zinc and no FBS
treatment, a strong zinc fluorescence labelling could still be seen (Figure 3.9-a). Zinc
labelling was also strong in NT2 cells with the second experimental condition, which
was treatment with FBS in the absence of DHA, following 2 days of serum starvation
(Figure 3.9-b). Following this treatment, cells appeared healthier compared to the
previous “no FBS and no DHA treatment”. In addition, a more specific localization
pattern for zinc could be seen with this second experimental condition. The most
interesting results were produced with the third condition, where cells were treated
with 20 μg/mL of DHA without FBS, after serum starvation for 2 days (Figure 3.9-c).
Even though there was no FBS present, cells appeared to be healthier compared to
the first experimental condition of no FBS and no DHA. This suggests DHA alone can
promote cell survival, which validates our previous (Chapter 2) results obtained with
Chapter 3.3: Results
133 | P a g e
DHA treatment and caspase-3 and Bcl-2 studies. Green fluorescence signalling was
also very low in cells exposed to the third experimental condition (Figure 3.9-c),
suggesting the lack of free zinc. When cells were treated with both DHA and FBS after
the serum starvation period, once again the cells did not produce any green
fluorescence labelling when incubated with the zinc fluorophore (Figure 3.9-d).
These results were consistent among the replicates and validate the results of
previous studies done with DHA and zinc fluorophores. Moreover, both M17 and
NT2 cells produced similar results with the serum starvation study.
Chapter 3.3: Results
134 | P a g e
Figure 3.7: Timepoint (0 – 8 hours) analysis of NT2 cells with DHA treatment.
DHA (20 μg/mL) treated NT2 cells were tested for free zinc availability using Znpyr-1
at different time points to identify DHA effects at different stages. NT2 cells were
tested at 0 hour (1-a), 4 hours (2-a), 8 hours (3-a) for the green fluorescence labelling
by Znpyr-1 treatment, and the red signalling was from nuclear ethidium bromide
staining. Magnified image is presented next to the corresponding image to gain
better understanding of the zinc localisation pattern (1-b, 2-b & 3b).
Chapter 3.3: Results
135 | P a g e
Figure 3.8: Timepoint (16 – 48 hours) analysis of NT2 cells with DHA treatment.
DHA (20 μg/mL) treated NT2 cells were tested for free zinc availability using Znpyr-1
at different time points to identify DHA effects at different stages. NT2 cells were
tested at 16 hour (1-a), 24 hours (2-a), 48 hours (3-a) for the green fluorescence
labelling by Znpyr-1 treatment, and the red signalling was from nuclear ethidium
bromide staining. Magnified image is presented next to the corresponding image to
gain better understanding of the zinc localisation pattern (1-b, 2-b & 3b).
Chapter 3.3: Results
136 | P a g e
Figure 3.9: Serum starvation study with DHA enrichment.
48 hour serum starved (-FBS) NT2 cells were tested for free zinc levels in the cells
following DHA treatment with one of the following combinations for another 48
hours followed by a 30-minute incubation with the zinc fluorophore Znpyr-1.
(a) –DHA and –FBS, (b) -DHA and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA
and +FBS.
Chapter 3.4: Discussion
137 | P a g e
CHAPTER 3.4: Discussion
Zinc is considered as an indispensable element in the molecular economy of
mammalian cells. Gene transcription and metalloenzyme activity is highly dependent
on zinc availability (Berg and Shi, 1996; Vallee and Falchuk, 1993). In addition, cell-
cell signalling in the CNS is mediated by zinc (Frederickson, 1989). The glutamategic
terminal in mammalian brains are known to contain high levels of labile zinc
(Danscher, 1984). Zinc exists as three main forms in the human brain. Firstly, as
vesicular pools localized in synaptic vesicles of nerve ends. Zinc also exists as
metalloproteins or protein-metal complexes, and thirdly as ionic pools of free or
loosely bound zinc in the cell cytoplasm (Frederickson, 1989). Independent from the
dietary zinc availability, cerebral zinc is maintained at a steady level, highlighting the
importance of zinc in brain function (O'Neal et al., 1970; Wallwork et al., 1983).
Despite the importance of zinc in neuronal cells, neurons only have a very narrow
window of zinc tolerability compared to other cell types. In vivo and in vitro studies
have shown excessive amounts of zinc can induce both necrotic and apoptotic death
in neuronal cells (Choi et al., 1988; Chuah et al., 1995; Cuajungco and Lees, 1997b;
Duncan et al., 1992; Yokoyama et al., 1986). Labile zinc in the cytosol is considered
as an apoptotic marker in neuronal cells (Lee et al., 2006). Many neurodegenerative
conditions including AD, is linked with altered zinc homeostasis (Cuajungco and Lees,
1997a; Cuajungco and Lees, 1997b; Joseph et al., 2009; Mizuno and Kawahara, 2013;
Chapter 3.4: Discussion
138 | P a g e
Mocchegiani et al., 2005; Weiss et al., 2000). However, the exact intracellular
mechanism(s) of zinc induced toxicity in neuronal cells are not yet known.
Therefore, this study was done to examine the possible protective mechanism of DHA
through decreasing the amount of labile zinc in human neuronal cells. Generally, DHA
is known as a neuro-protective agent (Akbar et al., 2005a; Cole et al., 2005; Horrocks
and Yeo, 1999; Treen et al., 1992). Studies conducted have also shown anti-apoptotic
properties of DHA in many cell types (Akbar and Kim, 2002; German et al., 2006).
When treated with DHA, serum starved Neuro 2 cells showed increase in anti-
apoptotic markers (Kim et al., 2000) indicating a possible protective mechanism over
programmed cell death. These reported observations were re-tested using human
M17 and NT2 cells to identify a link between DHA and cellular levels of free zinc.
3.4.1 Compatibility study of four different zinc fluorophores
The first part of this study was to analyse four different free zinc markers to assess
the usability of those markers under specific conditions. There are two main families
of zinc fluorophores, membrane permeable and membrane impermeable. Once
inside the cell, membrane permeable fluorophores undergo an esterase modification
and is converted into membrane impermeable derivatives (Kimber et al., 2000), thus
enabling the modified derivative to bind free zinc.
Chapter 3.4: Discussion
139 | P a g e
When incubated with fluorophores for 30 minutes, cultures of M17 cells exhibit
specific results under fixed or live conditions (Figure 3.1). Fluozin-3, the only
membrane impermeable fluorophore tested displayed very weak signalling when
examined under live conditions. In contrast, in fixed cells Fluozin-3 was the only
fluorophore which produced specific signalling. In permeabilized cells, the other
three fluorophores exhibit non-specific signalling which was more diffuse across the
entire cell. These results confirm that there are specific conditions ideally suited for
the use of different zinc fluorophores.
3.4.2 DHA effect on zinc fluxes across the cell membrane
M17 and NT2 cells were used to assess the effect of DHA on zinc fluxes across the cell
membrane. Cells were treated with 20 μg/mL or 0 μg/mL of DHA for 48 hours and
subsequently incubated with the zinc fluorophore for an additional 30 minutes.
Interestingly, both cell types showed similar results when incubated with Zinpyr-1,
following DHA treatment. The strong zinc labelling seen in cells not exposed to DHA
(Figure 3.2.1-a & 3.6.1-a) almost disappeared following the DHA treatment (Figure
3.2.1-b & 3.6.1-b), indicating a possible effect of DHA on free zinc availability. As
indicted in our published data, 65Zn studies showed a decrease in cellular zinc
accumulation following DHA treatment in M17 cells (Suphioglu et al., 2010a). The
significantly reduced florescence labelling observed in both cell lines following Zinpyr-
1 incubation also confirms the above findings. As evident in the findings of Chapter
2, ZnT3 transporter levels were also downregulated in both these cell lines following
Chapter 3.4: Discussion
140 | P a g e
DHA treatment, suggesting the high likelihood of a link between DHA, labile zinc and
ZnT3 transporter expression levels in these two cell lines. However, the exact
mechanism or the order in which DHA acts on these cells is not yet confirmed.
3.4.3 Linoleic acid effect on zinc fluxes across the cell membrane
The specificity of the results obtained with DHA treatment on zinc flux was tested
using LA as a substitute for DHA. Cells were incubated with LA (0 or 20 μg/mL) for 48
hours, followed by 30 minutes incubation of Zinpyr-1 and examined under the
microscope. Control cells incubated in the absence of LA displayed strong zinc
labelling following exposure to zinc fluorophores (Figure 3.2.2-a & 3.6.2-a).
Interestingly, no significant changes could be seen following the LA treatment in both
M17 and NT2 cells (Figure 3.2.2-b & 3.6.2-b). The results observed in LA treated cells
were contrary to what was observed when treated with DHA, where following LA
treatment strong zinc labelling was still visible, as same as the control cells. LA (18:2n-
6) is a polyunsaturated omega-6 FA with a18 carbon chain and two cis double bonds.
The main structural difference between omega-3 FAs and omega-6 FAs is the position
of the first double bond. In omega-3 FAs it’s on the third carbon atom and in omega-
6 FAs it’s on the sixth carbon atom, counting from the methyl end. Omega-6 FAs are
considered to be essential in maintaining biochemical functions in the human body
(Simopoulos, 2002). At the cellular level, omega-6 FAs tend to have an opposing
effect when compared to omega-3 FAs. As an example, at high concentrations
omega-6 FAs can increase the formation of prostaglandins and thereby increase
Chapter 3.4: Discussion
141 | P a g e
inflammatory processes. In contrast, the reverse can be seen with increased omega-
3 FAs in the body. Many biochemical factors such as thromboxane A2 (TXA2),
leukotriene B4 (LTB4), IL-1, IL-6, tumour necrosis factor (TNF), and C-reactive protein,
which are related to various health conditions have been shown to increase with high
levels omega-6 FAs. Thus, suggesting a clear difference between omega-3 and
omega-6 FAs at the cellular level. The difference in the results obtained from this
study could be due to the functional differences between these two FAs, and
therefore, the changes seen in cellular free zinc levels can be classified as DHA-
specific. A previous study done with mouse Neuro 2A cells have shown a DHA specific
decrease in apoptotic cell death, induced by serum starvation. In contrast, oleic acid
was unable to illicit similar anti-apoptotic properties in serum starved Neuro 2A cells
(Kim et al., 2000). In another study where Neuro 2A cells were treated with
docosapentaenoic acid, was less effective in inducing
phosphatidylserine accumulation and Akt translocation, and therefore was less
effective as an anti-apoptotic agent when compared to DHA. Oleic and arachidonic
acids were also less effective in reducing the caspase-3 activity, DNA strand breaking
and laddering in mouse cells compared to DHA (Akbar and Kim, 2002). Hence,
observations made in our study also falls in line with these previously reported
findings, re-establishing the specificity of DHA in preventing apoptosis.
Chapter 3.4: Discussion
142 | P a g e
3.4.4 DHA treatment - timepoint study
In this study, the effect of DHA on both M17 and NT2 cells were studied at different
timepoints to gain a better understanding of the mechanism involved. The
timepoints selected for this study were 0, 4, 8, 16, 24 and 48 hours after DHA
treatment. As predicted, both cell lines showed the maximum intensity in
fluorescence labelling at 0 hours, and the lowest at 48 hours. No notable changes
were seen during the first three timepoints. However, from the fourth timepoint
onwards, a slight decrease was visible. These observations provide an insight into
DHA effects at the functional level in M17 and NT2 cells. A time course study done
with rat pheochromocytoma PC12 cells have shown that DHA effects were visible
only after 24 hours and was at the highest at 48 hours (Kim et al., 2000). In PC12
cells, DNA fragmentation induced by serum starvation was reduced when the cells
were enriched with DHA for a longer period of up to 48 hours. In addition in HL-60
cells, sphingosine-induced apoptosis was only reduced following a pre-incubation of
cells with DHA for at least 24 hours (Kishida et al., 1998).
The changes in zinc levels following DHA treatment can be due to the direct influence
DHA has on membrane composition and fluidity. DHA is able to readily incorporate
into membrane phospholipids and esterified into phospholipids. DHA can influence
many basic membrane properties such as acyl chain order, phase behaviour,
membrane elasticity, membrane permeability, flip-flop and protein activity (Stillwell
and Wassall, 2003). DHA’s ability to interact with cholesterol and other membrane
lipids may have an important role in its ability to modify the structure and functions
Chapter 3.4: Discussion
143 | P a g e
of the cell membrane (Stillwell and Wassall, 2003). In addition to the changes in the
lipid profile of the cell membrane, DHA has a shown tendency to alter gene
transcription levels in many cells (Kim et al., 2000; Sadli et al., 2012; Suphioglu et al.,
2010b). In fact, during our study we have also observed this in regard to the ZnT3
expression levels (Chapter 2).
3.4.5 Serum starvation study with DHA enrichment
M17 and NT2 cells were cultured in serum free media (-FBS) for 48 hours, and then
treated with one of the following combinations for another 48 hrs followed by a 30
minute incubation with the zinc fluorophore Znpyr-1: (a) –DHA and –FBS, (b) -DHA
and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS. Following
incubation with Znpyr-1, both cell lines showed a very similar zinc labelling pattern in
response to different treatments. With –DHA and –FBS treatment, both cell lines
indicated significant zinc labelling (Figure 3.5-a & 3.9-a). However, with this
treatment cells were distressed and dying. When treated with –DHA and +FBS cells
were healthier than the previous treatment and a strong zinc labelling pattern was
still present (Figure 3.5-b & 3.9-b). When treated with both DHA and FBS cells
appeared healthier, but zinc labelling was not present indicating a possible DHA
modulation of free zinc availability (Figure 3.5-d & 3.9-d). However, the most
significant results came with the +DHA and –FBS treatment. With this treatment
regime both the cell lines displayed minimum zinc labelling, which is in line with
previous observations. Despite the absence of FBS, cells looked healthier when
Chapter 3.4: Discussion
144 | P a g e
treated with only DHA (Figure 3.5-c & 3.9-c), indicating the anti-apoptotic effects of
DHA. Many studies done with DHA have also reported similar anti-apoptotic
properties of DHA. In cultured mouse Neuro 2A cells, DHA increased phosophatidyl
serine levels resulting in membrane translocation/activation of Akt through its
capacity to increase phosphatidylserine, thus promoting cell survival (Akbar et al.,
2005b). DHA enrichment of Neuro 2A cells prior to serum starvation has shown a
protective effect against apoptotic death (Kim et al., 2000). In addition, DHA
enrichment has also elicited a protective effect on staurosporine (ST) induced
apoptosis in Neuro 2A cells (Akbar and Kim, 2002). Thus, observations made during
this study are well in line with the reported literature linking DHA, zinc levels and
apoptosis.
3.5.6 Conclusion
Zinc fluxes across the membrane in both M17 and NT2 cells displayed interesting
changes in response to DHA treatment. A significant decrease in free zinc levels was
visible following 48 hours of DHA treatment. Changes in labile zinc levels were only
seen upon incubation of cells with DHA. LA showed no effect on labile zinc levels in
both M17 and NT2 cell lines. In general, elevated levels of free zinc is associated with
neurodegeneration and apoptosis. Thus, the reported depletion in free zinc levels
following DHA treatment could potentially be linked with the well-known anti-
apoptotic properties of DHA. In the second chapter of my study, I was able to
Chapter 3.4: Discussion
145 | P a g e
re-establish the anti-apoptotic nature of DHA. The current study provides strong
evidence for a DHA mediated zinc-dependent pathway of neuroprotection.
Chapter 4.1: Introduction
146 | P a g e
CHAPTER 4.1: Introduction
4.1.1 Cell culture models in neuro-research
Neurosciences have advanced significantly over the last few decades with the
development in molecular biology, electron microscopy and computer technology.
However, the key limitation of neuroscience, aside from its high cost, is the lack of
relevant in vitro models which can mimic the structure, function and expression of
the proteins present in mature human neurons. With the increase in the incidence
of neurodegenerative diseases such as AD (Hebert et al., 2001), there is a greater
need for high-throughput neuroscience research. Neuroscience research, especially
research into AD use animal models or rodent neurons or other immortalized cells
such as neuroblastoma cells as a substitute, due to the lack of live mature human
neuronal cells.
Animal models can be a good in vivo substitute for the human system, although
immortalized human cell lines can be more advantageous due to their homogenous
nature and also because cellular mechanisms such as cell death can be more easily
and closely studied using a specific cell line rather than an animal system.
Immortalized human cell lines also allow investigations into species specific effects of
drugs. Using an animal model instead of a human cell line may restrict obtaining
similar results due to the species or environmental specificity of certain drugs (Allen
Chapter 4.1: Introduction
147 | P a g e
et al., 2014). In addition, study of mutations through genetic manipulation is much
easier to conduct in cell lines compared to animal models.
Thus, there is a high demand to develop a system to grow human neuronal cells in
vitro. If such a system can be developed, it will deliver experimental material for
studying cell therapies for central nervous system (CNS) disorders and may ultimately
assist as a source for neural transplantation and brain repair. Many research groups
have attempted to address this need in the past using different approaches. One of
the most popular methods used is to differentiate neuroblastoma cell lines into a
more neuronal-like state.
Neuroblastoma is one of the most common solid tumours in children which accounts
for more than 9% of all childhood cancers. It is known to have a neural crest origin,
with over half the incidences arising within or near the adrenal gland (Beckwith and
Perrin, 1963; Imashuku et al., 1976). Originally, short term in vitro culture of
neuroblastoma tumours was used as a tool for diagnosis (Murray and Stout, 1947),
and they found that explants of neuroblastoma tumours grown in plasma-clot
cultures readily expressed axons. The long term culture of neuroblastoma cells and
their propensity to differentiate in vivo and in vitro under special culture conditions
have attracted the interest of many researchers (Goldstein, 1968).
However, under normal culture conditions most of the neuroblastoma cell lines do
not demonstrate many neuronal features such as neuronal morphology, inhibited cell
division and expression of neuron-specific markers. More importantly, expression of
Chapter 4.1: Introduction
148 | P a g e
neuron-specific proteins such as β-III tubulin and mature tau isoforms are
significantly lower in neuroblastoma cells in comparison to mature neurons (Agholme
et al., 2010). Previous studies have shown that M17 cells are resistant to retinoic acid
(RA) differentiation, and M17 cells continued to proliferate after RA treatment
(Draoui et al., 1997). However, one published study has successfully demonstrated
differentiation of SY5Y cells using RA (Simpson et al., 2001).
A likely alternative to neuroblastoma cells is the well-characterized neuronally
committed teratocarcinoma cell line Ntera2 (NT2). NT2 cells were derived from a
human testicular cancer (Andrews, 1984). According to published literature, NT2
cells can be induced to differentiate into fully functional, post-mitotic neurons and
other cell types of the neuronal lineage which display a variety of neurotransmitter
phenotypes when treated with RA (Guillemain et al., 2000). NT2 cells have been used
extensively in neuroscience studies in the past few decades (Paquet-Durand and
Bicker, 2007). Published work by Nelson et al. reveal that terminally differentiated
NT2 cells were successfully transplanted into a human stroke patient (Nelson et al.,
2002).
4.1.2 Differentiation agents
Differentiation of neuroblastoma and teratocarcinoma cells can be induced using a
few different differentiation agents. These agents can be classified under three
Chapter 4.1: Introduction
149 | P a g e
groups according to their biological functions: growth factors, kinase
activators/inhibitors and serum withdrawal. RA, insulin, insulin like growth factors
(IGF), brain derived neurotrophic factors (BDNF) and nerve growth factors (NGF) are
the most widely used growth factors (Pahlman et al., 1984; Recio-Pinto et al., 1984;
Sidell, 1982; Sonnenfeld and Ishii, 1982). Protein kinase C activators such as 12-O-
tetradecanolyphorbol-13-acetate (TPA) is a widely used kinase activator to induce
differentiation (Pahlman et al., 1981; Spinelli et al., 1982). Non-specific protein
kinase inhibitors such as staurosporine are also used extensively to induce
differentiation in many neuroblastoma cell lines (Jalava et al., 1992; Leli et al., 1992).
Serum withdrawal is also widely used to differentiate many neuroblastoma cell lines
(Diaz-Nido et al., 1991; Evangelopoulos et al., 2005; Wang et al., 2004b). However,
none of the methods are considered to be more effective than the other.
Effectiveness can vary with the cell line and the conditions used. Many researchers
tend to use at least a combination of these methods to maximise the outcome of the
differentiation process.
4.1.3 Traditional culture system versus 3D system
The traditional method of culturing cell lines is in monolayers in cell culture vessels,
flasks or petri dishes. Flat and hard plastic or glass substrate is used in this method
as the adherent material for the cells. However, many have questioned the use of
this 2 dimensional (2D) method of cell culture, especially in neuroscience research. It
Chapter 4.1: Introduction
150 | P a g e
is generally accepted that a 2D cell culture method is not capable of mimicking the
cellular environment found in organisms. Growth, cell expansion, cell to cell
interaction and cell to drug interaction are hindered in traditional 2D culture systems,
thus the accuracy of many studies can be embattled (Abbott, 2003).
In contrast to the traditional 2D method, cells grown in a 3 dimensional (3D) matrix
has many advantages. Firstly, it’s a better representation of the cell’s growth
patterns and interactions in vivo. The 3D system allows cells to form more natural cell
to cell attachments including gap junctions. The native configuration of cells and their
tissue-like flexibility and pliability can be achieved using the 3D culture method. The
microenvironment of the 3D culture system promotes many natural cellular
characteristics such as cell morphology, polarity, motility, differentiation, gene
expression, cellular migration and many other biochemical activities compared to the
2D system (Pampaloni et al., 2007). Studies done using cancer cells have shown
decreased chemo-sensitivity (Loessner et al., 2010) and decreased radiation-induced
cytotoxicity (Sowa et al., 2010) in the 3D culture system relative to the 2D monolayer
system. Thus, these studies highlight the importance of a 3D culture system to gain
a better understanding of the pathophysiological events seen in patients.
However, as with any system the 3D culture system has its own disadvantages. The
high costs associated with 3D culture is a key limitation in its infrequent use in a
majority of academic research settings. Variations between 3D matrix to matrix, over
time structural changes of the matrix and difficulty in harvesting cells from the matrix
are a few other limitations. In addition to these disadvantages, one of the basic
Chapter 4.1: Introduction
151 | P a g e
difficulties with many differentiation attempts is the prolonged cell culture and
treatment period. In particular, the time consuming process of NT2 cell
differentiation has been widely reported (Pleasure et al., 1992).
4.1.4 Outline of the study
Thus, this study was conducted with several aims. The main focus of this study was
to differentiate three different human cell lines including two neuroblastoma cell
lines (SY5Y, M17) and a teratocarcinoma cell line (NT-2). The second main focus was
to test egg white as a low cost alternative to ECM matrigel using M17 cells. Thirdly,
to develop a differentiation method with a shorter culture/treatment period in order
to maximise economical out turn and productivity. Differentiation achieved by these
three improved methods was tested for neuronal-specific markers using
immunocytochemistry and Western blotting techniques.
Chapter 4.2: Materials & Methods
152 | P a g e
CHAPTER 4.2: Materials & Methods
4.2.1 Cell culture
The human neuroblastoma cell lines BE(2)-M17, SH-SY5Y and neuronally committed
human teratocarcinoma cell line NT2 used in the present experimental study were
obtained from Professor Leigh Ackland, Centre for Cellular and Molecular Biology,
Deakin University, (VIC, Australia).
NT2 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10%
heat inactivated foetal bovine serum (FBS). SH-SY5Y cells were grown in Roswell Park
Memorial institute 1640 (RPMI) medium supplemented with 20% heat inactivated
FBS, while BE(2)-M17 cells were cultured in OPTI-MEM (modified Eagles Minimum
Essential Medium) with 2.5% heat inactivated FBS. All three cell lines were grown as
monolayers in 75 cm2 disposable culture flasks (NuncTM, Roskilde, Denmark) and
incubated at 37°C in a humidified atmosphere of 5% carbon dioxide. At ~90%
confluence, cells were harvested or passaged using 0.025% trypsin/EDTA.
Chapter 4.2: Materials & Methods
153 | P a g e
4.2.2 M17 differentiation using a conventional 2D cell culture system
M17 cells were grown on glass coverslips or in a culture flask in the presence of 10
μM retinoic acid [all-trans-retinoic acid (RA); Sigma, St. Louis, MO] for a period of 14
days. Media was replaced every 2–3 days. Cells grown in flasks were harvested for
Western blot analysis and the coverslips were processed for immunocytochemistry
studies.
4.2.3 M17 differentiation using 3D culture system
Following primary culture, cells were cultured onto Costar Transwell Clear Insert
(Costar, Cambridge, MA). Four inserts were coated with 200μl of matrigel and egg
white. Briefly, thawed egg white or matrigel was pipetted directly into the middle of
6-well plate wells and spread using a 25 mL pipette. The coated filters were left to
set at 37°C for approximately 2-3 hours. Any excess liquid was aspirated before
seeding of cells. From the following day, two egg white coated filters and two
matrigel coated filters were treated with 10 μM RA for 14 days. Media was replaced
every 2–3 days. Concurrently, control filters were treated with media in the absence
of RA. Subsequently, cells were either processed for immunocytochemistry or
harvested for Western blot analysis.
Chapter 4.2: Materials & Methods
154 | P a g e
4.2.4 Modified 3D culture system for differentiation
The protocol developed for this study was performed by modifying and shortening
previously reported cell aggregation methods (Paquet-Durand et al., 2003, Jain P et
al., 2007). A summary of the method employed is exhibited in Figure 4.1. Cells (1–
1.5 × 106) were grown in corresponding medium (as described previously) on
bacteriological plates or on filers coated with matrigel to induce neurosphere
formation. On day 2, 10 μM RA was added, and medium was replaced every 2-3 days
for 14 days. One set of cells grown on bacteriological plates were divided into culture
flasks and glass coverslips. The second set was transferred onto filters coated with
matrigel. All three sets were then treated with corresponding medium containing
either 5% FBS (SY5Y & NT2 cells) or 1% FBS (M17 cells) and mitotic inhibitors (10 lM
FUdR, 10 lM Urd, 10 lM araC) for 7 days. Low FBS and mitotic inhibitors were used
to reduce non-neuronal cell proliferation. Neurons were maintained in culture media
with 5% FBS and mitotic inhibitors, and media was replaced twice a week. Neurons
could be maintained for approximately 2 months.
Chapter 4.2: Materials & Methods
155 | P a g e
Figure 4.1: Schematic diagram of the modified 3D cell culture system developed for
cellular differentiation.
A summary of the method employed during the study for 3D cellular differentiation.
Filter Filter method (A), Suspension culture Filter method (B) and Suspension
culture Flask method were the tree different methods used.
Chapter 4.2: Materials & Methods
156 | P a g e
4.2.5 Protein isolation and Western blot analysis
Harvested cells were re-suspended in 500 μL lysis buffer (1% sodium dodecyl sulfate
(SDS) in 10 mM Tris-hydrochloric acid (HCl), pH 6.8). To prevent protein degradation,
a mini EDTA-free protease inhibitor cocktail tablet (Roche Applied Science, Castle Hill,
NSW, Australia) was added to every 10 mL of lysis buffer prior to pipetting onto cell
pellet. Cells were placed on ice and homogenized by passing through a 21-gauge
needle ~10 times and sonicated (40% power output, 30% duty cycle) three times for
15 seconds with a 30 second break between each sonication, using a Microsone
ultrasonic cell disrupter (Misonix Incorporated, NY, USA). The homogenate was
centrifuged at 16,000 X g at room temperature for 10 minutes and the supernatant
was collected and stored at -80°C until further analysis. Quantification of protein
concentration was performed using the Pierce BCA Protein Assay Reagent Kit (Perbio,
Rockford, USA), according to the manufacturer’s Microplate Procedure instructions,
adapted from Smith et al. (Smith, 1985).
For Western blot analysis, cell lysates (described above) were resolved on 12% SDS-
PAGE gels, transferred onto a nitrocellulose membrane (Pall, Life Sciences, Pensacola,
Florida, USA) and blocked with 1% (w/v) casein in TBS. Membranes were incubated
with either rabbit anti-Beta III tubulin, mouse anti-Tau, mouse anti-DBH or mouse
anti-MAP antibodies overnight at 4°C. After washing, antibody binding was detected
with anti-mouse or anti-rabbit (HRP) horseradish-peroxidase conjugated (Chemicon
International, CA, USA) secondary antibodies (diluted 1:10,000 in TBS), as previously
described (Suphioglu et al., 2010b). Proteins were detected using Immobilan
Chapter 4.2: Materials & Methods
157 | P a g e
Western chemiluminesence HRP substrate (Millipore Corporation, CA, USA) following
the manufacturer’s instructions. Membranes were developed using a Fujifilm
Luminescent Image Analyser LAS-3000.
Developed membranes were stripped for 10 mins at room temperature using 1 mL
Re-blot Plus-strong (Chemicon International, Temecula, CA, USA) diluted 1:10 in
MilliQ water. In order to confirm equal protein loading, membranes were re-probed
for β-actin using a mouse anti-β-actin (Sigma-Aldrich) primary antibody (diluted
1:5000 in TBS), followed by an anti-mouse HRP antibody (Chemicon International),
and developed as described above. Densitometry to quantify results was performed
using Fujifilm Multi Gauge V2.3 computer software.
4.2.6 Immunocytochemistry experiments
Immunocytochemistry was performed as previously described (Hardman et al.,
2007). Briefly, treated cells cultured on glass coverslips or coated filters were rinsed
3 times with PBS, fixed with 4% (w/v) paraformaldehyde (PFA/PBS) (Sigma-Aldrich,
Sydney, Australia) for 5 minutes at room temperature and rinsed again with PBS 3
times. The cells were permeabilised with 0.1% (v/v) Triton X-100/PBS (Amresco Inc.
Solon, USA) for 10 minutes at room temperature, rinsed 3 times with PBS and blocked
with 1% (w/v) BSA for 10 minutes at room temperature. Cells were incubated
overnight at 4°C with either rabbit anti-Beta III tubulin, mouse anti-Tau, mouse anti-
Chapter 4.2: Materials & Methods
158 | P a g e
DBH or mouse anti-MAP primary antibodies at a 1:1000 dilution in 1% (w/v) BSA/PBS.
Samples were then rinsed with PBS 3 times, incubated with either Alexa Flour 488
anti-mouse (1:10,000) or Alexa Flour 488 anti-rabbit (1:10,000) antibody for 2 hours
at room temperature, washed 3 times with PBS and mounted with Bio-Rad
FluoroGuard anti-fade reagent (Bio-Rad, Hercules, USA). Confocal images were
obtained as previously described (Hardman et al., 2007).
Chapter 4.3: Results
159 | P a g e
CHAPTER 4.3: Results
4.3.1 M17 cells are resistant to retinoic acid in a conventional 2D cell culture
system
Previous studies conducted with the M17 cell line and RA suggest that it is resistant
to RA and continue to proliferate even after treatment with RA (Draoui et al., 1997).
These observations were re-tested in a study where M17 cells were cultured in a
conventional 2D cell culture system. After 14 days of RA treatment, cells were tested
for cellular differentiation by assessing the expression levels of neuronal markers β-
tubulin III, Tau, DBH and MAP2 using immunocytochemistry and Western blotting
techniques.
Immunocytochemistry analysis of these RA treated M17 cells demonstrated low
levels of neuronal markers β-tubulin III (Figure 4.2.1a), Tau (Figure 4.2.2a), DBH
(Figure 4.2.3a) and MAP2 (Figure 4.2.3a) as visualized by green fluorescence labelling.
Magnified cell images are also shown to give a more detailed understanding of the
neuronal marker labelling patterns (Figure 4.2.1b), (Figure 4.2.2b), (Figure 4.2.3b),
(Figure 4.2.4b). Green fluorescence labelling was lowest with the DBH antibody and
the rest displayed very minimal levels of labelling, indicating possible low levels of
these markers within the M17 cells under these conditions.
Chapter 4.3: Results
160 | P a g e
Immunocytochemistry results were verified by Western blot analysis using the four
neuronal marker antibodies. M17 cells treated with RA under the conventional 2D
cell culture method did not demonstrate a significant difference in neuronal marker
levels compared to untreated cells (Figure 4.3A). Equal protein loading of the gel
lanes was assessed by Western blot analysis for the housekeeping gene, β-actin
(Figure 4.3B). Neuronal marker protein levels were then normalized against the
corresponding β-actin protein levels and densitometry analysis was performed to
quantify the changes in expression. Following densitometry analysis, it was
confirmed that there was no significant changes in the levels of any neuronal markers
in RA-treated cells compared to untreated control cells (Figure 4.3C) in the 2D culture
system. These results were consistent across the three individual experimental sets
and the findings corroborated published literature regarding differentiation of M17
cells using RA under a conventional 2D cell culture method.
Chapter 4.3: Results
161 | P a g e
Figure 4.2: Immunocytochemistry analysis of M17 cell differentiation using the
traditional 2D culture system.
Immunocytochemistry analysis of RA treated M17 cells for neuronal markers β-
tubulin III (1-a), Tau (2-a), DBH (3-a) and MAP2 (4-a) as visualized by green
fluorescence labelling. Magnified cell images are also shown next to the
corresponding image to give a more detailed understanding of the neuronal marker
labelling patterns (Figure 4.2-b). Red signalling was from nuclear ethidium bromide
staining
Chapter 4.3: Results
162 | P a g e
Figure 4.3: Western blotting analysis of M17 cell differentiation using traditional
2D culture system.
Neuronal markers, β-tubulin III, Tau, DBH and MAP2 (A) and the housekeeping β-
actin (B) protein levels of M17 cells cultured in 2D system in the presence of RA
were measured with specific antibodies. (C) Densitometric analysis of neuronal
marker protein levels (normalised with the β-actin protein levels) are shown in
arbitrary units (AU). Molecular mass protein markers (Mr) are indicated on the left
of each gel. This result is representative of three similar independent experiments.
Chapter 4.3: Results
163 | P a g e
4.3.2 M17 cells acquire expression of neuronal markers when cultured in the
presence of RA in a 3D cell culture system
Since M17 showed resistance to RA in a 2D cell culture, a novel method was
developed to culture cells in a 3D matrix to promote RA induced differentiation. The
3D culture system was developed using cell culture filters and coating them with
matrigel or the cheaper alternative egg white, as the 3D cell adhesive media. Cells
cultured using the 3D system were treated with 10 μM RA for 14 days. Following
treatment, cells were harvested and analysed for expression levels of neuronal
markers β-tubulin III, Tau, DBH and MAP2 using immunocytochemistry and Western
blotting techniques.
4.3.2.1 Immunocytochemistry results revealed a clear difference between 2D and
3D culture systems
The dichotomy between 2D and 3D cell culture systems was clearly demonstrated by
the immunocytochemistry results. A dramatic increase was clearly visible in all four
neuronal markers tested (Figure 4.4). Green fluorescence labelling in RA treated
experimental groups under 3D conditions showed a marked increase in fluorescence
labelling compared to the 2D culture system. Under the microscope, most of the cells
showed neuronal morphology, including elongated axons and dendrites. With the
3D culture system, labelling of neuronal markers was stronger and unanimous among
the cells. Also importantly, despite of the cell adhesive media used, both matrigel
Chapter 4.3: Results
164 | P a g e
and the cheaper alternative egg white produced strong labelling with all four
neuronal markers with only a slight difference in the labelling intensity. Nuclear
labelling is indicated in red by ethidium bromide staining. β-tubulin III labelling of
differentiated M17 cells showed very strong signalling with the matrigel system
(Figure 4.4.1-a) compared to the egg white system (Figure 4.4.1-b). Elongated and
fluorescence labelled axons were visible in both matrigel and egg white grown cells.
A similar pattern was observed with the tau antibody as well, where cells grown on
matrigel (Figure 4.4.2-a) showed a slight increase in antibody labelling compared to
cells grown on egg white (Figure 4.4.2-b). β-tubulin III is mainly present in
microtubules and tau is a microtubule-associated protein. Thus, an elongated
labelling pattern was visible with antibody binding. However, fluorescence labelling
with DBH was more intracellular in its localisation pattern. Matrigel grown cells
(Figure 4.4.3-a) still produced stronger signalling with the antibody labelling
compared to cells grown on egg white (Figure 4.4.3-b). An antibody specific to MAP2
proteins also produced similar results as the other three antibodies. Strong and well-
defined antibody staining was visible with cells grown on matrigel (Figure 4.4.4-a),
and a slightly reduced but still well defined antibody labelling was present with cells
grown on egg white (Figure 4.4.4-b).
Chapter 4.3: Results
165 | P a g e
Figure 4.4: Immunohistochemistry analysis of M17 cells differentiated on matrigel
and egg white matrixes.
M17 cell were grown in either matrigel (a) or egg white (b) and Immunocytochemistry
analysis of RA treated cells were done to test the neuronal marker levels. β-tubulin
III (1), Tau (2), DBH (3) and MAP2 (4) antibody labelling are visualized by green
fluorescence signals. Red signalling was from nuclear ethidium bromide staining
Chapter 4.3: Results
166 | P a g e
4.3.2.2 Analysis of protein expression levels in RA treated M17 cells using a 3D
culture system
M17 cells from both matrigel and egg white matrixes were collected and lysed to
extract protein, and then analysed by Western blotting. Four antibodies were used
to assess changes in the protein expression levels of neuronal cell markers. The
experiment was repeated three times and the results were consistent among the
three independent replicates.
β-tubulin III expression was significantly increased in lysates of all RA treated M17
cells compared to untreated cells, which was demonstrated by a strong band of
approximately 50-55 kDa by Western blot analysis. This strong band was visible in
both egg white and matrigel systems (Figure 4.5-A). The band corresponding to
untreated cell lysates was very faint suggesting low levels of β-Tubulin-III. Protein
loading was normalized using β-actin levels (Figure 4.5-B), and densitometric analysis
was performed to quantify changes in the expression levels (Figure 4.5-C).
Densitometry results demonstrated an approximately 7-fold increase in β-tubulin III
protein levels in cells grown on matrigel compared to control cells. In cells grown on
egg white, the fold difference was lower (3-fold) but still significant similar to the cells
grown on matrigel.
A second Western blot incubated with antibodies specific for tau protein displayed a
band of approximately 80 kDa in all lanes confirming expression of the protein. Band
intensity was much weaker in untreated control cells compared to RA-treated cells
Chapter 4.3: Results
167 | P a g e
(Figure 4.5-A). This suggested that tau protein levels have increased following RA
treatment in the 3D culture method. Both egg white and matrigel showed very
similar results, with tau signalling having only about 1-fold difference between the
two adhesive media. β-actin levels were then tested to ensure equal protein loading
across all the lanes (Figure 4.5-B), followed by quantification using densitometry
analysis (Figure 4.5-C), which showed approximately a 9-fold increase in tau
expression in response to RA treatment compared to untreated cells in the matrigel
system.
When incubated with an antibody specific for DBH, a band of approximately 70 kDa
was visible in all lanes confirming expression of the protein. Moreover, an increase
in band intensity was noticeable in RA treated cells compared to untreated cells
(Figure 4.5-A). Band intensity was highest with the matrigel system followed by the
egg white system, with very faint signalling visible in control samples using both
systems. This suggests that DBH protein expression levels have increased following
RA treatment using the 3D culture method. β-actin levels were then tested to ensure
equal protein loading across all the lanes (Figure 4.5-B), followed by the densitometry
analysis (Figure 4.5-C). Quantification analysis revealed that using the matrigel
system, over 7-fold increase in DBH expression was seen at the protein level in RA-
treated cells compared to the control M17 cells. With the egg white system, a 5-fold
increase in DBH protein levels was detected than in control cells.
MAP2 also displayed a similar trend to the other three neuronal markers. When
treated with RA, M17 cells showed an increase in MAP2 band intensity when cultured
Chapter 4.3: Results
168 | P a g e
in a 3D culture model. Expression of the MAP2 protein was confirmed by the
presence of an approximately 75 kDa band in all lanes (Figure 4.5-A). Once again, the
band intensity was highest with the matrigel system (approximately 4-fold increase)
compared to the control sample. Cells grown on egg white also showed an increase
of about 2.5-fold than the control M17 cells. β-actin levels were then tested to
ensure equal protein loading across all lanes (Figure 4.5-B), followed by the
densitometry analysis (Figure 4.5-C).
The increase observed in the protein expression levels of neuronal markers with the
3D culture system was contradictory to findings from the 2D culture system and the
reported observations in published literature. These findings are significantly
important considering the level of differentiation achieved with the novel 3D culture
method. Findings made in this study reiterate the importance of a 3D culture system
in achieving a better differentiation, at least in M17 cells.
Chapter 4.3: Results
169 | P a g e
Figure 4.5: Changes in protein expression levels in M17 cells following 3D culture
differentiation.
Neuronal markers, β-tubulin III, Tau, DBH and MAP2 (A) and the housekeeping β-
actin (B) protein levels of M17 cells grown in 3D culture system in the presence of
RA were measured with specific antibodies. (C) Densitometric analysis of neuronal
marker protein levels (normalised with the β-actin protein levels) are shown in
arbitrary units (AU). Molecular mass protein markers (Mr) are indicated on the left
of each gel. This result is representative of three similar independent experiments.
Chapter 4.3: Results
170 | P a g e
4.3.3 Modified 3D culture method with reduced differentiation time
The following modified 3D culture method was used to differentiate neuronal cell
lines, and consequently develop a differentiation method with a reduced treatment
period.
METHOD 1: Cells grown on matrigel with RA (for 2weeks) Cells grown on
matrigel for 1 week with anti-mitotic agents, no RA.
METHOD 2: Suspension culture of cells with RA (for 2weeks) Cells grown on
matrigel for 1 week with anti-mitotic agents, no RA.
METHOD 3: Suspension culture of cells with RA (for 2weeks) Normal cell culture
flasks for 1 week with anti-mitotic agents, no RA.
Immunocytochemistry was performed to assess the neuronal marker protein levels
using antibodies specific for β-tubulin III, tau, DBH and MAP proteins. MAP2 and DBH
are classified as markers of later stages of differentiation, while β-tubulin III is
classified as a more early stage differentiation marker in neuronal cells (Gingras et
al., 2007). The cells used for these experiments were cultured using the three
different cell culture methods (detailed above) for three weeks in the presence of RA.
Cells were cultured in 10 μM RA for the first two weeks followed by one week of
treatment with mitotic inhibitors. Three different human cell lines, which include the
neuroblastoma M17 and SY5Y cells, and the teratocarcinoma NT2 cells, were cultured
using these three different culture methods. Therefore, there were 9 different
treatment regimens and with four neuronal markers, 36 samples per set in total.
Chapter 4.3: Results
171 | P a g e
4.3.3.1 Filter method
This was the most basic method out of the three methods tested. Cells were grown
on filters which were coated with matrigel as the culture media, and after three
weeks of treatment, filter pieces were cut out to be used in immunocytochemistry,
and the rest of the cells were used to perform Western blotting.
4.3.3.1.1 M17 cells
M17 cells, which were cultured on filters, produced a strong fluorescence signal for
all four neuronal markers (Figure 4.6.1-a, 4.6.2-a, 4.6.3-a & 4.6.4-a,). This was
consistent with the previous study done with M17 cells cultured on a basic 3D system
using RA. Red ethidium bromide labelling was used as the nuclear marker and green
Alexa 488 labelling corresponds to the neuronal marker primary antibody.
β-tubulin III protein expression was seen in M17 cells with very strong green
fluorescence labelling present in both the cytoplasm and nucleus (Figure 4.6.1-a).
This labelling was seen in almost all and was consistent across the three individual
experimental sets. Tau labelling was also very strong (Figure 4.6.2-a) in M17 cells
grown on filters with RA. Tau protein is predominantly found in the axons of neurons,
in the cytosol and in association with plasma membrane components. DBH also
produced strong cytoplasmic fluorescence labelling in differentiated M17 cells
(Figure 4.6.3-a). This is an indication of late stage differentiation of these particular
Chapter 4.3: Results
172 | P a g e
cells. Strong MAP2 labelling was present in M17 cells (Figure 4.6.4-a), indicating that
the cells have reached a later stage of differentiation. With the tested samples,
almost all the cells unanimously produced positive fluorescence labelling suggesting
universal expression of these specific neuronal marker proteins.
4.3.3.1.2 SY5Y cells
All four antibodies for neuronal markers produced strong fluorescence labelling in
SY5Y cells (Figure 4.6.1-b, 4.6.2-b, 4.6.3-b & 4.6.4-b,). Specific neuronal marker
signals are identified by green labelling, while the red labelling indicates nuclear
staining by ethidium bromide. DBH green labelling visible was more concentrated in
the cytoplasmic area, and with other antibodies they were detected more towards
the neurites. Differentiated SY5Y cells were more elongated compared to normal
undifferentiated cells. Tau and MAP2 labelling was especially distinctive in neurite
projections in RA treated cells. Both DBH and MAP2 labelling were once again very
strong in RA treated SY5Y cells, suggesting full differentiation of the cells. The
antibody staining of these cells were consistent indicating complete differentiation
of the systems as a whole. Results obtained were consistent among the replicates
demonstrating convincing differentiation of SY5Y cells under these conditions.
Chapter 4.3: Results
173 | P a g e
4.3.3.1.3 NT2 cells
Strong fluorescence labelling was visible with all four antibodies when NT2 cells were
treated with RA (Figure 4.6.1-c, 4.6.2-c, 4.6.3-c & 4.6.4-c,). Similar with other cells
discussed above, red fluorescence staining indicates ethidium bromide labelling of
the nucleus and green staining corresponds to the neuronal marker primary
antibody. In general, using the filter method, NT2 cells had a tendency to grow as
cluster-like formations, which made it difficult to identify individual cells.
Nevertheless, fluorescence labelling was present abundantly with all neuronal
marker antibodies. Published literature suggests that at least 5-6 weeks of RA
treatment of NT2 cells can achieve their complete differentiation (Jain et al., 2007).
However, the presence of DBH and MAP2 after just 3 weeks of RA treatment using
the new method employed in this study suggests otherwise. Following RA treatment,
neurite bearing cells were clearly visible, while non-neuronal cells had almost
disappeared, thus producing ubiquitous labelling of the cells with all four antibodies.
Chapter 4.3: Results
174 | P a g e
Figure 4.6: 3D Cell differentiation – filter method.
Immunocytochemistry analysis of cells cultures with 3D filter method and treated
with RA. Fluorescence signalling from neuronal markers β-tubulin III (1), Tau (2), DBH
(3) and MAP2 (4) were present in all the three cell lines, M17 (a), SY5Y (b) and NT2
(c). Red signalling was from nuclear ethidium bromide staining
Chapter 4.3: Results
175 | P a g e
4.3.3.2 Suspension filter method
Cells were grown in a suspension culture with RA for two weeks, then transferred
onto filters coated with matrigel and then cultured for another week with mitotic
inhibitors prior to use in immunocytochemistry.
4.3.3.2.1 M17 cells
Antibody specific labelling was detected with all four neuronal markers in RA treated
M17 cells (Figure 4.7). Green fluorescence signifies labelling by neuronal marker
antibodies and red labelling indicates nuclear staining by ethidium bromide.
M17 cells displayed a more cluster forming tendency with this method compared to
the filter only method used previously. However, clear neurite outgrowth was
present and the cells were more elongated under RA treatment compared to the
normal spindle shape (Figure 4.7).
Strong green labelling was visible with β-tubulin III antibodies suggesting expression
of this neuronal marker protein (Figure 4.7.1.a). This labelling was present in almost
90-95% cells grown on coverslips. The same expression pattern was seen with tau,
which also produced strong green fluorescence labelling (Figure 4.7.2.a). Since most
of the cells were in a cluster formation, a defined labelling pattern in terms of protein
localisation could not be identified.
Chapter 4.3: Results
176 | P a g e
Both MAP2 (Figure 4.7.3.a) and DBH (Figure 4.7.4.a) neuronal markers were present
in RA treated M17 cells as shown by green fluorescence labelling. Presence of these
two neuronal markers suggests cells have reached the final stages of differentiation.
The majority of M17 cells were positive for green fluorescence labelling.
4.3.3.2.2 SY5Y cells
SY5Y cells treated with RA demonstrated positive fluorescence labelling for the four
neuronal marker antibodies tested (Figure 4.7.1.b, Figure 4.7.2.b, Figure 4.7.3.b,
Figure 4.7.4.b). Signals from the neuronal specific marker are shown by green
fluorescence and red labelling indicates nuclear staining by ethidium bromide.
Neuronal projections from SY5Y cells can be clearly identified using antibodies
specific for β-tubulin III (Figure 4.7.1.b), tau (Figure 4.7.2.b) and MAP2 (Figure
4.7.3.b). However, more prominent elongations were seen with the later neuronal
marker. DBH (Figure 4.7.4.b) was more confined to the cytoplasmic area, which was
consistent with previous experiments. Once again, by the presence of fluorescence
labelling for DBH and MAP2, it can be concluded that the cells are at a more end stage
of differentiation. All cells on the slide were universally fluorescent labelled and this
was consistent among the individual experimental sets.
Chapter 4.3: Results
177 | P a g e
4.3.3.2.3 NT2 cells
All four neuronal marker antibodies produced strong fluorescence labelling in NT2
cells cultured using the suspension and filter method and treated with RA (Figure
4.7.1.c, Figure 4.7.2.c, Figure 4.7.3.c, Figure 4.7.4.c). As mentioned previously, red
labelling signifies nuclear labelling from ethidium bromide and green labelling
corresponds to the neuronal marker primary antibody. NT2 cells still exhibited a
cluster formation tendency, however the tendency was decreased compared to the
Filter method. Both end stage neuronal markers were also present, as highlighted by
green labelling indicating the cells are fully differentiated. Specific labelling
localisations or patterns were again hard to identify due to the cluster like formations
displayed by NT2 cells.
Chapter 4.3: Results
178 | P a g e
Figure 4.7: 3D Cell differentiation – Suspension filter method.
Immunocytochemistry analysis of cells cultures with suspension culture filter
method and treated with RA. Fluorescence signalling from neuronal markers β-
tubulin III (1), Tau (2), DBH (3) and MAP2 (4) were present in all the three cell lines,
M17 (a), SY5Y (b) and NT2 (c). Red signalling was from nuclear ethidium bromide
staining
Chapter 4.3: Results
179 | P a g e
4.3.3.3 Suspension flask method
Cells were grown in a suspension culture for two weeks in the presence of RA, then
transferred into cell culture flasks and cultured for another week with mitotic
inhibitors prior to use in immunocytochemistry.
4.3.3.3.1 M17 cells
When cultured using this method, M17 cells produced specific fluorescence labelling
for all four neuronal markers tested. Green fluorescence labelling corresponded to
specific neuronal marker antibodies and red labelling represented nuclear staining
from ethidium bromide. This method promoted cell growth in a monolayer enabling
easier detection by immunocytochemistry compared to the other two culture
methods.
The β-tubulin III antibody produced strong green labelling indicating a very high
expression level of the protein in M17 cells (Figure 4.8.1.a). This protein was
expressed by all of the cells present on the coverslip. A similar expression pattern
was seen with the tau antibody, which produced strong green fluorescence labelling
(Figure 4.8.2.a) in M17 cells. Cell elongation and the presence of neurites were
identified when M17 cells were cultured using this method. MAP2 (Figure 4.8.3.a)
and DBH (Figure 4.8.4.a) neuronal markers were also present in RA treated M17 cells,
which were identified by green fluorescence labelling. Positive labelling for MAP2
Chapter 4.3: Results
180 | P a g e
and DBH neuronal markers suggests these cells have reached the final stages of
differentiation.
4.3.3.3.2 SY5Y cells
Strong green fluorescence labelling detected in SY5Y cells demonstrated positive
expression of the four neuronal marker antibodies tested (Figure 4.8.1.b, Figure
4.8.2.b, Figure 4.8.3.b, Figure 4.8.4.b). Red labelling present in the images are nuclear
staining by ethidium bromide. As seen with M17 cells, the presence of fluorescence
labelling for both DBH and MAP2 suggests that the cells are in a later stage of
differentiation. Florescent-labelled cells comprised almost 100% of cells present on
the slide and this phenomenon was consistent across the individual experimental
sets.
4.3.3.3.3 NT2 cells
When cultured using the suspension and flask method in the presence of RA, NT2
cells indicated positive labelling for all four neuronal marker antibodies used (Figure
4.8.1.c, Figure 4.8.2.c, Figure 4.8.3.c, Figure 4.8.4.c). Even with this culture method,
NT2 cells displayed a cluster-forming tendency although this was almost negligible
when compared with the previous two methods. Neuronal projections and cell
elongations could be clearly identified as the morphological changes the cells have
Chapter 4.3: Results
181 | P a g e
undergone when cultured using this method. NT2 cells produced green fluorescence
labelling for both DBH and MAP2 end stage neuronal markers, indicating the cells
were fully differentiated.
Chapter 4.3: Results
182 | P a g e
Figure 4.8: 3D Cell differentiation – suspension flask method.
Immunocytochemistry analysis of cells cultures with suspension culture flask
method and treated with RA. Fluorescence signalling from neuronal markers β-
tubulin III (1), Tau (2), DBH (3) and MAP2 (4) were present in all the three cell lines,
M17 (a), SY5Y (b) and NT2 (c). Red signalling was from nuclear ethidium bromide
staining
Chapter 4.3: Results
183 | P a g e
4.3.4 Analysis of protein expression levels in RA treated cells using the modified 3D
culture systems
Cells cultured with RA using three different 3D culture systems were collected and
lysed to extract proteins. Extracted proteins were then analysed using Western
blotting. The same four antibodies (β-tubulin III, tau, DBH and MAP2) used in
immunocytochemistry were used in Western blotting to assess changes in protein
expression levels of neuronal markers.
A strong band of approximately 50 kDa was visible in all the lanes indicating the
presence of β-tubulin III protein (Figure 4.9.A). The intensity of the bands
corresponding to β-tubulin III was lower in the 1st, 5th and the 9th lanes where proteins
were from the untreated M17, SY5Y and NT2 cells, respectively. Furthermore,
Western blotting of M17 cell proteins showed the largest increase in band intensity
between control cells and RA treated lanes (Figure 4.9.A), followed by NT2 and SY5Y
cells. Protein loading was normalized using β-Actin levels (Figure 4.9.B), which
verified consistent loading across all lanes. Densitometric analysis was performed to
quantify protein levels and the results are presented as a graph (Figure 4.9.C).
Suspension culture followed by culture in filters showed the highest increase in the
levels of β-tubulin III protein in both M17 and NT2 cells. The increase in the levels of
this neuronal marker was relatively lower in SY5Y cells compared to the other two
cell lines. However, the increase in β-tubulin III protein levels in RA treated cells was
still significant when compared to untreated control SY5Y cells.
Chapter 4.3: Results
184 | P a g e
A band of approximately 80 kDa in size was visible when incubated with antibodies
specific for tau protein (Figure 4.10.A). Once again, the lanes corresponding to
untreated control cells displayed the weakest band relative to RA treated lanes. This
observation suggests that tau protein levels have increased following RA treatment.
The most significant increase in tau protein was displayed in SY5Y cells. Increase in
the tau levels following the RA treatment was consistent and verified the previous
observations made with M17 cells in the basic 3D culture system. Equal protein
loading across all lanes were evaluated using the housekeeper gene β-actin (Figure
4.10B), followed by quantification using densitometry analysis (Figure 4.10.C).
Similar to β-tubulin III expression levels, tau expression was highest with the
suspension filter method.
Western blots incubated with an antibody specific for DBH also produced a strong
band of approximately 70 -75 kDa in all lanes (Figure 4.11.A), revealing the presence
of this neuronal marker in all samples. The intensity of the band was lower in the 1st,
5th and 9th untreated samples compared to the RA treated protein samples. Increase
in the band intensity of this neuronal marker with RA treatment suggests the
acquisition of neuronal cell-like properties following RA treatment. Blots were re-
probed with β-actin to ensure equal protein loading across all lanes (Figure 4.11.B).
Subsequently, densitometric analysis was performed to quantify the changes
observed (Figure 4.11.C). All 3 cell lines showed a significant increase in DBH
expression in response to RA, and of these M17 cells exhibited the most prominent
change.
Chapter 4.3: Results
185 | P a g e
MAP2 expression was significantly increased in lysates of all RA treated cells
compared to untreated cells (Lanes 1, 8 and 15), which was demonstrated by a strong
band of approximately 70 kDa by Western blot analysis (Figure 4.12.A). Presence of
these strong bands suggests high expression of this neuronal specific marker in RA
treated samples compared to untreated cells. Protein loading was normalized using
β-actin (Figure 4.12.B) and densitometric analysis was done to quantify the findings
(Figure 4.12.C). SY5Y cells showed the largest increase in MAP2 expression. Both
NT2 and M17 cells showed similar levels of change in MAP2 levels following RA
treatment. All three cell lines showed the highest change in expression using the
suspension filter method when treated with RA.
This increase in MAP2 and DBH levels when treated with RA using these 3D culture
systems demonstrates that the cells have progressed to a later stage of neuronal
differentiation.
Chapter 4.3: Results
186 | P a g e
Figure 4.9: Changes in β-tubulin III protein expression levels in cells following 3D
culture differentiation.
Western blot analysis of β-tubulin III protein levels in cells cultures with novel 3D
culture methods and treated with RA. The housekeeping β-actin (B) protein levels of
cells were also analysed using Western blotting. Densitometric analysis (C) of β-
tubulin III protein levels (normalised with the β-actin protein levels) are shown in
arbitrary units (AU). Molecular mass protein markers (Mr) are indicated on the left of
each gel. Corresponding control cells (WT) were used to analyse the difference in the
expression levels (lanes 1, 5 & 9). This result is representative of three similar
independent experiments.
Chapter 4.3: Results
187 | P a g e
Figure 4.10: Changes in tau protein expression levels in cells following 3D culture
differentiation.
Western blot analysis of tau levels in cells cultures with novel 3D culture methods
and treated with RA. The housekeeping β-actin (B) protein levels of cells were also
analysed using Western blotting. Densitometric analysis (C) of tau protein levels
(normalised with the β-actin protein levels) are shown in arbitrary units (AU).
Molecular mass protein markers (Mr) are indicated on the left of each gel.
Corresponding control cells (WT) were used to analyse the difference in the
expression levels (lanes 1, 5 & 9). This result is representative of three similar
independent experiments.
Chapter 4.3: Results
188 | P a g e
Figure 4.11: Changes in DBH protein expression levels in cells following 3D culture
differentiation.
Western blot analysis of DBH levels in cells cultures with novel 3D culture methods
and treated with RA. The housekeeping β-actin (B) protein levels of cells were also
analysed using Western blotting. Densitometric analysis (C) of DBH protein levels
(normalised with the β-actin protein levels) are shown in arbitrary units (AU).
Molecular mass protein markers (Mr) are indicated on the left of each gel.
Corresponding control cells (WT) were used to analyse the difference in the
expression levels (lanes 1, 5 & 9). This result is representative of three similar
independent experiments.
Chapter 4.3: Results
189 | P a g e
Figure 4.12: Changes in MAP2 protein expression levels in cells following 3D
culture differentiation.
Western blot analysis of MAP2 levels in cells cultures with novel 3D culture methods
and treated with RA. The housekeeping β-actin (B) protein levels of cells were also
analysed using Western blotting. Densitometric analysis (C) of MAP2 protein levels
(normalised with the β-actin protein levels) are shown in arbitrary units (AU).
Molecular mass protein markers (Mr) are indicated on the left of each gel.
Corresponding control cells (WT) were used to analyse the difference in the
expression levels (lanes 1, 5 & 9). This result is representative of three similar
independent experiments.
Chapter 4.4: Discussion
190 | P a g e
CHAPTER 4.4: Discussion
RA induced cellular differentiation is one of the most common and widely used
methods in differentiating cells, including neuronal cell lines. Currently, the
neuroscience field is lacking a successful and economical method to differentiate
neuronal cells into the primary neuronal stage. Many studies reported in the
literature with different cell lines have been unable to develop a successful,
economical and universal method to differentiate human neuronal cells. In this
study, we were able to compare and further develop the current methods used into
a more economical and efficient method. This study also obtained very conclusive
evidence to elucidate the importance of a 3D cell culture system in neuronal cell
differentiation.
4.4.1 M17 cells are resistant to retinoic acid in a conventional 2D cell culture system
When M17 cells were cultured using a conventional 2D system, they showed
resistance towards RA treatment. This was concluded by both immunocytochemistry
and Western blotting techniques. With both methods, M17 cells showed no
significant increase in neuronal marker levels (Figure 4.2 and Figure 4.3) following a
14-day RA treatment.
Chapter 4.4: Discussion
191 | P a g e
Green fluorescence labelling indicative of neuronal marker expression (Figure 4.2)
was very limited for all four tested neuronal marker antibodies (β-tubulin III, tau, DBH
& MAP2). Western blotting results also showed (Figure 4.3) no significant increase
when quantified using densitometric analysis. These findings are in agreement with
literature where it has been reported that following RA treatment, proliferation
rather than differentiation or apoptosis occurs (Draoui et al., 1997; Ramkumar and
Adler, 1999). Although RA resistance of M17 cells with the conventional 2D culture
method has been widely reported, the mechanism involved in RA resistance remains
to be investigated (Melino et al., 1996). Nevertheless, cell-cell interaction is well
known to be important in neuronal development. Cell-cell interaction is crucial
during neural development. Many aspects of neuronal development, including
migration of neural cells and the establishment of functional interactions between
axons and their target cells are highly dependent on cell-cell interactions (Cole et al.,
1986). Cellular interaction and the environment has also been directly linked with
neuronal cell differentiation and cellular morphogenesis (Letourneau et al., 1994).
Moreover, the ECM and neuronal cell interaction has also been linked to neuronal
cell migration, cell shape, cytoskeletal architecture and neurite growth (Damsky and
Werb, 1992; Strittmatter and Fishman, 1991). Both cell-cell interaction and cell-ECM
interaction are limited in a conventional 2D cell culture model. This may be the
underlying reason for the limited cellular differentiation observed with M17 cells in a
2D culture.
Chapter 4.4: Discussion
192 | P a g e
4.4.2 M17 cells acquire expression of neuronal markers when cultured in the
presence of RA in a 3D cell culture system
The conventional method of cell culture involves growing cells on a flat 2D substrate,
hence far different from the physiological environment of the in vivo state. Under
physiological conditions, cells acquire their natural 3D structure where it is supported
by a complex ECM, which facilitates the cells to function in their optimal condition.
However, the widely used 2D cell culture models does not allow for such support or
cell-cell interactions and contacts thus, failing to provide the sufficient physical and
chemical cues which underlie their characteristics and functions in vivo (Ben-Ze'ev,
1991). As a consequence, there has been widespread concern and discussion
regarding the validity and resemblance of the data obtained from 2D cell culture
models to a 3D culture model (Geckil et al., 2010).
As mentioned previously, M17 cells have been reported to be RA resistant in a normal
2D culture system. Thus, a novel method was developed in my PhD studies to culture
cells in a 3D matrix to promote RA-induced cell differentiation. A 3D culture system
was developed using cell culture filters and coating them with matrigel or the cheaper
alternative, egg white as the 3D cell adhesive media. Cells cultured on the 3D systems
were treated with either 10 μM RA as the experimental group or without RA as the
control group. After 14 days, cells were harvested and analysed for the expression
levels of neuronal markers using immunocytochemistry and Western blotting.
Chapter 4.4: Discussion
193 | P a g e
The dichotomy between a 2D and 3D cell culture system was clearly demonstrated
by the immunocytochemistry results alone. A dramatic increase was clearly evident
in all the neuronal marker protein levels (Figure 4.4), compared to the 2D culture
method (Figure 4.2). With 2D differentiation, neuronal marker labelling of M17 cells
was very limited and could not be seen in all the cells present. However, with the 3D
culture system, RA treated cells displayed strong and unanimous labelling of the
neuronal markers. Most importantly, despite the type of cell adhesive media used,
both matrigel and the cheaper alternative egg white produced strong labelling for the
tested neuronal markers. However, signals produced with egg white were slightly
weaker than with the matrigel system. After 14 days of RA treatment, the matrigel
matrix was holding marginally better than the egg white matrix. Considering the
prolonged time (3-4 weeks) of the next study, matrigel was selected as the preferred
matrix for further studies. However, after considering the results obtained during
the current study and given its cost effectiveness and readily availability, egg white
can be classified as a very cost effective alternative for matrigel.
The immunocytochemistry results were re-confirmed by Western blotting results
where there was a significant increase in neuronal marker protein levels in 3D
cultured cells when compared to that in control M17 cells (Figure 4.5). Only a minor
and almost negligible difference could be seen in the expression levels of the
neuronal marker proteins between matrigel and egg white matrixes.
This increase in neuronal marker levels observed in M17 cells was contradictory from
the results obtained with the 2D method and also with the reported literature where
Chapter 4.4: Discussion
194 | P a g e
conventional 2D culture method and RA was used on M17 cells (Draoui et al., 1997).
Though this observation is novel and not previously reported in the literature, similar
kind of differences in the expression levels have been reported in relation to 2D and
3D cell culture methods. Studies done with PMC4 cells have shown an increase in
milk-specific gene expression when treated with hormone in a 3D matrix system
compared to the flat 2D system (Ackland et al., 2001). Extensive studies done with
human endothelial cells have also shown the importance of a 3D cell culture system
over a 2D method. A study conducted by Davis and colleague have shown that when
cultured in a 3D system, human endothelial cells develop intracellular vacuoles that
coalesce to form capillary lumens and tubes (Davis and Camarillo, 1996). In another
study, Sacharidou and colleagues have shown the importance of a 3D culture over a
2D system where they reported a 3D culture specific endothelial lumen signalling
complexes involved in the formation of lumen and tube structures of endothelial cells
(Sacharidou et al., 2010). Culture of human skin cells have also shown marked
increase in their ability to withstand cytotoxic agents when cultured in a 3D method.
This study reported up to 50% increase in resistance and a difference in the way cells
respond to small molecules under a 3D culture method (Sun et al., 2006).
There are more compelling evidence highlighting the difference in the way cells react
and interact when grown in a 3D culture system rather than using the conventional
method. Thus, the observations made by the current study re-iterate the importance
of a 3D culture system over a conventional 2D system. Though many publications
have reported M17 cells as RA resistant and not differentiable, this study
demonstrates that under the correct conditions it can be induced to differentiate into
Chapter 4.4: Discussion
195 | P a g e
a more neuronal cell-like stage. Thus, the current study allows the usage of a cell
culture model that is more readily available for neuronal research.
4.4.3 Modified 3D culture methods
NT2 cells in general are considered to have a rather prolonged differentiation
process. Published literature reports that they can take between 42 and 54 days to
differentiate into post-mitotic neurons (Andrews, 1984). Another study has
suggested the use of suspension cultures to reduce the differentiation time of NT2
cells (Jain et al., 2007; Paquet-Durand and Bicker, 2007; Paquet-Durand et al., 2003).
One of the disadvantages of suspension cultures is their susceptibility for infections.
Suspension cultures need regular agitation to keep cells in suspension and
centrifuging to passage cells (Mustafa et al., 2011). The absence of an ECM and cell
interactions may be a limiting factor with this method in achieving terminal
differentiation with some cell types. Hence, the following modified 3D culture
methods were used to differentiate neuronal cell lines with a reduced treatment
period and a better 3D model of cellular matrix:
1. Cells grown on matrigel with RA (for 2weeks) Cells grown on matrigel for 1
week with anti-mitotic agents, no RA;
2. Suspension culture of cells with RA (for 2weeks) Cells grown on matrigel
for 1 week with anti-mitotic agents, no RA;
3. Suspension culture of cells with RA (for 2weeks) Normal cell culture flasks
for 1 week with anti-mitotic agents, no RA.
Chapter 4.4: Discussion
196 | P a g e
Immunocytochemistry and Western blotting were performed to assess neuronal
marker protein levels using antibodies for β-tubulin III, tau, DBH and MAP proteins
following the treatment periods. MAP2 and DBH are classified as markers of late
stage differentiation, while β-tubulin III is classified as an early stage marker of
neuronal cell differentiation (Gingras et al., 2007).
Immunocytochemistry analysis of the three cell lines displayed positive and specific
labelling with the four neuronal marker antibodies tested (Figure 4.6, 4.7 and 4.8) ,
and Western blotting confirmed the findings of immunocytochemistry analysis
(Figure 4.9, 4.10, 4.11 & 4.12). Western blotting and densitometry analysis confirmed
that the increase in neuronal marker protein levels were significant in all three cell
lines with all three different methods tested. In summary, cells grown in suspension
with RA followed by the filter method demonstrated the highest level of significance.
However, cells grown on the filter for the entire period also showed similar results to
the suspension filter method. Cells grown on suspension culture and transferred
onto cell culture flasks also showed an increase in neuronal marker protein levels.
However, compared to the other two methods the increase in expression of the
neuronal markers was considerably low. This observation suggests that the extra one
week of 3D culture can promote cellular differentiation even further. As discussed
above, this might be due to the cell-cell interaction and ECM-cell interaction, which
is more conceivable with the 3D matrix than with monolayer flasks.
The positive labelling, which was seen with both MAP2 and DBH neuronal markers,
signifies that the cells have reached the final stages of neuronal differentiation
Chapter 4.4: Discussion
197 | P a g e
(Dehmelt and Halpain, 2005; Gingras et al., 2007). Published literature reports the
necessity for longer RA treatment periods to achieve terminal differentiation
(Pleasure et al., 1992). However, one study that used a simple suspension method
to achieve neuronal differentiation has reported a shorter turnover period, although
the yield of post-mitotic neurons was considerably reduced with this method (Cheung
et al., 1999). Immunocytochemistry results obtained from our study failed to identify
any non-stained cells, suggesting that the majority of cells have reached the terminal
stages of differentiation. After 3 weeks of RA treatment, cells appeared healthy and
very little dead cells were present, confirming the suitability of these methods to
differentiate cells for further studies.
4.4.4 Conclusion
In conclusion, the findings of this study have successfully identified a novel method
to differentiate M17 cells in vitro, which has previously been reported as RA resistant.
In contrast to the conventional 2D culture method, a 3D cell culture model in
conjunction with RA has resulted in a significant overexpression of neuronal marker
levels in M17 cells, making this the most significant discovery of this study. This
finding also reiterates the importance of the cell culture media and culture
environment used in experiments. As a well-established and widely used cell line in
neuroscience research, the current findings allows M17 cells to be used in a wide
variety of studies and experiments. Their ability to terminally differentiate into a
Chapter 4.4: Discussion
198 | P a g e
more neuronal state means better access to cheaper and widely available culture
models in the future.
The modified 3D differentiation culture model, which was tested during this study,
enables a shorter, efficient and more economical approach to generate terminally
differentiated neurons. This novel method with a shorter period of RA treatment will
facilitate all studies involving primary neurons and will enable study and greater
understanding of the bio-mechanisms involved in cell differentiation and
pathophysiology.
In summary, the findings of the current study will be valuable in developing a cell
culture model, which can be used as an alternative to animal models in neuroscience
research and drug screening studies.
Chapter 5: General Discussion
199 | P a g e
CHAPTER 5: General Discussion
A diet high in PUFAs, mainly omega-3 FAs, have been reported to reduce the risk of
some common cancers, notably those of breast, colon, and perhaps, prostate cancer
(Berquin et al., 2007; Brasky et al., 2010; Hall et al., 2008; Wolk et al., 2006). It has
also been reported that omega-3 FAs can inhibit the growth of tumours in animal
models (Kato et al., 2007; Zhang et al., 2013), and increase the rate of apoptosis in
cancer cells (Abdi et al., 2014; Serini et al., 2008). Epidemiological and pre-clinical
studies have shown that a diet rich in omega-3 FAs, such as DHA, inhibits colon
tumours by modulating signalling pathways that alter gene expression related to
tumour growth and inducing apoptosis (Chapkin et al., 2008; Reddy, 2002; Skender
et al., 2014). Anti-inflammatory properties have also been observed in diets rich in
omega-3 acids. In vitro studies have revealed an ability of omega-3 FAs to promote
apoptotic death of pro-inflammatory T helper cell-1 lymphocytes through
incorporating into the cell membrane (Switzer et al., 2004). Thus, many protective
effects of omega-3 FAs have been reported over the years. The importance of DHA
in neuronal cells has also been reported widely. One of the most important findings
to support the effect of DHA in neuronal cells is the binding affinity DHA has to these
cells. DHA has the highest reported fatty acid-binding protein/ligand interaction ratio
in human neuronal cells. The binding affinity of DHA has a Kd value of approximately
10 nM, which is even greater than the RA affinity towards its binding proteins (Xu et
al., 1996).
Chapter 5: General Discussion
200 | P a g e
Similarly, zinc is considered to be one of the most important trace elements for
cellular and biochemical functions (Bitanihirwe and Cunningham, 2009; Takeda,
2000). However, excessive amounts of zinc is considered to be cytotoxic (Szewczyk,
2013). Many neurodegenerative conditions such as AD has been linked to excessive
amounts of free zinc (Watt et al., 2010). Thus, the homeostasis of zinc is very
important at the cellular level. Two main groups of proteins are involved in
maintaining the zinc balance at the cellular level. The ZnT family that mediates zinc
efflux from cells to ECM or into cellular compartments or organelles (Cousins and
McMahon, 2000), and the Zip family that transport zinc from the ECM or from
intracellular vesicles into the cytosol (Cousins et al., 2006).
The main focus of the current PhD project was to evaluate the effect of DHA on
neuronal cell survival and zinc homeostasis. In summary, the current study was able
to demonstrate a link between DHA and free zinc availability, and also link DHA with
zinc transporter expression levels. Importantly, the current study was able to confirm
the link between DHA and apoptosis, which has been discussed above.
Chapter 5: General Discussion
201 | P a g e
5.1 DHA effect on neuronal cell survival and zinc homeostasis
5.1.1 DHA effect on apoptosis levels
To establish the role of DHA as a neuro-protector, apoptosis marker levels were
tested in DHA-treated neuronal cells using Western blotting (Figure 1.14 & Figure
1.15). When treated with 20 μg/ml DHA for 48 hours, M17 cells demonstrated a
marked reduction in caspase-3 protein levels compared to untreated cells (Figure
1.14). Densitometry analysis revealed a significant decrease in caspase-3 protein
levels (66%) with the DHA treatment, when compared with untreated cells. In
contrast, Bcl2 levels were upregulated following DHA treatment (Figure 1.15). Bcl2
is known to promote cell survival by inhibiting apoptotic death and by regulating
programmed cell death (Miyashita et al., 1994; Oltvai et al., 1993; Reed, 1994).
Caspase-3 on the other hand is a well-known end stage marker of apoptosis (Gown
and Willingham, 2002; Jeruc et al., 2006). Therefore, the findings of this study
corroborate published literature, where DHA has been reported as a regulator for
apoptosis.
5.1.2 DHA and zinc transporter levels
When tested for zinc transporter expression levels following the DHA treatment,
ZnT3 expression exhibited a significant downregulation at both the mRNA (Figure 2.6)
and protein levels in M17 and NT2 cells (Figure 2.16 & Figure 2.19). ZnT3 is prominent
Chapter 5: General Discussion
202 | P a g e
in the human brain and testis, and within the brain it’s more pronounced in the
hippocampus and cerebral cortex (Palmiter et al., 1996). Zinc accumulation in
synaptic vesicles are known to be facilitated by the ZnT3 transporter (Palmiter et al.,
1996), highlighting the importance of the ZnT3 transporter in neuronal cells. In the
current study, we demonstrated a significant downregulation of ZnT3 mRNA levels
when grown in DHA enriched culture medium compared to the control cells (Figure
2.6). These findings suggest a possible DHA dependent regulation of cellular zinc
levels in these tested human cells. To test this theory further, cellular levels of “free
zinc” availability was tested using zinc fluorophores and these results are reported in
Chapter 3 of this thesis.
5.1.3 DHA and free zinc availability
M17 and NT2 cells were grown in a culture medium enriched with DHA (20 μg/mL)
prior to exposure to Zinpyr-1 for a period of 30 minutes. DHA treated cells showed a
marked reduction in fluorescence labelling compared to untreated cells at the 48
hour timepoint (Figure 3.3, Figure 3.4, Figure 3.7 & Figure 8). At the 0, 4, 8, 16 & 24
hour timepoints there were no significant changes observed in fluorescence labelling
patterns, apart from a minor decrease in the intensity at later timepoints. Results
observed were tested for DHA specificity using LA, where no differences were visible
in fluorescence signalling (Figure 3.2 & (Figure 3.6). Similarly, DHA specific cellular
responses have been reported with many different cell types. When treated with
metabolites derived from omega-6 arachidonic acid (epoxyeicosatrienoic acid)
Chapter 5: General Discussion
203 | P a g e
angiogenesis and tumour progression was increased in mice. In contrast, when
treated with DHA, more than 70% reduction in primary tumour growth and
metastasis was observed (Zhang et al., 2013). In a study performed with using U937
cells, DHA induced a rapid increase in Ca2+, suggesting an ability of DHA to mobilise
Ca2+ from intracellular pools. However, when tested with other structural analogues
of DHA, this same effect was not visible (Aires et al., 2007). Many other studies also
have shown similar DHA-specific effects on cellular apoptosis in cancer cells. (Iigo et
al., 1997; Merendino et al., 2003; Rahman et al., 2013; Suzuki et al., 1997).
The ability of DHA to regulate apoptosis was also established in the present serum
starved study conducted using M17 and NT2 cells. DHA alone was sufficient to rescue
cells, which were serum starved for 48 hours (Figure 3.5 & Figure 3.9). As discussed
above, both pro and anti-apoptotic effects of DHA have been reported in literature.
The combination of results obtained in both Chapters 2 and 3 suggest possible DHA
regulation of apoptosis. Results obtained in Chapter 3 also reveal a significant
decrease in cellular free zinc levels with DHA treatment. Elevated levels of free zinc
have been linked to both necrotic and apoptotic death in neuronal cells (Choi et al.,
1988; Chuah et al., 1995; Cuajungco and Lees, 1997b; Duncan et al., 1992; Yokoyama
et al., 1986). Taken together, these results indicate a potential link between DHA,
free zinc availability and apoptosis.
Following analysis of the results, we propose that the apoptotic regulatory effects of
DHA are mediated through control of cellular zinc homeostasis. In neuronal cells, this
mechanism may contribute to the positive effects of DHA as a neuro-protector by
Chapter 5: General Discussion
204 | P a g e
reducing neuronal cell death and neurodegenerative diseases such as AD (Figure 5.1),
whose incidence is reduced in populations with a high omega-3 FA diet.
5.2 Cellular differentiation
Scientific research into cellular, molecular and pharmaceutical aspects is in desperate
need of improved in vitro models to aid the identification and assessment of many
biological functions and reactions. The widely used traditional cell culture models
involve growing cells on a 2D substrate. Though this practice is common, easy and
economical than any complex cell culture model, there are certain flaws attached to
this system. With the 2D method, cells adapt to a synthetic 2D environment, thus
changing the characteristics of normal cells and becoming flattened. Cell-cell
interaction becomes hindered and ultimately cells fail to express and perform at the
peak level. Therefore, the demand for a more efficient and economical 3D cell culture
model has grown over the years. A 3D culture model will allow cells to grow in an
environment which is closer to the native physiological conditions. In a 3D cell
culture, cells are able to acquire a natural 3D phenotype, thus favouring improved
cell proliferation, differentiation and function. In the current study, we succeeded in
overcoming M17 cell resistance to RA by using a 3D model, thus enabling cells to
acquire a more neuronal phenotype.
In the second part of the study, we also managed to develop a shorter and more
efficient 3D culture model to use with cellular differentiation.
Chapter 5: General Discussion
205 | P a g e
Figure 5.1: Schematic diagram of the proposed apoptotic regulatory effect of DHA.
Following the analysis of the key findings of this study, we propose that the apoptotic
regulatory effects of DHA are mediated through control of cellular zinc homeostasis.
In turn this mechanism may contribute to the positive effects of DHA as a neuro-
protector by reducing neuronal cell death and neurodegenerative diseases such as
AD. The key findings of this study are represented by the solid (black) arrows. Empty
(white) arrows represent possible benefits of DHA in neuroprotection (NP) and
therefore contributing to lower incidence of neurodegenerative diseases (ND), such
as Alzheimer’s disease (AD).
Chapter 5: General Discussion
206 | P a g e
5.2.1 Differentiating M17 cells
M17 cells are a subclone of the parental cell line SK-N-BE(2). The parental cell line
was originally isolated in 1972 from the bone marrow of a two year old Caucasian
male suffering from disseminated neuroblastoma (Ciccarone et al., 1989). M17 cells
have been long reported as a RA resistant cell line, thus been deemed not suitable
for differentiation (Carvalho et al., 1993; Draoui et al., 1997; Melino et al., 1993).
During the current study we managed to differentiate M17 cells to acquire mature
neuronal cell properties by using a 3D culture model instead of the traditional 2D
monolayer model.
Immunocytochemistry performed on M17 cells which were grown on 3D culture and
treated with RA, showed a clear increase in all neuronal marker protein levels (Figure
4.3) compared with M17 cells grown on 2D culture flasks (Figure 4.2). In M17 cells
grown on 2D flasks, neuronal marker labelling was very limited and not ubiquitous
among all the cells present. However, RA treated cells grown under a 3D culture
system displayed strong and universal labelling of the neuronal markers.
This study yet again establishes the importance of a 3D culture model over the
conventional 2D model. Due to its versatility and availability, M17 cells have become
a widely used cell culture model. However, many attempts to differentiate M17 cells
have failed in the past. As discussed above, 3D differentiated cells allow a closer
resemblance to the structure and function of their in situ counterparts. Having a
greater resemblance to the actual physiological conditions allows researchers to
Chapter 5: General Discussion
207 | P a g e
carry out more accurate in vitro investigations of complex biological processes.
Studies have shown a clear difference in cell-cell interactions, drug delivery methods
and cellular responses in neuroblastoma cells and primary neuronal cells (Haghighat
et al., 2000; LePage et al., 2005; Storch et al., 2000). Therefore, the current M17 cell
differentiation protocol we have developed has the potential to provide substantial
benefits for further neuroscience studies.
5.2.2 Novel differentiation method
One of the disadvantages of the current differentiation methods are the lengthy
periods of RA treatment. As an example, NT2 cells take between 42 and 54 days to
differentiate into post-mitotic neurons (Andrews, 1984). Shorter RA treatment
periods have resulted in a reduced yield of post-mitotic neurons (Cheung et al., 1999).
During this study, we were able to develop a novel differentiation method with a
reduced RA treatment time, without compromising the yield or the quality of cells.
Cells grown in suspension culture followed by the filter method showed the highest
increase in neuronal marker levels compared to the other two methods tested. This
novel combination of suspension culture and filter enables cells to have a better cell-
cell and cell-matrix interaction than the suspension culture alone. Moreover, this
method cuts down the differentiation period in half to just 21 days, making the entire
differentiation process more economical and efficient. The simplicity of the method
and the quick turnaround period allows this method to be used easily and routinely
in laboratory experiments.
Chapter 5: General Discussion
208 | P a g e
A readily available method of producing human neurons in the lab has many
advantages. Due to the lack of availability and ethical complications linked with
primary human neuronal cells, many scientists rely on using animal models or other
substitutions for neuronal studies. Thus, the current model provides an easy and
cheaper alternative for obtaining pure post mitotic neuronal cells. Ultimately, a
similar method of producing human neuronal cells can be used in gene therapy,
neurogenesis and neural transplantation. This will greatly facilitate in combating the
increasing incidence of neurodegenerative cases and treating other brain related
injuries (Paquet-Durand and Bicker, 2007; Trojanowski et al., 1997).
5.3 Limitations of the present study
One of the main aims of this study was to identify any possible link between DHA and
zinc homeostasis. Human cells treated with different doses of DHA in the presence
or absence of zinc displayed several important patterns in the expression levels of
zinc transporters and the availability of free zinc. The ZnT3 transporter exhibited the
most significant change in expression following DHA treatment. Labile zinc levels
were also significantly altered following DHA treatment. Moreover, the apoptosis
marker caspase-2, was downregulated in M17 and NT2 cells following DHA
treatment.
Chapter 5: General Discussion
209 | P a g e
The cells used in Chapters 2 and 3 of the current study were not differentiated cells,
thus were not a true and accurate representation of primary neuronal cells.
Therefore, more work needs to be carried out before proposing an overall model for
ZnT or ZIP transporter expression. It will be interesting to ascertain the outcome if
the experiments were conducted using differentiated cells. However, studies have
shown that both undifferentiated M17 and SY5Y cell lines express neuronal markers
to a certain extent (Ciccarone et al., 1989). In general, SY5Y cells are more
predisposed to environmental parameter induced variations in gene expression, and
are influenced by factors such as the health of the culture media, nutrient
composition and the growth substrates utilized (Buttiglione et al., 2007). A study
conducted using SY5Y cells and different types of growth media and substrates
suggests that the expression of neuronal differentiation markers can be reduced by
the use of FBS on carboxylic group containing surfaces (Buttiglione et al., 2007).
Therefore, fewer neuronal characteristics exhibited by SY5Y cells in some cases can
be attributed to this reason.
5.4 Future directions
To ascertain a better understanding of the effect of DHA on neuronal survival and
zinc homeostasis under natural physiological conditions, it will be beneficial to repeat
the Chapter 2 & 3 studies with differentiated cells using the methods proposed in
Chapter 4. As discussed extensively, differentiated cells can mimic actual
Chapter 5: General Discussion
210 | P a g e
physiological conditions better than undifferentiated cells. Thus, their cellular
responses will be more accurate and similar to in situ conditions. Though the cells
used in Chapters 2 and 3 have many neuronal properties, as reported extensively in
literature, they are very different to primary neuronal cells. Therefore, it will be
interesting to find out whether differentiated cells possessing more neuronal
properties will respond likewise when treated with DHA. A study conducted in mice
have reported similar results to that obtained in this study (Jayasooriya et al., 2005b;
Kitajka et al., 2004). If differentiated cells respond to DHA in the same way, this will
provide conclusive evidence to establish the effect of DHA on neuronal survival and
zinc homeostasis.
It will also be beneficial to study the importance of the ZnT3 transporter in neuronal
cells. One of the most resourceful and widely used techniques to study its
importance will be to manipulate the gene expression of ZnT3 at the cellular level.
Overexpression and most importantly silencing of the ZnT3 gene will provide greater
knowledge of the importance of this transporter in neuronal cells. To study gene
manipulation effects, cell lines with silenced or overexpressed ZnT3 will need to be
established, and subsequently analysed for transporter expression levels using QPCR.
Zinc fluorophore studies can assist in the understanding of zinc trafficking in the
silenced and overexpressed cell lines. The effects of both silencing and
overexpression on cell survival must be investigated by analysis of caspase-3 and Bcl2
levels. It will also be interesting to determine whether there is a direct link between
DHA, APP and β-amyloid levels. Both APP and β-amyloid are hallmark proteins in AD
pathophysiology. DHA treated-differentiated neuronal cells can be tested using
Chapter 5: General Discussion
211 | P a g e
Western blotting or QPCR techniques to determine if there are any changes to APP
and β-amyloid expression levels. Collectively, these additional studies will benefit in
understanding the importance of these zinc transporters to human cells even further.
5.5 Significance of the current findings
As discussed extensively throughout this thesis, neurodegenerative disorders
including AD are considered a huge health threat and a burden to individuals, and to
the world as a whole. With the rapid increase in rate and no effective cure,
neuroscience research has become a national priority for many countries.
The current study provides a few significant contributions towards the advancement
of neuroscience research, to ultimately find a cure for many neurodegenerative
conditions. There is a significant amount of data that has been reported linking excess
amounts of free zinc to AD. Moreover, many other studies have reported
neuroprotective effects of DHA, especially in relation to AD. However, the exact
mechanism of DHA or zinc involvement in such conditions was not clear until now.
During this study, we successfully elucidated a link between free zinc availability, DHA
levels and apoptosis, thus we are able to suggest a pathway of neuroprotection
following DHA treatment at the cellular level. Understanding the ability of DHA to
regulate apoptosis via altering zinc homeostasis provides a possible platform and a
mechanism for further studies in both cellular and animal models.
Chapter 5: General Discussion
212 | P a g e
The other major contribution of this study was to develop a better cell culture model
for neuronal differentiation. Due to the practical difficulties in obtaining primary
neuronal cells for experiments, much research is done with alternatives such as
neuroblastoma cells or animal models. Though, both alternatives share similarities
at the structural and functional level with primary neurons, there are many major
dissimilarities as well. Thus, the validity of the observations seen with alternative
models are somewhat questionable. Therefore, the current PhD project provides an
economical, effective and simple method of differentiating neuronally committed
cells into primary neuronal cells. This method allows quick and easy access to
terminally differentiated neuronal cells for neuroscience research. Therefore,
increasing the productivity and specificity of the research conducted. More
importantly, by further improvement of this method, it can ultimately be used as a
method for producing human neuronal cells, which in turn can be used in gene
therapy, neurogenesis and neural transplantation. This will greatly facilitate
combating the increasing incidence of neurodegenerative cases and treating other
brain related injuries.
Chapter 5: General Discussion
213 | P a g e
5.6 Conclusion
In conclusion, the experimental findings of this thesis provide novel information
about DHA involvement in zinc uptake and apoptosis in human cells. Following a
comprehensive analysis of the molecular events in DHA treated M17 and NT2 cell
lines, we conclude that zinc uptake was significantly lowered and ZnT3 mRNA and
protein levels were downregulated in comparison to DHA-depleted cells. Moreover,
the end apoptosis marker caspase-3 displayed a marked reduction in protein levels
when compared with untreated cells. Furthermore, anti- apoptotic Bcl-2 protein
levels were increased following the DHA treatment in both M17 and NT2 cells. In
combination, these observations infer a link between DHA and free zinc availability,
which ultimately can regulate programmed cell death in neuronal cells. However,
with both SY5Y cells and the human keratinocyte cell line HaCaT we did not observe
this same response to DHA, highlighting the neuronal specificity of the findings made
during this study.
The outcomes presented in this thesis re-establish the importance of 3D cell culture
models. M17 cells which were previously reported as RA resistant, when cultured on
3D models responded to RA and expressed neuronal markers. The current study also
presents a novel method with shorter treatment periods for cellular differentiation.
This unique method combining suspension culture and 3D culture facilitate terminal
cellular differentiation of both M17 and NT2 cells to neuronal cells within 21 days,
which is almost half the time of most widely used methods. This novel method
Chapter 5: General Discussion
214 | P a g e
provides an efficient, economical and simple method for cellular differentiation in
neuroscience research.
Chapter 6: Bibliography
215 | P a g e
CHAPTER 6: Bibliography
Abbott, A. (2003). Cell culture: biology's new dimension. Nature 424, 870-872.
Abdi, J., Garssen, J., Faber, J., and Redegeld, F.A. (2014). Omega-3 fatty acids, EPA
and DHA induce apoptosis and enhance drug sensitivity in multiple myeloma
cells but not in normal peripheral mononuclear cells. The Journal of nutritional
biochemistry 25, 1254-1262.
Ackland, M.L., and Michalczyk, A. (2006). Zinc deficiency and its inherited disorders -
a review. Genes Nutr 1, 41-49.
Ackland, M.L., Michalczyk, A., and Whitehead, R.H. (2001). PMC42, a novel model
for the differentiated human breast. Exp Cell Res 263, 14-22.
Aggett, P.J. (1983). Acrodermatitis enteropathica. J Inherit Metab Dis 6 Suppl 1, 39-
43.
Agholme, L., Lindstrom, T., Kagedal, K., Marcusson, J., and Hallbeck, M. (2010). An in
vitro model for neuroscience: differentiation of SH-SY5Y cells into cells with
morphological and biochemical characteristics of mature neurons. J Alzheimers
Dis 20, 1069-1082.
Aires, V., Hichami, A., Filomenko, R., Ple, A., Rebe, C., Bettaieb, A., and Khan, N.A.
(2007). Docosahexaenoic acid induces increases in [Ca2+]i via inositol 1,4,5-
triphosphate production and activates protein kinase C gamma and -delta via
Chapter 6: Bibliography
216 | P a g e
phosphatidylserine binding site: implication in apoptosis in U937 cells. Mol
Pharmacol 72, 1545-1556.
Akaike, N., Kostyuk, P.G., Osipchuk, Y.V. (1989). Dihydropyridine-Sensitive Low-
Threshold Calcium Channels in Isolated Rat Hypothalamic Neurons. Journal of
Physiology-London 412, 181-195.
Akbar, M., Calderon, F., Wen, Z., and Kim, H.-Y. (2005a). Docosahexaenoic acid: A
positive modulator of Akt signaling in neuronal survival
10.1073/pnas.0502903102. PNAS 102, 10858-10863.
Akbar, M., Calderon, F., Wen, Z., and Kim, H.Y. (2005b). Docosahexaenoic acid: a
positive modulator of Akt signaling in neuronal survival. Proc Natl Acad Sci U S A
102, 10858-10863.
Akbar, M., and Kim, H.Y. (2002). Protective effects of docosahexaenoic acid in
staurosporine-induced apoptosis: involvement of phosphatidylinositol-3 kinase
pathway. J Neurochem 82, 655-665.
Allen, R.C., Popat, R., Diggle, S.P., and Brown, S.P. (2014). Targeting virulence: can
we make evolution-proof drugs? Nature reviews Microbiology 12, 300-308.
Andrews, G.K., Wang, H., Dey, S.K., and Palmiter, R.D. (2004). Mouse zinc
transporter 1 gene provides an essential function during early embryonic
development. Genesis 40, 74-81.
Chapter 6: Bibliography
217 | P a g e
Andrews, P.W. (1984). Retinoic acid induces neuronal differentiation of a cloned
human embryonal carcinoma cell line in vitro. Developmental biology 103, 285-
293.
Atwood, C.S.e.a. (1998). Dramatic aggregation of Alzheimer Ab by Cu(II) is induced
by conditions representing physiological acidosis. Journal of Biological Chemistry
273, 12817–12826.
Beckwith, J.B., and Perrin, E.V. (1963). In Situ Neuroblastomas: A Contribution to
the Natural History of Neural Crest Tumors. The American journal of pathology
43, 1089-1104.
Ben-Ze'ev, A. (1991). Animal cell shape changes and gene expression. BioEssays :
news and reviews in molecular, cellular and developmental biology 13, 207-212.
Benolken, R.M., Anderson, R.E., and Wheeler, T.G. (1973). Membrane Fatty Acids
Associated with the Electrical Response in Visual Excitation. Science 182, 1253-
1254.
Berg, J.M., and Shi, Y. (1996). The galvanization of biology: a growing appreciation
for the roles of zinc. Science 271, 1081-1085.
Berquin, I.M., Min, Y., Wu, R., Wu, J., Perry, D., Cline, J.M., Thomas, M.J., Thornburg,
T., Kulik, G., Smith, A., et al. (2007). Modulation of prostate cancer genetic risk by
omega-3 and omega-6 fatty acids. The Journal of clinical investigation 117, 1866-
1875.
Chapter 6: Bibliography
218 | P a g e
Biedler, J.L., Roffler-Tarlov, S., Schachner, M., and Freedman, L.S. (1978). Multiple
neurotransmitter synthesis by human neuroblastoma cell lines and clones.
Cancer Res 38, 3751-3757.
Bitanihirwe, B.K., and Cunningham, M.G. (2009). Zinc: the brain's dark horse.
Synapse (New York, NY) 63, 1029-1049.
Bourre, J.M. (2004). Roles of unsaturated fatty acids (especially omega-3 fatty acids)
in the brain at various ages and during ageing. The Journal of Nutrition, Health &
Aging 8.
Bousquet, M., Calon, F., and Cicchetti, F. (2011). Impact of omega-3 fatty acids in
Parkinson's disease. Ageing research reviews 10, 453-463.
Bousquet, M., Saint-Pierre, M., Julien, C., Salem, N., Jr., Cicchetti, F., and Calon, F.
(2008). Beneficial effects of dietary omega-3 polyunsaturated fatty acid on toxin-
induced neuronal degeneration in an animal model of Parkinson's disease. FASEB
journal : official publication of the Federation of American Societies for
Experimental Biology 22, 1213-1225.
Brasky, T.M., Lampe, J.W., Potter, J.D., Patterson, R.E., and White, E. (2010).
Specialty supplements and breast cancer risk in the VITamins And Lifestyle
(VITAL) Cohort. Cancer epidemiology, biomarkers & prevention : a publication of
the American Association for Cancer Research, cosponsored by the American
Society of Preventive Oncology 19, 1696-1708.
Chapter 6: Bibliography
219 | P a g e
Bubner, B., Gase, K., and Baldwin, I.T. (2004). Two-fold differences are the detection
limit for determining transgene copy numbers in plants by real-time PCR. BMC
Biotechnol 4, 14.
Burr, G.O., and Burr, M.M. (1930). ON THE NATURE AND RÔLE OF THE FATTY ACIDS
ESSENTIAL IN NUTRITION. Journal of Biological Chemistry 86, 587-621.
Bush, A.I. (2003). The metallobiology of Alzheimer's disease. Trends Neurosci 26,
207-214.
Bush, A.I., Multhaup, G., Moir, R.D., Williamson, T.G., Small, D.H., Rumble, B.,
Pollwein, P., Beyreuther, K., and Masters, C.L. (1993). A novel zinc(II) binding site
modulates the function of the beta A4 amyloid protein precursor of Alzheimer's
disease. J Biol Chem 268, 16109-16112.
Bush, A.I., Pettingell, W.H., Jr., de Paradis, M., Tanzi, R.E., and Wasco, W. (1994a).
The amyloid beta-protein precursor and its mammalian homologues. Evidence
for a zinc-modulated heparin-binding superfamily. J Biol Chem 269, 26618-
26621.
Bush, A.I., Pettingell, W.H., Multhaup, G., d Paradis, M., Vonsattel, J.P., Gusella, J.F.,
Beyreuther, K., Masters, C.L., and Tanzi, R.E. (1994b). Rapid induction of
Alzheimer A beta amyloid formation by zinc. Science 265, 1464-1467.
Bush, A.I., Pettingell, W.H Jr, de Paradis, M, Tanzi, RE., Wasco, W. (1994a). The
amyloid beta-protein precursor and its mammalian homologues. Evidence for a
zinc-modulated heparin-binding superfamily. J Biol Chem 269, 26618-26621.
Chapter 6: Bibliography
220 | P a g e
Bush, A.I., Pettingell, W.H. Jr, Paradis, M.D, Tanzi, R.E. (1994b). Modulation of Ab
adhesiveness and secretase site cleavage by zinc. The Journal of Biological
Chemistry 269, 12152–12158.
Buttiglione, M., Vitiello, F., Sardella, E., Petrone, L., Nardulli, M., Favia, P.,
d'Agostino, R., and Gristina, R. (2007). Behaviour of SH-SY5Y neuroblastoma cell
line grown in different media and on different chemically modified substrates.
Biomaterials 28, 2932-2945.
Cai, Y.D., and Chou, K.C. (2005). Predicting enzyme subclass by functional domain
composition and pseudo amino acid composition. Journal of proteome research
4, 967-971.
Calon, F., and Cole, G. (2007). Neuroprotective action of omega-3 polyunsaturated
fatty acids against neurodegenerative diseases: evidence from animal studies.
Prostaglandins, leukotrienes, and essential fatty acids 77, 287-293.
Carvalho, K.M., De Laurenzi, V., Melino, G., and Cohen, P. (1993). Modulation of a
novel thermolysin-like metallo-endopeptidase activity during retinoic acid-
induced differentiation of human neuroectodermal tumor cell lines. Biochemical
and biophysical research communications 191, 172-179.
Chai, F., Truong-Tran, A.Q., Ho, L.H., and Zalewski, P.D. (1999). Regulation of
caspase activation and apoptosis by cellular zinc fluxes and zinc deprivation: A
review. Immunol Cell Biol 77, 272-278.
Chapter 6: Bibliography
221 | P a g e
Chapkin, R.S., Seo, J., McMurray, D.N., and Lupton, J.R. (2008). Mechanisms by
which docosahexaenoic acid and related fatty acids reduce colon cancer risk and
inflammatory disorders of the intestine. Chemistry and physics of lipids 153, 14-
23.
Cherny R. A., M.C.L., Beyreuther K., Fairlie D., Tanzi R. E., Bush A. I. (1997). The
aggregation of Aß in human brain is mediated by zinc. . Society for Neuroscience
23, 534.
Cherny, R.A., Atwood, C.S., Xilinas, M.E., Gray, D.N., Jones, W.D., McLean, C.A.,
Barnham, K.J., Volitakis, I., Fraser, F.W., Kim, Y., et al. (2001). Treatment with a
copper-zinc chelator markedly and rapidly inhibits beta-amyloid accumulation in
Alzheimer's disease transgenic mice. Neuron 30, 665-676.
Cheung, W.M., Fu, W.Y., Hui, W.S., and Ip, N.Y. (1999). Production of human CNS
neurons from embryonal carcinoma cells using a cell aggregation method.
BioTechniques 26, 946-948, 950-942, 954.
Choi, D.W., Yokoyama, M., and Koh, J. (1988). Zinc neurotoxicity in cortical cell
culture. Neuroscience 24, 67-79.
Chowanadisai, W., Lonnerdal, B., and Kelleher, S.L. (2006). Identification of a
mutation in SLC30A2 (ZnT-2) in women with low milk zinc concentration that
results in transient neonatal zinc deficiency. J Biol Chem 281, 39699-39707.
Christy, A.A., Egeberg, P.K., and Østensen, E.T. (2003). Simultaneous quantitative
determination of isolated trans fatty acids and conjugated linoleic acids in oils
Chapter 6: Bibliography
222 | P a g e
and fats by chemometric analysis of the infrared profiles. Vibrational
Spectroscopy 33, 37-48.
Chuah, M.I., Tennent, R., and Jacobs, I. (1995). Response of olfactory Schwann cells
to intranasal zinc sulfate irrigation. J Neurosci Res 42, 470-478.
Ciccarone, V., Spengler, B.A., Meyers, M.B., Biedler, J.L., and Ross, R.A. (1989).
Phenotypic diversification in human neuroblastoma cells: expression of distinct
neural crest lineages. Cancer Res 49, 219-225.
Cole, G.J., Loewy, A., and Glaser, L. (1986). Neuronal cell-cell adhesion depends on
interactions of N-CAM with heparin-like molecules. Nature 320, 445-447.
Cole, G.M., Lim, G.P., Yang, F., Teter, B., Begum, A., Ma, Q., Harris-White, M.E., and
Frautschy, S.A. (2005). Prevention of Alzheimer's disease: Omega-3 fatty acid and
phenolic anti-oxidant interventions. Neurobiol Aging 26 Suppl 1, 133-136.
Connor, W.E. (2000). Importance of n-3 fatty acids in health and disease1. Am J Clin
Nutr 71, 171S-175.
Connor, W.E., and Connor, S.L. (2007). The importance of fish and docosahexaenoic
acid in Alzheimer disease. Am J Clin Nutr 85, 929-930.
Connor, W.E., Neuringer, M., and Lin, D.S. (1990). Dietary effects on brain fatty acid
composition: the reversibility of n-3 fatty acid deficiency and turnover of
docosahexaenoic acid in the brain, erythrocytes, and plasma of rhesus monkeys.
Journal of lipid research 31, 237-247.
Chapter 6: Bibliography
223 | P a g e
Connor, W.E., Neuringer, M., and Reisbick, S. (1992). Essential fatty acids: the
importance of n-3 fatty acids in the retina and brain. Nutr Rev 50, 21-29.
Conquer, J.A., Tierney, M.C., Zecevic, J., Bettger, W.J., and Fisher, R.H. (2000). Fatty
acid analysis of blood plasma of patients with Alzheimer's disease, other types of
dementia, and cognitive impairment. Lipids 35, 1305-1312.
Cory, S., Huang, D.C., and Adams, J.M. (2003). The Bcl-2 family: roles in cell survival
and oncogenesis. Oncogene 22, 8590-8607.
Cousins, R.J., Liuzzi, J.P., and Lichten, L.A. (2006). Mammalian zinc transport,
trafficking, and signals. J Biol Chem 281, 24085-24089.
Cousins, R.J., and McMahon, R.J. (2000). Integrative aspects of zinc transporters. J
Nutr 130, 1384S-1387S.
Crawford, M., Bloom, M., Broadhurst, C., Schmidt, W., Cunnane, S., Galli, C.,
Gehbremeskel, K., Linseisen, F., Lloyd-Smith, J., and Parkington, J. (1999).
Evidence for the unique function of docosahexaenoic acid during the evolution of
the modern hominid brain. Lipids 34, S39-S47.
Cuajungco, M.P., and Lees, G.J. (1997a). Zinc and Alzheimer's disease: is there a
direct link? Brain Research Reviews 23, 219-236.
Cuajungco, M.P., and Lees, G.J. (1997b). Zinc metabolism in the brain: relevance to
human neurodegenerative disorders. Neurobiol Dis 4, 137-169.
Chapter 6: Bibliography
224 | P a g e
Cunnane, S.C., and Yang, J. (1995). Zinc deficiency impairs whole-body accumulation
of polyunsaturates and increases the utilization of [1-14C]linoleate for de novo
lipid synthesis in pregnant rats. Canadian journal of physiology and
pharmacology 73, 1246-1252.
Dai, Z., and Canary, J.W. (2007). Tailoring tripodal ligands for zinc sensing. New
Journal of Chemistry 31, 1708.
Damsky, C.H., and Werb, Z. (1992). Signal transduction by integrin receptors for
extracellular matrix: cooperative processing of extracellular information. Current
opinion in cell biology 4, 772-781.
Danscher, G. (1984). Dynamic changes in the stainability of rat hippocampal mossy
fiber boutons after local injection of sodium sulphide, sodium selenite, and
sodium diethyldithiocarbamate. The neurobiology of zinc, Part B New York: Alan
R Liss Inc, 177-191.
Davis, G.E., and Camarillo, C.W. (1996). An alpha 2 beta 1 integrin-dependent
pinocytic mechanism involving intracellular vacuole formation and coalescence
regulates capillary lumen and tube formation in three-dimensional collagen
matrix. Exp Cell Res 224, 39-51.
de la Torre, J.C. (2005). Cerebrovascular gene linked to Alzheimer's disease
pathology. Trends Mol Med 11, 534-536.
Dean, M., Hamon, Y., Chimini, G. (2001). The human ATP-binding cassette (ABC)
transporter superfamily. J Lipid Res 42, 1007-1017.
Chapter 6: Bibliography
225 | P a g e
Dehmelt, L., and Halpain, S. (2005). The MAP2/Tau family of microtubule-associated
proteins. Genome biology 6, 204.
Deshpande, A., Kawai, H., Metherate, R., Glabe, C.G., and Busciglio, J. (2009). A role
for synaptic zinc in activity-dependent Abeta oligomer formation and
accumulation at excitatory synapses. The Journal of neuroscience : the official
journal of the Society for Neuroscience 29, 4004-4015.
Diaz-Nido, J., Armas-Portela, R., Correas, I., Dominguez, J.E., Montejo, E., and Avila,
J. (1991). Microtubule protein phosphorylation in neuroblastoma cells and
neurite growth. Journal of cell science Supplement 15, 51-59.
Draoui, M., Bellincampi, L., Hospital, V., Cadel, S., Foulon, T., Prat, A., Barre, N.,
Reichert, U., Melino, G., and Cohen, P. (1997). Expression and retinoid
modulation of N-arginine dibasic convertase and an aminopeptidase-B in human
neuroblastoma cell lines. J Neurooncol 31, 99-106.
Dreostl, I.E. (1983). Zinc and the central nervous system., Vol 1 (New Jersey:
Humana Press).
Dufner-Beattie, J., Wang, F., Kuo, Y.M., Gitschier, J., Eide, D., and Andrews, G.K.
(2003). The acrodermatitis enteropathica gene ZIP4 encodes a tissue-specific,
zinc-regulated zinc transporter in mice. J Biol Chem 278, 33474-33481.
Duncan, M.W., Marini, A.M., Watters, R., Kopin, I.J., and Markey, S.P. (1992). Zinc, a
neurotoxin to cultured neurons, contaminates cycad flour prepared by
Chapter 6: Bibliography
226 | P a g e
traditional guamanian methods. The Journal of neuroscience : the official journal
of the Society for Neuroscience 12, 1523-1537.
Eide, D.J. (2004). The SLC39 family of metal ion transporters. Pflugers Archiv :
European journal of physiology 447, 796-800.
Erçelen, N., Mercan, S. (2005). Alzheimer’s disease and genes. Advances in
Moleculer Medicine 1 155-164.
Evangelopoulos, M.E., Weis, J., and Kruttgen, A. (2005). Signalling pathways leading
to neuroblastoma differentiation after serum withdrawal: HDL blocks
neuroblastoma differentiation by inhibition of EGFR. Oncogene 24, 3309-3318.
Evans, D.A., Funkenstein, H.H., Albert, M.S., Scherr, P.A., Cook, N.R., Chown, M.J.,
Hebert, L.E., Hennekens, C.H., and Taylor, J.O. (1989). Prevalence of Alzheimer's
disease in a community population of older persons. Higher than previously
reported. JAMA 262, 2551-2556.
Fenton, W.S., Dickerson, F., Boronow, J., Hibbeln, J.R., and Knable, M. (2001). A
Placebo-Controlled Trial of Omega-3 Fatty Acid (Ethyl Eicosapentaenoic Acid)
Supplementation for Residual Symptoms and Cognitive Impairment in
Schizophrenia. Am J Psychiatry 158, 2071-2074.
Findley, R.D.P.a.S.D. (1995). Cloning and functional characterization of a mammalian
zinc transporter that confers resistance to zinc. EMBO J 14 639–649.
Chapter 6: Bibliography
227 | P a g e
Frederickson, C.J. (1989). Neurobiology of zinc and zinc-containing neurons. Int Rev
Neurobiol 31, 145-238.
Frederickson, C.J., Kasarskis, E.J., Ringo, D., and Frederickson, R.E. (1987). A
quinoline fluorescence method for visualizing and assaying the histochemically
reactive zinc (bouton zinc) in the brain. J Neurosci Methods 20, 91-103.
Frederickson, C.J., Koh, J.-Y., and Bush, A.I. (2005a). THE NEUROBIOLOGY OF ZINC IN
HEALTH AND DISEASE. Nature Reviews Neuroscience 6, 449-462.
Frederickson, C.J., Koh, J.Y., and Bush, A.I. (2005b). The neurobiology of zinc in
health and disease. Nature reviews Neuroscience 6, 449-462.
Gaither, L.A., and Eide, D.J. (2000). Functional expression of the human hZIP2 zinc
transporter. J Biol Chem 275, 5560-5564.
Gaither, L.A., Eide, D.J. (2001). Eukaryotic zinc transporters and their regulation.
BioMetals 14, 251-270.
Gamoh, S., Hashimoto, M., Hossain, S., and Masumura, S. (2001). Chronic
administration of docosahexaenoic acid improves the performance of radial arm
maze task in aged rats. Clinical and experimental pharmacology & physiology 28,
266-270.
Geckil, H., Xu, F., Zhang, X., Moon, S., and Demirci, U. (2010). Engineering hydrogels
as extracellular matrix mimics. Nanomedicine (London, England) 5, 469-484.
Chapter 6: Bibliography
228 | P a g e
German, O.L., Insua, M.F., Gentili, C., Rotstein, N.P., and Politi, L.E. (2006).
Docosahexaenoic acid prevents apoptosis of retina photoreceptors by activating
the ERK/MAPK pathway. J Neurochem 98, 1507-1520.
Gingras, M., Champigny, M.F., and Berthod, F. (2007). Differentiation of human
adult skin-derived neuronal precursors into mature neurons. Journal of cellular
physiology 210, 498-506.
Goldstein, M.N. (1968). Neuroblastoma cells in tissue culture. Journal of pediatric
surgery 3, 166-169.
Gown, A.M., and Willingham, M.C. (2002). Improved detection of apoptotic cells in
archival paraffin sections: immunohistochemistry using antibodies to cleaved
caspase 3. The journal of histochemistry and cytochemistry : official journal of
the Histochemistry Society 50, 449-454.
Gracious, B.L., Chirieac, M.C., Costescu, S., Finucane, T.L., Youngstrom, E.A., and
Hibbeln, J.R. (2010). Randomized, placebo-controlled trial of flax oil in pediatric
bipolar disorder. Bipolar Disord 12, 142-154.
Guillemain, I., Gaboyard, S., Fontes, G., Saunier, M., Privat, A., and Patey, G. (2000).
Differential expression of Bcl-2-related proteins in differentiating NT2 cells.
Neuroreport 11, 1421-1425.
Gunshin H, M.B., Berger UV, Gunshin Y, Romero MF, et al. (1997). Cloning and
characterization of a mammalian proton-coupled metal-ion transporter. Nature
388, 482–488.
Chapter 6: Bibliography
229 | P a g e
Haghighat, N., McCandless, D.W., and Geraminegad, P. (2000). The effect of
ammonium chloride on metabolism of primary neurons and neuroblastoma cells
in vitro. Metabolic brain disease 15, 151-162.
Hall, M.N., Chavarro, J.E., Lee, I.M., Willett, W.C., and Ma, J. (2008). A 22-year
prospective study of fish, n-3 fatty acid intake, and colorectal cancer risk in men.
Cancer epidemiology, biomarkers & prevention : a publication of the American
Association for Cancer Research, cosponsored by the American Society of
Preventive Oncology 17, 1136-1143.
Halsted, J.A., Ronaghy, H. A., Abadi, P. (1972). Zinc deficienc in man. American
Journal of Medicine 53, 277-284.
Hamano, H., Nabekura, J., Nishikawa, M., and Ogawa, T. (1996). Docosahexaenoic
acid reduces GABA response in substantia nigra neuron of rat. J Neurophysiol 75,
1264-1270.
Hanas, J.S., Hazuda, D.J., Bogenhagen, D.F., Wu, F.Y., and Wu, C.W. (1983). Xenopus
transcription factor A requires zinc for binding to the 5 S RNA gene. J Biol Chem
258, 14120-14125.
Hardman, B., Michalczyk, A., Greenough, M., Camakaris, J., Mercer, J., and Ackland,
L. (2007). Distinct functional roles for the Menkes and Wilson copper
translocating P-type ATPases in human placental cells. Cellular physiology and
biochemistry : international journal of experimental cellular physiology,
biochemistry, and pharmacology 20, 1073-1084.
Chapter 6: Bibliography
230 | P a g e
Hebert, L.E., Beckett, L.A., Scherr, P.A., and Evans, D.A. (2001). Annual incidence of
Alzheimer disease in the United States projected to the years 2000 through 2050.
Alzheimer disease and associated disorders 15, 169-173.
Hibbeln, J.R. (1998). Fish consumption and major depression. Lancet 351, 1213.
Hobbeln, J.R., Salem, Jr. N. (2001). Omega-3 Fatty Acids and Psychiatric Disorders
Current Status of the field. Fatty acids : physiological and behavioral functions,
311- 330.
Holman, R.T. (1971). Essential fatty acid deficiency. Progress in the Chemistry of
Fats and other Lipids 9, 275-348.
Horrocks, L.A., and Yeo, Y.K. (1999). Health benefits of docosahexaenoic acid (DHA).
Pharmacological research : the official journal of the Italian Pharmacological
Society 40, 211-225.
Huang, L., Kirschke, C.P., and Gitschier, J. (2002). Functional characterization of a
novel mammalian zinc transporter, ZnT6. J Biol Chem 277, 26389-26395.
Huang, X., Cuajungco, M.P., Atwood, C.S., Moir, R.D., Tanzi, R.E., and Bush, A.I.
(2000). Alzheimer's disease, beta-amyloid protein and zinc. J Nutr 130, 1488S-
1492S.
Hurley, L.S. (1981). Teratogenic aspects of manganese, zinc, and copper nutrition.
Physiological reviews 61, 249-295.
Chapter 6: Bibliography
231 | P a g e
Hyman, T.L.S.a.B.T. (2005). Transgenic Models of Alzheimer's Disease: Learning from
Animals. NeuroRx 2, 423-437. .
Iigo, M., Nakagawa, T., Ishikawa, C., Iwahori, Y., Asamoto, M., Yazawa, K., Araki, E.,
and Tsuda, H. (1997). Inhibitory effects of docosahexaenoic acid on colon
carcinoma 26 metastasis to the lung. British journal of cancer 75, 650-655.
Ikemoto, A., Ohishi, M., Sato, Y., Hata, N., Misawa, Y., Fujii, Y., and Okuyama, H.
(2001). Reversibility of n-3 fatty acid deficiency-induced alterations of learning
behavior in the rat: level of n-6 fatty acids as another critical factor. Journal of
lipid research 42, 1655-1663.
Imashuku, S., Inui, A., Kusunoki, T., Okabe, H., and Yonezawa, T. (1976).
Acetylcholine synthesis in sympathetic human neuroblastoma. Journal of
pediatric surgery 11, 949-954.
Jain, P., Cerone, M.A., Leblanc, A.C., and Autexier, C. (2007). Telomerase and
neuronal marker status of differentiated NT2 and SK-N-SH human neuronal cells
and primary human neurons. J Neurosci Res 85, 83-89.
Jalava, A., Heikkila, J., Lintunen, M., Akerman, K., and Pahlman, S. (1992).
Staurosporine induces a neuronal phenotype in SH-SY5Y human neuroblastoma
cells that resembles that induced by the phorbol ester 12-O-tetradecanoyl
phorbol-13 acetate (TPA). FEBS letters 300, 114-118.
Jayasooriya, A.P., Ackland, M.L., Mathai, M.L., Sinclair, A.J., Weisinger, H.S.,
Weisinger, R.S., Halver, J.E., Kitajka, K., and Puskas, L.G. (2005a). Perinatal
Chapter 6: Bibliography
232 | P a g e
{omega}-3 polyunsaturated fatty acid supply modifies brain zinc homeostasis
during adulthood. PNAS 102, 7133-7138.
Jayasooriya, A.P., Ackland, M.L., Mathai, M.L., Sinclair, A.J., Weisinger, H.S.,
Weisinger, R.S., Halver, J.E., Kitajka, K., and Puskas, L.G. (2005b). Perinatal
omega-3 polyunsaturated fatty acid supply modifies brain zinc homeostasis
during adulthood. Proc Natl Acad Sci U S A 102, 7133-7138.
Jeruc, J., Vizjak, A., Rozman, B., and Ferluga, D. (2006). Immunohistochemical
expression of activated caspase-3 as a marker of apoptosis in glomeruli of human
lupus nephritis. American journal of kidney diseases : the official journal of the
National Kidney Foundation 48, 410-418.
Joseph, J., Cole, G., Head, E., and Ingram, D. (2009). Nutrition, brain aging, and
neurodegeneration. The Journal of neuroscience : the official journal of the
Society for Neuroscience 29, 12795-12801.
Kagi, J.H.R., Vallee, B.L., and With the technical assistance of Janet, M.C. (1961).
Metallothionein: a Cadmium and Zinc-containing Protein from Equine Renal
Cortex. II. PHYSICOCHEMICAL PROPERTIES. J Biol Chem 236, 2435-2442.
Kambe, T., Yamaguchi-Iwai, Y., Sasaki, R., and Nagao, M. (2004a). Overview of
mammalian zinc transporters. Cellular and molecular life sciences : CMLS 61, 49-
68.
Chapter 6: Bibliography
233 | P a g e
Kambe, T., Yamaguchi-Iwai, Y., Sasaki, R., and Nagao, M. (2004b). Overview of
mammalian zinc transporters. Cellular and Molecular Life Sciences CMLS 61, 49-
68.
Kato, T., Kolenic, N., and Pardini, R.S. (2007). Docosahexaenoic acid (DHA), a
primary tumor suppressive omega-3 fatty acid, inhibits growth of colorectal
cancer independent of p53 mutational status. Nutrition and cancer 58, 178-187.
Katzman, R. (1986). Alzheimer’s disease. New England Journal of Medicine 314, 964-
973.
Kelleher, S.L., and Lonnerdal, B. (2002). Zinc transporters in the rat mammary gland
respond to marginal zinc and vitamin A intakes during lactation. J Nutr 132, 3280-
3285.
Kim, E.Y., Koh, J.Y., Kim, Y.H., Sohn, S., Joe, E., and Gwag, B.J. (1999a). Zn2+ entry
produces oxidative neuronal necrosis in cortical cell cultures. European Journal
of Neuroscience 11, 327-334.
Kim, E.Y., Koh, J.Y., Kim, Y.H., Sohn, S., Joe, E., and Gwag, B.J. (1999b). Zn2+ entry
produces oxidative neuronal necrosis in cortical cell cultures. The European
journal of neuroscience 11, 327-334.
Kim, H.Y., Akbar, M., Lau, A., and Edsall, L. (2000). Inhibition of neuronal apoptosis
by docosahexaenoic acid (22:6n-3). Role of phosphatidylserine in antiapoptotic
effect. J Biol Chem 275, 35215-35223.
Chapter 6: Bibliography
234 | P a g e
Kim, Y.H., Kim, E.Y., Gwag, B.J., Sohn, S., and Koh, J.Y. (1999c). Zinc-induced cortical
neuronal death with features of apoptosis and necrosis: mediation by free
radicals. Neuroscience 89, 175-182.
Kimber, M.C., Mahadevan, I.B., Lincoln, S.F., Ward, A.D., and Tiekink, E.R. (2000).
The synthesis and fluorescent properties of analogues of the zinc(II) specific
fluorophore zinquin ester. The Journal of organic chemistry 65, 8204-8209.
Kirschke, C.P., and Huang, L. (2003). ZnT7, a novel mammalian zinc transporter,
accumulates zinc in the Golgi apparatus. J Biol Chem 278, 4096-4102.
Kishida, E., Yano, M., Kasahara, M., and Masuzawa, Y. (1998). Distinctive inhibitory
activity of docosahexaenoic acid against sphingosine-induced apoptosis.
Biochimica et biophysica acta 1391, 401-408.
Kitajka, K., Sinclair, A.J., Weisinger, R.S., Weisinger, H.S., Mathai, M., Jayasooriya,
A.P., Halver, J.E., and Puskas, L.G. (2004). Effects of dietary omega-3
polyunsaturated fatty acids on brain gene expression. Proc Natl Acad Sci U S A
101, 10931-10936.
Koh, J.Y., and Choi, D.W. (1994). Zinc toxicity on cultured cortical neurons:
involvement of N-methyl-D-aspartate receptors. Neuroscience 60, 1049-1057.
Koh, J.Y., Suh, S.W., Gwag, B.J., He, Y.Y., Hsu, C.Y., and Choi, D.W. (1996). The role of
zinc in selective neuronal death after transient global cerebral ischemia. Science
272, 1013-1016.
Chapter 6: Bibliography
235 | P a g e
Krebs, N.F. (2000). Overview of Zinc Absorption and Excretion in the Human
Gastrointestinal Tract. J Nutr 130, 1374S-1377.
Kris-Etherton, P.M., Taylor, D.S., Yu-Poth, S., Huth, P., Moriarty, K., Fishell, V.,
Hargrove, R.L., Zhao, G., and Etherton, T.D. (2000). Polyunsaturated fatty acids in
the food chain in the United States. Am J Clin Nutr 71, 179S-188S.
Kubo, K., Saito, M., Tadokoro, T., and Maekawa, A. (1997). Changes in susceptibility
of tissues to lipid peroxidation after ingestion of various levels of
docosahexaenoic acid and vitamin E. The British journal of nutrition 78, 655-669.
Kuratko, C.N., and Salem, N., Jr. (2009). Biomarkers of DHA status. Prostaglandins,
leukotrienes, and essential fatty acids 81, 111-118.
Kyle, D.J., Schaefer, E., Patton, G., and Beiser, A. (1999). Low serum
docosahexaenoic acid is a significant risk factor for Alzheimer's dementia. Lipids
34 Suppl, S245.
Lee, J.Y., Cole, T.B., Palmiter, R.D., Suh, S.W., and Koh, J.Y. (2002). Contribution by
synaptic zinc to the gender-disparate plaque formation in human Swedish
mutant APP transgenic mice. Proc Natl Acad Sci U S A 99, 7705-7710.
Lee, J.Y., Cole, T.B., Palmiter, R.D., Suh, S.W., Koh, J.Y. (2002). From the Cover:
Contribution by synaptic zinc to the gender-disparate plaque formation in human
Swedish mutant APP transgenic mice. Proceedings of the National Academy of
Sciences 99, 7705-7710.
Chapter 6: Bibliography
236 | P a g e
Lee, J.Y., Hwang, J.J., Park, M.H., and Koh, J.Y. (2006). Cytosolic labile zinc: a marker
for apoptosis in the developing rat brain. The European journal of neuroscience
23, 435-442.
Leli, U., Cataldo, A., Shea, T.B., Nixon, R.A., and Hauser, G. (1992). Distinct
mechanisms of differentiation of SH-SY5Y neuroblastoma cells by protein kinase
C activators and inhibitors. J Neurochem 58, 1191-1198.
LePage, K.T., Dickey, R.W., Gerwick, W.H., Jester, E.L., and Murray, T.F. (2005). On
the use of neuro-2a neuroblastoma cells versus intact neurons in primary culture
for neurotoxicity studies. Critical reviews in neurobiology 17, 27-50.
Letourneau, P.C., Condic, M.L., and Snow, D.M. (1994). Interactions of developing
neurons with the extracellular matrix. The Journal of neuroscience : the official
journal of the Society for Neuroscience 14, 915-928.
Li, Y., Hough, C.J., Frederickson, C.J., and Sarvey, J.M. (2001). Induction of mossy
fiber --> Ca3 long-term potentiation requires translocation of synaptically
released Zn2+. The Journal of neuroscience : the official journal of the Society for
Neuroscience 21, 8015-8025.
Lien, E.L. (2009). Toxicology and safety of DHA. Prostaglandins, leukotrienes, and
essential fatty acids 81, 125-132.
Lim, G.P., Calon, F., Morihara, T., Yang, F., Teter, B., Ubeda, O., Salem, N., Jr.,
Frautschy, S.A., and Cole, G.M. (2005). A diet enriched with the omega-3 fatty
acid docosahexaenoic acid reduces amyloid burden in an aged Alzheimer mouse
Chapter 6: Bibliography
237 | P a g e
model. The Journal of neuroscience : the official journal of the Society for
Neuroscience 25, 3032-3040.
Lippard, S.J.a.B., J.M. (1994). Principles of Bioinorganic Chemistry. University
Science Books, Mill Valley.
Liuzzi, J.P., Bobo, J.A., Cui, L., McMahon, R.J., and Cousins, R.J. (2003). Zinc
transporters 1, 2 and 4 are differentially expressed and localized in rats during
pregnancy and lactation. J Nutr 133, 342-351.
Liuzzi, J.P., Bobo, J.A., Lichten, L.A., Samuelson, D.A., and Cousins, R.J. (2004).
Responsive transporter genes within the murine intestinal-pancreatic axis form a
basis of zinc homeostasis. Proc Natl Acad Sci U S A 101, 14355-14360.
Liuzzi, J.P., and Cousins, R.J. (2004a). Mammalian zinc transporters. Annu Rev Nutr
24, 151-172.
Liuzzi, J.P., and Cousins, R.J. (2004b). MAMMALIAN ZINC TRANSPORTERS. Annual
Review of Nutrition 24, 151-172.
Loessner, D., Stok, K.S., Lutolf, M.P., Hutmacher, D.W., Clements, J.A., and Rizzi, S.C.
(2010). Bioengineered 3D platform to explore cell-ECM interactions and drug
resistance of epithelial ovarian cancer cells. Biomaterials 31, 8494-8506.
Logan, A.C. (2004). Omega-3 fatty acids and major depression: a primer for the
mental health professional. Lipids Health Dis 3, 25.
Chapter 6: Bibliography
238 | P a g e
Longo, I., Frints, S.G.M., Fryns, J.P., Meloni, I., Pescucci, C., Ariani, F., Borghgraef, M.,
Raynaud, M., Marynen, P., Schwartz, C., et al. (2003). A third MRX family
(MRX68) is the result of mutation in the long chain fatty acid-CoA ligase 4 (FACL4)
gene: proposal of a rapid enzymatic assay for screening mentally retarded
patients. J Med Genet 40, 11-17.
Lopez, V., and Kelleher, S.L. (2009). Zinc transporter-2 (ZnT2) variants are localized
to distinct subcellular compartments and functionally transport zinc. The
Biochemical journal 422, 43-52.
Lovell, M.A., Robertson, J.D., Teesdale, W.J., Campbell, J.L., and Markesbery, W.R.
(1998). Copper, iron and zinc in Alzheimer's disease senile plaques. Journal of the
neurological sciences 158, 47-52.
Lovell, M.A., Smith, J.L., and Markesbery, W.R. (2006). Elevated zinc transporter-6 in
mild cognitive impairment, Alzheimer disease, and pick disease. J Neuropathol
Exp Neurol 65, 489-498.
Lovell, M.A., Smith, J.L., Xiong, S., and Markesbery, W.R. (2005). Alterations in zinc
transporter protein-1 (ZnT-1) in the brain of subjects with mild cognitive
impairment, early, and late-stage Alzheimer's disease. Neurotox Res 7, 265-271.
Lukiw, W.J., Cui, J.-G., Marcheselli, V.L., Bodker, M., Botkjaer, A., Gotlinger, K.,
Serhan, C.N., and Bazan, N.G. (2005). A role for docosahexaenoic acid-derived
neuroprotectin D1 in neural cell survival and Alzheimer disease. J Clin Invest 115,
2774-2783.
Chapter 6: Bibliography
239 | P a g e
Manev, H., Kharlamov, E., Uz, T., Mason, R.P., and Cagnoli, C.M. (1997).
Characterization of zinc-induced neuronal death in primary cultures of rat
cerebellar granule cells. Experimental neurology 146, 171-178.
McGowan, A.J., Fernandes, R.S., Verhaegen, S., and Cotter, T.G. (1994). Zinc inhibits
UV radiation-induced apoptosis but fails to prevent subsequent cell death. Int J
Radiat Biol 66, 343-349.
McLennan PL, B.T., Abeywardena MY, Charnock JS. (1992). Dietary lipid modulation
of ventricular fibrillation threshold in the marmoset
monkey. Am Heart J 123, 1555-1561.
McMahon, R.J., and Cousins, R.J. (1998). Mammalian Zinc Transporters1,2. J Nutr
128, 667-670.
McMahon, R.J., Cousins, R. J. (1998). Mammalian Zinc Transporters1,2. J Nutr 128,
667-670.
Melino, G., Draoui, M., Bernardini, S., Bellincampi, L., Reichert, U., and Cohen, P.
(1996). Regulation by retinoic acid of insulin-degrading enzyme and of a related
endoprotease in human neuroblastoma cell lines. Cell Growth Differ 7, 787-796.
Melino, G., Stephanou, A., Annicchiarico-Petruzzelli, M., Knight, R.A., Finazzi-Agro,
A., and Lightman, S.L. (1993). Modulation of IGF-2 expression during growth and
differentiation of human neuroblastoma cells: retinoic acid may induce IGF-2.
Neurosci Lett 151, 187-191.
Chapter 6: Bibliography
240 | P a g e
Merendino, N., Molinari, R., Loppi, B., Pessina, G., M, D.A., Tomassi, G., and Velotti,
F. (2003). Induction of apoptosis in human pancreatic cancer cells by
docosahexaenoic acid. Annals of the New York Academy of Sciences 1010, 361-
364.
Michalczyk, A.A., Allen, J., Blomeley, R.C., and Ackland, M.L. (2002). Constitutive
expression of hZnT4 zinc transporter in human breast epithelial cells. The
Biochemical journal 364, 105-113.
Mitchell, D.C., Gawrisch, K., Litman, B.J., and Salem, N., Jr. (1998). Why is
docosahexaenoic acid essential for nervous system function? Biochemical Society
transactions 26, 365-370.
Miyashita, T., Krajewski, S., Krajewska, M., Wang, H.G., Lin, H.K., Liebermann, D.A.,
Hoffman, B., and Reed, J.C. (1994). Tumor suppressor p53 is a regulator of bcl-2
and bax gene expression in vitro and in vivo. Oncogene 9, 1799-1805.
Mizuno, D., and Kawahara, M. (2013). The molecular mechanisms of zinc
neurotoxicity and the pathogenesis of vascular type senile dementia.
International journal of molecular sciences 14, 22067-22081.
Mocchegiani, E., Bertoni-Freddari, C., Marcellini, F., and Malavolta, M. (2005). Brain,
aging and neurodegeneration: role of zinc ion availability. Prog Neurobiol 75,
367-390.
Murphy, M.P., and LeVine, H., 3rd (2010). Alzheimer's disease and the amyloid-beta
peptide. J Alzheimers Dis 19, 311-323.
Chapter 6: Bibliography
241 | P a g e
Murray, M.R., and Stout, A.P. (1947). Distinctive Characteristics of the
Sympathicoblastoma Cultivated in Vitro: A Method for Prompt Diagnosis. The
American journal of pathology 23, 429-441.
Mustafa, N.R., de Winter, W., van Iren, F., and Verpoorte, R. (2011). Initiation,
growth and cryopreservation of plant cell suspension cultures. Nature protocols
6, 715-742.
Nair, S.S.D., Leitch, J.W., Falconer, J., and Garg, M.L. (1997). Prevention of cardiac
arrhythmia by dietary (n-3) polyunsaturated fatty acids and their mechanism of
action. Journal of Nutrition 127, 383-393.
Nelson, P.T., Kondziolka, D., Wechsler, L., Goldstein, S., Gebel, J., DeCesare, S., Elder,
E.M., Zhang, P.J., Jacobs, A., McGrogan, M., et al. (2002). Clonal human (hNT)
neuron grafts for stroke therapy: neuropathology in a patient 27 months after
implantation. The American journal of pathology 160, 1201-1206.
Nemets, B., Stahl, Z., and Belmaker, R.H. (2002). Addition of omega-3 fatty acid to
maintenance medication treatment for recurrent unipolar depressive disorder.
Am J Psychiatry 159, 477-479.
Neuringer, M., Anderson, G.J., and Connor, W.E. (1988). The Essentiality of N-3
Fatty Acids for the Development and Function of the Retina and Brain. Annual
Review of Nutrition 8, 517-541.
Chapter 6: Bibliography
242 | P a g e
O'Neal, R.M., Pla, G.W., Fox, M.R., Gibson, F.S., and Fry, B.E., Jr. (1970). Effect of zinc
deficiency and restricted feeding on protein and ribonucleic acid metabolism of
rat brain. J Nutr 100, 491-497.
Oltvai, Z.N., Milliman, C.L., and Korsmeyer, S.J. (1993). Bcl-2 heterodimerizes in vivo
with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74,
609-619.
Pahlman, S., Odelstad, L., Larsson, E., Grotte, G., and Nilsson, K. (1981). Phenotypic
changes of human neuroblastoma cells in culture induced by 12-O-
tetradecanoyl-phorbol-13-acetate. International journal of cancer Journal
international du cancer 28, 583-589.
Pahlman, S., Ruusala, A.I., Abrahamsson, L., Mattsson, M.E., and Esscher, T. (1984).
Retinoic acid-induced differentiation of cultured human neuroblastoma cells: a
comparison with phorbolester-induced differentiation. Cell differentiation 14,
135-144.
Palmiter, R.D., Cole, T.B., Quaife, C.J., and Findley, S.D. (1996). ZnT-3, a putative
transporter of zinc into synaptic vesicles. Proc Natl Acad Sci U S A 93, 14934-
14939.
Palmiter, R.D.a.F., S. D. (1995a). Cloning and functional characterization of a
mammalian zinc transporter that confers resistance to zinc. EMBO Journal 14,
639–649.
Chapter 6: Bibliography
243 | P a g e
Palmiter, R.D.a.F., S. D. (1995b). Cloning and functional characterization of a
mammalian zinc transporter that confers resistance to zinc.
. EMBO Journal 14, 639–649.
Pampaloni, F., Reynaud, E.G., and Stelzer, E.H. (2007). The third dimension bridges
the gap between cell culture and live tissue. Nature reviews Molecular cell
biology 8, 839-845.
Paquet-Durand, F., and Bicker, G. (2007). Human model neurons in studies of brain
cell damage and neural repair. Current molecular medicine 7, 541-554.
Paquet-Durand, F., Tan, S., and Bicker, G. (2003). Turning teratocarcinoma cells into
neurons: rapid differentiation of NT-2 cells in floating spheres. Developmental
Brain Research 142, 161-167.
Patel, C. (2003). The Effect of Lipid Fluidity Modulating Agents on the Activity of
Secretases. Journal of Undergraduate Research 4.
Pawlosky, R.J., Hibbeln, J.R., Novotny, J.A., and Salem, N., Jr. (2001). Physiological
compartmental analysis of {alpha}-linolenic acid metabolism in adult humans. J
Lipid Res 42, 1257-1265.
Piche, L.A., Draper, H.H., and Cole, P.D. (1988). Malondialdehyde excretion by
subjects consuming cod liver oil vs a concentrate of n-3 fatty acids. Lipids 23,
370-371.
Chapter 6: Bibliography
244 | P a g e
Pleasure, S.J., Page, C., and Lee, V.M. (1992). Pure, postmitotic, polarized human
neurons derived from NTera 2 cells provide a system for expressing exogenous
proteins in terminally differentiated neurons. The Journal of neuroscience : the
official journal of the Society for Neuroscience 12, 1802-1815.
Porter, A.G., and Janicke, R.U. (1999). Emerging roles of caspase-3 in apoptosis. Cell
death and differentiation 6, 99-104.
Puskas, L.G., Kitajka, K., Nyakas, C., Barcelo-Coblijn, G., and Farkas, T. (2003). Short-
term administration of omega 3 fatty acids from fish oil results in increased
transthyretin transcription in old rat hippocampus. Proc Natl Acad Sci U S A 100,
1580-1585.
R. Ishihara, T. Kawakami, Y. Mizuno, T. Takeuchi, and Ide, A. (2003). Neuronal
Degeneration from the Perspective of Abnormal Distribution of Cellular Metallic
Elements in Cases of Alzheimer’s Disease.
Biomed Res Trace Elements 14, 204.
Rahman, M.M., Veigas, J.M., Williams, P.J., and Fernandes, G. (2013). DHA is a more
potent inhibitor of breast cancer metastasis to bone and related osteolysis than
EPA. Breast cancer research and treatment 141, 341-352.
Rainulf, A.S., H. Norman Schnitzlein F. Reed Murtagh (1995). An english translation
of alzheimer's 1907 paper, "über eine eigenartige erkankung der hirnrinde".
Clinical Anatomy 8, 429-431.
Chapter 6: Bibliography
245 | P a g e
Ramkumar, T., and Adler, S. (1999). A requirement for the POU transcription factor,
Brn-2, in corticotropin-releasing hormone expression in a neuronal cell line.
Molecular endocrinology (Baltimore, Md) 13, 1237-1248.
Ravindran, A., Schild, L., and Moczydlowski, E. (1991). Divalent cation selectivity for
external block of voltage-dependent Na+ channels prolonged by batrachotoxin.
Zn2+ induces discrete substates in cardiac Na+ channels. The Journal of general
physiology 97, 89-115.
Recio-Pinto, E., Lang, F.F., and Ishii, D.N. (1984). Insulin and insulin-like growth
factor II permit nerve growth factor binding and the neurite formation response
in cultured human neuroblastoma cells. Proc Natl Acad Sci U S A 81, 2562-2566.
Reddy, B.S. (2002). Types and amount of dietary fat and colon cancer risk:
Prevention by omega-3 fatty acid-rich diets. Environmental health and
preventive medicine 7, 95-102.
Reed, J.C. (1994). Bcl-2 and the regulation of programmed cell death. The Journal of
cell biology 124, 1-6.
Robert Adalberta, J.G.a.M.P.C. (2007). Ab, tau and ApoE4 in Alzheimer’s disease: the
axonal connection Trends in Molecular Medicine 13, 135-142.
Roberts, S.B., Ripellino, J.A., Ingalls, K.M., Robakis, N.K., and Felsenstein, K.M.
(1994). Non-amyloidogenic cleavage of the beta-amyloid precursor protein by an
integral membrane metalloendopeptidase. J Biol Chem 269, 3111-3116.
Chapter 6: Bibliography
246 | P a g e
Sacharidou, A., Koh, W., Stratman, A.N., Mayo, A.M., Fisher, K.E., and Davis, G.E.
(2010). Endothelial lumen signaling complexes control 3D matrix-specific
tubulogenesis through interdependent Cdc42- and MT1-MMP-mediated events.
Blood 115, 5259-5269.
Sadli, N., Ackland, M.L., De Mel, D., Sinclair, A.J., and Suphioglu, C. (2012). Effects of
zinc and DHA on the epigenetic regulation of human neuronal cells. Cellular
physiology and biochemistry : international journal of experimental cellular
physiology, biochemistry, and pharmacology 29, 87-98.
Salem, N., Jr., Abood, L.G., and Hoss, W. (1976). Separation of brain
phosphatidylserines according to degree of unsaturation by thin-layer
chromatography. Anal Biochem 76, 407-415.
Salem, N., Jr., Wegher, B., Mena, P., and Uauy, R. (1996). Arachidonic and
docosahexaenoic acids are biosynthesized from their 18-carbon precursors in
human infants. PNAS 93, 49-54.
Sandra Kalmijn, L.J.L.A.O.J.C.M.W.A.H.M.M.B.B. (1997). Dietary fat intake and the
risk of incident dementia in the Rotterdam study. Annals of Neurology 42, 776-
782.
Sekler, I., Moran, A., Hershfinkel, M., Dori, A., Margulis, A., Birenzweig, N., Nitzan,
Y., and Silverman, W.F. (2002). Distribution of the zinc transporter ZnT-1 in
comparison with chelatable zinc in the mouse brain. J Comp Neurol 447, 201-
209.
Chapter 6: Bibliography
247 | P a g e
Sensi, S.L., Yin, H.Z., and Weiss, J.H. (2000). AMPA/kainate receptor-triggered Zn2+
entry into cortical neurons induces mitochondrial Zn2+ uptake and persistent
mitochondrial dysfunction. The European journal of neuroscience 12, 3813-3818.
Serini, S., Trombino, S., Oliva, F., Piccioni, E., Monego, G., Resci, F., Boninsegna, A.,
Picci, N., Ranelletti, F.O., and Calviello, G. (2008). Docosahexaenoic acid induces
apoptosis in lung cancer cells by increasing MKP-1 and down-regulating p-ERK1/2
and p-p38 expression. Apoptosis : an international journal on programmed cell
death 13, 1172-1183.
Shahdat, H., Hashimoto, M., Katakura, M., Miwa, K., Shimada, T., and Shido, O.
(2009). Mechanism of Docosahexaenoic acid-induced inhibition of in vitro
Abeta(1-42) fibrillation and Abeta(1-42)-induced toxicity in SH-S5Y5 cells. Journal
of Neurochemistry 9999.
Shapiro, S., Hamby, C.L., and Shapiro, D.A. (1985). Alzheimer's disease: an emerging
affliction of the aging population. J Am Dent Assoc 111, 287-292.
Sheline, C.T., Behrens, M.M., and Choi, D.W. (2000a). Zinc-induced cortical neuronal
death: contribution of energy failure attributable to loss of NAD(+) and inhibition
of glycolysis. The Journal of neuroscience : the official journal of the Society for
Neuroscience 20, 3139-3146.
Sheline, C.T., Behrens, M.M., and Choi, D.W. (2000b). Zinc-Induced Cortical
Neuronal Death: Contribution of Energy Failure Attributable to Loss of NAD+ and
Inhibition of Glycolysis. J Neurosci 20, 3139-3146.
Chapter 6: Bibliography
248 | P a g e
Sidell, N. (1982). Retinoic acid-induced growth inhibition and morphologic
differentiation of human neuroblastoma cells in vitro. Journal of the National
Cancer Institute 68, 589-596.
Simopoulos, A.P. (1991). Omega-3 fatty acids in health and disease and in growth
and development. Am J Clin Nutr 54, 438-463.
Simopoulos, A.P. (2002). The importance of the ratio of omega-6/omega-3 essential
fatty acids. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
56, 365-379.
Simpson, P.B., Bacha, J.I., Palfreyman, E.L., Woollacott, A.J., McKernan, R.M., and
Kerby, J. (2001). Retinoic acid evoked-differentiation of neuroblastoma cells
predominates over growth factor stimulation: an automated image capture and
quantitation approach to neuritogenesis. Anal Biochem 298, 163-169.
Skender, B., Hofmanova, J., Slavik, J., Jelinkova, I., Machala, M., Moyer, M.P.,
Kozubik, A., and Hyrslova Vaculova, A. (2014). DHA-mediated enhancement of
TRAIL-induced apoptosis in colon cancer cells is associated with engagement of
mitochondria and specific alterations in sphingolipid metabolism. Biochimica et
biophysica acta 1841, 1308-1317.
Smart, T.G., Xie, X., and Krishek, B.J. (1994). Modulation of inhibitory and excitatory
amino acid receptor ion channels by zinc. Prog Neurobiol 42, 393-441.
Smidt, K., and Rungby, J. (2012). ZnT3: a zinc transporter active in several organs.
Biometals 25, 1-8.
Chapter 6: Bibliography
249 | P a g e
Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano,
M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C. (1985). Measurement
of protein using bicinchoninic acid. Analytical Biochemistry 150, 76-85.
Smith, R.A., Miller, T.M., Yamanaka, K., Monia, B.P., Condon, T.P., Hung, G.,
Lobsiger, C.S., Ward, C.M., McAlonis-Downes, M., Wei, H., et al. (2006).
Antisense oligonucleotide therapy for neurodegenerative disease. The Journal of
clinical investigation 116, 2290-2296.
Solfrizzi, V., D'Introno, A., Colacicco, A.M., Capurso, C., Del Parigi, A., Capurso, S.,
Gadaleta, A., Capurso, A., and Panza, F. (2005). Dietary fatty acids intake:
possible role in cognitive decline and dementia. Exp Gerontol 40, 257-270.
Sonnenfeld, K.H., and Ishii, D.N. (1982). Nerve growth factor effects and receptors in
cultured human neuroblastoma cell lines. J Neurosci Res 8, 375-391.
Sowa, M.B., Chrisler, W.B., Zens, K.D., Ashjian, E.J., and Opresko, L.K. (2010). Three-
dimensional culture conditions lead to decreased radiation induced cytotoxicity
in human mammary epithelial cells. Mutation research 687, 78-83.
Spinelli, P., Pizzetti, P., Lo Gullo, C., Rocca, F., Gobbi, A., and Ravasi, G. (1982).
Resection of obstructive bronchial fibrolipoma through the flexible fiberoptic
bronchoscope. Endoscopy 14, 61-63.
Stillwell, W., and Wassall, S.R. (2003). Docosahexaenoic acid: membrane properties
of a unique fatty acid. Chemistry and physics of lipids 126, 1-27.
Chapter 6: Bibliography
250 | P a g e
Stoll, A.L.M.D., Severus, W. Emanuel M. D. PhD, Freeman, Marlene P. M. D., Rueter,
Stephanie, Zboyan, Holly A., Diamond, Eli, Cress, Kimberly K. M. D., Marangell,
Lauren B. M. D. (1999). Omega3 Fatty Acids in Bipolar Disorder: A Preliminary
Double-blind, Placebo-Controlled Trial. Archives of General Psychiatry 56, 413–
416.
Stoltenberg, M., Bruhn, M., Sondergaard, C., Doering, P., West, M.J., Larsen, A.,
Troncoso, J.C., and Danscher, G. (2005a). Immersion autometallographic tracing
of zinc ions in Alzheimer beta-amyloid plaques. Histochem Cell Biol 123, 605-611.
Stoltenberg, M., Bruhn, M., Søndergaard, C., Doering, P., West, M.J., Larsen, A.,
Troncoso, J.C., and Danscher, G. (2005b). Immersion autometallographic tracing
of zinc ions in Alzheimer beta-amyloid plaques. Histochemistry and Cell Biology
123, 605-611.
Storch, A., Burkhardt, K., Ludolph, A.C., and Schwarz, J. (2000). Protective effects of
riluzole on dopamine neurons: involvement of oxidative stress and cellular
energy metabolism. J Neurochem 75, 2259-2269.
Strittmatter, S.M., and Fishman, M.C. (1991). The neuronal growth cone as a
specialized transduction system. BioEssays : news and reviews in molecular,
cellular and developmental biology 13, 127-134.
Suh, S.W., Chen, J.W, Motamedi, M, Bell, B, Listiak, K, Pons, NF, Danscher, G,
Frederickson, C.J. (2000). Evidence that synaptically-released zinc contributes to
neuronal injury after traumatic brain injury. Brain Research 852, 268-273.
Chapter 6: Bibliography
251 | P a g e
Sun, T., Jackson, S., Haycock, J.W., and MacNeil, S. (2006). Culture of skin cells in 3D
rather than 2D improves their ability to survive exposure to cytotoxic agents.
Journal of biotechnology 122, 372-381.
Suphioglu, C., De Mel, D., Kumar, L., Sadli, N., Freestone, D., Michalczyk, A., Sinclair,
A., and Ackland, M.L. (2010a). The omega-3 fatty acid, DHA, decreases neuronal
cell death in association with altered zinc transport. FEBS letters 584, 612-618.
Suphioglu, C., Sadli, N., Coonan, D., Kumar, L., De Mel, D., Lesheim, J., Sinclair, A.J.,
and Ackland, L. (2010b). Zinc and DHA have opposing effects on the expression
levels of histones H3 and H4 in human neuronal cells. The British journal of
nutrition 103, 344-351.
Suzuki, H., Park, S.J., Tamura, M., and Ando, S. (1998). Effect of the long-term
feeding of dietary lipids on the learning ability, fatty acid composition of brain
stem phospholipids and synaptic membrane fluidity in adult mice: a comparison
of sardine oil diet with palm oil diet. Mech Ageing Dev 101, 119-128.
Suzuki, I., Iigo, M., Ishikawa, C., Kuhara, T., Asamoto, M., Kunimoto, T., Moore, M.A.,
Yazawa, K., Araki, E., and Tsuda, H. (1997). Inhibitory effects of oleic and
docosahexaenoic acids on lung metastasis by colon-carcinoma-26 cells are
associated with reduced matrix metalloproteinase-2 and -9 activities.
International journal of cancer Journal international du cancer 73, 607-612.
Svennerholm, L. (1968). Distribution and fatty acid composition of
phosphoglycerides in normal human brain. Journal of lipid research 9, 570-579.
Chapter 6: Bibliography
252 | P a g e
Switzer, K.C., Fan, Y.Y., Wang, N., McMurray, D.N., and Chapkin, R.S. (2004). Dietary
n-3 polyunsaturated fatty acids promote activation-induced cell death in Th1-
polarized murine CD4+ T-cells. Journal of lipid research 45, 1482-1492.
Szewczyk, B. (2013). Zinc homeostasis and neurodegenerative disorders. Frontiers
in aging neuroscience 5, 33.
Takeda, A. (2000). Movement of zinc and its functional significance in the brain.
Brain research Brain research reviews 34, 137-148.
Thelwell, C., Robinson, N.J., and Turner-Cavet, J.S. (1998). An SmtB-like repressor
from Synechocystis PCC 6803 regulates a zinc exporter. Proceedings of the
National Academy of Sciences 95, 10728-10733.
Thompson, R.B. (2005). Studying zinc biology with fluorescence: ain't we got fun?
Current opinion in chemical biology 9, 526-532.
Treen, M., Uauy, R.D., Jameson, D.M., Thomas, V.L., and Hoffman, D.R. (1992).
Effect of docosahexaenoic acid on membrane fluidity and function in intact
cultured Y-79 retinoblastoma cells. Arch Biochem Biophys 294, 564-570.
Trojanowski, J.Q., Kleppner, S.R., Hartley, R.S., Miyazono, M., Fraser, N.W., Kesari,
S., and Lee, V.M. (1997). Transfectable and transplantable postmitotic human
neurons: a potential "platform" for gene therapy of nervous system diseases.
Experimental neurology 144, 92-97.
Chapter 6: Bibliography
253 | P a g e
Vallee, B.L., and Auld, D.S. (1990). Active-Site Zinc Ligands and Activated H2O of Zinc
Enzymes. PNAS 87, 220-224.
Vallee, B.L., and Auld, D.S. (1992). Active zinc binding sites of zinc metalloenzymes.
Matrix 1, 5-19.
Vallee, B.L., and Falchuk, K.H. (1993). The biochemical basis of zinc physiology.
Physiological reviews 73, 79-118.
Vaux, D.L., Cory, S., and Adams, J.M. (1988). Bcl-2 gene promotes haemopoietic cell
survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-
442.
Vickers, J.C., Dickson, T.C., Adlard, P.A., Saunders, H.L., King, C.E., and McCormack,
G. (2000). The cause of neuronal degeneration in Alzheimer's disease. Prog
Neurobiol 60, 139-165.
Wall, S. (2007). Alzheimer's Cases Could Soar by Midcentury. In Wall Street Journal -
Eastern Edition, pp. B7.
Wallwork, J.C. (1987). Zinc and the central nervous system. Prog Food Nutr Sci 11,
203-247.
Wallwork, J.C., Milne, D.B., Sims, R.L., and Sandstead, H.H. (1983). Severe zinc
deficiency: effects on the distribution of nine elements (potassium, phosphorus,
sodium, magnesium, calcium, iron, zinc, copper and manganese) in regions of the
rat brain. J Nutr 113, 1895-1905.
Chapter 6: Bibliography
254 | P a g e
Wander, R.C., Du, S.H., Ketchum, S.O., and Rowe, K.E. (1996). Effects of interaction
of RRR-alpha-tocopheryl acetate and fish oil on low-density-lipoprotein oxidation
in postmenopausal women with and without hormone-replacement therapy. Am
J Clin Nutr 63, 184-193.
Wang, F., Dufner-Beattie, J., Kim, B.E., Petris, M.J., Andrews, G., and Eide, D.J.
(2004a). Zinc-stimulated endocytosis controls activity of the mouse ZIP1 and ZIP3
zinc uptake transporters. J Biol Chem 279, 24631-24639.
Wang, Z., Wang, D.Z., Hockemeyer, D., McAnally, J., Nordheim, A., and Olson, E.N.
(2004b). Myocardin and ternary complex factors compete for SRF to control
smooth muscle gene expression. Nature 428, 185-189.
Wang, Z.Y., Stoltenberg, M., Huang, L., Danscher, G., Dahlstrom, A., Shi, Y., and Li,
J.Y. (2005). Abundant expression of zinc transporters in Bergman glia of mouse
cerebellum. Brain Res Bull 64, 441-448.
Watt, N.T., Whitehouse, I.J., and Hooper, N.M. (2010). The role of zinc in
Alzheimer's disease. Int J Alzheimers Dis 2011, 971021.
Webber, K.M., Raina, A.K., Marlatt, M.W., Zhu, X., Prat, M.I., Morelli, L., Casadesus,
G., Perry, G., and Smith, M.A. (2005). The cell cycle in Alzheimer disease: a
unique target for neuropharmacology. Mech Ageing Dev 126, 1019-1025.
Weiss, J.H., Sensi, S.L., and Koh, J.Y. (2000). Zn(2+): a novel ionic mediator of neural
injury in brain disease. Trends Pharmacol Sci 21, 395-401.
Chapter 6: Bibliography
255 | P a g e
Winegar, B.D., and Lansman, J.B. (1990). Voltage-dependent block by zinc of single
calcium channels in mouse myotubes. The Journal of physiology 425, 563-578.
Wolk, A., Larsson, S.C., Johansson, J.E., and Ekman, P. (2006). Long-term fatty fish
consumption and renal cell carcinoma incidence in women. JAMA 296, 1371-
1376.
Wolozin, B. (2001). Peering into proteolysis with presenilins. J Alzheimers Dis 3, 191-
193.
Xiao, Z., D. Prieto, et al. (2005). Proteomic patterns: their potential for disease
diagnosis. Molecular and Cellular Endocrinology 230, 95-106.
Xu, L.Z., Sanchez, R., Sali, A., and Heintz, N. (1996). Ligand specificity of brain lipid-
binding protein. J Biol Chem 271, 24711-24719.
Yamamoto, N., Saitoh, M., Moriuchi, A., Nomura, M., and Okuyama, H. (1987).
Effect of dietary alpha-linolenate/linoleate balance on brain lipid compositions
and learning ability of rats. J Lipid Res 28, 144-151.
Yin HZ, L.A., Weiss JH. (1994). Kainate injury to cultured basal forebrain cholinergic
neurons is Ca21 dependent. . Neuroreport 5, 1477–1480.
Yokoyama, M., Koh, J., and Choi, D.W. (1986). Brief exposure to zinc is toxic to
cortical neurons. Neurosci Lett 71, 351-355.
Zhang, G., Panigrahy, D., Mahakian, L.M., Yang, J., Liu, J.Y., Stephen Lee, K.S.,
Wettersten, H.I., Ulu, A., Hu, X., Tam, S., et al. (2013). Epoxy metabolites of
Chapter 6: Bibliography
256 | P a g e
docosahexaenoic acid (DHA) inhibit angiogenesis, tumor growth, and metastasis.
Proc Natl Acad Sci U S A 110, 6530-6535.
Zhang, L.H., Wang, X., Stoltenberg, M., Danscher, G., Huang, L., and Wang, Z.Y.
(2008). Abundant expression of zinc transporters in the amyloid plaques of
Alzheimer's disease brain. Brain Res Bull 77, 55-60.
Zhang, Y., Mukherjee, S., and Oldfield, E. (2005). (67)Zn NMR chemical shifts and
electric field gradients in zinc complexes: a quantum chemical investigation.
Journal of the American Chemical Society 127, 2370-2371.
Zheng, W., Wang, T., Yu, D., Feng, W.Y., Nie, Y.X., Stoltenberg, M., Danscher, G., and
Wang, Z.Y. (2010). Elevation of zinc transporter ZnT3 protein in the cerebellar
cortex of the AbetaPP/PS1 transgenic mouse. J Alzheimers Dis 20, 323-331.
Zlokovic, B.V. (2005). Neurovascular mechanisms of Alzheimer's
neurodegeneration. Trends Neurosci 28, 202-208.
Zlokovic, B.V., Deane, R., Sallstrom, J., Chow, N., and Miano, J.M. (2005).
Neurovascular pathways and Alzheimer amyloid beta-peptide. Brain Pathol 15,
78-83.