overexpressionofcyclind1promotestumorcellgrowth ... › ... › 11 › 16 › 6075.full-text.pdf ·...

Overexpression of Cyclin D1 Promotes Tumor Cell Growthand Confers Resistance to Cisplatin-Mediated Apoptosisin an Elastase-myc Transgene^ExpressingPancreaticTumor Cell LineHector Biliran, Jr.,1Yong Wang,1Sanjeev Banerjee,1Haiming Xu,1Henry Heng,2 Archana Thakur,1

Aliccia Bollig,1Fazlul H. Sarkar,1andJoshua D. Liao1

Abstract Purpose: Elevated cyclin D1 in human pancreatic cancer correlates with poor prognosis.Because pancreatic cancer is invariably resistant to chemotherapy, the goal of this study wasto examine whether the drug resistance of pancreatic cancer cells is in part attributed to cyclinD1overexpression.Experimental Design: Stable overexpression and small interfering RNA (siRNA)^mediatedknockdown of cyclin D1were done in the newly established Ela-myc pancreatic tumor cell line.Cisplatin sensitivity of control, overexpressing, and siRNA-transfected cells was determined bythe 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, clonogenic, and apoptoticassays [DNA fragmentation, sub-G1, and poly(ADP-ribose) polymerase cleavage analysis]. Therole of nuclear factor-nB and apoptotic proteins in cyclin D1-mediated chemoresistance wasexamined by EMSA andWestern blotting, respectively.Results:Overexpressionof cyclinD1in Ela-myc pancreatic tumor cells promoted cellproliferationand anchorage-independent growth. Moreover, cyclin D1^ overexpressing cells exhibited signifi-cantly reducedchemosensitivity andahigher survival rate uponcisplatin treatment, as determinedby 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and clonogenic assays,respectively. Although overexpression of cyclin D1rendered cells more resistant to cisplatin-induced apoptosis, siRNA-directed suppression of cyclin D1expression resulted in enhancedsusceptibility to cisplatin-mediated apoptosis. The attenuation of cisplatin-induced cell death incyclinD1^ overexpressingcellswas correlatedwith theup-regulationofnuclear factor-nBactivityandmaintenance of bcl-2 and bcl-xl protein levels.Conclusions:These results suggest that overexpression of cyclin D1can contribute to chemo-resistance of pancreatic cancer cells because of the dual roles of cyclin D1 in promoting cellproliferation and in inhibiting drug-induced apoptosis.

Human pancreatic cancer is an aggressive disease that currentlyhas no viable treatment. This is mainly due to late diagnosisand resistance of the cancer cells to conventional chemother-apeutic agents (1–3). Previous studies have addressed theclinical relevance of cyclin D1 in pancreatic cancer (4–7). Asignificant proportion of pancreatic cancer cases show over-expression of the cyclin D1 gene (5, 8). Furthermore, increasedcyclin D1 expression is associated with poor prognosis (5) and

decreased postoperative patient survival (8). However, themolecular mechanisms underlying the poor prognostic valueof elevated cyclin D1 in pancreatic cancer remain unknown.

The proto-oncogenic function of cyclin D1 has beenattributed in part to its role in promoting cell cycle progression.Cyclin D1 is a key cell cycle regulator of the G1 to S phaseprogression (9, 10). The binding of cyclin D1 to cyclin-dependent kinase (cdk4 or cdk6) leads to the phosphorylationof retinoblastoma protein (pRb) subsequently triggering therelease of E2F transcription factors to allow transcription ofgenes required for the G1 to S phase progression of the cell cycle(11–13). Consistent with this function, overexpression ofcyclin D1 results in a more rapid progression from the G1 to Sphase transition and in a reduced serum dependency infibroblast cells (14–16).

In addition to its role in cell cycle regulation, cyclin D1 is alsointricately involved in the regulation of apoptosis. The effect ofcyclin D1 can be pro- or antiapoptotic, depending on theproliferative and differentiated state of the cell (17). Inparticular, overexpression of cyclin D1 leads to the inductionof apoptosis in quiescent, postmitotic neurons (18),

Cancer Therapy: Preclinical

Authors’ Affiliations: 1Department of Pathology and 2Center for MolecularMedicine and Genetics, Wayne State University School of Medicine, Detroit,MichiganReceived11/24/04; revised 2/24/05; accepted 3/25/05.Grant support: NIH grants RO1CA100864 (J.D. Liao).The costs of publication of this article were defrayed in part by the payment of pagecharges.This article must therefore be hereby marked advertisement in accordancewith18 U.S.C. Section1734 solely to indicate this fact.Requests for reprints: Joshua D. Liao, Department of Pathology, KarmanosCancer Institute,Wayne State University School of Medicine, Detroit, MI 48201.Phone: 313-966-9376; Fax: 313-966-7558; E-mail: [email protected].

F2005 American Association for Cancer Research.doi:10.1158/1078-0432.CCR-04-2419

www.aacrjournals.org Clin Cancer Res 2005;11(16) August15, 20056075

Research. on July 9, 2020. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

growth-restricted fibroblasts (19), or irradiated fibroblasts (20).On the other hand, abrogation of cyclin D1 expression by theantisense strategy predisposed human lung cancer cells andvarious squamous carcinoma cell lines to apoptosis (21, 22).Furthermore, transcriptional up-regulation of endogenouscyclin D1 inhibits apoptosis in human choriocarcinoma cells(23), whereas overexpression of cyclin D1 protein attenuatesdrug-induced apoptosis in rat embryonic fibroblasts (24).Taken together, these latter studies indicate the prosurvivalfunction of cyclin D1 in tumor cells.

One of the hallmarks of pancreatic cancer is its resistance tochemotherapeutic agents. Although overexpression of cyclin D1has been associated with a poor clinical outcome, therelationship between elevated cyclin D1 and chemoresistancein pancreatic cancer cells has not been extensively studied.Kornmann et al. (6) first reported that inhibition of cyclin D1expression using an antisense strategy not only suppressedpancreatic cancer cell growth but also potentiated the anti-proliferative effect of cisplatinum. Suppression of cyclin D1expression in human pancreatic cells was also associated withthe enhanced growth-inhibitory effect of fluoropyrimidinecompounds and decreased expression of multiple chemo-resistance genes. Overall, these studies suggest that cyclin D1exerts a protective effect against drug-induced cytotoxicity. Theprecise mechanism of cyclin D1-mediated chemoresistance,however, remains to be identified.

We report here that in addition to promoting cell prolifer-ation and anchorage-independent growth, overexpression ofcyclin D1 in an elastase-myc (Ela-myc) transgene expressingpancreatic tumor cell line significantly decreases chemosensi-tivity to cisplatin treatment. The cyclin D1 overexpressing cellsdisplayed a higher survival rate and increased resistance toapoptosis when challenged with cisplatin. Conversely, smallinterfering RNA (siRNA)–directed suppression of cyclin D1expression in these cells resulted in increased susceptibility tocisplatin-induced apoptosis. The attenuation of cisplatin-induced cell death in cyclin D1-overexpressing cells wasassociated with the up-regulation of nuclear factor-nB(NF-nB) activity and maintenance in the protein levels of bcl-2 and bcl-xl. Collectively, these findings suggest that elevatedcyclin D1 may contribute to chemoresistance in pancreaticcancer cells by promoting cell proliferation and inhibiting drug-induced apoptosis.

Materials andMethods

Establishment of an elastase-myc pancreatic tumor cell line. Weobtained one male c-myc transgenic mouse (C57BL/6 � SJL back-ground) driven by elastase-1 gene promoter (Ela-myc) from Dr.Sandgren (Department of Pathobiological Sciences, University ofWisconsin-Madison, Madison, WI) (25) and crossed it with a FVBfemale mouse. The F1 pups were crossed with each other to produce F2generation of transgene carriers, which developed pancreatic tumorsbetween 2 and 7 months of age. As originally reported by Sandgrenet al. (25), half of the tumors were acinar cell adenocarcinomas and theother half were ductal cell adenocarcinomas or mixed acinar cell andductal cell tumors. At the time of sacrifice of a tumor-bearing mouse, asmall piece of the pancreatic tumor tissue (explant), which was laterfound to contain both ductal and acinar tumor cells, was immediatelyplaced into a culture dish containing minimal essential mediumsupplemented with 10% FCS, essential and nonessential amino acids,10 Ag/mL insulin, 20 ng/mL epidermal growth factor (to inhibit

fibroblasts), 2 mmol/L glutamine, penicillin G (100 units/mL), andstreptomycin (100 Ag/mL) termed as primary cell culture medium. Cellswith typical cancer cell morphology were selected (at f10 passages) asclones for further passaging. The elastase-myc pancreatic tumor cell linewas generated from one of the clones and subsequently maintained inmonolayer culture at 37jC in humidified air with 5% CO2.

Spectral karyotyping. Cultured cells were treated with Colcemid for

4 hours prior to harvesting mitotic cells. Collected cells were then treated

with hypotonic solution and dropped on microscope slides after fixation

according to standard protocols (26). Chromosomal slides were

pretreated, denatured, and hybridized with denatured mouse-specific

spectral karyotyping painting probes for 48 hours at 37jC. After color

detection and image acquisition, chromosomes were analyzed (27, 28).Constructs and transfection. The 1.7 kb mouse cyclin D1 cDNA

(Dr. Sherr, St. Jude’s Children’s Hospital), which contains the entirecoding sequence, was subcloned into the pcDNA3.1 vector (LifeTechnologies, Gaithersburg, MD), termed pcDNA3.CCND1. Theelastase-myc pancreatic cancer cells were transfected in a stablemanner with the pcDNA3.CCND1 plasmid or the pcDNA3.1Neovector control plasmid using LipofectAMINE 2000 as prescribed by themanufacturer (Life Technologies). After 48 hours of incubation,transfected cells were selected in primary cell culture mediumcontaining 200 Ag/mL G418. After 2 to 3 weeks, single independentclones were randomly isolated, and each individual clone was platedseparately. After clonal expansion, cells from each independent clonewere tested for cyclin D1 expression by immonoblotting. The primarycell culture medium for cell lines containing a neomycin resistancegene was supplemented with 100 Ag/mL G418 (Life Technologies).

Protein extraction and Western blotting. Proteins were extractedfrom subconfluent culture of cells and were subjected to Western blotanalysis as described previously (29). After blocking with 5% nonfatmilk in PBS-T for 1 hour at room temperature, the membranes wereblotted with primary antibody, followed by incubation with aperoxidase-conjugated secondary antibody. Bound antibodies werevisualized using enhanced chemiluminescence (Pierce, Rockford, IL).The primary antibodies used were rabbit polyclonal antibody to cyclinD1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, sc-717, 1:1,000dilution), rabbit polyclonal antibody to c-myc (Santa Cruz Biotechnol-ogy, sc-764, 1:1,000), mouse monoclonal antibody to pan-cytokeratin(Santa Cruz Biotechnology, sc-17843), goat polyclonal antibody toamylase (Santa Cruz Biotechnology, sc-12821), mouse monoclonalantibody to poly(ADP-ribose) polymerase (PARP; Biomol, 1:2,500dilution), mouse monoclonal antibody to pRB (PharMingen, SanDiego, CA, 1:500 dilution), rabbit polyclonal antibody to bcl-2 (SantaCruz Biotechnology, sc-492, 1:1000 dilution), rabbit polyclonalantibody to bax (Santa Cruz Biotechnology, sc-526, 1:1000 dilution),rabbit polyclonal antibody to p53 (Santa Cruz Biotechnology, sc-6243,1:1,000 dilution), and rabbit polyclonal antibody to bcl-xl (Calbio-chem, La Jolla, CA, 1:500 dilution).

RT-PCR analysis. Total RNA was isolated from exponentially

growing cells using the RNeasy Isolation Kit (Qiagen, Valencia, CA).The extracted RNA (1 Ag) was reversed-transcribed with the TaqMan

reverse transcriptase in the presence of oligo(dT)15 primer as described

by the manufacturer (Roche, Applied Biosystems, Foster City, CA).The resulting cDNA preparation was subjected to PCR amplification

using an exogenous cyclin D1 primer set with the forward primer (5V-CTACCGCACAACGCACTTTC-3V) identifying a neo-specific sequence

located upstream of the cyclin D1 cDNA sequence and the reverse

primer (5V-TAGAAGGCACAGTCGAGG-3V) specific to a cyclin D1 exonfor 25 cycles. Each PCR cycle included a denaturation step at 94jC for

30 seconds, a primer-annealing step at 55jC for 45 seconds, and anextension step at 72jC for 45 seconds. Reactions were done in an

Eppendorf AG Mastercycler (Hamburg, Germany). To confirm equal

loading, PCR amplification of the h-actin gene was also done inparallel. The primers used for h-actin PCR amplification were 5V-ACGGATTTGGTCGTATTGGG-3V and 5V-TGATTTTGGAGGGATCTCGC-

3V. The PCR products were analyzed by electrophoresis on 1%


www.aacrjournals.orgClin Cancer Res 2005;11(16) August15, 2005 6076



agarose gel containing ethidium bromide, and photographed under

UV light.Cell proliferation assay. Cell growth was determined by the 3-(4,5-

dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colori-metric assay (30). Neo control and cyclin D1-overexpressing cloneswere plated onto 96-well plates (3.0 � 103 cells/well) and culturedovernight to allow for cell attachment. Cells were then grown inprimary cell culture medium containing 0.1%, 1.0%, 3.0%, or 5.0%FCS. At daily intervals (24, 48, 72, 96, 120, and 144 hours), the numberof viable cells was determined by MTT assay. Briefly, cells wereincubated with 0.2 Ag/mL MTT for 2 hours in the dark at 37jC. Afterremoval of the medium, the dye crystals were dissolved in isopropanoland the absorbance was measured at 570 nm with an UltraMultifunctional Microplate Reader (Tecan, Durham, NC). Threeindependent experiments were done in quadruplicate wells. Todetermine doubling times, the natural logarithm of absorbance at570 nm was plotted as a function of time and the doubling time wascalculated using the following formula: number of doublings perhour = ln y2 � ln y1/ln 2 / x2 � x1, where x1, y1, and x2, y2 were twopoints on the steepest part of the plot.

To assess the chemosensitivity to cisplatinum and gemcitabine, neovector control and cyclin D1-overexpressing clones were plated onto a96-well plate (3.0 � 103 cells/well) and incubated with variousconcentrations of cisplatin (0.5, 1.0, and 2.0 Amol/L) or gemcitabine(10, 20, or 30 nmol/L). After 72 hours of treatment, cells were subjectedto MTT assay as described above.

Cell cycle analysis. Subconfluent cultures of neo vector control and

cyclin D1 overexpressing cells were trypsinized, collected, and washed

twice with PBS. Cell pellets were resuspended in 0.5 mL of PBS and

fixed in 4.5 mL of 70% ethanol and stored at 4jC. On the day of

analysis, cells were collected by centrifugation and the pellets were

resuspended in 0.2 mg/mL of propidium iodide containing 0.1% Triton

X-100 and RNase A (1 mg/mL, both from Sigma, St. Louis, MO). The

cell suspension was incubated in the dark for 30 minutes at room

temperature and subsequently analyzed on a Coulter EPICS 753 flow

cytometer for DNA content. The percentage of cells in different phases

of the cell cycle was determined using a ModFit 5.2 computer program.Soft agar assay. Anchorage-independent growth of neo vector

control and cyclin D1 overexpressing clones was assessed by a double-layer soft agar assay (31). Briefly, 1.0 � 104 cells were suspended in 0.3%agar containing primary cell culture medium plus 5% FCS and plated intriplicate in six-well plates onto a base layer of 0.5% agar containingprimary cell culture medium plus 5% FCS. The cells were re-fed with0.3% agar containing primary cell culture medium plus 5% FCS every 5days. After 4 weeks of growth, the number of colonies were counted.

Clonogenic survival assay. Neo vector and cyclin D1–overexpressing

cells were seeded at a density of 2.0 � 105 in a 24-well plate and

allowed to adhere overnight. The cells were then treated with variousconcentrations of cisplatin (0.125, 0.250, 0.50, and 1.0 Amol/L).

Twelve hours after cisplatin addition, cells were trypsinized, counted,

and reseeded at a low density (10,000 cells in a 10 cm dish)in triplicate. Medium was replaced every 3 days, and the cells were

allowed to grow for 10 days. The colonies were fixed with methanol-

acetic acid (3:1), stained with 1% crystal violet, and counted. The

survival fraction was determined by dividing the number of coloniesformed in the presence of the drugs by the number of colonies formed

in the untreated control cells. Each dose was done in triplicate, and the

experiments were done at least thrice.Apoptosis assays. Neo vector control and cyclin D1–overexpressing

cells were incubated with 10 Amol/L cisplatin for 48 hours. Aftertreatment, both attached and floating cells were collected and subjectedto the following apoptosis assays: (a) for DNA ladder analysis, cellswere lysed in 10 mmol/L Tris (pH 8.0), 1 mmol/L EDTA, and 0.2%Triton X-100, incubated overnight with 100 Ag/mL proteinase at 37jC,and followed by RNase treatment. Genomic DNA was extracted withphenol chloroform, and precipitated with ethanol in the presence of0.3 mol/L potassium acetate. DNA was separated in a 2% agarose gel,

followed by ethidium bromide staining. (b) The quantitation ofcytoplasmic histone-associated DNA fragments was done using theCell Death Detection ELISA kit (Roche). Briefly, cells were lysed and celllysates were overlaid and incubated in microtiter plate modules coatedwith antihistone antibody. Samples were subsequently incubated withanti-DNA peroxidase followed by color development with ABTSsubstrate. The absorbance of the samples was determined by the UltraMultifunctional Microplate Reader (Tecan) at 405 nm. (c) Thepercentage of cells with sub-G0/G1 DNA content was determined byflow cytometry following staining with propidium iodide using theprocedure described above. (d) The cleavage of PARP was examined byimmunoblotting as described above.

Small interfering RNA studies. Chemically synthesized murinecyclin D1-specific siRNAs (sc-29287) and the control siRNAs (sc-37007,5V-CGAACUCACUGGUCUGACCdtdt-3V, sense strand; 5V-GGUCAGAC-CAGUGAGUUCGdtdt-3V, antisense strand) were purchased from SantaCruz Biotechnology. The second set of murine cyclin D1 specific siRNA(qia-815) was purchased from Qiagen with the following sequences:sense strand, 5V-AUGCCAGAGGCGGAUGAGAdtdt-3V; and antisensestrand, 5V-UCUCAUCCGCCUCUGGCAUdtdt-3V. For siRNA transfec-tion, 5 � 105 cells/well were plated in six-well plates and transfectedwith 80 nmol/L cyclin D1 siRNA or control siRNA for 48 hours usingLipofectAMINE 2000 as a transfection mediator according to themanufacturer’s instructions (Life Technologies). To assess the effect ofcyclin D1 down-regulation on chemosensitivity, cyclin D1 or controlsiRNA-transfected cells were plated in 96-well plates containingcomplete medium and allowed to recover for 24 hours, and treatedwith 2 Amol/L of cisplatin for 72 hours. Cell viability was evaluated byMTT assay as described above. To assay apoptosis induction aftercisplatin treatment, siRNA-transfected cells were subcultured in 24-wellplates and allowed to recover for 24 hours in complete medium andtreated with 2 Amol/L cisplatin for 72 hours. Apoptosis induction wasthen quantified by using the Cell Death Detection ELISA kit (Roche)and sub-G1 DNA content assay as described above.

Electrophoretic mobility shift assay for measuring NF-jB activity. Neovector control and cyclin D1 overexpressing cells were incubated in thepresence or absence of 10 Amol/L cisplatin for 24 hours. Followingtreatment, the cells were collected and nuclear proteins were extractedas previously described (32). Electrophoretic mobility shift assay wasdone by preincubating 10 Ag of nuclear extract with a binding buffercontaining 20% glycerol, 100 mM MgCl2, 2.5 mmol/L EDTA,2.5 mmol/L DTT, 250 mmol/L NaCl, 50 mmol/L Tris-HCl, and 0.25mg/mL poly (dI:dC) for 10 minutes. After the addition of IRDye-700labeled NF-nB oligonucleotide, samples were incubated for an addi-tional 20 minutes. The DNA-protein complexes were electrophoresedin an 8.0% native polyacrylamide gel, and then visualized by OdysseyInfrared Imaging System using Odyssey Software Release 1.1. Toidentify proteins in the DNA-protein complex, a supershift experimentwas done with polyclonal anti-NF-nB p50 and p65 subunit-specificantibodies. The anti-cyclin D1 antibody was used as the nonspecific,negative control antibody. Briefly, nuclear proteins were incubated for30 minutes with different antibodies and assayed for supershift by gelshift assay as described above. The anti-p65 (sc-8008) and anti-p50(sc-7178) antibodies were purchased from Santa Cruz Biotechnology.

Statistics. Statistical analysis was done with GraphPad PrismSoftware (El Camino Real, San Diego, CA). Results are expressed asmean F SD or as mean F SE, and Student’s t test was used for statisticalanalysis. P < 0.05 was taken as the level of significance.

Results

Elastase-myc pancreatic cancer cell line expressed both acinarand ductal markers. Of several elastase-myc pancreatic celllines we recently established, the one used in this study wascharacterized preliminarily. The cells grew as an adheringmonolayer and were continuously maintained in culture.

Cyclin D1^Mediated Resistance to Cisplatin-Induced Apoptosis




Growth kinetic analysis showed that the average cell populationdoubling time ranged from 42.5 to 52.5 hours. Furthercharacterization revealed that these cells grew under anchor-age-independent conditions with a colony-forming efficiency of5% to 10% in soft agar assay. Cytogenetic analysis usingspectral karyotyping revealed the typical morphologic featuresof mouse chromosomes with no contamination of chromo-somal materials of other origin. Although no consistentchromosomal translocations or rearrangements were detected,spectral karyotyping analysis showed that the chromosomalnumber varied between 45 and 69. The representative4V,6-diamidino-2-phenylindole-stained and spectral images ofmetaphase spread chromosomes are shown in Fig. 1A and B. Inorder to provide information regarding the origin of this cellline, the mRNA and protein expression of acinar and ductalcell–specific markers were examined by RT-PCR and Westernblot analysis, respectively. RT-PCR analysis revealed theexpression of acinar (trypsin, RNase, elastase) and ductal

(carbonic anhydrase 2, cytokeratin 19, mucin) cell markers(Fig. 1C; Table 1). Furthermore, Western blot analysis detectedthe expression of amylase (acinar marker) and pan-cytokeratin(ductal marker) in the elastase-myc pancreatic cancer cells(Fig. 1D). The expression of these acinar and ductal cell markerswas maintained at various (10, 15, 20) passages. The presenceof both ductal and acinar markers in this cell line is similarto several widely used human pancreatic adenocarcinoma celllines such as MDAPanc-28 and Capan-1 (33, 34), and maypartly be attributed to the enormous plasticity or transdiffer-entiation of pancreatic cells which are known to change theirphenotype from one type to another (acinar to ductal or viceversa; refs. 35–38). Although determination of the preciseorigin of the Ela-myc pancreatic cancer cell line requires furtherdetailed molecular characterization, the stronger expression ofcarbonic anhydrase 2, cytokeratin 19, and pan-cytokeratin thantrypsin, elastase, and amylase seems to indicate that this cellline exhibits a more prominent ductal phenotype.

Fig. 1. Initial characterization of the elastase-myc pancreatic cancer cell line. A and B, spectral karyotyping of mouse chromosomes. A, representative inverted image of the4V,6-diamidino-2-phenylindole ^ stained chromosomes inmetaphase spread. B, color image of the samemetaphase spread shown in (A) following per-pixel classification ofthe spectral data. RT-PCR (C) andWestern blot (D) analyses for the expression of acinar and ductal cell markers in an Ela-myc pancreatic cancer cell line. C, expression ofacinar (trypsin, RNase, elastase) and ductal (carbonic anhydrase 2, cytokeratin19, mucin)marker genes byRT-PCRanalysis in an Ela-myc pancreatic cancer cell line. Cells fromvarious passages [10 (lanes1and 4),15 (lanes 2 and 5), 20 (lanes 3 and 6)] were harvested for RNA isolation and subjected to RT-PCRanalysis as described inMaterials andMethods using gene-specific primers shown in (Table1). h-Actin was used as a control for loading.D,Western blot analysis of amylase and pan-cytokeratin.Total cellularprotein (50 Ag) from Ela-myc pancreatic cancer cells at various passages [10 (lane1),15 (lane 2), 20 (lane 3)] was subjected to immunoblotting with a specific antibody toamylase or pan-cytokeratin.





Cyclin D1 is overexpressed in an elastase-myc pancreatic cancercell line. A novel elastase-myc pancreatic tumor cell line (Ela-myc) was chosen as the parental cell line for the ectopicoverexpression of cyclin D1 because microarray and Westernblot analysis confirmed the low basal level of endogenouscyclin D1 in this pancreatic tumor cell line, probably due tosuppression of cyclin D1 by c-myc (39–41). Because theendogenous cyclin D1 expression is highly dependent on serumand mitogenic factors, the stable clonal lines were firstsubjected to serum-starved conditions (0.1% serum) andsubsequently screened for exogenous cyclin D1 expression. Asshown in Fig. 2A, elevated levels of cyclin D1 protein wasobserved in most cyclin D1 clones but not in the neo vectorcontrol cells. RT-PCR analysis with primers for exogenouscyclin D1 shows a specific 300 bp product that was detectedonly in cyclin D1 clones and not in neo control clones(Fig. 2B). Based on their expression level of cyclin D1, we choseEla-myc cyclin D1.4, D1.5, and D1.12 clones for subsequentstudies. It is noteworthy that both the neo vector control andcyclin D1-overexpressing clones expressed comparable levels ofc-myc protein (Fig. 2C). Furthermore, Western blotting using aphospho-specific antibody to Ser780 of the pRb detected higherlevels of phosphorylated pRb in cyclin D1 overexpressingclones than in control clones, suggesting that the ectopicallyexpressed cyclin D1 is functional (Fig. 2C).

Cyclin D1 overexpression enhanced cell proliferation and cellcycle progression. We first investigated the effect of elevatedcyclin D1 expression on the growth properties of Ela-mycpancreatic tumor cell line by the MTT assay. Cyclin D1transfectants showed a markedly higher proliferation ratecompared with the neo vector control cells under variousserum concentrations (Fig. 3; Table 2). The enhanced prolifer-ative potential of cyclin D1 clones remained significant evenunder low serum conditions (1.0% and 3.0%), although theirproliferation rate was less under 5% serum condition. At 1.0%serum concentration, the cyclin D1-overexpressing clonescontinued to grow, albeit at a much slower rate, whereasproliferation of the neo control cells ceased. However, underserum-starved conditions (0.1% serum concentration), thecyclin D1-overexpressing clones did not show any growth

advantage compared with neo controls, suggesting that eleva-tion of cyclin D1 alone is not sufficient to promote cellproliferation independent of certain serum-derived growth-promoting factors. Furthermore, the cyclin D1-overexpressingclones (D1.4, D1.5, D1.12) showed a 2- to 3-fold higher colony-forming efficiency in a soft agar assay compared with the neo

Table1. List of gene-specific primers, expected product sizes, and reaction conditions for RT-PCRanalysis

Gene name Primer sequences (5V!3V) Genbankaccession no.

Productsize (bp)

PCR cycle parameters No. ofcycles

Trypsin (Try) F:GATGACAAGATCGTTGGAGGA NM_035776 308 94jC (30 s); 55jC (30 s); 72jC (30 s) 30R:ACTCTGGCATTGAGGGTCAC

Cytokeratin-19 (Ck-19) F:TGATCGTCTCGCCTCCTACT NM_008471 374 94jC (30 s); 53jC (1min); 72jC (1min) 30R:GGCTCTCAATCTGCATCTCC

RNase1 (RNase1) F:TTCCATTGTTTGTCCTGCTG NM_011271 140 94jC (30 s); 53jC (30 s); 72jC (30 s) 35R:ATATCCCGGCGTTTCATCAT

Elastase-2 (Ela2) F:ATTGCCTCAGCAACTATCAGA NM_007919 200 94jC (30 s); 55jC (30 s); 72jC (30 s) 30R:TGTCTGGATGTTCTTGCTCA

Carbonic anhydrase 2 (Car2) F:TGATAAAGCTGCGTCCAAGA NM_009801 304 94jC (30 s); 55jC (30 s); 72jC (30 s) 30R:GGCAGGTCCAATCTTCAAAA

Mucin1 (Muc1) F:TCCTGCAGATTTTTAACGGAGA NM_013605 206 94jC (30 s); 55jC (30 s); 72jC (30 s) 35R:AGGGAACTGCATCTCATTCA

h-actin F:ACGGATTTGGTCGTATTGGG NM_007393 200 94jC (30 s); 56jC (30 s); 72jC (30 s) 23R:TGATTTTGGAGGGATCTCGC

Fig. 2. Stable overexpression of cyclin D1in an Ela-myc pancreatic tumor cell line.A,Western blot analysis of cyclin D1. Serum-starved neo control (Neo1and Neo8)and cyclin D1overexpressing (D1.2,1.3,1.4,1.5,1.6, and1.12) clones were collected,and total cellular protein (50 Ag) was subjected to immunoblotting analysis with aspecific anti-cyclin D1antibody.The membrane was reprobed with an anti-h-actinantibody to confirm equal loading. Molecular weight markers are shown on the left.B, RT-PCRanalysis.Total RNA (1 Ag) from serum-starved neo control and cyclinD1-overexpressing clones was analyzed by RT-PCRwith primers for exogenouscyclin D1 (consisting of a neo-specific upstream and cyclin D1-specific downstreamprimers) and h-actin. RT-PCR produced a 300 bp exogenous cyclin D1fragmentand a 200 bp actin fragment.C,Western blot analysis ofc-myc and Rb.Total cellularprotein (50 Ag) from each of the indicated clones was subjected to immunoblottingwith an antibody to c-myc or phosphorylated Rb at Ser780.The membrane wassubsequently reprobed with an anti-h-actin antibody to confirm equal loading.pRbphos, phosphorylated pRb.





control clones (Fig. 4). The D1.12 clone, which exhibited thehighest cyclin D1 expression, also displayed the highest colony-forming efficiency. In addition to higher colony numbers,colony size was also bigger in cyclin D1-overexpressing clonesthan those formed by the neo control cells (data not shown).

Cell cycle parameters were examined in subconfluent cul-tures of cyclin D1-overexpressing or neo vector control cellsusing fluorescence-activated cell sorting. All three cyclin D1-overexpressing clones (D1.4, D1.5, and D1.12) displayed a sig-nificant decrease in percentage of cells in the G0-G1 phase anda concomitant increase in percentage of cells in the S phaseas compared with the neo control clones (Fig. 5; Table 3). Onthe other hand, the percentage of cells in G2-M phase wasunaffected by cyclin D1 overexpression. However, under serum-starved conditions, the cyclin D1 clones exhibited an increasedpercentage of cells in G0-G1 phase and a decreased percentage ofcells in S phase as compared with the neo control cells (Table 3).

Elevation of cyclin D1 is associated with decreased chemo-sensitivity to cisplatin due to enhanced resistance to cisplatin-induced apoptosis. To determine the effects of cyclin D1overexpression on sensitivity to chemotherapeutic agents, neovector control and cyclin D1-overexpressing cells were treatedwith escalating concentrations of cisplatin or gemcitabine, andcell growth was measured by the MTT assay 72 hours later. Asshown in Fig. 6A, the growth of the vector control clones wassignificantly inhibited by 55% to 60% (P < 0.01) at aconcentration of 2 Amol/L cisplatin, compared with 15% to20% growth inhibition of cyclin D1-overexpressing clones.

Similarly, incubation with gemcitabine resulted in dose-dependent growth inhibitory effects in all of the clonal lineswith decreased gemcitabine sensitivity in the cyclin D1-overexpressing cells (Fig. 6B). At the concentration range of10 to 30 nmol/L, the cyclin D1-overexpressing clones displayedsignificantly decreased growth inhibition (P < 0.01) comparedwith neo vector control cells (Fig. 6B).

Fig. 3. Effect of overexpression of cyclin D1on cell proliferation. Neo control (Neo1and Neo8) and cyclin D1-overexpressing clones (D1.4, D1.5, and D1.12) were seeded(3,000 cells/well) in 96-wellplates and cultured inprimary cell culturemedium in the presence of various concentrations of serum (0.1%,1.0%, 3.0%, or 5.0%) for the indicatedtimes. After each time point, thenumber of viable cells wasmeasured by theMTTassay. Results are shown asmean absorbance values (FSE) of quadruplicate determinationsfrom three experiments. *, P < 0.03 comparedwith Neo1and Neo8 cells.

Table 2. Doubling times in Ela-myc pancreatic tumorcells overexpressing cyclin D1in response to variousserum levels

Doubling time (h) at serum concentration

0.1% 1% 3% 5%

Neo1 K* K 91.6F 6.1 48.7F2.5Neo8 K K 83.5F 5.8 48.0F 5.9D1.4 K 154.3F 5.5 64.0F 2.5 38.3F 6.4D1.5 K 110.7F 8.5 37.5F10.8 26.9F 1.5D1.12 K 83.0F 10.2 40.5F 7.5 31.5F 4.2

NOTE: Neo control and cyclin D1-overexpressing cells were maintained inprimary cell culture medium in the presence of various concentrations ofserum as described in the legend of Fig. 3. At daily intervals, the number ofcells was determined by the MTTassay and the doubling times (mean F SE)were calculated as described in Materials andMethods.*No growth observed.





We then investigated whether the decreased chemosensitivityis associated with enhanced survival in cyclin D1-overexpress-ing clones. A short-term, high-dose exposure to cisplatin (5 and10 Amol/L) resulted in a considerable amount of cell death inthe neo vector control cells as evidenced by the increasednumber of floating and detached cells (data not shown). Incontrast, the cyclin D1-overexpressing cells remained largelyadherent (data not shown). The clonogenic assay wassubsequently done to measure the survival fraction ofcisplatin-treated neo control and cyclin D1-overexpressingclones (Fig. 6C). The surviving fractions for the different celllines were calculated based on the surviving colony numbercompared with the nontreated control. At the concentrationrange of 0.1 to 1.0 Amol/L, the cyclin D1-overexpressing clonesdisplayed a significantly increased survival (P < 0.01) of f20%to 30% greater than the neo vector control cells. Collectively,these findings suggest that cyclin D1 overexpression renderscells resistant to cisplatin.

To examine whether cyclin D1 overexpression protects thecells from cisplatin-induced apoptosis, cisplatin-treated con-trol and cyclin D1-overexpressing clones were subjected toDNA ladder and DNA/histone fragmentation analyses (Fig. 7Aand B). Cisplatin-treated cyclin D1 clones showed decreasedDNA fragmentation compared with neo vector control cells.

Consistently, cisplatin treatment resulted in a significantlyhigher percentage of neo control cells in sub-G1 phase ascompared with cyclin D1-overexpressing cells (Fig. 7C).Furthermore, treatment of neo control cells with 10 Amol/Lcisplatin for 48 hours showed cleavage of the DNA repairenzyme PARP, which was evidenced by the 85 kDa cleavedintermediate (Fig. 7D). Cleaved PARP was not observed incisplatin-treated cyclin D1-overexpressing cells (Fig. 7D).Taken together, these data indicate that cyclin D1 over-expression suppresses cisplatin-induced apoptosis.

Down-regulation of cyclin D1 resulted in increased sensitivityto cisplatin-mediated apoptosis. To further confirm the role ofcyclin D1 in chemoresistance, we examined whether down-regulation of cyclin D1 correlates with enhanced susceptibilityto cisplatin-induced apoptosis. Cyclin D1 expression in stableD1.12 clone was down-regulated using a siRNA strategy. CyclinD1 protein levels were decreased by 25% to 50% at 48 hoursposttransfection with two different cyclin D1-specific siRNAs(sc-29287 and qia-815) compared with the control siRNA-transfected cells (Fig. 8A). To assess whether suppression ofcyclin D1 enhances chemosensitivity, cyclin D1 siRNA- andcontrol siRNA-transfected cells were challenged with 2 Amol/Lcisplatin for 72 hours and analyzed with the MTT assay. Asshown in Fig. 8B, untreated or control siRNA-treated D1.12cells displayed a significantly higher percentage of viable cells

Fig. 4. Effect of overexpression of cyclin D1on anchorage-independent growth.Neo control and cyclin D1overexpressing cells (1.0� 104 cells/well) were seeded insix-well plates in primary cell culture medium containing 0.3% agar. After 4 weeksof growth, the colonies were counted by an inverted light microscope. Columns,mean; bars,F SD; *, P < 0.001compared with Neo1and Neo8 clones.

Fig. 5. Flow cytometry profiles of Neo1and Cyclin D1.4 clones. Neo1and CyclinD1.4 cells were plated at 5� 105 cells per10 cm dish in primary cell culture mediumcontaining 5% FCS. After 2 days, the exponentially growing cells were collectedand analyzed for DNA content by flow cytometry.Values are percentages of cells inthe indicated phase(s) of the cell cycle.

Table 3. Flow cytometric analysis of cyclin D1^overexpressing cells

Exponentialculture (5% FCS)*

Serum starved(0.1% FCS)c

Neo1%G0-G1 71.1F2.4% 68.5F1.8%%S 25.3F 1.9% 15.0F 1.5%%G2-M 3.3F 4.2% 16.3F1.1%

Neo8%G0-G1 70.3F 1.2% 68.8F 2.0%%S 28.3F 2.0% 12.7F1.2%%G2-M 1.1F3.2% 18.3F 2.8%

D1.4%G0-G1 51.5F 3.9% 79.8F 3.5%%S 44.6F1.8% 11.8F 1.1%%G2-M 3.8F 3.8% 8.3F 2.6%

D1.5%G0-G1 59.4F 0.7% 77.9F 1.5%%S 39.2F 1.0% 12.4F1.9%%G2-M 1.1F0.9% 9.7F 0.6%

D1.12%G0-G1 42.2F 1.6% 81.4F 2.8%%S 39.2F 1.4% 9.3F 1.4%%G2-M 18.5F 0.5% 8.5F 4.1%

NOTE: Flow cytometry was done as described in Fig. 5. The mean values(FSE) represent the percentage of cells in the indicated phase(s) of cell cyclefor three independent experiments.*For exponential cultures, the cells were plated at 5�105 cells per10-cm dishin primary cell culture medium containing 5% FCS and grown for 2 days.cFor serum-starved cultures, the cells were plated at 5 � 105 cells per 10-cmdish inprimary cell culturemedium containing 0.1% FCS andgrown for 2 days.





upon cisplatin treatment compared with that of Neo cells (P <0.002), which is consistent with our earlier observations thatcyclin D1-overexpressing cells exhibit enhanced cisplatinresistance. Furthermore, down-regulation of cyclin D1 by eithercyclin D1-specific siRNAs rendered D1.12 cells more suscepti-ble to the cytotoxic effects of cisplatin compared with the un-treated or control siRNA-transfection (P < 0.001; Fig. 8B and C).Consistently, the cyclin D1 stable cells transfected with thecyclin D1-specific siRNAs exhibited higher levels of apo-ptosis upon cisplatin treatment compared with controlsiRNA-transfected cells, as evidenced by the increased amountof cytoplasmic histone-associated DNA fragments and in-creased number of cells with a sub-G1 DNA content (Fig. 8Dand E). Taken together, these results indicate that cyclin D1may account for enhanced cisplatin resistance in cyclin D1-overexpressing cells.

Cyclin D1–overexpressing cells exhibited high basal andcisplatin-induced NF-kB activity and expressed the antiapoptoticbcl-2 and bcl-xl proteins. A considerably higher basal NF-nBDNA binding activity was observed in the cyclin D1 over-expressing clones as compared with the neo vector controlclones (Fig. 9A). The constitutive NF-nB activity was furtherenhanced in cyclin D1-overexpressing cells but not in neocontrol cells after cisplatin treatment. To show that the band

visualized by EMSA was indeed NF-nB, we incubated thenuclear extract pooled from D1 cells with antibodies to eitherp50 (NF-nB1) or p65 (RelA) subunit of NF-nB, and thenconducted EMSA. As shown in Fig. 9B, antibodies to eithersubunit of NF-nB and not the nonspecific anti-cyclin D1antibody, shifted the bands to a higher molecular weight,thus suggesting that the activated complex consisted of boththe p50 and p65 units. Consistent with the EMSA findings,the protein level of p65 subunit of NF-nB in nuclear lysatesof cyclin D1 clones was found to be higher than that ofcontrol cells in the presence or absence of cisplatin (Fig. 9C).Interestingly, the cyclin D1 clones maintained the expressionof bcl-2 and bcl-xl proteins upon cisplatin treatment,whereas cisplatin-treated neo control cells exhibited low orundetectable level of antiapoptotic proteins (Fig. 9D). Incontrast, we observed no significant differences in the basaland cisplatin-induced protein levels of p53 and its target baxbetween the neo control and cyclin D1 overexpressing clones(Fig. 9D).

Discussion

Cyclin D1 is overexpressed in a significant proportion ofhuman pancreatic cancers, and this overexpression correlates

Fig. 6. Overexpressionof cyclin D1is associatedwith decreased chemosensitivity.A andB, effect of cisplatin (A) and gemcitabine (B) on cell growth. Neo control and cyclinD1overexpressing clones were seeded in 96-well plates (3,000 cells/well), incubated for 24 hours in primary cell culture medium, and then incubated for 72 hours in thepresenceor absence of increasing cisplatinor gemcitabine concentrations. Cell viability was determinedby theMTTassay. Points,means; bars,FSEof triplicate determinationsof three separate experiments.C, clonogenic survival of neo control and cyclin D1-overexpressing clones upon treatment with cisplatin. Cells were treated with increasingconcentrations of cisplatin for12 hours and subjected to clonogenic assay as described inmaterials andmethods.Thepercentage of survival (meanF SE) is plotted against thedrug concentration as indicated. *, P < 0.01compared with Neo1and Neo8 control clones.





significantly with poor prognosis and decreased postoperativepatient survival (5, 8). However, very little is known about thepoor prognostic value of elevated cyclin D1 in pancreaticcancer. In this report, we provide data showing that ectopicoverexpression of cyclin D1 in an Ela-myc pancreatic tumor cellline not only confers a proliferative advantage but also renderscells more resistant to the growth-inhibitory and apoptoticeffects of cisplatin. Conversely, siRNA-mediated reduction ofcyclin D1 expression results in increased sensitivity to cisplatin-induced apoptosis.

In agreement with previous studies (14, 15), overexpressionof cyclin D1 in an Ela-myc pancreatic tumor cell line stimulatescell proliferation and promotes progression through the G1 to Scheckpoint of the cell cycle. Compared with neo vector controlcells, the cyclin D1 overexpressing clones displayed shorterdoubling times and had a larger fraction of cells in S phaseunder normal (5%) serum conditions. It is noteworthy that theenhanced growth rate of cyclin D1 clones remained significanteven under low serum conditions (1% and 3% FCS), suggestingthat cyclin D1 overexpression renders cells less dependent ongrowth factors. This finding is consistent with previous reportsdemonstrating that elevation of cyclin D1 leads to reducedserum dependency in rodent fibroblasts (14–16) and inhuman breast cancer cells (42). On the other hand, increasingthe level of cyclin D1 expression alone seemed insufficient inrendering cells completely growth factor–independent. Weobserved that the growth rate of cyclin D1 clones under lowserum conditions was less than under normal (5%) serum

conditions. Furthermore, under serum-starved conditions(0.1% FCS) the cyclin D1 clones, similar to neo control cells,ceased to proliferate and were arrested at the G0/G1 phase.Taken together, these data suggest that whereas it may reduceserum dependency, elevated cyclin D1 alone is not able to fullycompensate for the need of serum-derived mitogens for cellgrowth.

Resistance of pancreatic cancer cells to various chemother-apeutic agents poses a major impediment in the treatment ofhuman pancreatic cancer (2, 43). Kornmann et al. (6–8)showed that suppression of cyclin D1 expression in humanpancreatic cancer cell lines not only inhibited pancreatic cellgrowth but also led to increased growth-inhibitory effect ofcisplatin and fluoropyrimidine compounds. This findingsuggests that cyclin D1 may exert a protective effect againstdrug-induced cytotoxicity, and further implies a requirementfor cyclin D1 in the maintenance of chemoresistance in thesecells. Consistently, we report here that cyclin D1 over-expression in an Ela-myc pancreatic tumor cell line resultedin decreased chemosensitivity to cisplatin and to gemcitabine.The attenuation of the growth inhibitory effect of cisplatinwas accompanied by enhanced resistance of cyclin D1 clonesto cisplatin-mediated apoptosis, as determined by thedecreased fragmentation of DNA, reduced number of cellsin the sub-G1 phase, as well as the limited cleavage of PARP.Conversely, siRNA-mediated knockdown of cyclin D1 expres-sion resulted in an increased susceptibility to apoptosisinduced by cisplatin. Taken together, our findings suggest

Fig. 7. Overexpression of cyclin D1protects against cisplatin-induced apoptosis. Neo control and cyclin D1overexpressing cells were incubated in the absence or presenceof10 Amol/L cisplatin for 48 hours. Following drug treatment, floating and attached cells were collected and subjected to the following apoptotic assays: A, DNAfragmentation assay. Genomic DNAwas isolated and 25 Ag DNAwas electrophoresed, followed by ethidium bromide staining. B, histone-associated DNA fragmentanalysis.The cell death detection ELISA kit was used to quantitate the cytoplasmic histone-associated DNA fragments.C, fluorescence-activated cell sorting analysis.Thesub-G0/G1DNA content of cells following 24 or 48 hours of treatment with cisplatin was analyzed by flow cytometric analysis.D,Western blotting of PARPand cyclin D1.For PARP cleavage immunoblotting, 50 Ag of protein was subjected to 7% SDS-PAGE and immunoblotted with an anti-PARPantibody. ForWestern blotting of cyclin D1,50 Ag of protein was subjected to10% SDS-PAGE and immunoblotted with an anti-cyclin D1antibody.The membrane was reprobed with anti-h-actin antibody to ensureequal protein loading. B and C, columns, mean; bars,F SD; *, significantly different compared with neo vector control clones (P < 0.05).





that elevated cyclin D1 can contribute to chemoresistance ofpancreatic cancer cells by attenuating drug-induced apoptosis.It is noteworthy that the cyclin D1-mediated inhibition ofdrug-induced cell death may not only account for the failureof standard chemotherapy but may also help explain thepoor prognostic value of elevated cyclin D1 in pancreaticcancer.

Several studies have reported that the antiapoptotic functionof D-type cyclins (cyclin D1, D2, and D3) may requirecooperative interaction with other growth promoting genessuch as myc and ras (44, 45). In particular, coexpression ofc-myc and cyclin D3 rendered the lymphoid cells resistant to

dexamethasone-induced apoptosis, whereas individual expres-sion of either c-myc or cyclin D3 sensitized cells to apoptosis(45). Furthermore, Tan et al. (24) showed that overexpressionof cyclin D1 inhibited drug-induced apoptosis in rat embryofibroblasts ectopically expressing c-myc . These findings suggesta functional requirement for other growth promoters in theregulation of drug-induced apoptosis by D-cyclins. Based onour findings that both the control and cyclin D1-overexpressingclones exhibited comparable levels of c-myc expression, itremains possible that the observed resistance to cisplatin-induced apoptosis in cyclin D1 clones is not solely due to cyclinD1 overexpression alone but may be attributed to the

Fig. 8. SiRNA-directed suppression of cyclin D1enhances sensitivity to cisplatin-induced apoptosis.A,Western blot analysis of cyclin D1. Cyclin D1-overexpressing (D1.12) cellswere transfectedwith either cyclin D1siRNA (sc-29287 and qia-815) or control siRNA. After 48 hours, the cells were collected, and total cellular protein (50 Ag) was subjected toimmunoblotting analysis with a specific anti-cyclin D1antibody.Themembranewas reprobedwith an anti-h-actin antibody to confirm equal loading.B, MTTassay. Neo control(Neo1) and D1.12 cells were treatedwith either cyclin D1-specific siRNAs or control siRNA for 48 hours. Cells were subsequently treatedwith 2 Amol/L cisplatin for 72 hours, andcell viability was evaluatedbyMTTassay. *, significantly different comparedwith CDDPand control siRNA ^ treatedD1.12 cells (P < 0.001).C,D, and E, D1.12 cells transfectedwitheither cyclin D1siRNA or control siRNAwere treatedwith 2 Amol/L cisplatin for 72 hours and subjected to apoptotic assays.C, cultures fromD1.12 cells transfectedwith theindicated siRNA oligonucleotides after cisplatin treatment.D, the cell death detection ELISA kit was used to quantitate the cytoplasmic histone-associated DNA fragments. E, thesub-G0/G1DNA content of cells was analyzedby flow cytometric analysis.D and E, columns, mean; bars,F SD; *, P < 0.001comparedwith control siRNA ^ treatedD1.12 cells.





functional cooperation between c-myc and cyclin D1. Thisnotion is consistent with the previous report that cisplatinresistance was correlated with high cyclin D1 expression invarious c-myc-expressing human tumor cell lines (44). Al-though the role of c-myc in cisplatin-mediated apoptosis in ourin vitro model needs further investigation, our findingsillustrate that cyclin D1 overexpression potentiates cellularresistance to cisplatin.

The NF-nB pathway is one of the major antiapoptotic signaltransduction pathways linked to chemoresistance of pancreaticcarcinoma cell lines (46–48). In the present study, we show

that cyclin D1-overexpression was associated with high basal andcisplatin-induced NF-nB activity. The increased NF-nB activitymay be attributed to cyclin D1 overexpression and not due toclonal variation because several cyclin D1 overexpressing clonesshowed increased NF-nB activity compared with vector controlclones. Although it is known that cyclin D1 is a down-stream target gene of NF-nB (49, 50), our findings suggest theexistence of an autostimulatory or homeostatic loop in whichelevation of cyclin D1 can also lead to the activation of theNF-nB pathway. Such an autostimulatory loop may constitute anovel, cyclin D1-dependent mechanism of NF-nB induction.Although it is interesting to hypothesize that the enhancedNF-nB activity may have rendered cyclin D1 stable cells resistantto cisplatin-induced apoptosis, further mechanistic studies areneeded to address the causal link between cyclin D1 over-expression and increased NF-nB activation, and the ensuing roleof NF-nB activity in cyclin D1-mediated chemoresistance.

NF-nB contributes to chemoresistance of cancer cellsprimarily through the induction of antiapoptotic bcl2 familyof proteins (51, 52). Thus, it is likely that the increasedactivation of NF-nB observed in cyclin D1-overexpressing cellsmay in turn up-regulate the expression of cell survival andantiapoptotic proteins that ultimately protect cells fromapoptosis. Consistent with this hypothesis, we observed thatthe expression of cell survival proteins, bcl-2 and bcl-xl, incyclin D1-overexpressing cells remained relatively high com-pared with mock control cells upon cisplatin treatment.However, our current data cannot determine whether themaintenance of bcl-2 and bcl-xl protein levels may directlycontribute to the enhanced cisplatin resistance in cyclin D1stable cells or rather is a consequence of fewer cyclin D1 cellsundergoing apoptosis. Additional experiments, beyond thescope of this report, are necessary to elucidate the mechanismsunderlying the role, if any, of these antiapoptotic proteins incyclin D1-mediated chemoresistance.

In summary, we have shown that overexpression of cyclin D1protein in an Ela-myc pancreatic tumor cell line confersresistance to the growth-inhibitory and apoptotic effects ofcisplatin, whereas reduction of cyclin D1 expression results inincreased sensitivity to cisplatin-induced apoptosis. The en-hanced chemoresistance of cyclin D1 clones may be mecha-nistically related to the dual roles of cyclin D1 in promoting cellproliferation and in inhibiting drug-induced apoptosis. Collec-tively, these data implicate cyclin D1 as an important player inthe chemoresistance of pancreatic cancer.

Acknowledgments

WethankKuralayHomant forher technical assistanceandDr.C.J. Sherr (St. JudeChildren’s ResearchHospital) for providing us themurine cyclin D1cDNA construct.

Fig. 9. Overexpression of cyclin D1is associatedwith the induction of NF-nBactivity and up-regulation of bcl-2 and bcl-xl proteins upon cisplatin treatment.A, enhanced NF-nBDNA-binding activity in cyclin D1overexpressing clones.Exponentially growing neo vector control and cyclin D1cells were incubated in thepresence or absence of10 Amol/L cisplatin for 24 hours. Following treatment,floating and attached cells were collected, and nuclear extract was collected andsubjected to EMSA (NF-nBp). B, pooled nuclear extracts were prepared from D1clone of cells and incubated for 30 minutes with different antibodies and thenassayed for supershift to indicate specificity of NF-nB band (described in MaterialsandMethods). C, increased level of nuclear p65 protein in cyclin D1clones.Theabove nuclear extract (50 Ag) was subjected toWestern blotting using a specificantibody against the p65 subunit of NF-nB.D, cisplatin-inducedup-regulation ofbcl-2 and bcl-xl in cyclin D1clones. Following cisplatin treatment, floating andattached cells were collected, and total cellular protein (50 Ag) was subjected toimmunoblotting with an antibody against bcl-2, bcl-xl, p53, or bax.The membranewas reprobed with an anti-h-actin antibody to confirm equal loading.

References1. Parker SL,TongT, Bolden S,Wingo PA. Cancer statis-tics,1996. CACancerJClin1996;46:5^27.

2. Link KH, Gansauge F, Pillasch J, Beger HG. Multi-modal therapies in ductal pancreatic cancer. The fu-ture. IntJPancreatol1997;21:71^83.

3. Link KH, Leder G, PillaschJ, et al. In vitro concentra-tion response studies and in vitro phase II tests as theexperimental basis for regional chemotherapeutic pro-tocols. Semin Surg Oncol1998;14:189^201.

4. Gansauge F, Gansauge S, Schmidt E, MullerJ, Beger

HG. Prognostic significance of molecular alterations inhuman pancreatic carcinomaKan immunohistologicalstudy. Langenbecks Arch Surg1998;383:152^5.

5.Gansauge S, Gansauge F, RamadaniM, et al.Overex-pression of cyclin D1inhumanpancreatic carcinoma isassociated with poor prognosis. Cancer Res 1997;57:1634^7.

6. Kornmann M, Danenberg KD, Arber N, Beger HG,Danenberg PV, Korc M. Inhibition of cyclin D1 expres-sion in human pancreatic cancer cells is associated

with increased chemosensitivity and decreased ex-pression of multiple chemoresistance genes. CancerRes1999;59:3505^11.

7. KornmannM, Arber N, KorcM. Inhibitionof basal andmitogen-stimulated pancreatic cancer cell growth bycyclin D1antisense is associated with loss of tumori-genicity and potentiation of cytotoxicity to cisplati-num. JClin Invest1998;101:344^52.

8. Kornmann M, IshiwataT, Itakura J,TangvoranuntakulP, Beger HG, Korc M. Increased cyclin D1 in human





pancreatic cancer is associated with decreased post-operative survival. Oncology1998;55:363^9.

9. Pardee AB. G1events and regulation of cell prolifera-tion. Science1989;246:603^8.

10. Sherr CJ. G1 phase progression: cycling on cue.Cell 1994;79:551^5.

11. Serrano M, Hannon GJ, Beach D. A new regulatorymotif in cell-cycle control causing specific inhibition ofcyclin D/CDK4. Nature1993;366:704^7.

12.Weinberg RA. The molecular basis of carcinogene-sis: understanding the cell cycle clock. Cytokines CellMolTher1996;2:105^10.

13. Lundberg AS,Weinberg RA. Functional inactivationof the retinoblastomaprotein requires sequentialmod-ification by at least two distinct cyclin-cdk complexes.Mol Cell Biol1998;18:753^61.

14. Quelle DE, Ashmun RA, Shurtleff SA, et al. Overex-pression of mouse D-type cyclins accelerates G1phasein rodent fibroblasts. Genes Dev1993;7:1559^71.

15. JiangW, Kahn SM, Zhou P, et al. Overexpression ofcyclin D1 in rat fibroblasts causes abnormalities ingrowth control, cell cycle progression and geneexpression. Oncogene1993;8:3447^57.

16. Resnitzky D, GossenM, Bujard H, Reed SI. Acceler-ation of the G1/S phase transition by expression ofcyclins D1and E with an inducible system. Mol CellBiol1994;14:1669^79.

17.Han EK, Ng SC, Arber N, BegemannM,Weinstein IB.Roles of cyclin D1and related genes in growth inhibi-tion, senescence and apoptosis. Apoptosis 1999;4:213^9.

18. Kranenburg O, van der Eb AJ, Zantema A. Cyclin D1is an essential mediator of apoptotic neuronal celldeath. EMBOJ1996;15:46^54.

19. Sofer-Levi Y, Resnitzky D. Apoptosis induced byectopic expressionof cyclin D1but not cyclin E.Onco-gene1996;13:2431^7.

20. Pardo FS, Su M, Borek C. Cyclin D1induced apop-tosis maintains the integrity of the G1/S checkpointfollowing ionizing radiation irradiation. Somat CellMol Genet1996;22:135^44.

21. Driscoll B, Buckley S, Barsky L, Weinberg K,Anderson KD,Warburton D. Abrogation of cyclin D1expression predisposes lung cancer cells to serumdeprivation-induced apoptosis. Am J Physiol 1999;276:L679^87.

22. Sauter ER, Nesbit M, Litwin S, Klein-Szanto AJ,Cheffetz S, Herlyn M. Antisense cyclin D1 inducesapoptosis and tumor shrinkage in human squamouscarcinomas. Cancer Res1999;59:4876^81.

23. Albanese C, D’Amico M, Reutens AT, et al. Activa-tion of the cyclin D1gene by the E1A-associated pro-tein p300 through AP-1 inhibits cellular apoptosis.JBiol Chem1999;274:34186^95.

24. Tan A, Bitterman P, Sonenberg N, Peterson M,PolunovskyV. Inhibition of Myc-dependent apoptosisby eukaryotic translation initiation factor 4E requirescyclin D1. Oncogene 2000;19:1437^47.

25. Sandgren EP,Quaife CJ, PaulovichAG, Palmiter RD,Brinster RL. Pancreatic tumor pathogenesis reflectsthe causative genetic lesion. Proc Natl Acad Sci USA1991;88:93^7.

26. Heng HH, Tsui LC. Modes of DAPI banding andsimultaneous in situ hybridization. Chromosoma1993;102:325^32.

27.YeCJ, LuW, LiuG, et al.The combinationof SKYandspecific loci detection with FISH or immunostaining.Cytogenet Cell Genet 2001;93:195^202.

28. Heng HH, Liu G, LuW, et al. Spectral karyotyping(SKY) of mouse meiotic chromosomes. Genome2001;44:293^8.

29. Liao DZ, Pantazis CG, Hou X, Li SA. Promotionof estrogen-induced mammary gland carcinogenesisby androgen in the male Noble rat: probable medi-ation by steroid receptors. Carcinogenesis 1998;19:2173^80.

30. MosmannT. Rapid colorimetric assay for cellulargrowth and survival: application to proliferation andcytotoxicity assays. J Immunol Methods 1983;65:55^63.

31. Hamburger AW, Salmon SE. Primary bioassay ofhuman tumor stem cells. Science1977;197:461^3.

32. Chaturvedi MM, MukhopadhyayA, Aggarwal BB.Assay for redox-sensitive transcription factor. Meth-ods Enzymol 2000;319:585^602.

33. Fernandez E, Fallon MJ, Frazier ML, de Llorens R,Cuchillo CM. Expression of acinar and ductal productsin Capan-1 cells growing in synthetic serum andserum-free media. Cancer1994;73:2285^95.

34. FrazierML, Fernandez E, de Llorens R, et al.Pancre-atic adenocarcinoma cell line, MDAPanc-28, with fea-tures of both acinar and ductal cells. Int J Pancreatol1996;19:31^8.

35. Scarpelli DG, Rao MS, Reddy JK. Are acinar cellsinvolved in the pathogenesis of ductal adenocar-cinoma of the pancreas? Cancer Cell 1991;3:275^7.

36. Hall PA, Lemoine NR. Rapid acinar to ductal trans-differentiation in cultured human exocrine pancreas.JPathol1992;166:97^103.

37. Adell T, Gomez-Cuadrado A, Skoudy A, PettengillOS, Longnecker DS, Real FX. Role of the basic helix-loop-helix transcription factor p48 in the differentia-tion phenotype of exocrine pancreas cancer cells. CellGrowth Differ 2000;11:137^47.

38. Meszoely IM, Means AL, Scoggins CR, Leach SD.Developmental aspects of early pancreatic cancer.CancerJ 2001;7:242^50.

39. Philipp A, SchneiderA,Vasrik I, et al. Repression of

cyclin D1: a novel function of MYC. Mol Cell Biol1994;14:4032^43.

40. Marhin WW, Hei YJ, Chen S, et al. Loss of Rband Myc activation co-operate to suppress cyclin D1and contribute to transformation. Oncogene 1996;12:43^52.

41. Jansen-Durr P,MeichleA, Steiner P, et al. Differentialmodulation of cyclin gene expression by MYC. ProcNatl Acad Sci US A1993;90:3685^9.

42. Zwijsen RM, Klompmaker R,Wientjens EB, KristelPM, vander Burg B,Michalides RJ. Cyclin D1triggersautonomousgrowthofbreast cancer cells bygovern-ing cell cycle exit.MolCell Biol1996;16:2554^60.

43. Link KH, Leder G, Formentini A, et al. Surgery andmultimodal treatments in pancreatic cancerKa reviewon the basis of future multimodal treatment concepts.GanTo Kagaku Ryoho1999;26:10^40.

44.Warenius HM, Seabra LA,MawP. Sensitivity to cis-diamminedichloroplatinum in human cancer cells isrelated to expressionof cyclinD1but not c-raf-1protein.IntJCancer1996;67:224^31.

45. Rhee K, BresnahanW, Hirai A, Hirai M,ThompsonEA. c-Myc and cyclinD3 (CcnD3) genes are indepen-dent targets for glucocorticoid inhibition of lymphoidcell proliferation. Cancer Res1995;55:4188^95.

46.Wang W, Abbruzzese JL, Evans DB, Larry L,Cleary KR, Chiao PJ. The nuclear factor-nB RelAtranscription factor is constitutively activated in hu-man pancreatic adenocarcinoma cells. Clin CancerRes 1999;5:119^27.

47. DongQG, Sclabas GM, Fujioka S, et al.The functionof multiple InB: NF-nB complexes in the resistance ofcancer cells toTaxol-induced apoptosis. Oncogene2002;21:6510^9.

48. Arlt A, Schafer H. NFnB-dependent chemoresist-ance in solid tumors. Int J Clin Pharmacol Ther2002;40:336^47.

49. Guttridge DC, Albanese C, Reuther JY, Pestell RG,Baldwin AS Jr. NF-nB controls cell growth and differ-entiation through transcriptional regulation of cyclinD1. Mol Cell Biol1999;19:5785^99.

50. Hinz M, Krappmann D, Eichten A, Heder A,Scheidereit C, Strauss M. NF-nB function in growthcontrol: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol Cell Biol 1999;19:2690^8.

51. ZongWX, Edelstein LC, Chen C, Bash J, Gelinas C.The prosurvival Bcl-2 homolog Bfl-1/A1 is a directtranscriptional target of NF-nB that blocks TNFa-induced apoptosis. Genes Dev 1999;13:382^7.

52.Wang CY, Guttridge DC, Mayo MW, Baldwin AS,Jr. NF-nB induces expression of the Bcl-2 homo-logue A1/Bfl-1to preferentially suppress chemother-apy-induced apoptosis. Mol Cell Biol 1999;19:5923^9.





2005;11:6075-6086. Clin Cancer Res Hector Biliran, Jr., Yong Wang, Sanjeev Banerjee, et al. Cell Line

Expressing Pancreatic Tumor− Transgenemycan Elastase-and Confers Resistance to Cisplatin-Mediated Apoptosis in Overexpression of Cyclin D1 Promotes Tumor Cell Growth

Updated version

http://clincancerres.aacrjournals.org/content/11/16/6075

Access the most recent version of this article at:

Cited articles

http://clincancerres.aacrjournals.org/content/11/16/6075.full#ref-list-1

This article cites 50 articles, 20 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/11/16/6075.full#related-urls

This article has been cited by 10 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/11/16/6075To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/content/11/16/6075.full#ref-list-1

http://clincancerres.aacrjournals.org/content/11/16/6075.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



overexpressionofcyclind1promotestumorcellgrowth ... › ... › 11 › 16 › 6075.full-text.pdf ·...

Documents