p53 and hsp70a genes expression changes in colorectal cancer cells during stress response

8/3/2019 P53 and HSP70A Genes Expression Changes in Colorectal Cancer Cells During Stress Response

1/12

P53 and HSP70A genes expression changes in colorectal cancer cells

during stress response

Aim:

The practical aims to identify the responses of p53 and HSP70A in four types of colon cancer

cells. It also aims to highlight the responses of these to heat shock and Hydrogen Peroxide

(H2O2) utilizing the RT PCR in order to identify the gene expression at mRNA (c-DNA). The

Western blot was used to assess the protein expression, to understand the effect of p53 mutation

of the cancer cells and its expression during phases of stress.

Method:

Four colonic cancer cells selected for the study included HT29, HCT-15, H-116 and SW480

respectively. Three types of treatment were carried out on each type of cells, thus creating three

groups of untreated or control cells, the heat treated and the H2O2 treated cells. These were then

lysated in the Lysis Binding Buffer, and these lysate were then used for:

1. mRNA Preparation: the cells were incubated for half an hour at 37 degrees centigradewith Proteinase K. The mRNA was then isolated with the addition of conditioned

oligo (dT)25. These were then placed in a magnet, washed twice with buffer + SDS

and buffer-SDS. It was then re-suspended in sterile water.

2. With the help of reverse transcription reaction, the mRNA was converted into c-DNA for p53 and HSP70A gene. The glyceraldehydes 3 phosphate dehydrogenase

(GAPDH) served as a control. The mastermix (Table 1) was then made, and the


2/12

samples were then divided to +RT and RT, and incubated at 42 degrees C for one

hour. The PCR reaction of the 3 genes was then prepared, (table 1 and 2), with the

help of thermocycler (table 3), and finally the agarose gel electrophoresis to analyze

the RT PCR results.

3. SDS-PAGE and Western Blotting: variable concentration of bovin serum albumin orBSA were prepared as protein standard solutions with NaOH.

The lysate was then centrifuged at 4C for 5 min. the pellet was then stored at -80C,

resuspended with lysis buffer, and supernatant to NaOH was added. After this, the Bradford

reagent was added to all samples including the standards. The absorbance was then measured at

595nm and the target protein amount was normalized. This was then loaded in a gel which ran at100V for 15 min, and then 120V for 90 minutes respectively. At the conclusion of this, the

protein concerntation was measured using the method of Lowry et al (1).Mastermix of c-DNA synthesis Mastermix of RT PCR

5xbufferdNTPs,10mM

RNAsinSterile water

10xAlec Jeffreys bufferForward primer

Reverse primerH2O

Table 1.Showed the mastermix of c-DNA synthesis and RT PCR.

Gene Primer sequences

GAPDH Forward 5 AGAACATCATCCCTGCCTC 3,Reverse 5 GCCAAATTCGTTGTCATACC 3

P53 Forward 5 CTACTGGGACGGAACAGCTT 3Reverse 5 CAAGGCCTCATTCAGCTCTC 3

HSP70A Forward 5 CTAGCCTGAGGAGCTGCTGCGACAG 3Reverse 5 GTTCCCTGCTCTCTGTCGGCTCGGCT 3

Table 2. Showed forward and reverse primer sequences of p53,GAPDH,and HSP70A genes.

P53 &HSP70A GAPDH PCR reaction

Cycle No. Cycle No. Temp Time Purpose

35 cycles 28 cycles 94C 30 sec Denaturation

60C 30sec Annealing ofprimers


3/12

72C 30sec Extension of

sequences

Table 3. Showed cycle numbers, temperature and time of PCR reaction of p53,HSP70A,and

GAPDH genes.

Result:

The p53, HSP70 gene expression from H-116 colorectal cancer cells were analysed at the mRNA

level by the RT PCR, fig 1. The control used was the GAPDH gene expression, (fig 2), table 6.

Its protein expression was then analysed by western blot (fig 3, table 6).

The band size of the p53 was found to be 250bp, thus confirming the mRNA origin at p53 c-

DNA size equaling 255 bp. It clearly showed that the size was not genomic in origin (597 bp as

p53 primer cross one intron). We were unable to amplify the HSP70A gene through the RT PCR.

The band absorbance of the previous result were then measured through the Gene Tool program

(table 4 and 5). These were then statistically analysed with other groups using the Prism, figure

4-9.

H-116

cells

RT PCR

Control Heat H2O2

Absorbance normalization %change

Absorbance Normalization %change

Absorbance Normalization %change

GAPDH 25918 25918 100% 20960 25918 100% 24357 25918 100%

P53 37890 37890 100% 8572 10629 28% 27498 29148 78%

HSP70A No band - - No band - - No band - -

Table 4.Showed data of the band absorbance, with normalization and % changes of GAPDH, HSP70A,

and p53 RT PCR results fromH-116 colorectal cancer cells ( control cells ,heat treated cells,and H2O2

treated cells).

H-116

cells

Westren blot

Control Heat H2O2

normalization % change normalization % change Normalization % change

GAPDH 33772 100% 20441 61% 29346 87%

P53 6955 100% 12022 173% 8616 124%

HSP70A 20756 100% 26952 129% 23881 115%


4/12

Table 5.Showed data of the band absorbance and % changes of GAPDH, HSP70A, and p53 RT PCR

results fromH-116 colorectal cancer cells ( control cells ,heat treated cells,and H2O2 treated cells).

Size (bp) L 1 2 3 4 5 6 7 8 9 10 11 12 13 14

500

300

100

Figure 1.

Showed RT PCR

amplification o

p53 and HSP70

from H-116 cells,

L = 100bp size

ladder,Track 1-6

for p53 gene

amplification, ,(1,3and 5 with RT enzyme,2,4,6 without RT ) 1&2 control cells, 3&4 Heat treated cells, 5&6 H2O2

treated cells.7&14 water(-ve control).Track 8-15 HSP70A gene amplification,(8,10,12 with RT,9,11,13 without

RT), 8&9 control cells, 10&11 Heat treated cells, 12&13 H2O2 treated cells.

Size (bp) L 1 2 3 4 5 6

Figure 2, Showed RT PCR amplification of GAPDH gene from H-116 cells , L = 100bp size ladder, 1 &2 control

H-116 cells, 3 & 4 cells treated with heat, 5& 6 cells treated with H2O2, 1,3,5 with reverse transcriptase (RT)

enzyme, and 2,4,6 without RT.

Size(KDa) 1 2 3 4


5/12

Figure 3. Showed western blot result of H-116 cells analysis of proteins separated by SDS-

PAGE gradient gel electrophoresis, 1=Ladder, 2 control,3 Heat treated cells,4 H2O2 treated

cells.a=HSP70A protein,b=p53 protein,c=GAPDH protein.

H-116colorectalcancer cells

RT PCR Westren blot

GAPDH P53 HSP70A GAPDHbandsize(KDa)

P53 bandsize(KDa)

HSP70Abandsize(KDa)

bandNumber

bandsize(bp)

bandNumber

bandsize(bp)

bandNumber

bandsize(bp)

Control One 350 One 250 No band* - 36 53 70

Heat treated One 350 One 250 No band* - 36 53 70

H2O2treated

One 350 One 250 No band* - 36 53 70

* We failed to amplified HSP70A by RT PCR

Table 6.Showed RT PCR and western blot results of GAPDH, P53 and HSP70A genes from H-

116 colorectal cancer cells(control cells, heat treated cells,and H2O2 treated cells).

The p53 mRNA expression from the H-116 cells was reduced at 65% after the heat treatment and

78% after the H2O2 treatment (fig 4). However the expression at the protein level was found to

increase after the heat treatment to 148% and H2O2 at 151% (fig 5). The HSP70A protein

expression were increased after heat treatment at 129% and at 115% after H2O2. All these values

are in comparison to the untreated cells at 100% (fig 6).

Tables 7,8 and 9 demonstrate the comparison between the three types of colorectal cancer cells.

The p53 mRNA expression with its protein expression of each cell after heat and H2O2 were

also compared and can be seen in figures 7, 8 and 9, table 7.


6/12

Colorectal

cell lines

P53 HSP70A

Heat H2O2 Heat H2O2

mRNA

%

change

Protein

%

change

mRNA

%

change

Protein

%

change

mRNA

%

change

Protein

%

change

mRNA

%

change

Protein

%

change

H-116 65% 148% 78% 151% - 129% - 115%

HT29 73% 35% 585% 154% - 178% - 105%

HCT-15 27% 66% 116% 208% - 284% - 132%

SW480 - 128% - 111% 82% 140% - 146%

Table 7,showed comparison of p53 and HSP70A gene and protein expression in 4 cancer celllines,in response to the heat and H2O2.

Figure 4 .Showed p53

% changes at the mRNA level in different colorectal cancer cells, first column for each cancer

cell line represent control cells, second column represent heat treated cells,and third column

represent H2O2 treated cells.


7/12

Figure 5 .Showed p53 % changes at the protein level in different colorectal cancer cells, first

column for each cancer cell line represent control cells, second column represent heat treated

cells,and third column represent H2O2 treated cells.

Figure 6.Showed HSP70A % changes at the protein level in different colorectal cancer cells, first

column for each cancer cell line represent control cells, second column represent heat treated cells,and

third column represent H2O2 treated cells.


8/12

Figure 7, Showed a comparison of p53 %changes at protein and mrna level in different

colorectal cancer cells treated with heat,first column of each cell line reprents p53 %changes atmRNA level, and second

column represent p53%

changes at protein level.

Figure 8, Showed a comparison of p53 %changes at protein and mrna level in different

colorectal cancer cells treated with H2O2 ,first column of each cell line reprents p53 %changes at

mRNA level, and second column represent p53% changes at protein level.


9/12

Figure 9 .showed a comparison of HSP70A % changes at protein and mRNA level in SW480

colorectal cancer cells treated with heat.

The significant difference between P53 % changes at protein level for different colorectal ca

cell treated with heat(p=0.0031)HT29 vs H-116

HT29 vs SW480

H-116 vs HCT-15

Table 8. Showed the significant difference between P53 % changes at protein level for different

colorectal ca cells treated with heat.

Colorectal cancer cells Difference Significant p value(p0.05)

H-116 HSP70A at protein level

between control and heat,andbetween heat and H2O2.

P=0.0069

HT29 p53 at protein level between

heat and H2O2 .

HSP70A at protein levelbetween control and heat,and

between heat andH2O2(p=0.0016).

p=0.0059

p=0.0016

SW480 - -

HCT-15 p53 at protein level betweencontrol and and H2O2 , and

between heat and H2O2 .

HSP70A at protein levelbetween control and heat,and

between heat and H2O2

P=0.0144

p=0.0082


10/12

Table 9,Showed statistical differences between different colorectal cancer cells.

Discussion:

The p53 tumor suppressor gene can help in causing a temporary arresting of the growth, cause

DNA repair, or cause apoptosis when dealing with cellular stress. In most colorectal cancers

however, the mutations are found in TP53 (table 10). Approximately 50% of the colorectal

tumors show a gross overexpression of the protein p53 (2). This high expression levels of the

p53 protiens correlate with with the presence of point mutations. However, a certain mutant gene

did not cause such a gross overexpression of the protein. The result implies that a particular

mutation fails to stabilise the protein and in this way exerts its particular effect (2).

The H-116 heat treated cells in the experiment showed lesser p53 expression in mRNA, while a

higher figure in protein levels. Contrastingly, there was no significant change found at mRNA,

while an increase in the protein level was seen in the H2O2 treated cells when compared to the

untreated cells. The low mRNA expression could be because of a technical problem during RT

PCR. Or it could be due to a higher level of abnormal p53 protein in untreated cells. This is

because p53 overexpression is seen in colorectal cancer without heat or H2O2, and high levels of

abnormal p53 protein in cancer cells.

High temperature and other types of stress lead to an increase in the HSP70A expression. Some

studies suggest this overexpression of HSP70 in colorectal cancer cells (3), and in the HT-29

cells (4). The HSP70A gene from the H116 cells was not amplified, in other cell lines except for

SW480. The reason may be difficulty in HSP70A c-DNA primer design, low RT enzyme

efficiency, but in both the cases the protein expression was increased with heat and H2O2

treatment.


11/12

Our results suggest that the p53 mutation was the primary reason why there was an increase in

the expression. The heat and H2O2 both suggest that this increase is due to the accumulation of

the abnormal and non-functioning p53. In all the four cell lines, the HSP70A expression was

similarly increased after the heat and H2O2 treatment.

Colorectal cancercells

TP53 mutation

A.A mutation CDS mutation Zygosity

HCT-15 p.S241Fp.?

c.722CTc.1101-2AC

HeterozygousHeterozygous

HT-29 p.R273H c.818GA Homozygous

SW480 p.R273Hp.P309S

c.818GAc.925CT

HomozygousHomozygous

HCT-116 No mutation No mutation -Table 10. Showed p53 mutation in 4 different colorectal cancer cells.

P53 HSP70A

Highest

expression

Lowest

expression

Highest

expression

Lowest

expressionHeat treatedcells

At mRNAlevel

H-116 HCT-15 - -

At protein H-116 HT29 HCT-15 SW480

H2O2 treatedcells

At mRNAlevel

HT-29 H-116 - -

At protein HCT-15 SW480 SW480 H-116

Table 11. Showed comparison of p53 and HSP70A expression at mRNA and protein level,between 4 different cell lines treated with heat and H2O2.


12/12

p53 and hsp70a genes expression changes in colorectal cancer cells during stress response

Documents