orphan nuclear receptor pnr/nr2e3 stimulates p53 functions by
TRANSCRIPT
1
Orphan Nuclear Receptor PNR/NR2E3 Stimulates p53 Functions by Enhancing p53 1
Acetylation 2
3
Running title: Nuclear receptor PNR/NR2E3 regulates p53 4
5
Zhi Wen,1,2 Dohun Pyeon,1,2,5 Yidan Wang,1 Paul Lambert,1 Wei Xu,1* and Paul Ahlquist1,2,3,4* 6
McArdle Laboratory for Cancer Research,1 Institute for Molecular Virology,2 Howard Hughes 7
Medical Institute,3 and Morgridge Institute for Research,4 University of Wisconsin–Madison, 8
Madison, WI 53706; 9
Current address: Department of Microbiology, School of Medicine, University of Colorado, 10
Aurora, CO 800455 11
12
*Corresponding authors: 13
Paul Ahlquist, Institute for Molecular Virology, University of Wisconsin - Madison, 1525 14
Linden Dr, Madison, WI 53706; Tel: (608) 263-5916, Fax: (608) 265-9214, Email: 15
17
Wei Xu, McArdle Laboratory for Cancer Research, University of Wisconsin - Madison, 1400 18
University Ave, Madison, WI 53706; Tel: (608) 265-5540, Fax: (608) 262-2824, Email: 19
21
The word count for the Materials and Methods section: < 1,800 22
The combined word count for the introduction, Results, and Discussion sections: < 4,200 23
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.05513-11 MCB Accepts, published online ahead of print on 24 October 2011
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
2
ABSTRACT 24
25
Since inactivation of tumor suppressor p53 functions is one of the most common features 26
of human cancer cells, restoring p53 expression and activity is an important focus in cancer 27
therapy. Here we report identification of photoreceptor-specific nuclear receptor (PNR)/NR2E3 28
as a positive regulator of p53 in a high-throughput genetic screen. In HeLa cells, PNR stimulated 29
p53-responsive promoters in a p53-dependent fashion and induced apoptosis in several cell types. 30
PNR also increased p53 protein stability and specific activity as a transcriptional activator. Our 31
studies of the underlying mechanisms show that PNR complexes with p53 and the 32
acetyltransferase p300, stimulates p53 acetylation, and increases the expression of a subset of 33
p53 target genes. Furthermore, PNR significantly boosted actinomycin D-stimulated p53 34
acetylation. The unique mechanisms by which PNR stimulates p53 acetylation and functions 35
define this orphan nuclear receptor as a potentially valuable target and tool in p53-associated 36
cancer therapy, and offers new insights into the roles of PNR mutation in retinal diseases.37
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
3
INTRODUCTION 38
39
In most cancers, normal p53 functions are abrogated by p53 mutations, transcriptional 40
inhibition, or posttranslational modifications. Since p53 gene transcription is under tight control 41
(35, 36), it is valuable to identify factors that regulate p53 posttranslationally as potential targets 42
for p53-based cancer therapy. MDM2, a major regulator of p53 stability, also blocks the 43
transactivation domain of p53 and enhances p53 nuclear export (12, 13, 20). Nutlins, antagonists 44
of MDM2 and promising cancer therapeutic drugs, bind the p53 binding pocket of MDM2, 45
resulting in activation of p53 (47). 46
One important mechanism for p53 posttranslational regulation is acetylation (2, 3, 10, 21). 47
p53 acetylation at multiple sites directly affects p53 stability, DNA binding and transactivation. 48
Accordingly, p53 acetylation is commonly targeted by viral proteins to inactivate p53. One 49
example is the inhibition of p53 by human papillomavirus (HPV) oncoprotein E6. HPVs cause 50
over 5% of all human cancers, including essentially all cervical cancers, ~25% of head and neck 51
cancers, and other cancers (9, 32). Many HPV+ cancer cell lines retain a wild type p53 gene, but 52
E6 abrogates p53 functions by both stimulating p53 ubiquitination and inhibiting p53 acetylation 53
(54). Disrupting E6-mediated inhibition of p53 by knocking down E6 or E6AP significantly 54
restores p53 function and induces cell apoptosis (15). 55
To identify additional targets for p53-based cancer therapy in HPV+ and potentially other 56
cancers, we have now used a high throughput screen of full length, mammalian cDNA 57
overexpression plasmids to identify photoreceptor-specific nuclear receptor (PNR/NR2E3) as a 58
gene that enhanced p53 accumulation in HPV+ HeLa cells. PNR/NR2E3, a member of nuclear 59
receptor subfamily 2, is highly expressed in retinal cone and rod cells. With increased 60
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
4
characterization, PNR expression has been detected in additional tissues, such as prostate and 61
uterus (5, 30). Although PNR mutants are implicated as a causative factor for enhanced S-cone 62
syndrome, a cone cell hyperplasia disorder, the mechanism(s) of PNR involvement in the 63
etiology of this disease remain poorly characterized (11). PNR interacts with several 64
transcription factors to inhibit cone opsin expression and enhance rod opsin expression (31). 65
Moreover, PNR binds to and represses the promoter of cyclin D1, which promotes G1/S 66
progression and cell proliferation, implying that wild type PNR attenuates cell proliferation of S-67
cone cells from retinal progenitor cells (42). 68
In addition to identifying PNR’s effects on p53, we show here that PNR stimulates p53 69
accumulation and functions by enhancing p53 acetylation, a mechanism distinct from the means 70
of regulation of p53 by other nuclear receptors. Since nuclear receptors are proven 71
pharmaceutical targets, PNR, a novel modulator of p53, may serve as a new target for p53-based 72
cancer therapy. 73
74
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
5
MATERIALS AND METHODS 75
76
Plasmids. The pCMV-SP6-PNR expressing PNR was constructed by subcloning a full-77
length wild type PNR into a pCMV-SP6 expression vector from a pcDNA3.1/HisC-PNR (31), 78
kindly provided by Dr. S.M. Chen (Washington University). The pCMV-SP6-HA-PNR 79
expressing N-terminally HA-tagged PNR (Figs. 7-8) was constructed by adding an HA tag 80
coding sequence to the 5’-terminus of PNR with no space. Reporter plasmid p53RE-FLuc, 81
expressing firefly luciferase from a p53-responsive promoter containing two tandem p53-82
responsive elements, was from Panomics (cat# LR0057). A p53RE-FLuc derivative with the p53 83
binding site inactivated was generated by mutating critical CxxG residues (7) into AxxT with a 84
QuickChange® II XL site-directed mutagenesis kit (Agilent cat# 200521). Primers used for this 85
mutation are 5’-CGC GTG CTA GCT ACA GAA aAT tTC TAA GaA TtC TGT GCC TTG 86
CCT GGA aTT tCC TGG CaT TtC CTT GGG AGA TCT GGG TAT-3’ and 5’-ATA CCC AGA 87
TCT CCC AAG GaA AtG CCA GGa AAt TCC AGG CAA GGC ACA GaA TtC TTA GAa ATt 88
TTC TGT AGC TAG CAC GCG-3’. Plasmid expressing human p53 dominant-negative mutant-89
p53C135Y was from Clontech (cat# 631922). The pCMV-SP6-Pitx2a expressing Pitx2a was 90
constructed by subcloning a full-length wild type Pitx2a into a pCMV-Sp6 expression vector 91
from a GFP-Pitx2a plasmid (50), kindly provided by Dr. Q.Z. Wei (Kansas State University). 92
Cell culture. HeLa cells (ATCC cat# CCL-2), p53+/+ and p53¯/¯ HCT116 cells (kindly 93
provided by Dr. B. Vogelstein, John Hopkins University) and p53-null H1299 cells (a gift from 94
Dr. W. Sugden, University of Wisconsin-Madison) were cultured at 37°C in DMEM + 10% FBS 95
(heat-inactivated) with 5% CO2. 96
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
6
Luciferase reporter assays. Luciferase reporter assays were performed in 96-well plates 97
using reverse transfection. For each well, 0.01 µg reporter plasmid p53RE-Fluc, 0.005 µg phRL-98
SV40 expressing renilla luciferase and the indicated amounts of PNR expression plasmid and 99
other plasmids were added to total 0.085 µg DNA in 5 µl Opti-MEM. 0.17 µl TransIT-LT1 was 100
mixed with 9 µl Opti-MEM, mixed with the above DNA, transferred to the microplate, and 101
incubated for 30 min at room temperature. 1.2x104 cells in 100 µl medium were then added per 102
well. Two days after transfection, cells were processed with the Dual GLO Luciferase assay 103
(Promega cat# E2940) and a Perkin-Elmer luminometer. 104
Apoptosis assays. Annexin V Binding Assay: 106 cells were seeded per 6-cm dish and 105
incubated for 18 hr at 37 °C. Equal amount of total plasmids then were co-transfected using 106
Lipofectamine 2000 (Invitrogen cat# 11668-019; 2:1 Lipofectamine: DNA solution) following 107
manufacture’s protocol. The medium was changed 6 hr after transfection. Two days after 108
transfection, a Vybrant® Apoptosis Assay Kit #2-Alexa Fluor® 488 (Invitrogen cat# V13241) 109
was used to label apoptotic cells according to manufacturer’s instructions. Flow cytometry was 110
used to count the labeled cells and the data were analyzed using Flowjo software. The percentage 111
of apoptotic cells (Fig. 3) was Alexa Fluor 488 labeled cells among the transfected cells 112
expressing red fluorescent protein. 113
Sub-G1 apoptosis assay: Cells in 6-cm dishes were transfected with Lipofectamine 2000 114
as above, except that the indicated plasmids were used. Two days after transfection, cells were 115
detached, treated as http://sciencepark.mdanderson.org/fcores/flow/files/DNA_PI.html and 116
measured by Flow Cytometry. 117
Immunoblotting. Cells in 6-cm dishes were transfected with Lipofectamine 2000 as 118
above, except that the indicated plasmids were co-transfected. Cells were harvested two days 119
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
7
after transfection. After washing twice with cold PBS, the cell pellet was lysed with 200 µl RIPA 120
buffer (Pierce cat# 89900) plus protease inhibitors (Roche cat# 11873580001) for 15 min on ice. 121
50 µl 5x SDS sample buffer was added. The sample was sonicated twice for 5 sec each with a 122
probe sonicator at 4°C and heated for 15 min at 99°C with vigorous vortexing. After centrifuging 123
at 9,200x g for 10 min at 4°C, the supernatant was stored at -20°C. 124
Cell lysates were electrophoresed on a freshly-made 10% SDS-polyacrylamide gel and 125
transferred to nitrocellulose membranes (GE cat# RPN303D) in transfer buffer with 10% 126
methanol, except that 5% SDS-PAGE was used to resolve p300. The membrane was blocked 127
with Odyssey blocking buffer (LiCor cat# 927-40000) for 1 hr at room temperature, incubated 128
with primary antibodies for 1 hr at room temperature, and washed 5 times for 5 min each with 129
PBS + 0.1% Tween-20. For semi-quantitative analysis, the membrane was then incubated with 130
fluorescent secondary antibodies (LiCor goat anti-rabbit antibody conjugated with IRDye 800cw 131
(cat# 926-32211) and goat anti-mouse antibody conjugated with IRDye 680 (cat# 926-32220)) 132
for 40 min at room temperature, followed by 5 washes as above. The air-dried membranes 133
bearing a dilution curve of each sample were scanned with a LiCor Odyssey imager, and images 134
were analyzed using Odyssey V3.0 software. For detection of HA-tagged PNR (Fig. 8), samples 135
were transferred to PVDF membranes in transfer buffer with 15% methanol, a rat anti-HA 136
antibody conjugated to horseradish peroxidase (Roche cat# 12013819001) was used as the 137
primary antibody and the secondary antibody was omitted. 138
Antibodies used for immunoblotting were diluted as follows: 1:1,000 anti-acetylated p53 139
antibodies (K373+382 Upstate cat# 06-758, K382 Upstate cat# 04-1146, K320 Upstate cat# 06-140
1283, K120 AbCam cat# ab78316), 1:1,000 mouse anti-total p53 antibody (Calbiochem cat# 141
OP43), 1:1,000 rabbit anti-PNR antibody (Sigma cat# P5373), 1:1,000 rabbit anti-p300 antibody 142
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
8
(Santa Cruz cat# sc-584), 1:3,000 rabbit anti-β-actin antibody (Santa Cruz cat# sc-1616-R), 143
1:6,000 mouse anti-GFP antibody (Covance cat# MMS-118R) and 1:10,000 LiCor fluorescent 144
secondary antibodies were diluted in Odyssey blocking buffer; and 1:500 mouse anti-p21 145
antibody (Santa Cruz cat# SC-56335), 1:2,000 HRP-conjugated rat anti-HA antibody, 1:10,000 146
HRP-conjugated goat anti-mouse secondary antibody and 1:20,000 HRP-conjugated mouse anti-147
rabbit light chain secondary antibody were diluted in PBS, 0.1% Tween-20 and 5% non-fat milk. 148
Immunoprecipitation. Cells in 6-cm dishes were transfected with Lipofectamine 2000 149
as above, except that 0.5 µg p53 expressing plasmid, 1.5 µg HA-PNR expressing plasmid, and 150
1.5 µg p300 expressing plasmids were co-transfected. Two days after transfection, cells were 151
detached and washed 3 times with cold PBS. Cell pellets were resuspended with 400 µl Buffer A 152
(10 mM HEPES [pH 7.9], 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA and 0.5 mM PMSF) and 153
incubated for 15 min on ice. 25 µl 10% NP-40 was added, followed by vigorous vortexing for 10 154
sec. The lysate was centrifuged at 2,300x g for 1 min at 4°C. The supernatant (cytoplasmic 155
extract) was kept on ice. The nuclear pellet was resuspended in 200 µl Buffer B (20 mM HEPES 156
[pH 7.9], 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, and 0.5 mM PMSF) and sonicated twice 157
for 5 sec each. The resulting nuclear lysate was vigorously vortexed for 15 min and centrifuged 158
at 13,000x g for 10 min at 4°C. The supernatant (nuclear extract) was combined with the 159
cytoplasmic extract for immunoprecipitation. 160
2 µg of rabbit antibodies against p53 (Santa Cruz cat# sc-6243) or p300 (Santa Cruz cat# 161
sc-584) or HA (Sigma cat# H6908) was mixed with 50 µl Protein A Dynabeads (Invitrogen cat# 162
100-01D). 2 µg of rabbit anti-His antibody (cat# sc-803) and pre-immune rabbit IgG (cat# sc-163
2344) from Santa Cruz were used as controls. Immunoprecipitation was performed following the 164
manufacturer’s instructions except that Dynabeads were washed 6 times for 30 sec each after 165
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
9
immunoprecipitation. Dynabeads were then incubated with 100 µl 1x SDS sample buffer for 20 166
min at 50°C with vigorous vortexing to elute proteins. The beads were centrifuged at 9,200x g 167
for 1 min at 4°C and the supernatant was stored at -20°C after 10 min at 99°C. 168
Immunofluorescence. Cells were reverse-transfected as “Reporter assays”, except that 169
8-chamber slides were used and all materials were doubled per chamber. Two days after 170
transfection, the cells were washed 3 times with PBS and fixed in 1% paraformaldehyde in PBS 171
for 30 min at room temperature. Cells were washed with PBS 3 times and permeabilized in 0.5% 172
Triton-X100 in PBS for 30 min at room temperature. After another 3 washes, the cells were 173
blocked in PBS containing 5% normal horse serum and 5 µg/ ml DAPI for 5-6 hr at 4°C. 174
Subsequently, cells were washed 4 times, 1:200 rabbit anti-p53 antibody (Santa Cruz cat# sc-175
6243) and 1:100 mouse anti-HA antibody (Roche cat# 11583816001) in PBS containing 5% 176
normal horse serum were added to cover the cells for 8 hr at 4°C. The cells were washed 4 times 177
and incubated with 1:1,000 goat anti-mouse-Alexa Fluor 568 antibody (Invitrogen cat# A11004) 178
and 1:1,000 goat anti-rabbit-Alexa Fluor 488 antibody (Invitrogen cat# A31627) in PBS 179
containing 3% normal horse serum for 1 hr at room temperature. After 4 washes, the slide was 180
briefly dried and 40 µl mounting medium containing DAPI (Vector Laboratories cat# H-1200) 181
was added and covered with a coverslip for imaging with a confocal microscopy. 182
Reverse-transcription Real-time PCR. Cells were reverse-transfected as “Reporter 183
assays”, except that 6-cm dishes were used and all materials were increased by 60-fold. Two 184
days after transfection, total RNA was extracted using an RNeasy mini kit (Qiagen cat# 74106) 185
and treated by DNase for 30 min at 37°C. 0.1 µg total RNA was loaded per reaction. 186
TaqMan® One-Step RT-PCR Master Mix Reagents (Applied Biosystems cat# 4309169) 187
were used for reverse transcription / Real-time PCR on a 7900HT Real-time PCR System 188
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
10
(Applied Biosystems) programmed for 48°C, 30 min; 95°C, 10 min; and 40 cycles of 95°C 15 189
sec, 60°C 1 min. mRNAs levels of β-actin or RPL38 were used as internal control. The ratio of 190
TaqMan primer to probe was fixed at 2:1. The final probe concentration was approximately 191
50~100 nM in a 20-µl reaction volume per well in a 96-well plate. The primer and probe sets 192
were listed as forward, reverse and probe: for p53, 5’-TTTCCGTCTGGGCTTCT-3’, 5’-193
TGGAATCAACCCACAGCT-3’ and 5’-FAM/TGTGACTTGCACGTACTCCCCTG/IBFQ-3’; 194
for p21, 5’-TTCCTGTGGGCGGATTA-3’, 5’-GAGCAGGCTGAAGGGT-3’ and 5’-195
FAM/CGTTTGGAGTGGTAGAAATCTGTCATGC/IBFQ-3’; for Puma, 5’-196
GAGATGGAGCCCAATTAGGTG-3’, 5’-ACATGGTGCAGAGAAAGTCC-3’ and 5’-197
FAM/AGGGTGTCAGGAGGTGGGAGG/IBFQ-3’; for MDM2, 5’-198
TGCCAAGCTTCTCTGTGAAAG-3’, 5’-TCCTTTTGATCACTCCCACC-3’ and 5’-199
FAM/ACCTGAGTCCGATGATTCCTGCTG/IBFQ-3’; for Pirh2, 5’-200
GGTCAAGAGCGAGGTCAG-3’, 5’-CACAAGCGGCAAGTATAAAGC-3’ and 5’-201
FAM/ACAGCAAGGTGCCTTTAGGAGACATC/IBFQ-3’; for PNR, 5’-202
GGGAAGCACTATGGCATCTATG-3’, 5’-CACCTGGCACCTGTAGATG-3’ and 5’-203
FAM/CGCCGTACGCTCCTCTTGAAGAA/IBFQ-3’; for RPL38, 5’-204
GCAGATACCTTTACACCCTGG-3’, 5’-CTGGTTCATTTCAGTTCCTTCAC-3’ and 5’-205
FAM/TGCTTCAGTTTCTCTGCCTTCTCTTTGT/IBFQ-3’; for β-actin, 5’-206
TCACCCACACTGTGCCCATCTACGA-3’, 5’-CAGCGGAACCGCTCATTGCCAATGG-3’ 207
and 5’-FAM/ATGCCCTCCCCCATGCCATCCTGCGT/TAMRA-3’. 208
Protein stability assay. Cells in 6-cm dishes were processed as “Immunoblotting”, 209
except that the indicated plasmids were transfected and cells were treated with 2 µg/ ml 210
cycloheximide (Sigma cat# C4859) for 0, 15, 30 or 60 min before harvested for immunoblotting. 211
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
11
RNA interference. pLKO.1-based shRNA expression plasmids were co-transfected with 212
the indicated plasmids and transfection reagents, which were described in different assays above. 213
Two days after transfection, cells were processed for assays. For each target gene, two shRNA 214
plasmids were validated to efficiently knock down the indicated gene at two different fragments. 215
shRNA expression plasmids targeting p53 (cat# RHS4533), PNR (cat#RHS4533), p300 (cat# 216
RHS4533), GFP (cat# RHS4459) and pLKO.1 empty vector plasmid (cat# RHS4080) were from 217
Open Biosystems. 218
Statistical Analysis. P values were calculated using a paired Student’s t-Tests. 219
220
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
12
RESULTS 221
222
PNR enhances p53 accumulation and selectively activates p53-responsive promoters. We 223
identified PNR as a modulator of p53 in a screen for genes whose expression increased 224
accumulation of a directly assayable p53-luciferase fusion protein in HPV+ HeLa cells (Fig. 1A). 225
To validate PNR’s ability to increase accumulation of a p53-luciferase fusion, we tested PNR’s 226
effect on the level of endogenously expressed p53 in HeLa cells. In untransfected HeLa cells, 227
endogenous p53 was only weakly detectable by immunoblotting, presumably due to HPV E6-228
mediated, proteasome-dependent degradation (Fig. 1B). Transfecting a PNR-expressing plasmid 229
increased the level of endogenous p53 in a dose-dependent fashion by 2- to 3-fold as measured 230
using a quantitative immunoblotting approach (see Materials and methods). 231
Our subsequent studies showed that PNR dose-dependently stimulated expression of the 232
wild type, unfused luciferase gene from a p53-responsive reporter plasmid to over 20-fold higher 233
than an empty vector control in HeLa cells (Fig. 1C). PNR also stimulated expression from this 234
p53-responsive reporter in a HPV- but p53+ human colon carcinoma cancer cell line, RKO (data 235
not shown), showing that PNR stimulation of p53 activity is not restricted to HPV+ cells. To 236
determine if PNR enhances p53 binding to DNA, we used an electrophoretic mobility shift assay 237
with a p53 binding probe and found that nuclear extracts of PNR-transfected HeLa cells had 238
five-fold higher p53-specific DNA binding activity than GFP-transfected control cells (data not 239
shown). This implied that PNR increased p53 levels, p53 DNA binding activity, or both. 240
Next, we examined if PNR could activate endogenous p53 target genes. Four well-241
characterized p53 target genes were selected for study, including p21waf1 and Puma, whose 242
functions are related to cell growth inhibition, and MDM2 and Pirh2, which protect cells from 243
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
13
excessive p53 activation by negative feedback regulation (18). As shown by qRT-PCR, PNR 244
transfection of HeLa cells resulted in dose-dependent increases of p21 and Puma mRNAs, 245
although neither MDM2 nor Pirh2 mRNA levels were changed (Fig. 1E). This selective 246
regulation of p53 target genes by PNR also occurred in an E6¯ but p53+/+ human colon cancer 247
cell line, HCT116 (Fig. 1F). Thus, PNR preferentially up-regulates a subset of p53 target genes. 248
The nature of this selectivity is discussed further below. 249
Since the transfected PNR stimulated a subset of p53-responsive genes, we next 250
examined whether endogenous PNR could modulate p53-responsive promoters. Quantitative RT-251
PCR showed that the low mRNA level of endogenous PNR in HeLa cells was knocked down by 252
~80% using shRNA plasmids against PNR (data not shown). As a positive control, a shRNA 253
against p53 inhibited 80% of luciferase activity from a p53-responsive reporter plasmid (Fig. 1D). 254
shRNAs against PNR inhibited 30~40% of the luciferase activity of the p53-responsive reporter, 255
as compared with an empty shRNA expression vector control (Fig. 1D). We also measured 256
changes in mRNA levels for p53 target genes in HeLa cells when endogenous PNR was knocked 257
down by these two shRNA plasmids. As shown in Fig. 1G, the p21 mRNA level was reduced by 258
up to 65%, while lesser changes were detected in mRNAs levels of MDM2, Puma and Pirh2. To 259
exclude the possibility that PNR stimulation of p53-target genes is HeLa cell specific, 260
endogenous PNR was knocked down in HCT116 cells. Both p53 mRNA and protein levels were 261
significantly decreased and p21 mRNA level was also reduced by ~50% (data not shown). Thus, 262
endogenous PNR regulate p53 level and p53-responsive gene expression in HeLa cells and 263
HCT116 cells, regardless of the presence of E6. 264
PNR stimulation of p53-responsive promoters is p53-dependent. To test whether PNR 265
stimulates p53-responsive promoters in a p53-dependent manner, we used a p53-null human lung 266
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
14
carcinoma cell line, H1299. As expected, exogenous p53 stimulated a p53-responsive luciferase 267
reporter in these p53¯ H1299 cells (Fig. 2A). Moreover, consistent with p53-dependent action, 268
co-transfected PNR enhanced this p53-mediated stimulation, while PNR alone exhibited no 269
effect on the reporter in the absence of transfected p53 (Fig. 2A). To exclude the possibility that 270
unknown factors differentially expressed in H1299 and HeLa cells exhibited nonspecific effects, 271
we further examined the effects of knocking down endogenous p53 in HeLa cells using shRNAs. 272
Quantitative immunoblotting showed that the low protein level of endogenous p53 in HeLa cells 273
was knocked down by 70 ~80% using shRNA plasmids against p53 (Fig. 2B, upper panel). 274
Although p53-dependent luciferase expression was ~10-fold higher with exogenous PNR (0.01 275
µg PNR plasmid, Fig. 1C, 2B lower panel), knocking down p53 inhibited reporter expression by 276
a similar fraction (~5- to 10-fold) in either the presence (Fig. 2B, lower panel) or absence (Fig. 277
1D) of exogenous PNR. This proportional response implies that the dramatic PNR stimulation of 278
the p53-responsive reporter was directly dependent on p53. Consistent with this, shRNAs against 279
p53 also abolished the up-regulation of endogenous p21 transcription in HeLa cells by 280
exogenous PNR (Fig. 2C) and, in the absence of exogenous PNR, suppressed the mRNA levels 281
of p21 and MDM2, with lesser effects on two other p53 target genes, PUMA and Pirh2 (Fig. 1G). 282
Together, these results indicated that PNR alone does not activate p53-responsive promoters; 283
rather, it stimulates p53 target genes in a p53-dependent fashion. 284
To validate further that PNR specifically activates p53-responsive promoters, we mutated 285
key CxxG elements in the two p53-responsive elements in the luciferase reporter plasmid to 286
AxxT, thus suppressing p53 binding (7). As expected, transfecting PNR did not stimulate 287
expression from this mutated reporter plasmid in HeLa cells, demonstrating that PNR stimulation 288
requires the known p53-responsive elements (Fig. 2D). Finally, we examined a p53 dominant-289
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
15
negative mutant p53C135Y, which sequesters wild type p53 into a DNA binding-deficient 290
heterotetramer (6). This mutant was co-transfected with PNR and the p53-responsive reporter 291
into HeLa cells that express endogenous, wild type p53. PNR’s ability to stimulate p53 292
transactivation was abrogated by the co-transfected p53C135Y (Fig. 2E). Together, our data 293
implied that de novo p53 binding to its responsive DNA elements is required for PNR-mediated 294
stimulation of p53 transactivation. 295
PNR stimulates apoptosis in multiple cell lines. Since p53 activation results in tumor 296
inhibition via induction of apoptosis or cell cycle arrest (8), we tested whether transfecting PNR 297
potentiates p53-mediated growth inhibition in HeLa cells. To elucidate if PNR enhances 298
apoptosis, we monitored cell surface exposure of phosphatidylserine, a marker of cells in early 299
stage apoptosis (17). Two days after transfection, we used flow cytometry to measure the 300
percentage of HeLa cells labeled by phosphatidylserine binding protein annexin V. As a positive 301
control, we used Pitx2a, which, in HPV+ HeLa cells, reactivates p53 and induces apoptosis by 302
binding to HPV oncoprotein E6 (50). As expected, Pitx2a induced apoptosis by ~5- to 6-fold as 303
compared with an empty vector control (Fig. 3A). Similarly, PNR induced apoptosis in a dose 304
dependent fashion by up to ~4-to 5-fold. When p53 was knocked down by shRNA, the PNR-305
mediated induction of cell apoptosis was drastically attenuated, implying that p53 may contribute 306
to PNR-induced HeLa cell apoptosis (Fig. 3B). In addition to HPV+ HeLa cells, we found that 307
PNR transfection similarly induced apoptosis in HPV¯ but p53+ RKO cells (data not shown). 308
In addition to its effects on p53, PNR can inhibit cell proliferation by repressing 309
transcription of tumor-supporting genes including cyclin D1 and TBX2 (40). To test the degree 310
to which PNR stimulation of apoptosis was independent or dependent of p53, we examined the 311
effect of PNR on apoptosis in two isogenic HCT116 cell lines that either contained two wild type 312
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
16
p53 alleles or none (4) (Fig. 3C). To measure apoptosis frequencies in these cells, we used FACS 313
to assay annexin V binding (Fig. 3D) and also the fraction of cells with reduced (“sub-G1”) DNA 314
content (Fig. 3E), associated with the characteristic partial loss of DNA fragmented in apoptosis 315
(16, 44). For HeLa cells, the sub-G1 DNA content assay confirmed that PNR stimulated the 316
fraction of apoptotic cells (Fig. 3E), consistent with prior annexin V binding results (Fig. 3A). 317
For the isogenic HCT116 cell lines, PNR increased the fraction of apoptotic cells in both cell 318
lines ~2-fold by the annexin V binding assay (Fig. 3D), while ~6-fold and ~3-fold increases in 319
p53+/+ and p53¯/¯ HCT116 cell apoptosis were measured by the sub-G1 DNA content assay (Fig. 320
3E). Thus, PNR can induce apoptosis in the absence of p53, but under at least some 321
circumstances p53 also appears to enhance the PNR-induced cell apoptosis. 322
PNR modulates p53 at a posttranslational level. PNR increased the accumulation of 323
p53 protein (Fig. 1A and B). In contrast, using qRT-PCR, we found that expressing exogenous 324
PNR did not increase the level of p53 mRNA (Fig. 4A). Next we tested whether PNR increased 325
p53 protein stability. HeLa cells were treated with 2 µg/ml of cycloheximide to block de novo 326
protein synthesis. After 15, 30, and 60 min of incubation with cycloheximide, cells were 327
harvested and p53 protein levels were measured by immunoblotting. As compared with the GFP 328
transfection control, transfecting PNR increased the half-life of p53 from 7 min or less to 15 min 329
(Fig. 4B). 330
The results above showed that PNR stimulates both p53 transactivation and accumulation. 331
It remained unclear whether the stimulation of p53 transactivation exclusively resulted from 332
enhanced p53 accumulation. Increasing amounts of a p53-expressing plasmid were co-333
transfected with a constant amount of the p53-responsive luciferase reporter into HeLa cells, and 334
p53 protein levels were quantitatively measured by immunoblotting (Fig. 4C, upper panel). The 335
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
17
plot in Fig. 4C (middle panel) revealed a linear relationship between the amount of p53 336
expressing plasmid transfected and the p53 protein signal intensity in the immunoblot, 337
confirming that p53 protein can be quantitated by immunoblotting in this tested range. 338
Simultaneously, we measured the luciferase activity expressed from the p53-responsive reporter 339
(Fig. 4C, lower panel) in the same cells. We found that 0.6 µg of PNR plasmid increased the 340
level of p53 protein by 2-fold (Fig. 4C upper panel, lanes 1-2), but activated p53-dependent 341
transcriptional activity by 24-fold (Fig. 4C lower panel, lanes 1-2), as compared with an empty 342
vector control. For comparison, 0.02 µg of a p53 expressing plasmid increased the p53 343
transactivation signal of the reporter plasmid by a similar 22-fold, while increasing the p53 344
protein level by 6-fold (Fig. 4C upper panel, lanes 1 and 5). These results suggest that the high 345
level of transactivation by p53 in the presence of PNR may not be attributable solely to increased 346
p53 protein accumulation. In addition, the results suggest that PNR stimulates the specific 347
transcriptional activity of p53 by about 3-fold under these conditions. Thus, PNR may affect p53 348
transactivation by modulating p53 at two posttranslational levels: protein stability and specific 349
transcriptional activity per molecule of p53. 350
PNR acts largely by stimulating p53 acetylation. Acetylation is a major mode of p53 351
posttranslational regulation that enhances p53 protein stability, DNA binding, transcriptional 352
activity, and apoptosis induction (22, 24, 45), all of which resemble the phenotypes that we 353
observed for PNR in HeLa cells. Thus, we examined if PNR could regulate p53 acetylation, 354
using immunoblotting with an antibody specifically recognizing p53 acetylation at K373 and 355
K382. As shown in Fig. 5A, PNR significantly increased p53 acetylation and, consistent with 356
previous data (Fig. 1B and 4B), increased the level of total p53 protein. After normalizing 357
acetylated p53 to total p53 using quantitative immunoblotting, PNR stimulated p53 acetylation at 358
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
18
K373+382 by ~6 fold under these experimental conditions. Site-specific p53 acetylation at K382 359
and other lysines, including K320 by acetyltransferase PCAF and K120 by acetyltransferases 360
Tip60/hMOF (18), were examined by immunoblotting using appropriate specific antibodies. 361
Notably, PNR stimulated p53 acetylation at K320 and K382 but not at K120 (Fig. 5A). Thus, 362
PNR preferentially stimulates acetylation of p53 at certain lysines, possibly through selective 363
interactions with relevant site-specific acetyltransferases. 364
Next we tested whether reversing PNR-mediated p53 acetylation was sufficient to inhibit 365
PNR-mediated p53 transactivation and accumulation. SIRT1 is a well-characterized p53 366
deacetylase (25, 48). Co-expressing SIRT1 with PNR in HeLa cells significantly inhibited PNR-367
mediated p53 acetylation at multiple sites except K120 in a dose-dependent manner (Fig. 5B). 368
SIRT1 also inhibited PNR stimulation of total p53 accumulation, implying that PNR’s 369
enhancement of p53 accumulation results from stimulating p53 acetylation. Consistent with our 370
results on p21 mRNA level (Fig. 1E), PNR significantly enhanced endogenous p21 protein levels 371
(Fig. 5B, samples 1-2). However, co-expressing SIRT1 also abolished this enhancement (Fig. 5B, 372
samples 3-4). Simultaneously, co-expressing SIRT1 with PNR reversed the PNR-mediated 373
stimulation of p53 transactivation in a dose-dependent fashion (Fig. 5C), implying that PNR 374
stimulates p53 transactivation primarily through stimulating p53 acetylation. From these results, 375
we concluded that PNR-mediated stimulation of p53 acetylation is responsible for the PNR-376
mediated stimulation of p53 transactivation and accumulation. 377
p53 acetylation is essential for activating a subset of p53 target genes, but dispensable for 378
activating some other p53 target genes (18). Our tests of PNR’s effects on four selected p53 379
target genes matched the previously identified effects of p53 acetylation by up-regulating p21 380
and Puma mRNAs but inducing no change in MDM2 and Pirh2 mRNA levels (Fig. 1E and F). 381
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
19
These gene-specific differential effects notably extend the correlation between the effects of 382
PNR and those of p53 acetylation in HeLa cells. 383
PNR complexes with and enhances interaction between p300 and p53. To dissect the 384
mechanism of PNR-induced p53 acetylation, we focused on the interaction between p53 and 385
p300, a major p53 acetyltransferase. shRNAs against p300 mildly decreased the level of 386
endogenous p300 protein by less than 40% while inhibiting PNR-stimulated p53 transactivation 387
by 60% to 70% (Fig. 6A). Simultaneously, knocking down p300 also significantly repressed the 388
PNR-mediated stimulation of p53 acetylation and accumulation (Fig. 6B). These data suggested 389
that p300 is involved in the PNR-mediated stimulation of p53 acetylation. 390
The “LxxLL” motif is a common binding site for nuclear receptors like PNR (27). We 391
found one “LxxLL” motif in p53 (aa 22-26) at the N-terminus and two in p300 (aa 81-85 at the 392
N-terminus and aa 2051-2055 at the C-terminus). Thus, we tested whether PNR, p300 and p53 393
could complex with each other. First, we co-transfected HA-tagged PNR, p300 and p53 into 394
HeLa cells. Anti-p300 and anti-p53 antibodies successfully precipitated p300 and p53, 395
respectively (Fig. 7A). HA-PNR was detected by an anti-HA antibody in the immunoprecipitates 396
by the anti-p300 and anti-p53 antibodies, while the control IgGs failed to co-immunoprecipitate 397
HA-PNR. Simultaneously, an anti-HA antibody successfully immunoprecipitated HA-PNR 398
while the control IgGs did not (Fig. 7B). p53 was detected specifically in the immunoprecipitate 399
by the anti-HA antibody. We did not detect a clear band of p300 in the immunoprecipitate 400
product by the anti-HA antibody, although the reverse co-immunoprecipitation of PNR by the 401
anti-p300 antibody strongly suggested that p300 may interact with PNR. In addition, we found 402
by immunofluorescence in HeLa cells that transfected PNR and p53 both located inside nuclei 403
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
20
and partially overlapped (Fig. 7C and D). Thus, in combination, these results showed that, in 404
HeLa cells, PNR and p53 form a complex in which p300 is likely incorporated. 405
In general, increased interaction between p53 and its p300 acetyltransferase would be 406
expected to be associated with increased p53 acetylation. We therefore immunoprecipitated p300 407
from the whole cell lysate with or without PNR transfection and then measured p53 protein 408
levels in these immunoprecipitates using quantitative immunoblotting. As expected, more p53 409
was detected in the whole cell lysate with PNR transfection (Fig. 8A). Similarly, more p53 was 410
detected in anti-p300 immunoprecipitates from PNR-transfected cells than control cells. After 411
normalizing p53 levels in each immunoprecipitate to that in the corresponding whole cell lysate, 412
we found that PNR stimulates p300-p53 association by ~2- to 3-fold under these conditions. 413
Simultaneously, we found that PNR significantly increased acetylated p53 levels in the anti-p300 414
immunoprecipitates (Fig. 8A). These results implied that PNR enhances p53 acetylation by 415
promoting the intermolecular interaction between p53 and p300. 416
PNR boosts actinomycin D-stimulated association between p53 and p300. Wild type 417
p53 usually is in a quiescent state in cells until activated by various DNA damage stresses. 418
Actinomycin D is an anti-neoplastic, genotoxic agent that forms a stable complex with DNA, 419
stimulates p53 acetylation at K305 and K382, and induces cell apoptosis (49). We tested whether 420
actinomycin D treatment of HeLa cells could enhance the association between p53 and p300. 421
One day after co-transfecting the indicated plasmids (Fig. 8B), HeLa cells were treated with 10 422
nM actinomycin D for another 24 hrs before being lysed for immunoprecipitation with anti-p300 423
antibody as above. As shown in Fig. 8B, lanes 1-2, actinomycin D somewhat increased 424
accumulation in the cell lysate of both total p53 and p53 acetylated at K320 and K373+382. 425
Although the signal was relatively weak in the absence of added PNR, close inspection showed 426
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
21
that the co-immunoprecipitation of total and acetylated p53 with p300 also was enhanced (Fig. 427
8B, lanes 5-6). Expressing exogenous PNR boosted all of these signals, further revealing that 428
actinomycin D stimulated both the overall accumulation (Fig. 8B, lanes 2 and 4) and the co-429
immunoprecipitation with p300 of total and acetylated p53 (Fig. 8B, lanes 6 and 8). Thus, PNR 430
synergized with actinomycin D to jointly stimulate p53 acetylation and interaction with p300.431
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
22
DISCUSSION 432
p53, which plays crucial roles in regulating cell cycle arrest, apoptosis, and senescence, is 433
regulated by a variety of posttranslational modifications including ubiquitination, 434
phosphorylation, methylation and acetylation (45). p53 acetylation at multiple sites in its DNA 435
binding domain and C-terminal regulatory domain modulate p53’s stability, DNA binding, 436
coactivator interactions, and is essential for p53-activated transcription of a subset of p53 target 437
genes, including p21 and other genes associated with cell cycle arrest and apoptosis (25, 41, 45). 438
Acetylation is also crucial for p53’s transcription-independent pre-apoptotic functions (52). Thus, 439
stimulating p53 acetylation is a potentially valuable target for restoring normal p53 functions in 440
cell growth arrest and apoptosis in cancer cells. 441
Here, we reported the unexpected finding that orphan nuclear receptor PNR serves as a 442
positive regulator of p53 acetylation and activity. Building on our identification of PNR as a p53 443
activator in a high throughput genetic screen, we demonstrated that PNR is specifically engaged 444
in enhancing acetylation of p53 and thus potentiating acetylated p53 functions such as apoptosis 445
(Fig. 3). Expressing PNR enhanced formation of a complex between p53 and the 446
acetyltransferase p300 (Fig. 7), resulting in increased p53 acetylation (Fig. 5A). Coordinately, 447
PNR stimulated p53 transcriptional activity and stability (Fig. 1C and 4B). In agreement with the 448
finding that p53 acetylation is required for transcriptional regulation of a subset of genes (18, 45), 449
we further found that PNR selectively up-regulated expression of acetylated p53-dependent 450
genes p21 and Puma, but not acetylation-independent p53 target genes MDM2 and Pirh2 (Fig. 451
1E and F). Together, our results demonstrate that PNR regulates p53 functions by stimulating 452
p53 acetylation. 453
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
23
Although prior work has documented other regulatory interactions between nuclear 454
receptors and p53, the regulation of p53 acetylation by a non-acetyltransferase nuclear receptor is 455
unprecedented. In contrast, estrogen receptor α, another nuclear receptor, interacts with p53, 456
binds with p53 to p53 response elements in the promoters of p53 target genes, and inhibits p53-457
mediated transactivation and transrepression (23, 37). Orphan nuclear receptor Coup-TF II 458
stimulates transcription of p53 and p53-responsive reporter genes (14), and is down-regulated in 459
concert with the p53 target gene p21 in multiple breast cancer cell lines (29). Coup-TF I, a 460
cousin of Coup-TFII, stimulates transcription of MDM2, an essential E3 ligase for p53 461
degradation (33). Conversely, p53 regulates transcription of nuclear receptors HNF4A and TR2 462
(26, 28). Accordingly, our finding that PNR potentiates p53 acetylation and related acetylated 463
p53 functions provides a novel link between orphan nuclear receptors and p53. Notably, our 464
preliminary results further show that other members of nuclear receptor subfamily 2, which 465
includes PNR, also stimulate p53 activity through acetylation (unpublished data). Thus, 466
regulating p53 functions by enhancing p53 acetylation may be a general paradigm shared by 467
nuclear receptor subfamily 2 members. This finding has therapeutic implications since several 468
PNR subfamily orphan receptors have broad tissue distribution and are aberrantly expressed in 469
cancers (19, 30, 34, 43, 53). 470
One attractive set of targets for PNR-based therapeutic approaches are the cancers caused 471
by human papillomaviruses (HPVs). Most such HPV-linked cancers retain a wild type p53 gene, 472
but p53 accumulation and functions are down-regulated posttranslationally by multiple actions of 473
HPV oncogene E6 (38, 39, 46). Thus, approaches that stimulate p53 stability and function by 474
PNR or related nuclear receptors could be undertaken to control HPV-associated malignancies, 475
either alone or in conjunction with E6 inhibitors. Moreover, since we find that PNR stimulation 476
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
24
of p53 activity is not limited to HPV+ cells (Fig. 2A and unpublished data), PNR and related 477
nuclear receptors should be valuable for other HPV– cancers that retain functional p53 genes. 478
Furthermore, the benefits of PNR-based cancer therapies may extend beyond activating p53, 479
since, in addition to affecting p53+ cells, we find that PNR also induces apoptosis of p53¯/¯ 480
HCT116 cells (Fig. 3D-E). Similarly, prior work has shown that PNR has intrinsic tumor 481
suppression activities by binding and repressing the promoters of cyclin D1 (42) and another cell 482
cycle regulator, TBX2 (1, 42). 483
PNR is an orphan nuclear receptor whose natural ligand(s) remain to be identified. 484
However, compounds with a 2-phenylbenzimidazole core have been found to be potent agonists 485
of PNR (51). Thus, natural or artificial ligands for PNR, and perhaps for other subfamily 2 486
nuclear receptors, may stimulate p53 acetylation and induce cell apoptosis and thus have 487
therapeutic potential to be developed into anti-cancer drugs. In addition, the novel functional link 488
between p53 and PNR also makes it intriguing to explore the possible roles of p53 in retinal 489
diseases linked to PNR mutations, including enhanced s-cone syndrome, Leber’s congenital 490
amaurosis (LCA), retinitis pigmentosa, macular degeneration, etc. (11, 40). 491
492
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
25
ACKNOWLEDGEMENTS 493
494
This work was supported by the NIH through grants CA-22443 and CA-125387. P.A. is 495
an investigator of the Howard Hughes Medical Institute. 496
We thank Drs. Bill Sugden, Norman Drinkwater, Paul Friesen, Elaine Alarid, Shannon 497
Kenny, Robert Kalejta, Linhui Hao, James Bruce and Shouhong Guang for valuable advice, and 498
Drs. Shiming Chen, Qize Wei, Ann Palmenberg, Arthur Polans, William See, Saraswati 499
Sukumar and Bert Vogelstein for generously sharing reagents and materials. We also thank 500
Kathleen Schell (UW Carbone Cancer Center Flow Cytometry Facility) and Lance Rodenkirch 501
(UW Keck Laboratory for Biological Imaging) for helpful suggestions. 502
503
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
26
REFERENCES 504
1. Abrahams, A., M. I. Parker, and S. Prince. 2010. The T-box transcription factor Tbx2: its role 505 in development and possible implication in cancer. IUBMB Life 62:92-102. 506
2. Banin, S., L. Moyal, S. Shieh, Y. Taya, C. W. Anderson, L. Chessa, N. I. Smorodinsky, C. 507 Prives, Y. Reiss, Y. Shiloh, and Y. Ziv. 1998. Enhanced phosphorylation of p53 by ATM in 508 response to DNA damage. Science 281:1674-7. 509
3. Brooks, C. L., and W. Gu. 2003. Ubiquitination, phosphorylation and acetylation: the molecular 510 basis for p53 regulation. Curr Opin Cell Biol 15:164-71. 511
4. Bunz, F., A. Dutriaux, C. Lengauer, T. Waldman, S. Zhou, J. P. Brown, J. M. Sedivy, K. W. 512 Kinzler, and B. Vogelstein. 1998. Requirement for p53 and p21 to sustain G2 arrest after DNA 513 damage. Science 282:1497-501. 514
5. Choi, M. Y., A. I. Romer, M. Hu, M. Lepourcelet, A. Mechoor, A. Yesilaltay, M. Krieger, P. 515 A. Gray, and R. A. Shivdasani. 2006. A dynamic expression survey identifies transcription 516 factors relevant in mouse digestive tract development. Development 133:4119-29. 517
6. Clontech, I. 2008. Protocol NO. PT3348-5,. Version NO. PR842524. 518 7. el-Deiry, W. S., S. E. Kern, J. A. Pietenpol, K. W. Kinzler, and B. Vogelstein. 1992. 519
Definition of a consensus binding site for p53. Nat Genet 1:45-9. 520 8. Fojo, T. 2002. p53 as a therapeutic target: unresolved issues on the road to cancer therapy 521
targeting mutant p53. Drug Resist Updat 5:209-16. 522 9. Gillison, M. L., and D. R. Lowy. 2004. A causal role for human papillomavirus in head and 523
neck cancer. Lancet 363:1488-9. 524 10. Gu, W., and R. G. Roeder. 1997. Activation of p53 sequence-specific DNA binding by 525
acetylation of the p53 C-terminal domain. Cell 90:595-606. 526 11. Haider, N. B., S. G. Jacobson, A. V. Cideciyan, R. Swiderski, L. M. Streb, C. Searby, G. 527
Beck, R. Hockey, D. B. Hanna, S. Gorman, D. Duhl, R. Carmi, J. Bennett, R. G. Weleber, G. 528 A. Fishman, A. F. Wright, E. M. Stone, and V. C. Sheffield. 2000. Mutation of a nuclear 529 receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nat 530 Genet 24:127-31. 531
12. Haupt, Y., R. Maya, A. Kazaz, and M. Oren. 1997. Mdm2 promotes the rapid degradation of 532 p53. Nature 387:296-9. 533
13. Honda, R., H. Tanaka, and H. Yasuda. 1997. Oncoprotein MDM2 is a ubiquitin ligase E3 for 534 tumor suppressor p53. FEBS Lett 420:25-7. 535
14. Huang, Q., A. Raya, P. DeJesus, S. H. Chao, K. C. Quon, J. S. Caldwell, S. K. Chanda, J. C. 536 Izpisua-Belmonte, and P. G. Schultz. 2004. Identification of p53 regulators by genome-wide 537 functional analysis. Proc Natl Acad Sci U S A 101:3456-61. 538
15. Jiang, M., and J. Milner. 2002. Selective silencing of viral gene expression in HPV-positive 539 human cervical carcinoma cells treated with siRNA, a primer of RNA interference. Oncogene 540 21:6041-8. 541
16. Kajstura, M., H. D. Halicka, J. Pryjma, and Z. Darzynkiewicz. 2007. Discontinuous 542 fragmentation of nuclear DNA during apoptosis revealed by discrete "sub-G1" peaks on DNA 543 content histograms. Cytometry A 71:125-31. 544
17. Koopman, G., C. P. Reutelingsperger, G. A. Kuijten, R. M. Keehnen, S. T. Pals, and M. H. 545 van Oers. 1994. Annexin V for flow cytometric detection of phosphatidylserine expression on B 546 cells undergoing apoptosis. Blood 84:1415-20. 547
18. Kruse, J. P., and W. Gu. 2009. Modes of p53 regulation. Cell 137:609-22. 548 19. Lee, Y. F., H. J. Lee, and C. Chang. 2002. Recent advances in the TR2 and TR4 orphan 549
receptors of the nuclear receptor superfamily. J Steroid Biochem Mol Biol 81:291-308. 550 20. Li, M., C. L. Brooks, F. Wu-Baer, D. Chen, R. Baer, and W. Gu. 2003. Mono- versus 551
polyubiquitination: differential control of p53 fate by Mdm2. Science 302:1972-5. 552
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
27
21. Li, M., D. Chen, A. Shiloh, J. Luo, A. Y. Nikolaev, J. Qin, and W. Gu. 2002. Deubiquitination 553 of p53 by HAUSP is an important pathway for p53 stabilization. Nature 416:648-53. 554
22. Li, M., J. Luo, C. L. Brooks, and W. Gu. 2002. Acetylation of p53 inhibits its ubiquitination by 555 Mdm2. J Biol Chem 277:50607-11. 556
23. Liu, W., S. D. Konduri, S. Bansal, B. K. Nayak, S. A. Rajasekaran, S. M. Karuppayil, A. K. 557 Rajasekaran, and G. M. Das. 2006. Estrogen receptor-alpha binds p53 tumor suppressor protein 558 directly and represses its function. J Biol Chem 281:9837-40. 559
24. Luo, J., M. Li, Y. Tang, M. Laszkowska, R. G. Roeder, and W. Gu. 2004. Acetylation of p53 560 augments its site-specific DNA binding both in vitro and in vivo. Proc Natl Acad Sci U S A 561 101:2259-64. 562
25. Luo, J., A. Y. Nikolaev, S. Imai, D. Chen, F. Su, A. Shiloh, L. Guarente, and W. Gu. 2001. 563 Negative control of p53 by Sir2alpha promotes cell survival under stress. Cell 107:137-48. 564
26. Maeda, Y., W. W. Hwang-Verslues, G. Wei, T. Fukazawa, M. L. Durbin, L. B. Owen, X. 565 Liu, and F. M. Sladek. 2006. Tumour suppressor p53 down-regulates the expression of the 566 human hepatocyte nuclear factor 4alpha (HNF4alpha) gene. Biochem J 400:303-13. 567
27. McInerney, E. M., D. W. Rose, S. E. Flynn, S. Westin, T. M. Mullen, A. Krones, J. Inostroza, 568 J. Torchia, R. T. Nolte, N. Assa-Munt, M. V. Milburn, C. K. Glass, and M. G. Rosenfeld. 569 1998. Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional 570 activation. Genes Dev 12:3357-68. 571
28. Mu, X., Y. Liu, L. L. Collins, E. Kim, and C. Chang. 2000. The p53/retinoblastoma-mediated 572 repression of testicular orphan receptor-2 in the rhesus monkey with cryptorchidism. J Biol Chem 573 275:23877-83. 574
29. Nakshatri, H., M. S. Mendonca, P. Bhat-Nakshatri, N. M. Patel, R. J. Goulet, Jr., and K. 575 Cornetta. 2000. The orphan receptor COUP-TFII regulates G2/M progression of breast cancer 576 cells by modulating the expression/activity of p21(WAF1/CIP1), cyclin D1, and cdk2. Biochem 577 Biophys Res Commun 270:1144-53. 578
30. Nishimura, M., S. Naito, and T. Yokoi. 2004. Tissue-specific mRNA expression profiles of 579 human nuclear receptor subfamilies. Drug Metab Pharmacokinet 19:135-49. 580
31. Peng, G. H., O. Ahmad, F. Ahmad, J. Liu, and S. Chen. 2005. The photoreceptor-specific 581 nuclear receptor Nr2e3 interacts with Crx and exerts opposing effects on the transcription of rod 582 versus cone genes. Hum Mol Genet 14:747-64. 583
32. Pyeon, D., S. M. Pearce, S. M. Lank, P. Ahlquist, and P. F. Lambert. 2009. Establishment of 584 human papillomavirus infection requires cell cycle progression. PLoS Pathog 5:e1000318. 585
33. Qi, J. S., Y. Yuan, V. Desai-Yajnik, and H. H. Samuels. 1999. Regulation of the mdm2 586 oncogene by thyroid hormone receptor. Mol Cell Biol 19:864-72. 587
34. Qin, J., X. Chen, L. Y. Yu-Lee, M. J. Tsai, and S. Y. Tsai. 2010. Nuclear receptor COUP-TFII 588 controls pancreatic islet tumor angiogenesis by regulating vascular endothelial growth 589 factor/vascular endothelial growth factor receptor-2 signaling. Cancer Res 70:8812-21. 590
35. Raman, V., S. A. Martensen, D. Reisman, E. Evron, W. F. Odenwald, E. Jaffee, J. Marks, 591 and S. Sukumar. 2000. Compromised HOXA5 function can limit p53 expression in human 592 breast tumours. Nature 405:974-8. 593
36. Reisman, D., and W. T. Loging. 1998. Transcriptional regulation of the p53 tumor suppressor 594 gene. Semin Cancer Biol 8:317-24. 595
37. Sayeed, A., S. D. Konduri, W. Liu, S. Bansal, F. Li, and G. M. Das. 2007. Estrogen receptor 596 alpha inhibits p53-mediated transcriptional repression: implications for the regulation of 597 apoptosis. Cancer Res 67:7746-55. 598
38. Scheffner, M., J. M. Huibregtse, R. D. Vierstra, and P. M. Howley. 1993. The HPV-16 E6 599 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 600 75:495-505. 601
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
28
39. Scheffner, M., B. A. Werness, J. M. Huibregtse, A. J. Levine, and P. M. Howley. 1990. The 602 E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of 603 p53. Cell 63:1129-36. 604
40. Swaroop, A., D. Kim, and D. Forrest. 2010. Transcriptional regulation of photoreceptor 605 development and homeostasis in the mammalian retina. Nat Rev Neurosci 11:563-76. 606
41. Sykes, S. M., H. S. Mellert, M. A. Holbert, K. Li, R. Marmorstein, W. S. Lane, and S. B. 607 McMahon. 2006. Acetylation of the p53 DNA-binding domain regulates apoptosis induction. 608 Mol Cell 24:841-51. 609
42. Takezawa, S., A. Yokoyama, M. Okada, R. Fujiki, A. Iriyama, Y. Yanagi, H. Ito, I. Takada, 610 M. Kishimoto, A. Miyajima, K. Takeyama, K. Umesono, H. Kitagawa, and S. Kato. 2007. A 611 cell cycle-dependent co-repressor mediates photoreceptor cell-specific nuclear receptor function. 612 Embo J 26:764-74. 613
43. Tanaka, T., and L. M. De Luca. 2009. Therapeutic potential of "rexinoids" in cancer prevention 614 and treatment. Cancer Res 69:4945-7. 615
44. Tang, Y., J. Luo, W. Zhang, and W. Gu. 2006. Tip60-dependent acetylation of p53 modulates 616 the decision between cell-cycle arrest and apoptosis. Mol Cell 24:827-39. 617
45. Tang, Y., W. Zhao, Y. Chen, Y. Zhao, and W. Gu. 2008. Acetylation is indispensable for p53 618 activation. Cell 133:612-26. 619
46. Thomas, M. C., and C. M. Chiang. 2005. E6 oncoprotein represses p53-dependent gene 620 activation via inhibition of protein acetylation independently of inducing p53 degradation. Mol 621 Cell 17:251-64. 622
47. Vassilev, L. T., B. T. Vu, B. Graves, D. Carvajal, F. Podlaski, Z. Filipovic, N. Kong, U. 623 Kammlott, C. Lukacs, C. Klein, N. Fotouhi, and E. A. Liu. 2004. In vivo activation of the p53 624 pathway by small-molecule antagonists of MDM2. Science 303:844-8. 625
48. Vaziri, H., S. K. Dessain, E. Ng Eaton, S. I. Imai, R. A. Frye, T. K. Pandita, L. Guarente, 626 and R. A. Weinberg. 2001. hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. 627 Cell 107:149-59. 628
49. Wang, Y. H., Y. G. Tsay, B. C. Tan, W. Y. Lo, and S. C. Lee. 2003. Identification and 629 characterization of a novel p300-mediated p53 acetylation site, lysine 305. J Biol Chem 630 278:25568-76. 631
50. Wei, Q. 2005. Pitx2a binds to human papillomavirus type 18 E6 protein and inhibits E6-mediated 632 P53 degradation in HeLa cells. J Biol Chem 280:37790-7. 633
51. Wolkenberg, S. E., Z. Zhao, M. Kapitskaya, A. L. Webber, K. Petrukhin, Y. S. Tang, D. C. 634 Dean, G. D. Hartman, and C. W. Lindsley. 2006. Identification of potent agonists of 635 photoreceptor-specific nuclear receptor (NR2E3) and preparation of a radioligand. Bioorg Med 636 Chem Lett 16:5001-4. 637
52. Yamaguchi, H., N. T. Woods, L. G. Piluso, H. H. Lee, J. Chen, K. N. Bhalla, A. Monteiro, X. 638 Liu, M. C. Hung, and H. G. Wang. 2009. p53 acetylation is crucial for its transcription-639 independent proapoptotic functions. J Biol Chem 284:11171-83. 640
53. Yu, X., and J. E. Mertz. 2003. Distinct modes of regulation of transcription of hepatitis B virus 641 by the nuclear receptors HNF4alpha and COUP-TF1. J Virol 77:2489-99. 642
54. Zimmermann, H., R. Degenkolbe, H. U. Bernard, and M. J. O'Connor. 1999. The human 643 papillomavirus type 16 E6 oncoprotein can down-regulate p53 activity by targeting the 644 transcriptional coactivator CBP/p300. J Virol 73:6209-19. 645
646
647
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
29
FIGURE LEGENDS 648
649
FIG. 1. PNR enhances accumulation of p53 protein in HeLa cells and selectively 650
stimulates p53-responsive promoters in both HeLa cells and HCT116 cells. (A) PNR 651
increases a p53 and Firefly Luciferase fusion protein (p53/FLuc) in a dose-dependent fashion in 652
HeLa cells. A p53/FLuc-IRES-RLuc reporter plasmid expressing the p53/FLuc fusion protein 653
and Renilla Luciferase as internal control was co-transfected with the indicated amounts of PNR 654
expression plasmid into HeLa cells in a 96-well plate. Two days after transfection, the luciferases 655
activities were assayed. RLU: relative luciferase activity. FLuc: Firefly Luciferase; IRES: 656
Internal Ribosome Entry Site; RLuc: Renilla Luciferase. (B) PNR enhances accumulation of 657
endogenous p53 in HeLa cells. p53 levels were measured by immunoblotting 2 days after 658
transfecting PNR expression plasmid into HeLa cells in 6-cm dishes. The ratio of p53 signal 659
relative to β-actin signal in the sample with 0 μg PNR was normalized to 1. * p (one tail) < 0.05. 660
(C) PNR stimulates p53RE-FLuc, a p53-responsive Firefly Luciferase reporter plasmid, in a 661
dose-dependent fashion in HeLa cells. Cells were co-transfected with the indicated amounts of a 662
PNR expression plasmid and other plasmids in a 96-well plate. Two days later, the luciferases 663
activities were assayed and normalized to the level in the sample with 0 μg PNR. (D) 664
Endogenous PNR contributes to p53 response in HeLa cells. Cells in a 96-well plate were co-665
transfected with 0.02 µg p53RE-FLuc and the indicated shRNA expression plasmids targeting 666
p53 and PNR, respectively. shRNA-Con was a pLKO.1 empty lentiviral control. The FLuc 667
activity in the sample with shRNA-Con was normalized to 100%. * p (two tails) < 0.05. (E), (F) 668
and (G) PNR selectively stimulates p53 target genes in HeLa cells and p53 +/+ HCT116 cells. 669
Cells were transfected with the indicated amounts of the PNR expression plasmid (E and F) or 670
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
30
shRNA expression plasmids (G) in 6-cm dishes. Two days later, mRNAs levels of the indicated 671
p53 target genes were measured by qRT-PCR and normalized to β-actin or RPL38 mRNA level. 672
For each gene, the mRNA level in the sample with 0 μg PNR (E and F) or shRNA-GFP (G) was 673
normalized to 1. (E) PNR overexpression in HeLa cells. (F) PNR overexpression in HCT116 674
cells. (G) Knock-down of endogenous PNR in HeLa cells. sample 1: shRNA-GFP; sample 2: 675
shRNA-PNR-A; sample 3: shRNA-PNR-B; sample 4: shRNA-p53. 676
FIG. 2. PNR-mediated stimulation of p53-responsive promoters requires p53. (A) In 677
p53-null H1299 cells, PNR alone fails to stimulate p53RE-FLuc whereas PNR does in the 678
presence of exogenous p53. RLU in the sample with 0 μg p53 and PNR was normalized to 1. (B) 679
shRNAs targeting p53 abolish PNR-mediated stimulation of p53RE-FLuc in HeLa cells. shRNA-680
GFP expressed shRNA targeting GFP as a control. RLU in the sample with both shRNA-GFP 681
and PNR was normalized to 100%. Upper panel: immunoblot showing β-actin loading control 682
and shRNA-mediated reduction in p53 protein accumulation. The numbers below each band 683
report the level of p53 protein normalized to β-actin and to the p53 level in sample 1; Lower 684
panel: reporter assay. (C) shRNAs targeting p53 significantly inhibit PNR-mediated increase of 685
p21 mRNA in HeLa cells. p21 mRNA level was measured by qRT-PCR normalized to the 686
sample with only shRNA-GFP transfected. (D) Mutation of p53-responsive elements abrogates 687
PNR-mediated stimulation of MT-p53-RE-FLuc in HeLa cells. RLU in the sample only with 688
p53RE-FLuc was normalized to 1. (E) Dominant negative mutant p53-C135Y abrogates the 689
PNR-mediated stimulation of p53RE-FLuc in HeLa cells. RLU in the sample only with p53RE-690
FLuc was normalized to 1. 691
FIG. 3. p53 enhances PNR-induced cell apoptosis. (A) PNR induces HeLa cell 692
apoptosis in a dose-dependent fashion. Two days after transfection, an Annexin V binding assay 693
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
31
was used to quantitate apoptotic cells by flow cytometry. Pitx2a was used as a positive control 694
(Wei, 2005). The fraction of apoptotic cells in sample with 0 μg PNR was normalized to 1. The 695
data from three repeats was plotted on the right. (B) shRNAs targeting p53 significantly inhibit 696
PNR-induced HeLa cell apoptosis. shRNA-Con was a pLKO.1 empty expression vector control. 697
The right plot shows relative levels of apoptosis based on the means of each condition from 3 698
independent experiments. The mean for samples with only shRNA-Con was normalized to 1. * p 699
(one tail) < 0.05. (C) p53 protein levels in three isogenic HCT116 cell lines containing two p53 700
alleles, one allele or none. (D) and (E) PNR induces cell apoptosis in both p53+/+ and p53¯/¯ 701
HCT116 cells. Two days after transfecting PNR expression plasmid, the isogenic HCT116 cells 702
were processed for both Annexin V binding assay and sub-G1 analysis. The data from three 703
repeats was plotted on the right. (D) Annexin V binding assay. PNR mildly induced apoptosis 704
similarly in both cell lines. (E) sub-G1 analysis. PNR induced apoptosis in p53+/+ HCT116 cells 705
at ~2 fold higher than in p53¯/¯ HCT116 cells. PNR also increased sub-G1 phase in HeLa cells. 706
FIG. 4. PNR modulates p53 posttranslationally in HeLa cells. (A) PNR does not 707
stimulate p53 transcription. Two days after transfection, p53 mRNA levels were measured by 708
qRT-PCR and normalized to that of the sample with 0 μg PNR. (B) PNR stabilizes p53 protein. 709
Endogenous p53 remaining after 2 μg/ml cycloheximide treatment for the indicated times was 710
measured by immunoblotting and that in the 0 min sample was normalized to 1. Upper panel: 1.2 711
μg GFP control transfection; Middle panel: 1.2 μg PNR transfection; Lower panel: Plot of 712
remaining p53 protein against treatment time. (C) PNR stimulates the specific activity of p53 as 713
a transcriptional factor. Increasing amounts of the p53 expression plasmid were co-transfected 714
with a constant amount of p53RE-FLuc to provide standard curves of p53 protein levels vs. 715
reporter activity. For both p53 protein measurement by immunoblotting (upper panel) and p53 716
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
32
transcriptional activity measurement by reporter assay (lower panel), the results under the 717
conditions of sample 1 were normalized to 1. The middle panel shows the relative intensity of 718
p53 immunoblotting signal (y-axis) vs. dose of p53 plasmid transfected (x-axis). Sample 719
numbers correspond to the conditions shown in the upper panel (sample 1: empty vector control; 720
sample 2: PNR; samples 3-7: p53 standard curve). * p (one tail) < 0.05. 721
FIG. 5. PNR-stimulated p53 acetylation correlates with p53 transactivation and 722
accumulation in HeLa cells. (A) PNR stimulates p53 acetylation. Total p53 and acetylated p53 723
(Ac-p53) levels were measured by immunoblotting with anti-p53 and anti-Ac-p53 antibodies, 724
respectively. Acetylations can occur at multiple lysines of p53 by the indicated acetyltransferases, 725
which were measured with their specific anti-Ac-p53 antibodies. The numbers below each band 726
report the level of Ac-p53 per unit of total p53, normalized to that in sample 2. GFP was used as 727
a transfection control. (B) and (C) Co-expressing p53 deacetylase SIRT1 inhibits PNR-mediated 728
stimulation of p53 accumulation and transactivation. (B) SIRT1 inhibits the PNR-mediated p53 729
acetylation and accumulation in a dose-dependent fashion. Ac-p53, total p53, PNR and GFP 730
were measured as (A). Endogenous p21 and β-actin protein levels were also measured. SIRT1 731
abolished the PNR-mediated increase of p21 protein accumulation. (C) SIRT1 inhibits PNR-732
mediated stimulation of p53RE-FLuc expression in a dose-dependent fashion in a 96-well plate. 733
FIG. 6. p300 is involved in the PNR-mediated stimulation of p53 in HeLa cells. (A) 734
Two different shRNA plasmids targeting p300 inhibit the PNR-mediated stimulation of p53RE-735
FLuc expression. RLU in the sample of PNR+shRNA-Con was normalized to 100%. (B) shRNA 736
targeting p300 inhibits the PNR-mediated stimulation of p53 acetylation and accumulation. The 737
indicated proteins were measured by immunoblotting. The numbers below p300 band report the 738
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
33
level of p300 protein normalized to the p300 level in sample 1. shRNA-Con is a pLKO.1 empty 739
lentiviral control. 740
FIG. 7. PNR participates in a complex of p53 and p300 in HeLa cells. (A) and (B) 741
Two days after co-transfection of HA-tagged PNR, p53 and p300, cells were lysed for 742
immunoprecipitation with the indicated antibodies. Pre-immune IgG and anti-His antibody were 743
used as non-specific binding controls. (A) Anti-p53 and anti-p300 antibodies co-744
immunoprecipitate HA-PNR. (B) Anti-HA antibody co-immunoprecipitates p53. (C) and (D) 745
p53 and PNR co-localize in nuclei. Subcellular localizations of p53 and PNR were visualized by 746
immunofluorescence. p53: green; HA: red; DAPI: blue. Scale bar: 20 μm. (C) Sample 1: p53 747
transfection; 2: PNR transfection; 3: PNR and p53 co-transfection. Arrow: co-localization of 748
PNR and p53. (D) Enlarged image of a representative nucleus from a field of cells co-transfected 749
with PNR and p53. Scale bar: 5 μm. 750
FIG. 8. PNR enhances formation of a complex of p53 and p300 with or without 751
actinomycin D treatment in HeLa cells. (A) PNR enhances p300’s binding to total p53 and Ac-752
p53. Anti-p300 antibody co-immunoprecipitated p53. Both p53 and Ac-p53 (K373+382) were 753
measured by immunoblotting. Upper Arrow: Ac-p53; lower arrow: rabbit IgG heavy chain. (B) 754
PNR boosts actinomycin D-enhanced association between p53 and p300. One day after co-755
transfection of the indicated plasmids, cells were treated with 10 nM actinomycin D for 24 hrs 756
and then processed as (A). 757
on March 31, 2018 by guest
http://mcb.asm
.org/D
ownloaded from
