Oxidative stress and apoptosis in fetal rat liver induced by maternal

cholestasis. Protective effect of ursodeoxycholic acid*

Maria J. Perez1, Rocio I.R. Macias2, Cristina Duran1, Maria J. Monte2,

Jose M. Gonzalez-Buitrago1, Jose J.G. Marin2,*

1Laboratory of Experimental Hepatology and Drug Targeting, Research Unit, University Hospital,

University of Salamanca, 37007 Salamanca, Spain2Laboratory of Experimental Hepatology and Drug Targeting, Department of Physiology and Pharmacology,

University of Salamanca, Campus Miguel de Unamuno E.I.D. S-09, 37007 Salamanca, Spain

Background/Aims: The sensitivity of fetal rat liver to maternal obstructive cholestasis during pregnancy (OCP), and

the effect of ursodeoxycholic acid (UDCA) were investigated.

Methods: UDCA was administered (i.g. 0.6 mg/kg b.wt./day) from day 14 to day 21 of pregnancy after maternal

common bile duct ligation.

Results: Impairment in the activity of antioxidant enzymes, levels of total glutathione and GSH/GSSG ratio and the

degrees of lipid peroxidation and protein carbonylation were similar in livers of OCP mothers and fetuses at term,

despite hypercholanemia was milder in fetuses. Treatment of OCP rats with UDCA reduced maternal and fetal liver

oxidative stress. Although maternal hypercholanemia was not corrected, fetal serum concentrations of major bile acids

(except UDCA and b-muricholic acid) were reduced. Fetal liver expression of key enzyme in bile acid synthesis,

Cyp7a1, Cyp27 and Cyp8b1 was not affected by OCP or UDCA treatment. In OCP fetal livers, the relative expression of

Bax-a and Bcl-2 and the activity of caspase-3, but not caspase-8, were increased. These changes were markedly reduced

in fetuses of OCP animals treated with UDCA.

Conclusions: OCP induced moderate fetal hypercholanemia but marked liver oxidative stress and apoptosis that

were partly prevented by treatment of pregnant rats with UDCA.

q 2005 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Keywords: Bax; Bile acid; Caspase; Glutathione; Pregnancy

1. Introduction

Several mechanisms may account for the cytotoxicity

associated with the most hydrophobic bile acids (BAs) in

0168-8278/$30.00 q 2005 European Association for the Study of the Liver. Pub

doi:10.1016/j.jhep.2005.02.028

Received 2 July 2004; received in revised form 21 January 2005; accepted 2 Fe* This study was supported in part by the Junta de Castilla y Leon (Grant SA

Ministerio de Sanidad y Consumo, Spain, alone (CP03/00093) and co-funded by th

y Tecnologıa, Plan Nacional de Investigacion Cientıfica, Desarrollo e Innovaci

Research Fellowships: the ‘Juan Rodes’ Research Fellowship from the Spanish A

from the Fundacion ‘Miguel Casado San Jose’, Salamanca, Spain. The group is m

Salud Carlos III, FIS (Grant G03/015), Spain.* Corresponding author. Tel.: C34 923 294674; fax: C34 923 294669.

E-mail address: jjgmarin@usal.es (J.J.G. Marin).

Abbreviations: BAs, bile acids; ICP, intrahepatic cholestasis of pregnancy; MC

ursodeoxycholic acid.

cholestatic diseases [1]. BAs may disrupt cell membranes

through their detergent action on lipid components [2] and can

promote the generation of reactive oxygen species that, in turn,

oxidatively modify lipids, proteins, and nucleic acids,

Journal of Hepatology 43 (2005) 324–332

www.elsevier.com/locate/jhep

lished by Elsevier B.V. All rights reserved.

bruary 2005; available online 3 May 2005

013/04 and Grant SA017/03) Spain. Fondo de Investigaciones Sanitarias,

e FEDER-FSE Program of the E.U. (Grant 01/1043). Ministerio de Ciencia

on Tecnologica (Grant BFI2003-03208). Dr Maria J. Perez received two

ssociation for the Study of the Liver (AEEH), and the Research Fellowship

ember of the Network for Cooperative Research on Hepatitis, Instituto de

A, muricholic acid; OCP, obstructive cholestasis during pregnancy; UDCA,

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 325

and eventually cause hepatocyte apoptosis [3]. Additionally,

they can activate Kupffer cells to generate reactive

oxygen species that may contribute to liver cell insult [4].

Two pathways are involved in triggering hepatocytes

apoptosis (for a review see [5]). Toxic BAs can activate Fas

death receptors directly [6] and induce oxidative damage

that causes mitochondrial dysfunction and apoptosis [7,8].

The Bcl-2 protein family plays a role in the regulation of the

mitochondria-mediated pathway. Two key representative

members of this family are the anti-apoptotic Bcl-2 and the

pro-apoptotic Bax [9–11].

Ursodeoxycholic acid (UDCA) has therapeutic useful-

ness in several cholestatic liver diseases (for a review,

see [12]). The major beneficial effects of treatment with

UDCA are protection against cytotoxicity due to more

toxic BAs [13], stimulation of hepatobiliary secretion

[14], antioxidant activity due in part to an enhancement

in glutathione levels [15,16] and inhibition of liver cells

apoptosis [7].

Intrahepatic cholestasis of pregnancy (ICP), usually

implies a benign condition for the mother. However, in

the conceptus it is associated with serious repercussions,

including increased fetal distress, premature delivery, and

perinatal mortality and morbidity (for a review, see [17]).

This is probably due to the higher sensitivity of more fragile

fetal developing organs to toxic BAs [18]. In addition, ICP

impairs placental functions, reducing the ability of the fetus

to eliminate BAs towards the maternal blood [19], which

may aggravate the situation.

Like several other cholestatic disorders, ICP has been

shown to respond to UDCA treatment with a reduction in

maternal pruritus, a normalization of biochemical par-

ameters, including serum bilirubin and transaminases, and a

decrease in the number of premature deliveries [20].

Although UDCA administration to pregnant women induces

changes in the fetal BA pool [21], several studies have

indicated that treatment of ICP with UDCA has no risk for

the mother or the fetus [22,23].

Table 1

Morphological and biochemical parameters

Mothers

Control OCP OCPC

Body weight (g) 377G12a 314G17 346G

Liver weight (g) 11.9G0.5 13.3G1.0 13.4G

Fetuses per pregnancy 13.7G0.8a 8.3G0.8 12.7GTotal bile acids (mmol/L) 13G3a 238G29 275G

Total bilirubin (mg/dL) 0.18G0.03a 2.85G0.75 0.39G

Alkaline phosphatase (UI/L) 98G9b 185G15 128GGGT (UI/L) 5.8G0.4b 10.5G1.4 12.8G

LDH (UI/L) 1175G167b 1936G128 2161G

GPT (UI/L) 18G2b 37G5 45G

GOT (UI/L) 100G15b 401G57 515G

Biochemical parameters were determined in blood samples on day 21 of pregnancy

cholestasis (OCP), or OCP followed by i.g. treatment with UDCA (OCPCUDCA, 60

meansGSEM. aP!0.05; bP!0.01 on comparing with OCP by the Bonferroni me

The present study, carried out on an experimental model of

complete obstructive cholestasis (OCP) during the last third

of pregnancy in the rat, was undertaken to investigate whether

maternal cholestasis causes oxidative stress and apoptosis in

fetal liver and whether treatment of pregnant rats with UDCA

has beneficial effects. Although with a different etiology and

degree of impairment in biliary function, the experimental

model of OCP shares two important characteristics with

human ICP: the presence of marked maternal hypercholane-

mia, to which the conceptus is exposed, and a reduction in the

amount of BAs that reaches the maternal intestine, which

limits the absorption of dietary fat and liposoluble vitamins.

Other alternative models of cholestasis, such as drugs- or

hormones-induced cholestasis, which would be closer to the

actual situation of partial cholestasis occurring in ICP, were

not selected due to potential placental transfer and inter-

ference of cholestatic agents with fetal liver function.

2. Materials and methods

2.1. Animals and experimental design

Pregnant Wistar CF rats (University of Salamanca, Spain) were used.The experimental protocols were approved by the Local Ethical Committeefor the Use of Laboratory Animals. On day 14 of pregnancy, the rats wereanesthetized with ether and a sham operation (Control group) or completebiliary obstruction (OCP group) was performed as previously described[24]. In brief, using a non-absorbable suture, a double ligation separated by2 mm was carried out. The common bile duct was divided between theligations. During the following week, some of these animals (OCPCUDCAgroup) received daily intragastric administration of UDCA (60 mg/100 gb.wt.). This apparently low dose of UDCA was selected based on previousstudies on OCP, in which maternal serum BA concentrations were found toreach values 16-fold higher than in Controls. After receiving approximately3 mmol UDCA over the last week of pregnancy these values were furtherincreased by approximately 20% [25].

On day 21 of pregnancy, the animals were sacrificed under sodiumpentobarbital anesthesia. Liver and serum samples from the mothers andfetuses were collected [25], frozen in liquid nitrogen and stored at K80 8Cfor further use. Some morphological and biochemical characteristics ofthese experimental groups are shown in Table 1.

Fetuses

UDCA Control OCP OCPCUDCA

12 5.17G0.05a 4.77G0.05 4.67G0.03

0.6 0.31G0.01 0.30G0.01 0.30G0.01

0.4a

31 18G3a 47G5 33G4

0.07a 0.30G0.03a 0.66G0.05 0.31G0.03a

11a 975G58a 1242G61 1319G77

1.9 6.6G0.6 7.3G0.5 7.4G1.2

287 3102G198 2652G351 2653G272

9 23G5 27G5 22G4

62 350G23 361G25 369G22

. On day 14, pregnant rats underwent a sham operation (Control), obstructive

mg/100 g b.wt./day). In all groups nZ6 mothers and R12 fetuses. Values are

thod of multiple range testing.

Table 2

Oligonucleotide sequences of primers used for real-time quantitative PCR determinations of the relative abundance of mRNA

Gene Forward primer (50-30) Reverse primer (5 0-30) Accession number Product

size

Position (5 0-3 0)

Bax-a ATGGAGCTGCAGAGGATGATT TGAAGTTGCCATCAGCAAACA NM_017059 97 bp 220–316

Bcl2 TGGGATGCCTTTGTGGAACT TCTTCAGAGACTGCCAGGAGAAA U34964 73 bp 574–646

Cyp7a1 GCTTTACAGAGTGCTGGCCAA CTGTCTAGTACCGGCAGGTCATT NM012942 92 bp 987–1078

Cyp27 CCTTTGGGACTCGCACCA GCCCTCCTGTCTCATCACTTG M73231 71 bp 748–818

Cyp8b1 GTACACATGGACCCCGACATC GGGTGCCATCAGGGTTGAG AB009686 76 bp 1195–1270

Cyp7a1, cholesterol 7a-hydroxylase; Cyp27, sterol 27-hydroxylase; Cyp8b1, sterol 12a-hydroxylase.

Fig. 1. Bile acid concentrations measured by gas–liquid chromatog-

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332326

2.2. Analytical determinations and statistical methods

Total BA concentrations in serum were assayed by an enzymatic/fluorometric method [26]. BA species in serum were measured by gas–liquidchromatography-mass spectrometry [27]. To evaluate the state of oxidativestress, the following assays were carried out in liver homogenates prepared inice-cold phosphate-buffered saline. Lipid peroxidation was estimated bymeasuring malondialdehyde (MDA) formation [28]. Protein carbonylationwas determined using the 2,4-dinitrophenylhydrazine assay [29]. Totalglutathione (GSHCGSSG) contents in trichloroacetic acid supernatants ofliver homogenates were determined by an enzymatic method [30]. The GSH/GSSG ratio was calculated after selective measurement of GSSG levels [31].The activity of the following enzymes was determined: catalase [32],glutathione peroxidase [33], glutathione reductase [34] and glutathione-S-transferase [35]. Caspase-3 and caspase-8 activities were determined usingAc-DEVD-AMC and Ac-IETD-AFC (Alexis Corp., San Diego, CA) asspecific substrates, respectively [36]. Protein concentrations were deter-mined [37] using bovine serum albumin as standard. Nucleosomal DNAfragmentation was investigated by the DNA-ladder method using DNAobtained from the liver of an adult male rat that had received D-galactosamine (i.p. 0.1 g/100 g b.wt.) 24 h before, as a positive control ofapoptosis [38].

The abundance of mRNA of the key enzymes in BA synthesis (Cyp7a1,Cyp27 and Cyp8b1), as well as of the pro-apoptotic Bax-a, and the anti-apoptotic Bcl-2 proteins were determined by RT followed by real-timequantitative PCR using appropriate primers (Table 2), as previouslydescribed [39]. RNA from liver samples collected in RNAlater (QIAGEN,Izasa, Barcelona, Spain) was isolated using RNeasy spin columns(QIAGEN) and measured with the RiboGreen RNA-Quantitation kit(Molecular Probes, Leiden, The Netherlands). RT was carried out withtotal RNA, using random nanomers and Enhanced Avian RT-PCR kit(Sigma-Genosys, Cambridge, UK). The PCR amplification products weredetected using SYBR Green I, once it had been ascertained that non-specificproducts were not formed during PCR, in any case. Total liver RNA from ahealthy adult rat (for Bcl-2, Cyp7a1, Cyp27 and Cyp8b1) or from an adult ratwith bile duct ligation for 7 days (for Bax-a) were used in all determinationsas external calibrators. To normalize the results the level of 18S rRNA ineach sample was determined with an appropriate Taqmanw probe [39].

Immunoblotting studies on liver homogenates were carried out aspreviously described [39], using mouse monoclonal antibody againsta-tubulin (DM1A) from Sigma-Aldrich and rabbit polyclonal antibodiesto Bax-a (P19) and Bcl-2 (N19) from Santa Cruz Biotechnology (CA, USA).Anti-mouse or anti-rabbit IgG horseradish peroxidase-linked antibodies andenhanced chemiluminiscence reagents were from Amersham PharmaciaBiotech (Freiburg, Germany). Lysate from human promyelocytic leukaemiaHL-60 cells (Santa Cruz Biotechnology), which highly express severalmembers of the Bcl-2 family of proteins, was used as a positive control [40].

Values are expressed as meanGSEM. Comparisons were carried out bythe Bonferroni method of multiple range testing.

raphy coupled to mass spectrometry in fetal (A) and maternal (B)

serum on day 21 of pregnancy. On day 14, pregnant rats underwent a

sham operation (Control), obstructive cholestasis (OCP), or OCP

followed by treatment with ursodeoxycholic acid (UDCA) (OCPC

UDCA). In all groups nZ5 mothers and 7 fetuses. Inset of A: relative

abundance of mRNA for Cyp7a1, Cyp27 and Cyp8b1 in fetal livers

(nZ5 in all groups). *, P!0.05 on comparing with OCP. CA, Cholic

acid; CDCA, Chenodeoxycholic acid; DCA, Deoxycholic acid; MCA,

Muricholic acid.

3. Results

3.1. Obstructive cholestasis in pregnant rats

In agreement with previous studies [25], OCP caused a

decrease in body weight in both mothers and fetuses,

together with a reduction in the number of fetuses per

gestation. UDCA treatment partly restored normal maternal

body weight gaining and the number of fetuses per

pregnancy (Table 1). Changes in several serum biochemical

parameters were consistent with typical signs of liver cell

injury associated with cholestasis. The repercussions of

OCP on fetal biochemical parameters were milder. Serum

bilirubin concentrations and alkaline phosphatase activity

were significantly elevated; only the former of these two

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 327

alterations was prevented by UDCA. OCP induced an

elevation in serum BA concentrations that was less

marked in fetuses (Table 1, Fig. 1A) than in their mothers

(Table 1, Fig. 1B). UDCA treatment further increased

maternal hypercholanemia, mainly due to an elevation in

b-muricholic acid (b-MCA) serum concentrations, but

reduced fetal serum concentrations of major BAs, except

UDCA and b-MCA. No significant change in OCP or

OCPCUDCA groups in the abundance of mRNA in fetal

liver for Cyp7a1, Cyp27 or Cyp8b1 was found (Fig. 1A,

inset).

3.2. Oxidative stress

In both mothers and fetuses, OCP caused a reduction

in the activities of enzymes involved in resistance against

oxidative stress, such as glutathione peroxidase (Fig. 2A),

glutathione-S-transferase (Fig. 2B) and catalase (Fig. 2C),

whereas the activity of glutathione reductase was not

impaired (Fig. 3D). The absence of effect, or a moderate

tendency to amelioration, was observed in animals

treated with UDCA. Steady-state levels of total gluta-

thione were enhanced in maternal liver but decreased in

fetal liver by OCP (Fig. 3A). The GSH/GSSG ratio was

significantly reduced by OCP both in maternal and fetal

liver (Fig. 3B). UDCA prevented changes in total

Fig. 2. Glutathione peroxidase (A), glutathione-S-transferase (B), catalase (C)

day 21 of pregnancy. On day 14, pregnant rats underwent a sham operation (

with ursodeoxycholic acid (OCPCUDCA). In all groups nZ6 mothers and R

glutathione but did not restore GSH/GSSG ratio to

normal values. Oxidative damage, as indicated by the

magnitude of hepatic lipid peroxidation (Fig. 3C) and

protein carbonylation (Fig. 3D), was increased by OCP to

a similar extent in both maternal and fetal livers. UDCA

prevented (partially in mothers and more efficiently in

fetuses) these alterations.

3.3. Apoptosis

Caspase-3, which participates in several alternative path-

ways of apoptosis activation (for a review, see [41]), was

significantly enhanced by OCP in maternal liver (C50%),

and more markedly so (C150%) in fetal liver (Fig. 4A);

UDCA inhibited these changes. Since at least in adult rat

BA-mediated apoptosis is in part due to activation of the

death receptor-dependent pathway of apoptosis [6],

the activity of a mediator of this pathway, caspase-8, was

also measured. OCP and UDCA treatment had no effect on

caspase-8 activity in either fetal or maternal livers (Fig. 4B).

DNA fragmentation, although present in the liver of OCP

animals (Fig. 4C), was less marked than that found in animals

treated with a typical inducer of liver apoptosis such as

D-galactosamine [38]. Moreover, DNA fragmentation was

more evident in fetal than in maternal livers. However, it

should be considered that although this method permits to

and glutathione reductase (D) activities in maternal and fetal livers on

Control), obstructive cholestasis (OCP), or OCP followed by treatment

9 fetuses. NS, PO0.05; *, P!0.05; **, P!0.01 on comparing with OCP.

Fig. 3. Total glutathione content (A), GSH/GSSG ratio (B), lipid peroxidation (C), and protein carbonylation (D) in maternal and fetal livers on day 21

of pregnancy. On day 14, pregnant rats underwent a sham operation (Control), obstructive cholestasis (OCP), or OCP followed by treatment with

ursodeoxycholic acid (OCPCUDCA). In all groups nZ6 mothers and R12 fetuses. NS, PO0.05; *, P!0.05; **, P!0.01 on comparing with OCP.

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332328

visualize the presence of apoptosis, it lacks accuracy to

quantify the intensity of the process, above all when this is

relatively low as happens in most experimental groups of the

present study.

Although similar tests were passed by all pairs of primers

investigated in the present study, only the results for one

pro-apoptotic and another anti-apoptotic proteins, i.e. Bax-aand Bcl-2, respectively, that were measured as an index of

apoptosis susceptibility, are shown (Fig. 5A and C) to

illustrate the presence of a single peak in DNA melting

curves and a single band of the expected size in agarose gel

electrophoresis. Bax-a mRNA in the liver was significantly

increased by OCP (C100% in mothers; C200% in fetuses);

UDCA diminished this increase (Fig. 5B). Liver Bcl-2

mRNA was also increased by OCP (C350% in mothers;

C100% in fetuses), and a tendency to further increase in

both the mothers and fetuses of the OCPCUDCA group

was observed (Fig. 5D). In maternal liver with OCP, the

ratio between the relative abundances of mRNA (Fig. 5E)

was decreased (K50%). This change in part of the signaling

mechanism involved in controlling apoptosis might be

related with the finding that in this organ OCP-induced

increase in caspase-3 activity (Fig. 4A) and DNA fragmen-

tation (Fig. 4C) were mild. By contrast, in the fetal liver

Bax-a/Bcl-2 ratio for mRNA was enhanced by OCP

(C35%; Fig. 5E), which was consistent with the marked

increase in caspase-3 activity (Fig. 4A) and a more evident

DNA fragmentation (Fig. 4C) in this group. In both mothers

and fetuses UDCA induced a reduction in the Bax-a/Bcl-2

mRNA ratio and restored caspase-3 activity to normal

values. Changes in the abundance of these proteins as

investigated by western-blotting, were, in general, consist-

ent with measurements of mRNA abundance (Fig. 6),

except for the findings that Bax proteins were more

abundant in fetal than in maternal liver, whereas the

contrary occurred for Bcl-2. Indeed, Bcl-2 could be hardly

detected in fetal liver (Fig. 6).

4. Discussion

After bile duct ligation in the rat, biphasic changes in

total glutathione levels occur [42,43]. These are: (i) a

transient increase during the first week, which was also

observed here in maternal liver during OCP and,

(ii) subsequent depletion. Initial accumulation has been

explained in terms of the lack of integrity in the biliary

pathway for glutahione secretion [43]. This enhanced

amount of glutathione was not able to prevent liver

oxidative damage in OCP animals. Moreover, in the fetal

livers, partial depletion in glutathione contents occurred

Fig. 4. Caspase-3 (A) and caspase-8 (B) activities in maternal and fetal

livers on day 21 of pregnancy. On day 14, pregnant rats underwent a

sham operation (Control), obstructive cholestasis (OCP), or OCP

followed by treatment with ursodeoxycholic acid (OCPCUDCA). In all

groups nZ6 mothers and R9 fetuses. NS, PO0.05; **, P!0.01 on

comparing with OCP. C. Representative agarose gel electrophoresis of

cytosolic oligonucleosomal DNA obtained from maternal and fetal

livers in each experimental group. As a positive control, DNA obtained

from the liver of an adult male rat that had received D-galactosamine

was used (D-GalN).

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 329

even during transient glutathione accumulation in maternal

liver.

UDCA treatment lowered total glutathione contents in

maternal livers, even though biliary obstruction was main-

tained. Enhanced glutathione output from the hepatocytes

through their sinusoidal membrane was probably involved in

such decrease. Thus, the presence in this pole of the plasma

membrane of ABC proteins that export glutathione con-

jugates is enhanced by BAs, among which UDCA has been

reported to be particularly efficient in triggering this up-

regulation [44]. Moreover, UDCA may ameliorate hepatic

BA load in cholestasis by stimulating an alternative excretory

route via induction of hepatocellular/basolateral Mrp3 efflux

with concomitant overexpression of renal Mrp2. A similar

route could be followed by glutathione conjugates [44].

Whether this also occurs in pregnant rats with obstructive

cholestasis is not known.

During rat development there is an exaggerated

mitochondrial response to pro-oxidant stimuli [45],

together with less developed antioxidant protection mech-

anisms [46]. This may account for the particularly high

sensitivity of the fetal liver to hypercholanemia. Moreover,

this situation implies an increase in the danger associated

with any additional oxidative insult during the fetal-to-

neonatal transition, when important circulatory and respir-

atory changes already lead to a transient oxidative stress

[47]. Thus, at least in the rat, the liver is maximally

susceptible to lipid peroxidation during the first day after

birth [48]. Impairment in liver structure and function was

indeed observed in 4-week-old rats born from mothers with

OCP. These alterations were in part prevented if the

mothers were treated with UDCA during the last week of

pregnancy [49].

Several antioxidants have been shown to reduce the liver

injury caused by toxic BAs [8]. Among them is UDCA,

which is able to protect hepatocytes against oxidative injury

by enhancing the hepatic levels of glutathione and other

thiol-containing antioxidants [15]. Whether this is a specific

effect of UDCA or it is shared by other BAs has not been

elucidated. However, this could explain why UDCA had

marked antioxidant protective effect in OCP animals, even

though the activity of antioxidant enzymes was not restored.

The fact that GSH/GSSG ratio was decreased in both

maternal and fetal livers of OCP rats treated with UDCA

suggests that enhanced levels of glutathione are being used

to buffer OCP-induced free radical formation.

Since UDCA treatment also reduced fetal hyperchola-

nemia, due to a decrease in all major BA species except

UDCA and b-MCA, it is likely that part of the beneficial

effect observed in the fetal liver would be due to a

displacement of the most toxic BA species. The absence

of change in the abundance of Cyp7a1, Cyp27 and Cyp8a1

mRNA is consistent with an absence of increased fetal BA

synthesis. Fetal hypercholanemia was therefore probably

accounted for by enhanced overall transfer of BAs across

the placenta in the maternal-to-fetal direction. UDCA

improves placental functions by restoring the ability of

this organ to eliminate fetal BAs towards the mother and

reducing the permeability of the placental barrier to

maternal BAs [19,25]. Both mechanisms are likely to be

involved in the reduction of the fetal hypercholanemia

observed in OCPCUDCA group.

In adult rats, cholestasis enhances liver caspase-3

activity [50]. This was confirmed in OCP mothers and

was more marked in fetal liver. In addition to

mitochondria-mediated activation of apoptosis, the Fas

receptor/caspase-8 pathway is involved in BA-induced

apoptosis in the adult rat liver [6]. However, no

significant change in caspase-8 activity in maternal and

fetal livers of the OCP group was detected. Since

hepatocytes are considered type II cells, and thus a small

increase in caspase-8 activity might suffice to induce

apoptosis, a role of Fas-receptor in observed apoptosis

Fig. 5. Validation of the SYBR Green I method of detection in real time quantitative PCR to measure the relative abundance of mRNA for rat Bax-a

(A) and Bcl-2 (C) and the results of such measurements in maternal and fetal livers (B and D). A and C panels: negative derivative of DNA melting

curves for the amplified PCR product (inset: electrophoresis in 2.5% agarose gel; lane 1: calibrator cDNA; lane 2: no DNA template; lane 3: standard

DNA). On day 14, pregnant rats underwent a sham operation (Control), obstructive cholestasis (OCP), or OCP followed by treatment with

ursodeoxycholic acid (UDCA) (OCPCUDCA). Values are expressed as percentages of the external calibrator. E. Ratio between the relative

abundances of mRNA for Bax-a and Bcl-2 in maternal and fetal livers expressed as percentages of the values found in the Control group. In all groups

nZ7 mothers and R14 fetuses. NS, PO0.05; *, P!0.05; **, P!0.01 on comparing with OCP.

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332330

cannot be ruled out. However, if this mechanism does

exist, it does not seem to play a major role in OCP-

induced maternal/fetal liver apoptosis.

In fetal and maternal livers OCP induced not only Bax-a,

but also Bcl-2 expression. This has been previously found in

hepatocytes from cholestatic adult rats, in which such

increase has been suggested to play a role as an adaptive

response to resist, up to a certain extent, BA-induced injury

[51]. This mechanism seems to be more developed, and

hence more potent, in the maternal than in the fetal liver, but

not enough to counterbalance other signals promoting

caspase 3 activation.

In conclusion, in addition to several confirmatory data

related to oxidative stress caused in the rodent liver by bile

Fig. 6. A. Representative Western blot of the expression of members of

the Bcl-2 family in maternal and fetal liver at term. On day 14,

pregnant rats underwent a sham operation (Control), obstructive

cholestasis (OCP), or OCP followed by treatment with ursodeoxycholic

acid (UDCA) (OCPCUDCA). Similar results were obtained in samples

from six different animals from each group. Lysate from human

promyelocytic leukaemia HL-60 cells (Santa Cruz Biotechnology),

which highly express several members of the Bcl-2 family of proteins

was used as positive controls.

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 331

duct ligation [42,43,51], the present study also provides the

following original results: (i) imbalance in the antioxidant

status of maternal livers caused by OCP was partly

prevented by UDCA treatment, even though maternal

hypercholanemia was not corrected. (ii) In both maternal

and fetal livers some of the enzyme activities involved in

antioxidant system were impaired in OCP. (iii) As indicated

by the lower activities of catalase, glutathione peroxidase

and glutathione-S-transferase as well as the levels of total

glutathione, fetal livers had lower antioxidant defenses than

maternal livers. Consistently, fetal livers were more

sensitive to BA-mediated oxidative insult. Thus, although

OCP increased serum BA concentrations to a much lower

extent in the fetuses (2.7-fold) than in the mothers (15-fold),

oxidative damage and apoptosis were higher in the former.

(iv) Finally, UDCA treatment of pregnant rats has beneficial

effects on the fetal liver by lowering the exposure of the

fetus to toxic BAs, restoring the levels of glutathione,

preventing lipid peroxidation and protein carbonylation,

and correcting pro-apoptotic alterations in the Bax-a/Bcl-2

ratio.

Acknowledgements

The authors thank Mrs M.I. Hernandez Rodriguez for

her secretarial help, and Mr L. Munoz de la Pascua

and Mr J.F. Martin Martin for caring for the animals.

Thanks are also due to Nicholas Skinner for revision of

the English text of the manuscript.

References

[1] Attili AF, Angelico M, Cantafora A, Alvaro D, Capocaccia L. Bile

acid-induced liver toxicity: relation to the hydrophobic–hydrophilic

balance of bile acids. Med Hypotheses 1986;19:57–69.

[2] Billington D, Evans CE, Godfrey PP, Coleman R. Effects of bile salts

on the plasma membranes of isolated rat hepatocytes. Biochem J

1980;188:321–327.

[3] Sokol RJ, Straka MS, Dahl R, Devereaux MW, Yerushalmi B,

Gumpricht E, et al. Role of oxidant stress in the permeability

transition induced in rat hepatic mitochondria by hydrophobic bile

acids. Pediatr Res 2001;49:519–531.

[4] Ljubuncic P, Fuhrman B, Oiknine J, Aviram M, Bomzon A. Effect of

deoxycholic acid and ursodeoxycholic acid on lipid peroxidation in

cultured macrophages. Gut 1996;39:475–478.

[5] Czaja MJ. Induction and regulation of hepatocyte apoptosis by

oxidative stress. Antioxid Redox Signal 2002;4:759–767.

[6] Faubion WA, Guicciardi ME, Miyoshi H, Bronk SF, Roberts PJ,

Svingen PA, et al. Toxic bile salts induce rodent hepatocyte apoptosis

via direct activation of Fas. J Clin Invest 1999;103:137–145.

[7] Rodrigues CM, Fan G, Ma X, Kren BT, Steer CJ. A novel role for

ursodeoxycholic acid in inhibiting apoptosis by modulating mito-

chondrial membrane perturbation. J Clin Invest 1998;101:2790–2799.

[8] Yerushalmi B, Dahl R, Devereaux MW, Gumpricht E, Sokol RJ. Bile

acid-induced rat hepatocyte apoptosis is inhibited by antioxidants and

blockers of the mitochondrial permeability transition. Hepatology

2001;33:616–626.

[9] Oh SH, Yun KJ, Nan JX, Sohn DH, Lee BH. Changes in expression

and immunolocalization of protein associated with toxic bile salts-

induced apoptosis in rat hepatocytes. Arch Toxicol 2003;77:110–115.

[10] Narita M, Shimizu S, Ito T, Chittenden T, Lutz RJ, Matsuda H, et al.

Bax interacts with the permeability transition pore to induce

permeability transition and cytochrome c release in isolated

mitochondria. Proc Natl Acad Sci USA 1998;95:14681–14686.

[11] Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M,

Alnemri ES, et al. Cytochrome c and dATP-dependent formation of

Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.

Cell 1997;91:479–489.

[12] Paumgartner G, Beuers U. Ursodeoxycholic acid in cholestatic liver

disease: mechanisms of action and therapeutic use revisited.

Hepatology 2002;36:525–531.

[13] Guldutuna S, Leuschner M, Wunderlich N, Nickel A, Bhatti S,

Hubner K, et al. Cholic acid and ursodeoxycholic acid therapy in

primary biliary cirrhosis. Changes in bile acid patterns and their

correlation with liver function. Eur J Clin Pharmacol 1993;45:

221–225.

[14] Dumont M, Erlinger S, Uchman S. Hypercholeresis induced by

ursodeoxycholic acid and 7-ketolithocholic acid in the rat: possible

role of bicarbonate transport. Gastroenterology 1980;79:82–89.

[15] Mitsuyoshi H, Nakashima T, Sumida Y, Yoh T, Nakajima Y,

Ishikawa H, et al. Ursodeoxycholic acid protects hepatocytes against

oxidative injury via induction of antioxidants. Biochem Biophys Res

Commun 1999;263:537–542.

[16] Serviddio G, Pereda J, Pallardo FV, Carretero J, Borras C, Cutrin J,

et al. Ursodeoxycholic acid protects against secondary biliary

cirrhosis in rats by preventing mitochondrial oxidative stress.

Hepatology 2004;39:711–720.

[17] Lammert F, Marschall HU, Matern S. Intrahepatic cholestasis of

pregnancy. Curr Treat Options Gastroenterol 2003;6:123–132.

[18] Zimber A, Zusman I. Effects of secondary bile acids on the

intrauterine development in rats. Teratology 1990;42:215–224.

[19] Serrano MA, Brites D, Larena MG, Monte MJ, Bravo MP, Oliveira N,

et al. Beneficial effect of ursodeoxycholic acid on alterations induced

by cholestasis of pregnancy in bile acid transport across the human

placenta. J Hepatol 1998;28:829–839.

[20] Palma J, Reyes H, Ribalta J, Hernandez I, Sandoval L, Almuna R,

et al. Ursodeoxycholic acid in the treatment of cholestasis of

pregnancy: a randomized, double-blind study controlled with placebo.

J Hepatol 1997;27:1022–1028.

[21] Rodrigues CMP, Marin JJG, Brites D. Bile acid patterns in meconium

are influenced by cholestasis of pregnancy and not altered by

ursodeoxycholic acid treatment. Gut 1999;45:446–452.

M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332332

[22] Mazzella G, Rizzo N, Azzaroli F, Simoni P, Bovicelli L, Miracolo A,

et al. Ursodeoxycholic acid administration in patients with cholestasis

of pregnancy: effects on primary bile acids in babies and mothers.

Hepatology 2001;33:504–508.

[23] Palma J, Reyes H, Ribalta J, Iglesias J, Gonzalez MC, Hernandez I,

et al. Effects of ursodeoxycholic acid in patients with intrahepatic

cholestasis of pregnancy. Hepatology 1992;15:1043–1047.

[24] Monte MJ, Morales AI, Arevalo M, Alvaro I, Macias RIR, Marin JJG.

Reversible impairment of neonatal hepatobiliary function by maternal

cholestasis. Hepatology 1996;23:1208–1217.

[25] Serrano MA, Macias RI, Vallejo M, Briz O, Bravo A, Pascual MJ,

et al. Effect of ursodeoxycholic acid on the impairment induced by

maternal cholestasis in the rat placenta-maternal liver tandem

excretory pathway. J Pharmacol Exp Ther 2003;305:515–524.

[26] Mashige U, Imai K, Osuga T. Simple and sensitive assay of serum

total bile acids. Clin Chim Acta 1976;70:79–86.

[27] El-Mir MY, Monte MJ, Morales AI, Arevalo M, Serrano MA,

Marin JJG. Effect of maternal cholestasis on biliary lipid and bile acid

secretion in the infant rat. Hepatology 1997;26:527–536.

[28] Niehaus WG, Samuelsson B. Formation of malonaldehyde from

phospholipid arachidonate during microsomal lipid peroxidation. Eur

J Biochem 1968;6:126–130.

[29] Reznick AZ, Packer L. Oxidative damage to proteins: spectro-

photometric method for carbonyl assay. Methods Enzymol 1994;233:

357–363.

[30] Tietze F. Enzymatic method for quantitative determination of

nanogram amounts of total and oxidized glutathione: applications to

mammalian blood and other tissues. Anal Biochem 1969;27:502–522.

[31] Griffith OW. Determination of glutathione and glutathione disulfide

using glutathione reductase and 2-vinylpyridine. Anal Biochem 1980;

106:207–212.

[32] Clairborne A, Fridovich I. Purification of the o-dianisidine peroxidase

from Escherichia coli B. Physicochemical characterization and

analysis of its dual catalatic and peroxidatic activities. J Biol Chem

1979;254:4245–4252.

[33] Flohe L, Gunzler WA. Assays of glutathione peroxidase. Methods

Enzymol 1984;105:114–121.

[34] Carlberg I, Mannervick B. Glutathione reductase. Methods Enzymol

1985;113:484–490.

[35] Habig WH, Pabst MJ, Jakoby WB. Glutathione S-transferases. The

first enzymatic step in mercapturic acid formation. J Biol Chem 1974;

249:7130–7139.

[36] Hasegawa JI, Kamada S, Kamiike W, Shimizu S, Imazu T,

Matsuda H, et al. Involvement of CPP32/Yama (-like) proteases in

Fas-mediated apoptosis. Cancer Res 1996;56:1713–1718.

[37] Markwell MA, Haas SM, Bieber LL, Tolbert NE. A modification of

the Lowry procedure to simplify protein determination in membrane

and lipoprotein samples. Anal Biochem 1978;87:206–210.

[38] Muntane J, Montero JL, Marchal T, Perez-Seoane C, Lozano JM,

Fraga E, et al. Effect of PGE1 on TNF-alpha status and hepatic

D-galactosamine-induced apoptosis in rats. J Gastroenterol Hepatol

1998;13:197–207.

[39] Briz O, Macias RI, Vallejo M, Silva A, Serrano MA, Marin JJ.

Usefulness of liposomes loaded with cytostatic bile acid derivatives to

circumvent chemotherapy resistance of enterohepatic tumors. Mol

Pharmacol 2003;63:742–750.

[40] Sawai H, Kawai S, Domae N. Reduced expression of Bax in

ceramide-resistant HL-60 subline. Biochem Biophys Res Commun

2004;319:46–49.

[41] Salvesen GS, Dixit VM. Caspase activation: the induced-proximity

model. Proc Natl Acad Sci USA 1999;96:10964–10967.

[42] Singh S, Shackleton G, Ah-Sing E, Chakraborty J, Bailey ME.

Antioxidant defenses in the bile duct-ligated rat. Gastroenterology

1992;103:1625–1629.

[43] Purucker E, Winograd R, Roeb E, Matern S. Glutathione status in

liver and plasma during development of biliary cirrhosis after bile

duct ligation. Res Exp Med (Berl) 1998;198:167–174.

[44] Zollner G, Fickert P, Fuchsbichler A, Silbert D, Wagner M,

Arbeiter S, et al. Role of nuclear bile acid receptor, FXR, in adaptive

ABC transporter regulation by cholic and ursodeoxycholic acid in

mouse liver, kidney and intestine. J Hepatol 2003;39:480–488.

[45] Henderson GI, Chen JJ, Schenker S. Ethanol, oxidative stress, reactive

aldehydes, and the fetus. Front Biosci 1999;4:D541–D550.

[46] Yoshioka T, Takehara Y, Shimatani M, Abe K, Utsumi K. Lipid

peroxidation and antioxidants in rat liver during development. Tohoku

J Exp Med 1982;137:391–400.

[47] Sastre J, Asensi M, Rodrigo F, Pallardo FV, Vento M, Vina J.

Antioxidant administration to the mother prevents oxidative

stress associated with birth in the neonatal rat. Life Sci 1994;54:

2055–2059.

[48] Gonzalez MM, Madrid R, Arahuetes RM. Physiological changes in

antioxidant defences in fetal and neonatal rat liver. Reprod Fertil Dev

1995;7:1375–1380.

[49] Macias RIR, Serrano MA, Monte MJ, Jimenez S, Hernandez B, Marin

JJG. Long-term effect of treating pregnant rats with ursodeoxycholic

acid on the congenital impairment of bile secretion induced in

the pups by maternal cholestasis. J Pharmacol Exp Ther

2005;312:751–758.

[50] Schoemaker MH, Gommans WM, de la Rosa LC, Homan M, Klok P,

Trautwein C, et al. Resistance of rat hepatocytes against bile acid-

induced apoptosis in cholestatic liver injury is due to nuclear factor-

kappa B activation. J Hepatol 2003;39:153–161.

[51] Kurosawa H, Que FG, Roberts LR, Fesmier PJ, Gores GJ.

Hepatocytes in the bile duct-ligated rat express Bcl-2. Am J Physiol

1997;272:G1587–G1593.