overexpression of genes encoding glycolytic enzymes in ... · carbon ﬂow through the glycolytic...

Overexpression of Genes Encoding Glycolytic Enzymes inCorynebacterium glutamicum Enhances Glucose Metabolism andAlanine Production under Oxygen Deprivation Conditions

Shogo Yamamoto, Wataru Gunji, Hiroaki Suzuki, Hiroshi Toda, Masako Suda, Toru Jojima, Masayuki Inui, and Hideaki Yukawa

Research Institute of Innovative Technology for the Earth (RITE), Kizugawadai, Kizugawa, Kyoto, Japan

We previously reported that Corynebacterium glutamicum strain �ldhA�ppc�alaD�gapA, overexpressing glyceraldehyde-3-phos-phate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen depri-vation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159 –165, 2010). In this study,we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referredto as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen depriva-tion. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved itsglucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation,GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain.Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glycer-aldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of theextracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD� ratio, which alsoplays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach tomake drastic progress in growth-arrested bioprocesses.

Corynebacterium glutamicum is a Gram-positive, high-G�C-content, non-spore-forming bacterium widely used for the

industrial production of amino acids such as glutamate and lysine(15, 19, 38). The production was mainly via conventional, growth-dependent bioprocesses until aerobically grown C. glutamicumcells deprived of oxygen were discovered to efficiently convertglucose to organic acids despite cessation of growth (11, 21). Un-der these conditions, the cells exhibit increased enzymatic activi-ties following elevated expression of genes encoding key enzymesof the glycolytic and anaplerotic pathways, as well as those of thereductive arm of the tricarboxylic acid (TCA) cycle. It represents ametabolic shift toward these pathways, culminating in acceleratedcarbon flow through the glycolytic and organic acid productionpathways under oxygen deprivation (12, 42). This metabolic shiftis the basis upon which the efficient bioprocess underlying theproduction of D-lactic acid (23), succinic acid (22), ethanol (10),alanine (14), and valine (7), under which by-product formation isstrongly curtailed, is based. Recently, Blombach et al. reportedisobutanol production by metabolically engineered C. glutami-cum using the similar approach under oxygen deprivation (2). Thetremendous promise that this approach holds is particularlyborne out by the highly efficient alanine production by metabol-ically engineered C. glutamicum (14). Added to this, the successfulengineering of strains capable of mixed sugar utilization can onlycement the role of C. glutamicum as a premier microorganism inthe fermentation of biomass hydrolysates containing mixtures ofhexose and pentose sugars (30).

Amino acids are widely used in food additives, pharmaceuticals,feed supplements, cosmetics, and polymer materials (8, 13, 17). Theyare industrially manufactured largely by aerobic fermentation, a pro-

cess that invariably involves side reactions that may lead to biomassformation, CO2 production, and heat generation, which in turn mayadversely impact product yield and process energy efficiency. More-over, as aerobic fermentation requires intensive agitation to supplysufficient oxygen for microbial growth, it complicates the establish-ment of a modern, sustainable bioprocess which meets current trendsof high cost-effectiveness at reduced greenhouse gas emission levels.The aforementioned alanine production study confirmed the utilityof recombinant C. glutamicum in amino acid production under ox-ygen deprivation (14). Alanine, the easiest amino acid to produce inbacteria, is formed from pyruvate in a single reaction step catalyzedby glutamate-pyruvate transaminase or alanine dehydrogenase(AlaDH) (Fig. 1). The overexpression of the NADH-linked AlaDHgene (alaD) derived from Lysinibacillus sphaericus into C. glutamicumenables C. glutamicum to produce considerable amounts of alanineby the direct delivery of an amino residue from ammonia to pyruvate.The present study pursues improvements in growth-independent al-anine production through improvements in the glucose consump-tion rate occasioned by altered expression of select genes encodingglycolytic enzymes (herein referred to as glycolytic genes).

Glycolysis is one of the most accessible metabolic engineering

Received 28 December 2011 Accepted 28 March 2011

Published ahead of print 13 April 2012

Address correspondence to Hideaki Yukawa, [email protected].

Supplemental material for this article may be found at http://aem.asm.org/.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.07998-11

June 2012 Volume 78 Number 12 Applied and Environmental Microbiology p. 4447–4457 aem.asm.org 4447

on July 16, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1128/AEM.07998-11

http://aem.asm.org

http://aem.asm.org/

targets for flux control in carbon metabolism. Through this path-way, glucose is catabolized primarily to pyruvate, an intermediateof enzymatic production of amino acids, organic acids, and alco-hols. Carbon flow through the pathway concomitantly yields thehigh-energy compounds ATP and NADH. Although many studieshave evaluated the effects of individual glycolytic gene overexpres-sion on carbon flux, little or no significant acceleration of carbonmetabolism rate or product formation rate has been realized irre-spective of notable increases in target enzymatic activities andchanges in fermentation product patterns (1, 4, 16, 18, 27, 31,33–36). Nonetheless, some recombinants overexpressing only oneor two glycolytic enzymes do show improved glycolytic flux andproduct formation. For instance, a 10 to 30% increase in glucoseconsumption rate was observed in phosphofructokinase (PFK)gene (pfk)- and/or pyruvate kinase (PYK) gene (pyk)-overexpress-ing Escherichia coli strains under resting cell incubation (6, 9).

Likewise, glucose consumption and ethanol production by pfk-overexpressing yeast improved 1.3-fold under immobilized-cellconditions (3). Both these results were obtained using “nongrow-ing cells” and are in agreement with our previous study in whichincreased endogenous glyceraldehyde-3-phosphate dehydroge-nase (GAPDH) activity dramatically enhanced alanine formationas a result of the stimulation of glucose consumption under con-ditions of oxygen deprivation and growth arrest (14). In an oppo-site approach, an H�-ATPase-defective mutant of C. glutamicumexhibiting enhanced rates of glucose consumption under aerobicconditions has been reported (32). Based on these findings, wepostulate that overexpression of glycolytic genes can generate evengreater increases in glycolytic flux and product formation underthese particular conditions.

In the present study, we overexpress key endogenous genesencoding NAD�-dependent GAPDH, irreversible PYK and PFK,

FIG 1 Biosynthetic pathway for alanine. Endogenous gapA, pyk, pfk, and pgi genes (in black boxes) were chromosomally integrated. Alanine dehydrogenasegene, alaD, from L. sphaericus was overexpressed via expression plasmid (white box). The genes ldhA and ppc were deleted (crossed bars) from chromosomalDNA of C. glutamicum. Relevant reactions are represented by the names of the genes coding for the enzymes as follows: pts, phosphoenolpyruvate:carbohydratephosphotransferase system; glk, glucokinase; pgi, glucose-6-phosphate isomerase; pfk, phosphofructokinase; ald, fructose-1,6-biphosphate aldolase; gapA,glyceraldehyde-3-phosphate dehydrogenase; tpi, triosephosphate isomerase; pgk, phosphoglycerate kinase; pgm, phosphoglycerate mutase; eno, enolase; pyk,pyruvate kinase; alaD, alanine dehydrogenase; ldhA, lactate dehydrogenase; ppc, phosphoenolpyruvate carboxylase. Abbreviations: Glucose-6P, glucose-6-phosphate; Fructose-6P, fructose-6-phosphate; Fructose-1,6BP, fructose-1,6-bisphosphate; Glyceraldehyde-3P, glyceraldehyde-3-phosphate; Dihydroxyac-etone-P, dihydroxyacetone phosphate; Glycerate-1,3BP, glycerate-1,3-bisphosphate; Glycerate-3P, glycerate-3-phosphate; Glycerate-2P, glycerate-2-phosphate;Glucono-1,5-lactone-6P, glucono-1,5-lactone-6-phosphate; Ribulose-5P, ribulose-5-phosphate; Ribose-5P, ribose-5-phosphate; Xylulose-5P, xylulose-5-phos-phate; Sedoheptulose-7P, sedoheptulose-7-phosphate; Erythrose-4P, erythrose-4-phosphate.

Yamamoto et al.

4448 aem.asm.org Applied and Environmental Microbiology


.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

and the first enzyme specific to glycolysis, glucose-6-phosphateisomerase (PGI), in the chromosome of C. glutamicum in a step-wise approach. In a growth-arrested bioprocess under oxygen de-privation, we are able to ascribe incremental rises observed inglucose consumption and alanine accumulation after each cumu-lative step to the respective gene overexpression. The results revealglycolytic enzyme activity as a legitimate target for metabolic en-gineering aimed at increasing C. glutamicum carbon metabolismunder oxygen deprivation.

MATERIALS AND METHODSBacterial strains, media, growth conditions, and plasmids. All bacterialstrains and plasmids used in this study are listed in Table 1. For geneticmanipulations, E. coli strains were grown at 37°C in Luria-Bertani (LB)medium. For aerobic growth conditions, C. glutamicum R (JCM 18229)and its recombinants were precultured at 33°C in nutrient-rich medium(A medium) containing 2 g yeast extract, 7 g Casamino Acids, 2 g urea, 7

g ammonium sulfate, 0.5 g KH2PO4, 0.5 g K2HPO4, 0.5 g MgSO4 · 7H2O,6 mg Fe2SO4 · 7H2O, 4.2 mg Mn2SO4 · H2O, 0.2 mg biotin, 0.2 mg thia-mine per liter supplemented with 4% glucose. Where appropriate, mediawere supplemented with antibiotics and/or 1.5% agar. The final concen-trations of antibiotics used were follows: chloramphenicol, 50 �g/ml forE. coli and 5 �g/ml for C. glutamicum; kanamycin, 50 �g/ml for both E.coli and C. glutamicum.

DNA manipulations. Plasmid DNA was isolated either by the alkalinelysis procedure or by using a HiSpeed Plasmid Midi Kit (Qiagen Inc.)according to the manufacturer’s instructions, modified when extractingDNA from corynebacteria by using 4 mg/ml lysozyme at 37°C for 30 min.Chromosomal DNA was isolated from corynebacteria following methodspreviously described (29), modified by using 4 mg/ml lysozyme at 37°Cfor 30 min. Restriction endonucleases were purchased from TaKaRa (Ja-pan). PCR was performed using a GeneAmp PCR system (Applied Bio-systems) in a total volume of 100 �l with 50 ng of DNA, 0.2 mM deoxy-nucleoside triphosphates (dNTPs), 2% dimethyl sulfoxide in LA Taqpolymerase buffer with MgCl2, and 4 units of LA Taq polymerase

TABLE 1 Strains and plasmids used in this study

Strain/plasmid DescriptionReference/source

StrainsE. coli

JM109 recA1 endA1 gyrA96 thi hsdR17(rK� mK

�) e14-(mcrA�) supE44 relA1 �(lac-pro0AB) [F= traD36 proAB� lacIq

lacZ�M15]TaKaRa

JM110 dam dcm supE44 hsdR17 thi leu rpsL1 lacY galK galT ara tonA thr tsx �(lac-proAB) [F= traD36 proAB� lacIq

lacZ�M15]29

C. glutamicum RldhA-ppc mutant ldhA::markerless, ppc::markerless 10GLY1 Markerless two sets of Ptac-SD-gapA-term gene recombinantly integrated into SSI1 of C. glutamicum LLPEP strain This studyGLY2 Markerless Ptac-SD-pyk-term and Ptac-SD-pfk-term genes recombinantly integrated into SSI10 of C. glutamicum

GLY1 strainThis study

GLY3 Markerless Ptac-SD-gpi-term gene recombinantly integrated into SSI5 of C. glutamicum GLY2 strain This study�ldhA �ppc/pCRD500 Cmr; strain ldhA-ppc mutant bearing pCRD500 plasmid 14GLY1/pCRD500 Cmr; strain GLY1 bearing pCRD500 plasmid This studyGLY2/pCRD500 Cmr; strain GLY2 bearing pCRD500 plasmid This studyGLY3/pCRD500 Cmr; strain GLY3 bearing pCRD500 plasmid This studyGLY3/pCRD914 Kmr; strain GLY3 bearing pCRD914 plasmid This study

PlasmidspCRD500 Cmr; Ptac-alaD gene inserted into pCRC200 14pCASE1 Expression vector for C. glutamicum from C. casei ATCC 12072 40pCRB22 Kmr; expression vector, E. coli-C. glutamicum shuttle vector derived from pCASE1 This studypCRD914 Kmr; Ptac-alaD gene inserted into pCRB22 This studypKK223-3 Apr; expression vector PharmaciapCRC200 Cmr; source of tac promoter and rrnB terminator 41pCRA725 Kmr; pHSG298 with Ptac-sacR-sacB genes 10pCold I Apr; expression vector TaKaRapCRD903 Apr; pCold I with a 0.6-kb KpnI-XbaI PCR fragment containing Ptac-term gene This studypCRD904 Apr; pCRD903 with an EcoRI fragment containing SD region This studypCRD905 Apr; pCRD904 with a 1.0-kb EcoRI PCR fragment containing gapA gene This studypCRD908 Apr; pCRD904 with a 1.4-kb MunI fragment containing pyk gene This studypCRD909 Apr; pCRD904 with a 1.0-kb EcoRI fragment containing pfk gene This studypCRD910 Apr; pCRD904 with a 1.6-kb MunI fragment containing gpi gene This studypCRD900 Kmr; pCRA725 with a 2.0-kb SphI PCR fragment containing the SSI1 region This studypCRD901 Kmr; pCRA725 with a 2.8-kb SalI-SphI PCR fragment containing the SSI5 region This studypCRD902 Kmr; pCRA725 with a 3.1-kb XbaI PCR fragment containing the SSI10 region This studypCRD906 Kmr; pCRD900 with Ptac-SD-gapA-term genepCRD907 Kmr; pCRD906 with Ptac-SD-gapA-term gene This studypCRD913 Kmr; pCRD901 with Ptac-SD-gpi-term gene This studypCRD911 Kmr; pCRD902 with Ptac-SD-pyk-term gene This studypCRD912 Kmr; pCRD911 with Ptac-SD-pfk-term gene This study

Abbreviations: term, rrnB terminator; SD, ribosome-binding site.

Enhancing Alanine Production in C. glutamicum

June 2012 Volume 78 Number 12 aem.asm.org 4449


.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

(TaKaRa, Japan) for 30 cycles at temperatures of 94°C for denaturation (1min), 55°C for annealing (1 min), and 72°C for extension (1 min/kb).Oligonucleotide primers used in this study are listed in Table 2. The re-sulting PCR fragments were purified with a QIAquick PCR purificationkit (Qiagen Inc., Germany). The transformation of corynebacteria wascarried out by electroporation with a 2.5-kV, 200-�, and 25-�F electricpulse in a 0.2-cm cuvette using a Gene Pulser (Bio-Rad) (41). Transfor-mation of E. coli was performed by the CaCl2 procedure (29).

DNA sequencing. All sequencing was performed by the dideoxy chaintermination method as previously described with an ABI Prism 3100 ge-netic analyzer (Applied Biosystems) using a BigDye Terminator v3.1 cyclesequencing kit (Applied Biosystems). The nucleotide sequences of bothstrands were determined. DNA sequence data were analyzed with theGENETYX program (Software Development, Japan).

Chromosomal integration of glycolytic genes. Chromosomal inte-gration of gapA, pyk, pfk, and pgi, coding GAPDH, PYK, PFK, and PGIrespectively, was achieved via a markerless system using suicide vectorpCRA725 carrying the sacB gene. The plasmids for the markerless systemwere constructed using a previously described method (10). The glycolyticgenes were integrated into C. glutamicum R strain-specific islands (SSIs),previously identified as dispensable for cell growth (37). These DNA frag-ments (SSI1, 10, and 5 regions) were amplified by PCR using oligonucle-otide primers 1 and 2 for gapA integration, 3 and 4 for pgi integration, and5 and 6 for pyk and pfk integration, respectively (Table 2), and C. glutami-cum R chromosomal DNA as the template. The amplified DNA fragmentswere cloned into the appropriate restriction sites of pCRA725 to yieldplasmids pCRD900, pCRD901, and pCRD902, respectively. The tac pro-moter and rrnB terminator region was amplified using pCRC200 as thetemplate and oligonucleotide primers 7 and 8 to generate a DNA fragmentwith appropriate restriction site. The obtained 0.6-kb DNA fragment ofthe Ptac-term gene was digested by KpnI and XbaI, and it was insertedinto pCold I vector (TaKaRa, Japan) to generate pCRD903 plasmid. Fur-thermore, the SD sequence (5=-AATTGGAAACTTTTTAGAAAGGTGTGTTG-3=) was inserted into the EcoRI site between the tac promoter andthe rrnB terminator in pCRD903 so that only the EcoRI site remainedbehind the SD sequence (pCRD904). The 1.0-kb DNA fragment of gapAgene was amplified using C. glutamicum R chromosomal DNA as thetemplate and oligonucleotide primers 9 and 10 to generate a DNA frag-ment with EcoRI cohesive ends. The 1.0-kb EcoRI fragment carrying thegapA gene was cloned into pCRD904 to generate pCRD905. A 1.7-kb gapAgene under the control of the constitutive tac promoter was prepared bydigestion of pCRD905 with BamHI or BglII. A BamHI-digested Ptac-SD-gapA-term fragment was inserted into the BglII site of pCRD900(pCRD906). A BglII-digested Ptac-SD-gapA-term fragment was inserted

into the BglII site of pCRD906 (pCRD907). The 1.4-kb DNA fragment ofthe pyk gene, 1.0-kb DNA fragment of the pfk gene, and 1.6-kb DNAfragment of the pgi gene were amplified using C. glutamicum R chromo-somal DNA as the template and oligonucleotide primers 11 and 12 for pyk,13 and 14 for pfk, and 15 and 16 for pgi to generate a DNA fragment withappropriate cohesive ends. The 1.4-kb MunI fragment carrying the pykgene, the 1.0-kb EcoRI fragment carrying the pfk gene, and the 1.6-kbMunI fragment carrying the pgi gene were cloned into pCRD904 to gen-erate pCRD908, pCRD909, and pCRD910, respectively. The 2.1-kb pykgene, the 1.7-kb pfk gene, and the 2.3-kb pgi gene under the control of theconstitutive tac promoter were prepared by digestion of pCRD908,pCRD909, and pCRD910, respectively, with BamHI. A digested Ptac-SD-pyk-term fragment was additionally digested with BglII. The BamHI- andBglII-digested Ptac-SD-pyk-term fragment was inserted into the BglII siteof pCRD902 (pCRD911). The BamHI-digested Ptac-SD-pfk-term frag-ment was inserted into the BglII site of pCRD911 (pCRD912). TheBamHI-digested Ptac-SD-pgi-term fragment was inserted into the BglIIsite of pCRD901 (pCRD913).

The resultant plasmids were introduced into C. glutamicum by elec-troporation courtesy of a stepwise approach. Single-crossover mutantswere selected on A medium agar plates containing 50 �g/ml kanamycin.They were cultivated for 12 h in BT medium containing 10% sucrose.Gene integration was confirmed by PCR and DNA sequencing.

Conditions for alanine production under oxygen deprivation. Foralanine production, 500 ml of culture was harvested by centrifugation(5,000 � g, 4°C for 10 min). The cell precipitate was subsequently washedonce with BT medium. Appropriate amounts of washed cells were resus-pended in 60 ml of BT medium with 400 mM glucose. Cell suspensionswere incubated at 33°C with constant agitation without aeration. The pHof the cell reaction mix was maintained at 7.0 using a pH controller (DT-1023; Biott, Japan) by supplementing with 5 N ammonia solution.

Analytical procedures. Collected samples were centrifuged (15,000 �g, 4°C for 10 min) after dilution to dissolve precipitates, and the superna-tant concentrations of glucose, alanine, and organic acids were deter-mined. Alanine concentration was determined using high-performanceliquid chromatography (HPLC) (Prominence; Shimadzu Corp., Japan)equipped with a Shim-pack Amino-Na column (Shimadzu Corp., Japan)and a spectrofluorometer after derivatization with o-phthalaldehyde ac-cording to the manufacturer’s protocol. Organic acids were quantified bythe HPLC system (8020; Tosoh Corp., Japan) equipped with a UV andelectric conductivity detector and TSKgel OApac-A column (7.8-mm in-side diameter [i.d.] by 30 cm; Tosoh Corp., Japan) operating at 40°C witha 0.75 mM H2SO4 mobile phase at a flow rate of 1.0 ml/min. Glucoseconcentration was determined by an enzyme electrode glucose sensor

TABLE 2 Oligonucleotides used in this study

Primer Target gene Sequence (5=–3=)a Restriction site(s)

Primer 1 SSI1 region ATGCATGCTTGCGTATTTCTGGAAGAAG SphIPrimer 2 SSI1 region ATGCATGCCACACCTCGATAAACCTCTC SphIPrimer 3 SSI5 region CTCTGTCGACCCAGTCAGTACATACAGGCT SalIPrimer 4 SSI5 region CTCTGCATGCCTCTCCGCGAACGAATCCGT SphIPrimer 5 SSI10 region CTCTTCTAGAACACACCTCATCACGAGTAG XbaIPrimer 6 SSI10 region CTCTTCTAGACCTCGTCAGTTGCTGCAGTT XbaIPrimer 7 Ptac-term region CCCCGGTACCCAATTGAGATCTGGATCCGGCTGTGCAGGTCGTAAA KpnI, MunI, BamHI, BglIIPrimer 8 Ptac-term region CCCCTCTAGAGGATCCAGATCTCAATTGAAGAGTTTGTAGAAACGCAAAA BglII, BamHI, MunI, KpnIPrimer 9 gapA CCCCGAATTCATGACCATTCGTGTTGGT EcoRIPrimer 10 gapA CCCCGAATTCTTAGAGCTTGGAAGCTACG EcoRIPrimer 11 pyk CCCCCAATTGATGGGCGTGGATAGACG MunIPrimer 12 pyk CCCCCAATTGTTAGAGCTTTGCAATCCTTGT MunIPrimer 13 pfk CCCCGAATTCATGGAAGACATGCGAATTGC EcoRIPrimer 14 pfk CCCCGAATTCCTATCCAAACATTGCCTGGG EcoRIPrimer 15 gpi GCCCCAATTGATGGCGGACATTTCGAC MunIPrimer 16 gpi GCCCCAATTGCTACCTATTTGCGCGGT MunIa The restriction sites used in the cloning procedure are underlined.

Yamamoto et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

(BF-5; Oji Scientific Instruments, Japan). Cell growth was monitored bymeasuring absorbance at 610 nm using a spectrophotometer (DU800;Beckman Coulter).

Enzyme assays. For enzymatic activity, 2 ml of reaction solution washarvested by centrifugation at 8,000 � g, 4°C for 10 min. Cell pellets werewashed once with sonication buffer (100 mM Tris-HCl buffer, pH 7.5, 1mM MgCl2, 2 mM dithiothreitol [DTT]). The cells were resuspended in 1ml of the same buffer before adding 0.5 g of glass beads (150 to 212 �m;Sigma-Aldrich), and the suspensions were sonicated for 45 min (pulse, 5 s;interval, 10 s) with an ultrasonic homogenizer (UCD-200; Cosmo Bio,Japan) in an ice water bath. Cellular debris were removed by centrifuga-tion (15,000 � g, 4°C for 10 min), and the supernatants were used as acrude extract. Protein concentrations were measured with a Bio-Rad pro-tein assay kit (Bio-Rad Laboratories).

Assays for glucokinase (GLK), PGI, PFK, fructose-1,6-biphosphatealdolase (ALD), triosephosphate isomerase (TPI), GAPDH, phosphoglyc-erate kinase (PGK), PYK, and AlaDH activities were done at 340 nm bymonitoring the decrease or increase of NAD (phosphate) [NAD(P)H orNAD(P)�]. Briefly GLK activity was measured in 100 mM Tris-HCl buf-fer (pH 7.5) containing 4 mM MgCl2, 1 mM ATP, 0.2 mM NADP�, 40mM glucose, and 1 U/ml glucose-6-phosphate dehydrogenase (G6PDH).PGI activity was measured in 100 mM Tris-HCl buffer (pH 7.5) contain-ing 4 mM MgCl2, 0.2 mM NADP�, 10 mM fructose-6-phosphate, and 1U/ml G6PDH. PFK activity was measured in 100 mM Tris-HCl buffer(pH 7.5) containing 4 mM MgCl2, 0.2 mM NADH, 5 mM DTT, 5 mMATP, 10 mM fructose-6-phosphate, 1 U/ml ALD, 5 U/ml TPI, and 5 U/mlglycerol-3-phosphate dehydrogenase (G3PDH). ALD activity was mea-sured in 100 mM Tris-HCl buffer (pH 7.5) containing 4 mM MgCl2, 0.2mM NADH, 20 mM fructose-1,6-bisphosphate, 1 U/ml TPI, and 5 U/mlG3PDH. TPI activity was measured in 100 mM Tris HCl buffer (pH 7.5)containing 4 mM MgCl2, 0.2 mM NADH, 15 mM glyceraldehyde-3-phos-phate, and 5 mM G3PDH. GAPDH activity was measured in 25 mMsodium phosphate-25 mM triethanolamine buffer (pH 7.5) containing0.2 mM EDTA, 5 mM NAD�, and 5 mM glyceraldehyde-3-phosphate.PGK activity was measured in 100 mM Tris-HCl buffer (pH 7.5) contain-ing 4 mM MgCl2, 4 mM ATP, 0.2 mM NADH, 20 mM 3-phosphoglycer-ate, and 5 U/ml GAPDH. PYK activity was measured in 100 mM Tris-HClbuffer (pH 7.5) containing 10 mM MgCl2, 2 mM ADP, 0.2 mM NADH, 10mM phosphoenolpyruvate, and 20 U/ml lactate dehydrogenase. AlaDHactivity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 0.2mM NADH, 100 mM NH4Cl, and 2 mM sodium pyruvate. Units of theseactivities were calculated using an extinction coefficient for NAD(P)H/NAD(P)� of 6,220 M�1cm�1 at 340 nm.

Assays for phosphoglycerate mutase (PGM) and enolase (ENO) activ-ities were done at 240 nm by monitoring the increase of phosphoenolpy-ruvate (25). Briefly, PGM activity was determined in 100 mM Tris-HClbuffer (pH 7.5) containing 4 mM MgCl2, 10 mM 3-phosphoglycerate, and5 U/ml ENO. ENO activity was measured in the same reaction mixturewith PGM containing 5 U/ml PGM instead of ENO as a coupling enzyme.Units of these activities were calculated using an extinction coefficient forphosphoenolpyruvate of 1,400 M�1cm�1 at 240 nm.

Measurement of intracellular metabolites. Intracellular metaboliteswere extracted from C. glutamicum cells as follows. Samples (100 �l) weretaken 24 h after the reaction started and were immediately quenched bymixing with 1.0 ml of cold methanol (�80°C). The resultant cell suspen-sion (0.5 ml) was mixed vigorously with 0.5 ml of chloroform and 0.5 mlof H2O (�20°C) to disrupt cells, and after being incubated for 60 min at�20°C, the sample solution was centrifuged (20,000 � g, 4°C for 5 min).An aliquot of the upper layer (50 �l) was mixed with 50 �l of water orauthentic standard mixture solution (5.0 �M each) and centrifuged(20,000 � g, 4°C for 5 min). The resultant supernatant was analyzed byliquid chromatography-tandem mass spectrometry (LC-MS/MS) usingHPLC (Prominence 20A) coupled with a linear ion trap mass spectro-meter (4000 Q TRAP; Applied Biosystems/MDS SCIEX) as previouslydescribed (5). Data were obtained from three independent culture sam-

ples. A factor of 1.8 ml/g cell dry weight was assumed as the cell volume forthe calculation of intracellular concentrations. The ratio of intracellularmetabolite level between the two strains was mapped using KaPPA-View4 software (28, 39).

Calculation of NADH utilization efficiency. NADH utilization effi-ciency was computed using product yields and their NADH utilizationfactor. The NADH utilization factor was defined as the amount of NADHconsumption from 1 mol of glucose through their formation pathway;those of alanine, acetic acid, and succinic acid were �2 (by alanine dehy-drogenase), �2 (by pyruvate dehydrogenase), and �4 (by malate dehy-drogenase and succinate dehydrogenase), respectively. The NADH utili-zation efficiency of each product was calculated based on the followingformula: NADH utilization efficiency � �1 � NADH utilization factor �yield (%)/100.

The total NADH utilization efficiency was calculated by addingNADH utilization efficiencies of alanine, acetic acid, and succinic acid.

RESULTSC. glutamicum strain chromosomally harboring extra copies ofthe glycolytic genes gapA, pyk, pfk, and pgi is based on an ldhAand ppc deletion mutant. Four glycolytic genes, gapA, pyk, pfk,and pgi, controlled by the constitutive tac promoter were inte-grated into the chromosomal DNA of C. glutamicum in a stepwisemanner. To minimize any tendency for the formation of majorby-products (lactic and succinic acids) by the eventual strain, anldhA and ppc double deletion mutant (10) was used as the parentalstrain (Fig. 1). In the first step, two tandemly arranged sets of gapAwere integrated in order to obtain GAPDH activity comparable tothat of the previously constructed strain �ldhA�ppc�alaD�gapA. This strain is a high alanine producer overexpressing alaDand native gapA via the expression plasmid pCRD501 (14). Thenewly constructed GLY1 strain’s 6.5 U/mg protein GAPDH activ-ity was 1.5-fold higher than that of strain �ldhA�ppc�alaD�gapA (4.5 U/mg protein) and was the preferred parental strain forthe consequent integration of pyk and pfk. PYK and PFK wereallosterically regulated enzymes that catalyze essentially irrevers-ible reactions in glycolysis (26). To introduce pyk and pfk simul-taneously into the GLY1 strain, a suicide vector for the integrationwas constructed by connecting both genes with a tac promoter.The resulting recombinant strain, named GLY2, was used as theparental strain for the integration of pgi. PGI is the branch pointenzyme between the glycolytic pathway and the pentose-phos-phate pathway (PPP). Integration of pgi resulted in recombinantGLY3. GLY1, GLY2, and GLY3 were each transformed withpCRD500 harboring the alaD gene for alanine formation, endingup with recombinants named GLY1/pCRD500, GLY2/pCRD500,and GLY3/pCRD500, respectively.

Overexpression of glycolytic genes enhances productivityunder oxygen deprivation without affecting growth under aer-obic conditions. Enzymatic activity and alanine formation ofthree recombinants, GLY1/pCRD500, GLY2/pCRD500, andGLY3/pCRD500, and of their parental �ldhA �ppc/pCRD500strain, were evaluated under oxygen deprivation. Table 3 revealsthat gapA overexpression in GLY1/pCRD500, GLY2/pCRD500,and GLY3/pCRD500 resulted in GAPDH activities about 10-foldhigher than those of the parental strain. PGK and AlaDH activi-ties, which do not directly relate to the manipulated genes, wereslightly depressed, but the reasons for this are not known. Theeffects of overexpression of gapA were therefore largely confinedto GAPDH activity, as those of other genes were similarly confinedto the corresponding activities. Overexpression of pyk, pfk, and




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

pgi, on the other hand, increased PYK, PFK, and PGI activitiesabout 14-, 1.5-, and 3-fold, respectively. No significant alterationsof other enzymatic activities of the glycolytic pathway were ob-served.

Glucose consumption and alanine formation (Fig. 2 and Table4) profiles of all four strains under oxygen deprivation revealed1,520 mM alanine production by GLY1/pCRD500, a 4.5-fold in-crease over that of the �ldhA �ppc/pCRD500 strain (346 mM).This higher alanine production was comparable to that of thepreviously reported strain �ldhA�ppc�alaD�gapA (14). Overthe course of the fermentation, glucose consumption and alanineformation of GLY2/pCRD500 were progressively better than

those of GLY1/pCRD500, while those of GLY3/pCRD500 weresimilarly progressively better than those of GLY2/pCRD500. Con-sequently, alanine production, glucose consumption rate, alanineconcentration, alanine productivity, and alanine yield increasedwith the increase in the number of overexpressed genes in therecombinant strains (Table 4). Surprisingly, strain GLY3/pCRD500 produced so much alanine that it precipitated after 36h. At 48 h, alanine formation by this strain reached 2,430 mM (216g/liter), about 6.4-fold higher than that of the parental strain notoverexpressing any glycolytic genes. In contrast to the improvedalanine yield observed, the yield of major by-products reducedwith increasing number of glycolytic genes overexpressed (Table4). These results strongly suggested that increased glycolytic en-zyme activities enabled efficient alanine formation by virtue of notonly increasing glucose metabolism but also restraining by-prod-uct yield.

On the other hand, both specific growth rates and glucose con-sumption rates of log-phase cultures of the four recombinantswere not different under aerobic conditions (see Fig. S1 in thesupplemental material). These results also suggested that en-hancement of these glycolytic enzymes did not influence growthrate and glucose metabolism under growth-permitting condi-tions.

Intracellular metabolite profiles reflect the extent of glyco-lytic gene overexpression of recombinants under oxygen depri-vation. Intracellular metabolite levels and redox balances inalanine-producing recombinants under oxygen deprivationwere analyzed by LC-MS/MS to monitor metabolite changesthat correlate with enhanced glycolytic enzyme activities.gapA-overexpressing GLY1/pCRD500 revealed clearly de-pressed levels of the intermediates glucose-6-phosphate, fruc-tose-6-phosphate, and glyceraldehyde-3-phosphate upstreamof GAPDH and markedly increased levels of the intermediatesglycerate-1,3-bisphosphate, glycerate-3-phosphate/glycerate-2-phosphate, phosphoenolpyruvate, and pyruvate down-stream, compared with the parental �ldhA �ppc/pCRD500strain (Fig. 3A). The significant improvement of alanine for-mation and alterations of glycolytic intermediate profilesstrongly suggest that GAPDH indeed catalyzed the rate-limit-ing step of glycolysis under oxygen deprivation. Furthermore,the decrease observed in the NADPH/NADP� ratio (Fig. 4) andreduced concentrations of almost all PPP intermediates, ribu-lose-5-phosphate, xylulose-5-phosphate, sedoheptulose-7-

FIG 2 Profiles of alanine production by metabolically engineered C. glutami-cum under oxygen deprivation. Glucose consumption (A) and alanine pro-duction (B) by C. glutamicum recombinants �ldhA �ppc/pCRD500 (circles),GLY1/pCRD500 (triangles), GLY2/pCRD500 (squares), and GLY3/pCRD500(diamonds) are shown. Data points represent the averages calculated fromtriplicate measurements. Error bars show standard deviation.

TABLE 3 Enzymatic activities of glycolytic and alanine formation pathway in C. glutamicum variants under oxygen deprivation

Enzyme name

Enzymatic activity (U/mg protein) for indicated straina

�ldhA �ppc/pCRD500 GLY1/pCRD500 GLY2/pCRD500 GLY3/pCRD500

AlaDH 13.0 � 0.4 10.8 � 0.9 10.8 � 1.1 7.7 � 1.4GLD 0.011 � 0.0002 0.009 � 0.002 0.008 � 0.002 0.006 � 0.002PGI 0.71 � 0.01 0.92 � 0.03 0.73 � 0.08 2.17 � 0.32PFK 0.15 � 0.004 0.23 � 0.02 0.27 � 0.04 0.27 � 0.02ALD 0.55 � 0.07 0.62 � 0.03 0.51 � 0.02 0.48 � 0.004TPI 15.9 � 4.9 12.8 � 3.9 12.6 � 2.3 13.8 � 2.8GAPDH 0.5 � 0.03 5.4 � 2.0 4.7 � 0.8 6.0 � 0.3PGK 4.0 � 0.3 2.5 � 0.2 2.6 � 0.1 2.9 � 0.002PGM 0.51 � 0.03 0.66 � 0.06 0.56 � 0.02 0.55 � 0.04ENO 0.51 � 0.04 0.49 � 0.02 0.48 � 0.02 0.47 � 0.01PYK 1.5 � 0.1 1.4 � 0.2 19.9 � 2.5 19.8 � 3.1a All activities were measured as described in Materials and Methods, and values are reported as averages � standard deviations from triplicate assays.

Yamamoto et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

phosphate, and erythrose-4-phosphate (Fig. 3A), pointed tothe possibility of a reduction of carbon flow through the PPPand, consequently, NADPH formation (Fig. 1). Although theglycolytic and PPP intermediate profiles of GLY2/pCRD500relative to GLY1/pCRD500 and GLY3/pCRD500 relative toGLY2/pCRD500 did not appear significantly different (Fig. 3Band C), a relative increase in glucose consumption (Fig. 2) and

a relative reduction in the NAD(P)H/NAD(P)� ratio (Fig. 4)were apparent. The intermediate profiles of GLY3/pCRD500relative to the parental strain are much more pronounced thanthose of GLY1/pCRD500 relative to the parental strain (Fig.3D), corroborating the stronger glucose consumption and al-anine productivity of GLY3/pCRD500. The measured NADH/NAD� ratio in the three glycolytic gene-overexpressing strains cor-

TABLE 4 Recombinant productivities under oxygen deprivationa

StrainReactiontime (h)

Glucose consumptionrate (mM/h)

Alanineconcn(mM)

Alanineproductivity(mM/h)

Yield (%)b

Alanine Acetic acid Succinic acid Total

�ldhA �ppc/pCRD500 48 5.8 � 0.2 378 � 58 7.2 � 1.1 68.3 � 3.7 3.1 � 0.8 7.1 � 0.9 78.5 � 7.3GLY1/pCRD500 48 19.6 � 0.1 1,520 � 20 31.6 � 0.3 80.3 � 0.4 1.9 � 0.1 6.0 � 0.3 88.5 � 0.6GLY2/pCRD500 48 22.2 � 1.4 1,820 � 180 37.9 � 3.8 85.1 � 4.3 1.6 � 0.1 4.8 � 0.1 91.5 � 4.0GLY3/pCRD500 48 27.6 � 1.8 2,430 � 150 50.6 � 3.1 91.8 � 2.2 1.3 � 0.1 4.5 � 0.2 97.6 � 2.4GLY3/pCRD914 48 32.0 � 0.8 2,640 � 40 54.9 � 0.9 86.0 � 1.6 1.4 � 0.08 4.1 � 0.03 91.5 � 1.6

72 25.8 � 1.0 3,090 � 160 42.9 � 2.2 83.0 � 2.1 1.3 � 0.05 4.3 � 0.1 88.6 � 2.3a Data are reported as averages � standard deviations from three different experiments.b Yields are based on mol of alanine produced from mol of glucose consumption (100% means 2 mol of alanine per 1 mol of glucose).

FIG 3 Comparative assessment of intracellular metabolite levels between the two recombinants. The ratios of GLY1/pCRD500 to �ldhA �ppc/pCRD500 (A),GLY2/pCRD500 to GLY1/pCRD500 (B), GLY3/pCRD500 to GLY2/pCRD500 (C), and GLY3/pCRD500 to �ldhA �ppc/pCRD500 (D) are shown. The targetgenes for comparison of glycolytic intermediate levels are indicated by red arrows. Intracellular metabolites shown in white could not be determined by thismethod. Abbreviations of intracellular metabolites are the same as those in Fig. 1. Data points represent the averages calculated from triplicate measurements.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

related well with the total NADH utilization efficiency calculatedfrom product yields and their NADH utilization factors (see Materi-als and Methods) (Fig. 5). This result suggested that the observeddifferences in NADH/NAD� ratio among the three recombinantswere caused by the relative changes in NADH-NAD� conversion-dependent product yields of alanine and acetic and succinic acids.

Elevating alanine dehydrogenase activity raises C. glutami-cum alanine production. To explore the further enhancement ofAlaDH activity of recombinant GLY3, a strain bearing the alaD-containing pCASE1 plasmid, which was isolated from Corynebac-terium casei JCM 12072 and shows a high copy number in C.glutamicum (40), was constructed. AlaDH activity of the resultingGLY3/pCRD914 strain at 29.2 U/mg protein was about four timeshigher than the 7.7 U/mg protein of the GLY3/pCRD500 strain. In

alanine production under oxygen deprivation, the initial rate ofalanine formation (up to 12 h) was significantly high at 87.1 mM/hin this recombinant compared to the 34.5 mM/h in the GLY3/pCRD500 strain (Fig. 2 and 6). Also, alanine concentration im-proved by 10% at the time point of 48 h and eventually reached3,080 mM (275 g/liter) within 72 h (Table 4).

DISCUSSION

In the present study, we demonstrated improved glucose metab-olism of metabolically engineered C. glutamicum under oxygendeprivation, successfully establishing that glycolytic gene overex-pression accelerates glucose consumption of C. glutamicum underoxygen deprivation. The genes gapA, pyk, pfk, and pgi were inte-grated into the chromosomal DNA of a C. glutamicum ldhA andppc double deletion background using a stepwise approach, withthe observation that glucose utilization and alanine formation in-creased in tandem with each integration step. Alanine production,glucose consumption rate, alanine concentration, alanine pro-ductivity, and alanine yield of the eventual GLY3/pCRD500 strainimproved 4.8-, 6.4-, 7.0-, and 1.3-fold, respectively, relative to theparental strain, with the added bonus of decreased by-productyields. Most notably, the 50.6 mM/h alanine productivity ofGLY3/pCRD500 represents the highest productivity reported todate, at the considerably high yield of 91.8% at 48 h (Table 4).Moreover, the strain was amenable to further improvement ofAlaDH activity, with the resultant GLY3/pCRD914 strain finallyable to produce a maximum of 3,080 mM alanine at 72 h.

GAPDH, a key enzyme of glycolysis, catalyzes the NAD-depen-dent oxidation of glyceraldehyde-3-phosphate into glycerate-1,3-bisphosphate. Of two C. glutamicum genes encoding GAPDHs,only gapA is essential for glycolysis (24). The susceptibility of thegapA-encoded GAPDH to the intracellular NADH/NAD� ratiosuggests that the enzyme may well catalyze a rate-limiting step ofglycolysis under both aerobic culture (4) and oxygen deprivation(11, 14, 21) conditions. Strain GLY1/pCRD500 overexpressingonly gapA revealed significantly increased glucose consumptionand alanine formation (Fig. 2 and 4) due to a shift in intracellularmetabolite balance characterized by decreased concentrations ofintermediates upstream of GAPDH concurrent with increaseddownstream intermediates. These data betray the large extent towhich GAPDH may control the glycolytic flux of alanine-produc-ing C. glutamicum under oxygen deprivation. Although a 2-foldincrease in the NADH/NAD� ratio resulted from gapA overex-

FIG 4 Redox balances in C. glutamicum recombinants under oxygen depri-vation. Ratio of intracellular NADH/NAD� (open column) and NADPH/NADP� (solid column) were shown. Data points represent the averages cal-culated from triplicate measurements. Error bars show standard deviation.

FIG 5 NADH/NAD� ratio measured by intracellular metabolites analysis andcalculated NADH utilization efficiencies in three glycolytic gene-overexpressingrecombinants, GLY1/pCRD500, GLY2/pCRD500, and GLY3/pCRD500. TotalNADH utilization efficiency was calculated by adding NADH utilization efficien-cies of alanine and acetic and succinic acids (see Materials and Methods).

FIG 6 Alanine concentration by GLY3/pCRD914 strain under oxygen depri-vation. Data points represent the averages calculated from triplicate measure-ments. Error bars show standard deviation.

Yamamoto et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

pression, its potential negative effects on glucose consumptionrate were most probably compensated for by the concomitant10-fold increase in GAPDH activity.

Co-overexpression of gapA, pfk, and pyk (GLY2/pCRD500)and gapA, pfk, pyk, and pgi (GLY3/pCRD500) also resulted inaccelerated glucose consumption under oxygen deprivation eventhough the relative change was less than that attributable solely togapA overexpression. Unexpectedly, the increase in alanineyield as well as alanine productivity resulting from increasedactivities of the glycolytic enzymes was accompanied by re-duced by-product biosynthesis, even though no effort wasmade to engineer the reduction (Table 4). Lower NADH/NAD� ratios in GLY2/pCRD500 and GLY3/pCRD500 coupledto their higher activities of PFK-PYK and PFK-PYK-PGI, re-spectively, relative to the parental strain (Fig. 4) likely facili-tated an increase in the glucose consumption rate by impairingGAPDH inhibition, which is at least partially responsible forthe increased glucose consumption upon cumulative pfk, pyk,and pgi overexpression. These lower NADH/NAD� ratios werelikely caused by a shift in product yield ratios of alanine andacetic and succinic acids (Fig. 5); in particular, the increase inalanine yield largely contributed to this phenomenon. To ex-plain why product yield ratios are altered by increased activitiesof glycolytic enzymes, we propose the model shown in Fig. 7.The carbon flux through the glycolytic pathway increased instep with additional glycolytic gene overexpression. Becauseenhancement in carbon flux in GLY1/pCRD500 likely exceededthe rate of by-product formation, acetic and succinic acid pro-ductivity between GLY2/pCRD500 and GLY3/pCRD500 re-mained essentially unchanged, meaning that their yields clearlydecreased as the rate of glucose consumption increased (Table4). The increase in alanine yield most likely resulted from anincreased alanine production rate. This model does not fullyaccount for the fact that high NADH/NAD� levels limit alanineformation in GLY1/pCRD500 by inhibiting not only GAPDHactivity but also AlaDH activity (4, 20). Because of the inhibi-

tion of AlaDH activity amid increased glycolytic flux, intracel-lular pyruvate significantly accumulated (Fig. 3A), decreasingthe intracellular NADH/NAD� levels in GLY2/pCRD500 andGLY3/pCRD500 and hence contributing to improved glucosemetabolism by minimizing the inhibition of GAPDH andAlaDH activities. By elevating AlaDH activity even further inGLY3/pCRD914, accelerated glucose metabolism, particularlyduring the initial 12 h, led to the accumulation of higheramounts of alanine than possible with GLY3/pCRD500 (Fig. 6and Table 4). This acceleration of glucose metabolism wasthought to drive the remarkable accumulation of pyruvate poolin GLY3/pCRD500 toward alanine formation by the enhance-ment of AlaDH activity (Fig. 3D). This work is a demonstrationof how the overexpression of glycolytic genes can be applied toimprove the productivity of pyruvate-derived bioproducts us-ing C. glutamicum under oxygen deprivation.

Our results were surprising in view of the results from similarprevious works, almost all of which showed no improvement ofglucose consumption rate or product formation rates. For exam-ple, neither individual overproduction of many glycolytic en-zymes, hexokinase, PGI, PFK, PGK, PGM, PYK, or simultaneousoverproduction of PFK and PYK in yeast had any effect on theglycolytic flux or ethanol production rate (18, 31). In Lactococcuslactis, increasing the GAPDH activity resulted in no change in theglycolytic flux (35); the pyk overexpressing variant revealed a de-creased rate of glucose consumption and product formation inspite of accelerated FBP intermediate metabolite depletion andNAD� recovery (27). Snoep et al. reported that decreases in gly-colytic flux and growth rate were observed in individual GAPDH-,PGK-, and PGM-overproducing Zymomonas mobilis (33). Also,aldolase had little effect on glucose flux in E. coli (1). Authors inseveral reports concluded that glycolytic enzymes were present inlarge excesses in microorganisms and, therefore, modulating gly-colytic enzyme activity had very little effect on the glycolytic fluxand product formation (18, 34). Others have reported that simul-taneous modulation of several steps or accurate adjustment of

FIG 7 Models of the flux balance for alanine formation from glucose. Values show glucose consumption rate and formation rates of each product (mM/h).Abbreviations: AA, acetic acid; SA, succinic acid; Ala, alanine.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

individual activities to specific levels might be necessary in orderto increase the glycolytic flux (31, 35). However, in our results,increase in one or two glycolytic enzyme activities significantlyimproved glucose consumption rate and alanine yield. In light ofthese differences between our results and previous reports, someprimary factors thought to explain the results of our study in-clude that (i) our bioprocess utilizes high cell density underoxygen deprivation (which is equivalent to nongrowth condi-tions of other works), promoting pronounced effects on theglucose consumption rate upon glycolytic gene overexpression(3, 6, 9); and (ii) our targeting of a simple and single endproduct by restraining by-product formation resulted in com-paratively bigger effects than those that would be realized uponalteration of multiple end products (6).

Previously, we reported the construction of genetically en-gineered C. glutamicum highly capable of lactic acid (23), suc-cinic acid (22), ethanol (10), and valine (7) production. Theapproach in these reports was based on a tailor-made strategyinvolving metabolic optimization of a specific product path-way, not the common pathway, glycolysis. The present study,on the other hand, cast the spotlight on the overexpression ofglycolytic genes to improve glucose metabolism by C. glutami-cum under specific nongrowing conditions. Recombinantsoverexpressing these glycolytic genes have the potential to bewidely used as hosts for biochemical production of many prod-ucts. Great hope for further development lies in additionalglycolytic gene overexpression. Investigation of carbon fluxcontrol by glycolytic enzyme manipulation is not completelyunderstood yet, but the results of this study reveal a high po-tential for developments along this line.

ACKNOWLEDGMENTS

We thank Crispinus A. Omumasaba (RITE) for critical reading of themanuscript.

This work was partially supported by a grant from the New Energy andIndustrial Technology Development Organization, Japan.

REFERENCES1. Babul J, Clifton D, Kretschmer M, Fraenkel DG. 1993. Glucose metab-

olism in Escherichia coli and the effect of increased amount of aldolase.Biochemistry 32:4685– 4692.

2. Blombach B, et al. 2011. Corynebacterium glutamicum tailored for effi-cient isobutanol production. Appl. Environ. Microbiol. 77:3300 –3310.

3. Davies SE, Brindle KM. 1992. Effects of overexpression of phosphofruc-tokinase on glycolysis in the yeast Saccharomyces cerevisiae. Biochemistry31:4729 – 4735.

4. Dominguez H, et al. 1998. Carbon-flux distribution in the central met-abolic pathways of Corynebacterium glutamicum during growth on fruc-tose. European journal of biochemistry / FEBS. 254:96 –102.

5. Ehira S, Shirai T, Teramoto H, Inui M, Yukawa H. 2008. Group 2 sigmafactor SigB of Corynebacterium glutamicum positively regulates glucosemetabolism under conditions of oxygen deprivation. Appl. Environ. Mi-crobiol. 74:5146 –5152.

6. Emmerling M, Bailey JE, Sauer U. 2000. Altered regulation of pyruvatekinase or co-overexpression of phosphofructokinase increases glycolyticfluxes in resting Escherichia coli. Biotechnol. Bioeng. 67:623– 627.

7. Hasegawa S, et al. 2012. Improvement of the redox balance increasesL-valine production by Corynebacterium glutamicum under oxygen depri-vation. Appl. Environ. Microbiol. 78:865– 875.

8. Hashimoto S, Ozaki A. 1999. Whole microbial cell processes for manu-facturing amino acids, vitamins or ribonucleotides. Curr. Opin. Biotech-nol. 10:604 – 608.

9. Hatzimanikatis V, Emmerling M, Sauer U, Bailey JE. 1998. Applicationof mathematical tools for metabolic design of microbial ethanol produc-tion. Biotechnol. Bioeng. 58:154 –161.

10. Inui M, Kawaguchi H, Murakami S, Vertes AA, Yukawa H. 2004.Metabolic engineering of Corynebacterium glutamicum for fuel ethanolproduction under oxygen-deprivation conditions. J. Mol. Microbiol. Bio-technol. 8:243–254.

11. Inui M, et al. 2004. Metabolic analysis of Corynebacterium glutamicumduring lactate and succinate productions under oxygen deprivation con-ditions. J. Mol. Microbiol. Biotechnol. 7:182–196.

12. Inui M, et al. 2007. Transcriptional profiling of Corynebacterium glutami-cum metabolism during organic acid production under oxygen depriva-tion conditions. Microbiology 153:2491–2504.

13. Jetten MS, Sinskey AJ. 1995. Recent advances in the physiology and geneticsof amino acid-producing bacteria. Crit. Rev. Biotechnol. 15:73–103.

14. Jojima T, Fujii M, Mori E, Inui M, Yukawa H. 2010. Engineering ofsugar metabolism of Corynebacterium glutamicum for production ofamino acid L-alanine under oxygen deprivation. Appl. Microbiol. Bio-technol. 87:159 –165.

15. Kinoshita S. 1985. Glutamic acid bacteria, p 115–146. Biology of Indus-trial Microorganisms. Cummings, London, United Kingdom.

16. Koebmann B, Solem C, Jensen PR. 2006. Control analysis of the impor-tance of phosphoglycerate enolase for metabolic fluxes in Lactococcus lactissubsp. lactis IL1403. Syst. Biol. (Stevenage) 153:346 –349.

17. Mueller U, Huebner S. 2003. Economic aspects of amino acids produc-tion. Adv. Biochem. Eng. Biotechnol. 79:137–170.

18. Muller S, Zimmermann FK, Boles E. 1997. Mutant studies of phospho-fructo-2-kinases do not reveal an essential role of fructose-2,6-bisphosphate in the regulation of carbon fluxes in yeast cells. Microbiol-ogy 143:3055–3061.

19. Nakayama K, Kitada S, Kinoshita S. 1961. Studies on lysine fermentationI. The control mechanism on lysine accumulation by homoserine andthreonine. J. Gen. Appl. Microbiol. 7:145–154.

20. Ohashima T, Soda K. 1979. Purification and properties of alanine dehy-drogenase from Bacillus sphaericus. Eur. J. Biochem. 100:29 –30.

21. Okino S, Inui M, Yukawa H. 2005. Production of organic acids byCorynebacterium glutamicum under oxygen deprivation. Appl. Microbiol.Biotechnol. 68:475– 480.

22. Okino S, et al. 2008. An efficient succinic acid production process in ametabolically engineered Corynebacterium glutamicum strain. Appl. Mi-crobiol. Biotechnol. 81:459 – 464.

23. Okino S, Suda M, Fujikura K, Inui M, Yukawa H. 2008. Production ofD-lactic acid by Corynebacterium glutamicum under oxygen deprivation.Appl. Microbiol. Biotechnol. 78:449 – 454.

24. Omumasaba CA, Okai N, Inui M, Yukawa H. 2004. Corynebacteriumglutamicum glyceraldehyde-3-phosphate dehydrogenase isoforms withopposite, ATP-dependent regulation. J. Mol. Microbiol. Biotechnol. 8:91–103.

25. Pal-Bhowmick I, et al. 2004. Cloning, over-expression, purification andcharacterization of Plasmodium falciparum enolase. Eur. J. Biochem. 271:4845– 4854.

26. Pearce AK, et al. 2001. Pyruvate kinase (Pyk1) levels influence both therate and direction of carbon flux in yeast under fermentative conditions.Microbiology 147:391– 401.

27. Ramos A, et al. 2004. Effect of pyruvate kinase overproduction on glucosemetabolism of Lactococcus lactis. Microbiology 150:1103–1111.

28. Sakurai N, Shibata D. 2006. KaPPA-View for integrating quantitativetranscriptomic and metabolomic data on plant metabolic pathway maps.J. Pestic. Sci. 31:293–295.

29. Sambrook J, Fritsh EF, Maniatis T. 1989. Molecular cloning: a laboratorymanual, 2nd ed. New York Cold Spring Harbor Laboratory Press, NewYork, NY.

30. Sasaki M, Jojima T, Inui M, Yukawa H. 2008. Simultaneous utilizationof D-cellobiose, D-glucose, and D-xylose by recombinant Corynebacte-rium glutamicum under oxygen-deprived conditions. Appl. Microbiol.Biotechnol. 81:691– 699.

31. Schaaff I, Heinisch J, Zimmermann FK. 1989. Overproduction of gly-colytic enzymes in yeast. Yeast 5:285–290.

32. Sekine H, et al. 2001. H�-ATPase defect in Corynebacterium glutamicumabolishes glutamic acid production with enhancement of glucose con-sumption rate. Appl. Microbiol. Biotechnol. 57:534 –540.

33. Snoep JL, Yomano LP, Westerhoff HV, Ingram LO. 1995. Proteinburden in Zymomonas mobilis: negative flux and growth control due tooverproduction of glycolytic enzymes. Microbiology 141:2329 –2337.

34. Solem C, Koebmann B, Jensen PR. 2008. Control analysis of the role of

Yamamoto et al.



.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

triosephosphate isomerase in glucose metabolism in Lactococcus lactis. IETSyst. Biol. 2:64 –72.

35. Solem C, Koebmann BJ, Jensen PR. 2003. Glyceraldehyde-3-phosphatedehydrogenase has no control over glycolytic flux in Lactococcus lactisMG1363. J. Bacteriol. 185:1564 –1571.

36. Solem C, Petranovic D, Koebmann B, Mijakovic I, Jensen PR.2010. Phosphoglycerate mutase is a highly efficient enzyme withoutflux control in Lactococcus lactis. J. Mol. Microbiol. Biotechnol. 18:174 –180.

37. Suzuki N, et al. 2005. Large-scale engineering of the Corynebacteriumglutamicum genome. Appl. Environ. Microbiol. 71:3369 –3372.

38. Terasawa M, Yukawa H. 1993. Industrial production of biochemicals bynative immobilization. Bioprocess Technol. 16:37–52.

39. Tokimatsu T, et al. 2005. KaPPA-view: a Web-based analysis tool forintegration of transcript and metabolite data on plant metabolic pathwaymaps. Plant Physiol. 138:1289 –1300.

40. Tsuchida Y, Kimura S, Suzuki N, Inui M, Yukawa H. 2009. Character-ization of a new 2.4-kb plasmid of Corynebacterium casei and developmentof stable corynebacterial cloning vector. Appl. Microbiol. Biotechnol. 81:1107–1115.

41. Vertès AA, Inui M, Kobayashi M, Kurusu Y, Yukawa H. 1993. Presenceof mrr- and mcr-like restriction systems in coryneform bacteria. Res. Mi-crobiol. 144:181–185.

42. Yamamoto S, Sakai M, Inui M, Yukawa H. 2011. Diversity of metabolic shiftin response to oxygen deprivation in Corynebacterium glutamicum and itsclose relatives. Appl. Microbiol. Biotechnol. 90:1051–1061.




.asm.org/

Dow

nloaded from

http://aem.asm.org

http://aem.asm.org/

overexpression of genes encoding glycolytic enzymes in ... · carbon ﬂow through the glycolytic...

Documents