patterns of phenotypic and genotypic resistance to ... · lincosamides and streptogramins group of...

Mohammed and Flayyih Iraqi Journal of Science, 2017, Vol. 58, No.2B, pp: 803-814

DOI:10.24996.ijs.2017.58.2B.4

803

Patterns of Phenotypic and Genotypic Resistance to Macrolides,

Lincosamides and Streptogramins Group of Antibiotics by Efflux Pump

and Enzymatic Modification in Methicillin Resistant Staphylococcus aureus

Luma Saeed Mohammed*, May Talib Flayyih

Deprtment of Biology, College of Science, University of Baghdad, Baghdad, Iraq.

Abstract

The study was carried out to isolate Staphylococcus aureus isolates from

differents clinical samples to detect resistance of isolates to methicillin and detect

the phenotypic and genotypic patterns of resistance to macrolides, lincosamides and

streptogramins (MLS). The results showed that from 300 clinical sample there were

40 isolate related to S.aureus and there were 38(95)% of isolates were methicillin

resistance S.aureus (MRSA). The suscepltibility test showed that there was 55% of

isolates were resistance to erythromycin , 35% were resistance to clindamycin and

2.5% had intermediate resistance to the last one . The resistance to streptogramins

determined phenotypicallyby the using of vitek 2 compact system,the results

showed that there were four types of MLS resistance (iMLS, cMLS, M phenotype

and SAB). All isolates were subjected to polymerase chain reaction teqnique in a

monoplex pattern to amplify resistance encoding genes msrA, msrB,linA/linA’ and

vga .The results showed that 36(90)% of isolates contain msrA(940bp) and

msrB(595bp) , 30 (75)% of isolates contain linA/linA’ (323bp) gene while a region

of (470bp) of vga gene was not found in any isolate.

Keywords: S. aureus, MRSA, iMLSB , cMLS, M phenotype, SAB, msrA , msrB,

linA/linA’, vga.

اللنكوسأمايد و الماكروليدات مضادات لمجموعة االنماط المظهرية والوراثية المقاومةبألية الضخ خارج المقاومة للمثيسيلين Staphylococcus aureusبكتريا في والستربتوغرامين

الخلية والتحوير االنزيمي

حــي طالــــــــــب فليـــــــــمـــــــــ *،لـمـــــى سعيــــد محمـــــد

.العراق ،بغداد ، جامعة بغداد، كلية العلوم ، قسم علوم الحياة الخالصة

عن والتحريمن نماذج سريرية مختلفة المكورات العنقودية الذهبية هذه الدراسة لعزل بكتريا اجريت لعزالت لمضاد المثيسيلين و عن االنماط الوراثية والمظهرية لمقاومة مجموعة مضادات الماكروليدات امقاومة

03عينة سريرية تم الحصول على 033واللنكوسأمايد والستربتوغرامين ، اوضحت النتائج ان من مجموع النوع المقاوم للمثيسيلين ، ها منمن )%59عزلة ) 03و Staphylococcus aureus عزلة تابعة للنوع

(% منها مقاوم 09مة لمضاد االريثرومايسين بينما )و من العزالت مقا )%99نتائج اختبار الحساسية ان )بينت

ISSN: 0067-2904


DOI:10.24996.ijs.2017.58.2B.4

804

من العزالت لها مقاومة متوسطة للمضاد االخير . تم اختبار حساسية العزالت )%5,9للكليندامايسين و )ط مظهرية م نظام الفايتك حيث اوضحت النتائج ان هناك اربعة انمالمضاد الستربتوغرامين مظهريًا بأستخدا

( . عرضت كل العزالت لتفاعل SABو M phenotypeو cMLSو (iMLS لمقاومة هذه المجموعة هي (vga,linA/linA’,msrB,msrA)و النمط االحادي لتضخيم الجينات المشفرة للمقاومة وهيذالبلمرة المتسلسل

و msrA(940bp)من العزالت حاوية على الجينين )%53عزلة ) 03،اوضحت النتائج ان msrB(595bp) حاوية على الجين )%59عزلة ) 03و linA/linA’ (323bp) بينما لم تحتوي اي عزلة

vga(470bp). على الجين

Introduction Antimicrobial resistance is one of most serious health threats , infections from resistant bacteria

are now too common and some pathogens have even become resistant to multiple types or classes of

antibiotics , S. aureus has become a major public health concern as a result of the steadily increasing

incidence of antimicrobial resistance particularly methicillin-resistant S. aureus (MRSA) [1].

Macrolides (e.g. erythromycin, azithromycin, spiramycin), lincosamides (e.g.,clindamycin,

lincomycin), and streptogramin (e.g., quinupristin) are groups of antibiotic collectively name MLS

, they are chemically different, but have similar inhibitory effects on bacterial protein synthesis ,

MLS commonly used in treatment of staphylococcal infections and clindamycin is a frequent choice

for some staphylococcal infections particularly skin and soft tissue infections and it is an alternative in

the penicillin-allergic patients [2]. Due to the high resistance to most of the antibiotics by

MRSA, vancomycin is normally the drug of choice. As vancomycin has many side effects, it

leads to interest in the alternatives for vancomycin especially MLS antibiotics [3]. The

resistance phenotypes are:

*M Phenotype: Staphylococcal isolates exhibiting resistance to erythromycin or while sensitive to

clindamycin [4].

*Inducible MLS (iMLS) Phenotype:Staphylococcal isolates show resistance to erythromycin and

clindamycin [5].

*Constitutive MLS Phenotype (cMLS): resistant to macrolide, lincosamide and streptogramin

antibiotics [6].

*SAB: resistance to streptogramines A and B antibiotics [7].

Materials and Methods:

Sample collection:

Three hundreds clinical specimens including urine, ear, sputum, blood and skin swabs, were

collected from patients attending Baghdad Hospitals, for the period from January to April 2015.

Isolation of staphylococci:

The isolation of staphylococci from various clinical sample by specific way depending on routine

laboratory techniques, all samples were streaked on mannitol salt agar all plates were incubated

aerobically for 24 hrs. at 37°C. [8].

S.aureus isolates were identified depending on the morphological features on culture media and

biochemical tests according to Bergey’s Manual [9], and confirmed diagnosis by the use of vitek2

compact system.

Detection of MRSA The detection of MRSA was carried out through cefoxitin screen test and susceptibility test of S.

aureus isolates to oxacillin.

MLS susceptibility pattern:

Macrolide-lincosamide and streptogramines susceptibility pattern determined by using of vitek 2

compact system by estimation of MIC values of erythromycin and clindamycin, resistance to

streptogramines determined phenotypically.

DNA extraction from S.aureus isolates by using Wizard® Genomic DNA Purification Kit

Promega (USA):


DOI:10.24996.ijs.2017.58.2B.4

805

1. S.aureus isolates were streaked on mannitol salt agar, after incubated for 24 hrs. at 37ºC. There

after the bacterial isolates were inoculated in tubes contained 5 ml of sterile brain heart infusion

broth , incubated overnight 18 hrs. at 37 ºC.

2. From bacterial growth 1.5 ml was transferred to a 2ml microcentrifuge tubes and centrifuged at

14000g for 2 min. to pellet the cells, the supernatant was removed.

3. The pellet cells were resuspended in 480μl of 50mM EDTA and 120 μl of lysozyme was added to

the resuspended cells and pipetting gently to mix, after incubation at 37ºC for 2hrs. in water bath,

the microcentrifuge tubes were centrifuged for 2 min. at 14000g and the supernatant was

removed.

4. Nuclei Lysis Solution 600μl was added to the pellet cells and pipetting gently to mix then

incubated in water bath at 80ºC for 10 min., the microcentrifuge tubes allowed to cool at room

temperature.

5. RNase solution 3µl was added to the cell lysate, the microfuge tubes were inverted gently to mix,

the tubes were incubated in water bath for 60 min. at 37ºC.

6. Protein Precipitation Solution 200 µl was added to the RNase treated cell lysate, vortex

vigorously at high speed for 20 sec. to mix the protein precipitation solution with the cell lysate,

the microfuge tubes incubated in ice bath for 10 min.

7. The microcentrifuge tubes were centrifuged at 14000g for 3 min.

8. The supernatant contained DNA was transferred to new clean 1.5 microfuge tubes containing 600

µl of room temperature isopropanol at room temperature , gently mix by inversion until the

thread-like strands of DNA form a visible mass, centrifuged the tubes at 14000g for 2 min.

9. The supernatant carefully poured off and the tubes drained on clean absorbant paper, 70% ethanol

was added to wash the DNA pellet at room, centrifuged the tubes at 14000g for 2 min. and the

ethanol was aspirated.

10. DNA Rehydration Solution 100μl was added to the DNA in the microfuge tubes and rehydrate

through incubation at room temperature overnight.

11. The DNA was stored in -20ºC.

Determination of DNA quality

Estimating of DNA concentration and purity: The DNA concentration and purity were determined by using nano drop instrument from ACT

gene (China), the principle of this instrument is measuring the absorbency of nucleic acid in the wave

length 260/280 (according to company instructions).

Agarose Gel Preparation and Electrophoresis:

Agarose gel was prepared in 1% concentration for quality of the extracted DNA, by dissolving 1

gm of agarose powder in 100 ml of 1 x TBE buffer and melted, then the agarose gel was cooled to 50-

60ᵒC, 5 μL of ethidium bromide dye was added with mixing , DNA samples were first mixed with

aloading dye, so that 8 μL of each DNA sample were mixed with 2 μL loading dye, then this 10 μL of

loaded DNA were carefully transferred to a well of the agarose electrophoresis gel, electric current

was matched (72 volt for 90 min.) [10].

Primers selection:

All the primers listed in Table-1 were selected for this study, these primers were provided in a

lyophilized form (Bioneer) , dissolved in sterile distilled water to give a final concentration of 100

pmol ∕ μL and stored in deep freezer until used in PCR amplification , vga primer also designed

according to NCBI BLAST http://www.ncbi.nlm.gov. Table-1.

http://www.ncbi.nlm.gov/


DOI:10.24996.ijs.2017.58.2B.4

806

Table1-The primers and their sequnces used in convential PCR.

Target

gene

Primer

name Primer sequences5-3

PCR

frag-

ment

size(bp)

References

msrA MsrA F GGCACAATAA GAGTGTTTAA

AGG 940 [11]

msrA MsrAR AAGTTATATC ATGAATAGAT

TGTCCTGTT

msrB MsrB F TATGATATCC ATAATAATTA

TCCAATC 595 [11]

msrB MsrB R AAGTTATATC ATGAATAGAT

TGTCCTGTT

linA/linA′ linA/linA′ F GGTGGCTGGG GGGTAGATGT

ATTAACTGG 323 [12]

linA/linA′ linA/linA′ R GCTTCTTTTG AAATACATGG

TATTTTTCGA TC

Vga Vga F CCAGAACTGC TATTAGCAGA

TGAA 470 [13]

Vga Vga R AAGTTCGTTT CTCTTTTCGA CG

Vga Vga F CTCTTTGTACGAGTATATGG 198 Promega

/USA

Vga Vga R GTTTCTTAGTAGCTCGTTGAGC

Polymerase Chain Reaction (PCR) Technique:

The extracted DNA, primers and PCR premix (promega), were thawed at 4ᵒC, vortex and

centrifuged briefly to bring the contents to the bottom of the tubes.PCR mixture was set up in a total

volume of 25 μL included 5μL of PCR premix 2 μL of each primer, 5 μL of template DNA have been

used , the rest volume was completed with sterile neuclease free water water, then vortexed

(tempalate DNA was added finally) , PCR reaction tubes were centrifuged briefly to mix and bring

the contents to the bottom of the tubes then placed into thermocycler PCR instrument where DNA

was amplified as indicating in the Tables-2 ,3 and 4 after optimization .

Table 2- Program used to amplify the msrA and msrB gene.

Stage Temperature (time)

Initial denaturation 95°C (5min.)

Denaturation 95°C (30sec.)

30 cycles Annealing 50°C (35sec.)

Extension 72°C (50sec.)


DOI:10.24996.ijs.2017.58.2B.4

807

Final extension 72°C (7min.)

Hold 4°C

Table 3- Program used to a mplify the linA/linA′ gene.

Table 4- Program used to amplify the vga gene.







Hold 4°C

Determination of PCR product:

Agarose gel was prepared in 1 % concentration there after, 5 µl DNA ladder were placed in the

first left well of the agarose electrophoresis gel, 5 μL of each PCR product loaded carefully to other

wells of the agarose electrophoresis gel, then the electrophoresis tank closed with its special lid, and

electric current was matched (72 volt for 90 mim.) [14].

Results and discussion:

Based on biochemical characteristics , from 300 sampels 40 isolats (SA1 to SA40) were identified

as S.aureus.

Detection of MRSA:

The detection of MRSA was carried out through cefoxitin screen test and susceptibility test of S.

aureus isolates to oxacillin, these two tests confirmed phenotypically by presence of modification of

mecA gene, the results showed that 38 (95) % of S. aureus isolates gave positive results to cefoxitin

screen test indicated that these isolates were MRSA, 2 (5 %) isolates (SA34 and SA38) were negative

for this test indicated that these two isolates were MSSA, 95 % of S. aureus isolates resistant oxacillin

(MIC ≥ 4 μg/ml) and 5% of isolates were sensitive (MIC ≥ 0.5 μg/ml), Oxacillin-resistant S. aureus

(ORSA), more commonly referred as MRSA [15]. The results showed that all S. aureus isolates

which gave positive test of cefoxitin screen and resistance to oxacilline had modification of penicillin

binding protein (mecA) (95 %).

Susceptibility of S. aureus isolates to MLS antibiotics

S.aureus isolates were 55% and 32.5% resistance to erythromycin and clindamycin respectively.

(MIC>=8 µg/ml for both antibiotics and (<=0.25 µg/ml) for clindamycin for isolates (which had

inducible ressistance to it), (2.5)% of isolates had intermediate resistance to clindamycin (MIC=2

µg/ml) . MLS resistance pattern showed that there are four types of MLS resistance phenotypes,

22.5% of S.aureus isolates was iMLS, 3% was cMLS while M phenotype found in 25% of S.aureus

isolates resistance to streptogramins determined phenotypically results showed that 18 isolates (45)%

had SAB resistance phenotype.







Hold 4°C


DOI:10.24996.ijs.2017.58.2B.4

808

DNA Extraction from S.aureus isolates

Staphylococcus is gram positive bacteria; it's peptidoglycan is the basic component of the cell wall,

and makes up 50% of the cell wall mass [16]. Thick cell peptidoglycan layer makes DNA extraction

difficult work and expensive because of requirements lysozyme andlysostaphin DNA of 40 isolates

of S.aureus were extracted by Wizard® Genomic DNA purification kit. Purity of Genomic DNA was

estimated by Nano drop instrument in wave length 260/280, it ranged between (1.8-2), this indicates

to the methods efficiency was utilized in extraction and the purification of DNA as shown in Figure -1

,the purpose of DNA extraction was for detection of genes responsible for resistance to MLS group of

antibiotics.

Figure 1- Gel electrophoresis of DNA bands extracted from 16 isolates of S.aureus (agarose 1%

TBE buffer(1x) , 72 volt for 90 min.) stained with ethidium bromide lanes (1-16)were DNA extracted

band for isolates (SA1 to SA16).

msrA gene amplification by monoplex PCR technique:

To detect S. aureus isolates with msrA gene, it was subjected to PCR technique in a monoplex

pattern, msrA positivity was confirmed by agarose gel electrophoresis , Figure -2 .The result showed

that 36 isolates of S.aureus 90% ; (34 isolates of MRSA and 2 isolates of MSSA) had 940 bp band

(msrA) gene, this gene confer the inducible resistance (cross resistance) to macrolides and

streptogramines by pumping the antibiotics out of bacterial cell and prevent the accumulation in side

the cell [17]. Lina et al. (1999) found that the msrA gene was detected in 3 of S. aureus strains and 17

strains of CoNS conferring resistance to erythromycin . This gene was responsible for erythromycin

resistance in 36.4 % of clinical isolates of CoNs [18]. While [19] reported that msrA found in 33% of

CoNs. Other study showed that the frequency of erythromycin resistance gene (msrA) in S. aureus

was 10.2% [20].

Figure 2- Gel electrophoresis of amplified PCR products of msrA gene (940 bp) of S.aureus isolates

in monoplex PCR technique (agarose 1%, TBE buffer (1X) , 72 volt for 90 min. stained with ethidium

bromide). M:The DNA molecular weight marker (1500 bp ladder). All lanes for isolates

(SA1,SA2,SA3,SA4,SA5,SA6,SA7,SA8,SA9,SA10) gave positive results to msrA gene.

16


DOI:10.24996.ijs.2017.58.2B.4

809

MsrB gene amplification by monoplex PCR technique

msrB gene had been detected in S.aureus isolates by PCR technique in a monoplex pattern ,msrB

positivity was confirmed by agarose gel electrophoresis , Figure- 3 .The result showed that 36 (90)%

isolates of S.aureus MRSA and MSSA had 595 bp band . The msrB gene responsible for macrolides

and streptogramines resistance in S.aureus and other bacteria [21]. [22] reported that msrB genes

presence in (6)% in S.aureus isolates and it was responsible for macrolide resistance . Other study

showed that msrB found in S. xylosus [23].While [24] reporetd that this gene found in (1.8) % of

MRSA.

Figure 3-Gel electrophoresis of amplified PCR products of msrB gene (595 bp) of 10 S.aureus

isolates in monoplex PCR technique (agarose 1%, TBE buffer (1X), 72 volt for 90 min. stained with

ethidium bromide). M: The DNA molecular weight marker (1500 bp ladder),all lanes gave positive

amplification for isolates ( SA1 ,SA3, SA4, SA5,SA6 ,SA7,SA8, SA9, SA10) except lane 2 for the

isolate (SA2) : negative amplification of 595 bp for msrB gene .

linA/linA′ gene amplification by monoplex PCR technique:

To detect S.aureus isolates with linA/linA′ gene, it was subjected to PCR technique in a monoplex

pattern linA/linA′ positivity was confirmed by agarose gel electrophoresis , Figure- 4.The results

showed 30 isolates of S.aureus (75)% (MRSA and MSSA) had 323 bp band . Other studies showed

that linA/linA′ was found among 98 isolates (30)% of methicillin-resistant coagulase-negative

staphylococci caused additionally resistant to macrolides and lincosamides [25]. This gene conferring

resistance to lincosamide by nucleotidyltransferase catalyzing the adenylation of the hydroxyl group

in position 3 of lincosamides [26].

linA/linA′ conferring resistance to lincomycin detected in one strain of S. aureus and seven strains

of CoNS [12] . linA/linA′ genes in S. aureus found in combination with ermC in one strain, giving a

resistance phenotype which was the addition of an MLSB-inducible resistance due to the erm gene

plus a constitutive resistance to lincomycin due to linA/linA′. Other study showed that linA/linA′ of S.

epidermidis was the single resistance gene [27].

The frequently use of macrolides and lincosamides antibiotics in treatment of infections caused by

S.aureus led the high distribution of these genes in clinical S.aureus isolates [28].

Figure 4- Gel electrophoresis of amplified PCR products of linA/linA' gene 323 bp of 10 S.aureus

isolates in monoplex PCR technique (agarose 1%, TBE buffer (1X), 72 volt for 90 min. and stained


DOI:10.24996.ijs.2017.58.2B.4

810

with ethidium bromide). M:The DNA molecular weight marker (1500 bp ladder). All lanes gave

positive amplification for this gene for isolates (SA1, SA3,SA4,SA5,SA6,SA7,SA8,SA9 SA10)

except lane2 for isolate SA2 gave negative amplification for this gene.

Vga gene amplification by monoplex PCR technique:

Vga gene had been detected by PCR technique in a monoplex pattern, Vga was confirmed by

agarose gel electrophoresis in a 1% agarose staind with ethidium bromide, electrophoresed in 72 volt

for 90 min. and photographed under ultraviolet (UV) transilluminator, the results showed that 470 bp

band was not found in any isolates of S.aureus as shown in Figure-5. S.aureus isolates which had

resistance phenotypes to streptogramines had msrA and msrB genes conferring resistance to

macrolides and streptogramin B [29].

Figure 5- Gel electrophoresis of amplified PCR products of Vga gene (470bp): negative amplification

of all S.aureus isolates to this gene.

Distribution of genes among MLS resistance phenotypes in S.aureus isolates:

The resuts showed that among 9 S.aureus isolates had an iMLS resistance phenotype there were 7

isolates had not linA/linA' gene but there were resistance to clindamycin Table -5 , this occurred due

to the presence of msrA and msrB (one of them or both) conferring resistance to macrolides and

induced the resistance of S.aureus isolates to lincosamide after induction with macrolides (cross

resistance), because the resistance to lincosamide was closely tied to erythromycin through the

acquisition of MDR efflux pump [30, 31] Isolates (SA32 and SA40) had linA/linA' , msrA and msrB

for SA32 and msrB for SA40 , in this case linA/linA did not had any role in the resistance, because

one of resistance mechanisms to clindamycin in staphylococci is the active efflux pump of the

antibiotic from the periplasmic spase encoded by msrA gene [32, 33]. Other studies reported that

efflux pump of lincosamide is controlled by lmr, car and lsa genes [34]. Other study showed that

clindamycin resistance in S.aureus caused skin and soft tissue infections was due to vgaA allelic

variant for a putative efflux pump [35]. Clindamycin was problematic because it is exported from the

bacteria by the same inducible efflux pump that renders MRSA resistance to macrolides and it should

not be used if there is resistance to erythromycin or azithromycin, vancomycin, linezolid or

daptomycin [36].

In cMLS reistance phenotype the isolates SA13, SA30 and SA33 had linA/linA' gene which

conferring resistance to by drug modification mechanism via lincosamide nucleotidyl transferase

encoded by linA gene [37] . msrA gene in (SA13 ,SA30 and SA 33) and msrB gene in (SA30 and

SA33) responsible for macrolide resistance (erythromycin). In M resistance phenotype which

included S.aureus isolates showed resistance to macrolide only ,msrA gene found in 9 islates out of 10

,msrB found in all 10 isolates, msrA and msrB genes confered this resistance .

SAB resistance phenotype included S.aureus isolates had resistance phenotype to streptogramines

A and B but the streptogramines resistance determinant (vga) was not found in isolates ,antibiotics

conferred by msrA and msrB genes ,there were (94.7)% of the these two genes in S.aureus isolates

which had this resistance phenotype. This result agree with result of other study found that the

streptogramines resistance determinants vatA, vatB, vga were not found in S.aureus isolates and msrA

and msrB genes conferring resistance to these antibiotics [38]. linA/linA' found in (94.7)% of these

isolate, genes conferring resistance to one of the MLS antibiotics may confer cross-resistance to


DOI:10.24996.ijs.2017.58.2B.4

811

others, because they have similar effects on inhibition of bacterial protein synthesis [39]. This

illustrated the importance of msrA and msrB genes in resistance of macrolides and other antibiotics

related to this group like lincosamides in local S.aureus isolates, this led t the increasing in numbers

of S.aureus isolates with iMLS phenotype [40]. Other study showd that linA/linA' gene found in

(52)% of iMLS phenotype, in 26% of cMLS phenotype and (13)% of MS phenotype [41]. Other

study reported that msrA induce the resistance of staphylococci to telithromycin (iMTS) phenotype,

telithromycin related to ketolide antibiotics belong to MLS group [28]. According to the types of

specimens the results showed that MLS resistance determinants genes distributed in S.aureus isolated

from different specimens especially from blood and skin, MLS resistance genes distributed in these

isolates , gave rise to the use of alternative antibiotics such as macrolides and clindamycin which led

to the high percentages of these genes in different clinical samples of S.aureus . Other studies showed

that msrA and msrB genes presence in S.aureus isolated from various human infections in 46.29%

for msrA and 49.07% for msrB [42]. msrA gene presence in S.aureus isolated from respiratory tract

S.aureus isolated from blood, respiratory tract infections, wound infections and abscess with a high

percent in respiratory tract infections. infections and wound infections [43].

Table 5- Distribution of msrA, msrB and linAllinA'genes in MLS resistance phenotypes in S.aureus.

Genes

linA/linA' msrB msrA No.of isolates Resistance phenotype

- + + SA27

- - + SA2

+ + + SA32

+ + - SA40 iMLS

- + + SA26

- + + SA18

- + - SA28

- + + SA35

- - + SA15

+ - + SA13

+ + + SA30 cMLS

+ + + SA33

- + + SA36

- + - SA29o/

“{}IOL

+ + + SA12

+ + + SA14

+ + + SA10 M

+ + + SA6

+ + + SA5

+ + + SA25

+ + + SA37

+ + + SA11

+ + + SA1

+ + + SA31

+ + + SA17

+ + - SA39

+ + + SA34

+ + + SA22 SAB

+ + + SA21

+ + + SA23

+ + + SA8

+ + + SA9

+ + + SA19


DOI:10.24996.ijs.2017.58.2B.4

812

+ + + SA24

- - + SA20

+ + + SA7

+ + + SA38

+ + + SA3

+ + + SA4

+ + + SA16

References 1. Evangelista, S. S. and Oliveira, A. C. 2015. Community-acquired methicillin-resistant

Staphylococcus aureus: a global problem. J. Rev. Bras. Enferm, 68(1): 128-35.

2. Adaleti, R., Nakipoglu, Y., Ceran, N., Tasdemir, C., Kaya, F. and Sdemir, S. 2010. Prevalence of

phenotypic resistance of Staphylococcus aureus isolates to macrolide, lincosamide, streptogramin

B, ketolid and linezolid antibiotics in Turkey. Braz. J. Infect. Dis. 14(1): 11-14.

3. Reddy, M. C., Bindu, H., Soumendranath, M., Kanta, R. C. and Indu, K. 2014. Prevalence of

inducible clindamycin resistance in Staphylococcus aureus from clinical samples: a study from a

teaching hospital in Andhra Pradesh, India. Int. J. Curr. Microbiol. App. Sci., 3(3): 402-409.

4. Jain, S., Rukadikar, A. and Jain, A. 2016. Inducible clindamycin resistance in Staphylococcus

aureus isolated from clinical samples at C. U. Shah Medical College and Hospital, Surendranagar,

Gujarat, India. Int. J. Curr. Microbiol. App. Sci., 6: 875-879.

5. Vandana, K. E., Singh, J., Chiranjay, M. and Bairy, I. 2009. Inducible clindamycin resistance in

Staphylococcus aureus: reason for treatment failure. J. Glob. Infect. Dis. 1(1): 76-77.

6. Lim, J., Kwon, A., Kim, S., Chong,Y., Lee, K. and Choi, E. 2002. Prevalence of resistance to

macrolide ,lincosamide and streptogramin antibiotics in Gram-positive cocci. J. Antimicrob.

Agents Chemother. 49(3): 489-95.

7. Leclercq, R. and Courvalin, P.1991. Bacterial resistance to macrolide, lincosamide, and

streptogramin antibiotics by target modification. J. Antimicrob.Agents Chemother. 35(7): 1267-

1272.

8. Mendez-Vilas, A. 2012. Microbs in Applied Research. Current Advances and Challenges.World

Scientific Publishing Co.

9. Holt, J. G., Krieg, N. R., Sneath, P.H.A., Staley, J.T. and Williams, S.T. 1994. Bergey’s

Manual of Determinative Bacteriology, 9th ed. Williams and Wilkins, Baltimore, Maryland.

10. Das, S. and Dash, H.R. 2015. Microbial Biotechnology a Laboratory Manual for Bacterial

Systems.Springer.

11. Ross, J.I., Eady, E.A., Cove, J.H., Cunliffe, W.J., Baumberg, S. and Wootton, J.C. 1990.

Inducible erythromycin resistance in staphylococci is encoded by a member of the ATP-binding

transport super-gene family. Mol. Microbiol. 4(7): 1207-14.

12. Lina, G., Quaglia, A., Reverdy, M., Leclercq, R., Vandenesch, F. and Etienne, J. 1999.

Distribution of genes encoding resistance to macrolides, lincosamides and streptogramins among

staphylococci. J. Antimicrob. Agents Chemother. 43(5): 1062-1066.

13. Castro-Alarcon, N., Ribas-Aparicio, R.M., Silva-Sanchez, J., Calderon-Navarro A., Sanchez-

Perez, A., Parra-Rojas, I. and Aparicio-Ozores, G. 2011. Molecular typing and characterization

of macrolide, lincosamide and streptogramin resistance in Staphylococcus epidermidis strains

isolated in a Mexican hospital. J. Med. Microbiol. 60(6): 730-6.

14. Dubey, R.C. and Maheshwari, D.K. 2012. Practical Microbiology. Revised edition .S.Chand and

Company LTD. New Delhi.New Delhi .India.

15. McDougal, L.K., Steward, C.D., Killgore, G.E., Chaitram, J.M., McAllister, S.K. and Tenover,

F.C. 2003. Pulsed-field gel ectrophoresis typing of oxacillin-resistant Staphylococcus aureus

isolates from the United States:establishing a national database. J.Clin.Microbiol. 41(11): 3115 -

3115

16. Dmitriev, B.A., Toukach, F.V., Holst, O., Rietschel, E.T. and Ehlers, S. 2004. Tertiary structure

of Staphylococcus aureus cell wall murein. J. Bacteriol. 186(21): 7141-7148.

17. Chaieb, K., Zmantar,T., Chehab, O., Bouchami, O., Ben, H. A., Mahdouani, K. and Bakhrouf, A.

2007. Antibiotic resistance genes detected by multiplex PCR assays in Staphylococcus


DOI:10.24996.ijs.2017.58.2B.4

813

epidermidis strains isolated from dialysis fluid and needles in a dialysis service. Jpn. J. Infect.

Dis. 60 (4): 183-187.

18. Eady, E. A., Ross, J.I., Tipper, J.L., Walters, C.E., Cove, J.H. and Noble, W.C. 1993. Distribution

of genes encoding erythromycin ribosomal methylases and an erythromycin efflux pump in

epidemiologically distinct groups of staphylococci. J. Antimicrob. Agents Chemother. 31(2):211-

217.

19. Wondrack, L., Massa, M., Yang, B.V. and Sutcliffe, J. 1996. Clinical strain of Staphylococcus

aureus inactivates and causes efflux of macrolides. J.Antimicrob. Agents Chemother. 40 (4): 992-

998.

20. Zmantar, T., Kouidhi, B., Miladi, H. and Bakhrouf. A. 2011. Detection of macrolide and

disinfectant resistance genes in clinical Staphylococcus aureus and coagulase-negative

staphylococci. BMC. Res. Notes. 4: 453.

21. Hershberger, E., Donabedian, S., Konstantinou, K. and Zervos, M.J. 2004. Quinupristin-

Dalfopristin resistance in Gram-positive bacteria: mechanism of resistance and epidemiology. J.

Clin. Infect. Dis. 38(1): 92-98.

22. Schmitz, F., Sadurskia, R., Kraya, A., Boosa, M., Geisela, R., Kohrer, K., Verhoef, J. and Fluitb,

C. 2000. Prevalence of macrolide-resistance genes in Staphylococcus aureus and Enterococcus

faecium isolates from 24 European university Hospitals. J. Antimicrob. Agents Chemother. 45 (6):

891-894.

23. Milton, I. D., Hewitt, C. L. and Harwood, C. R. 1992. Cloning and sequencing of a plasmid-

mediated erythromycin resistance determinant from Staphylococcus xylosus. FEMS Microbiology

Letters. 97 (1-2):141–147.

24. Ozansoy F. A., Cevahir, N. and Kaleli, I. 2015. Investigation of macrolide, lincosamide and

streptogramin B resistance in Staphylococcus aureus strains isolated from clinical samples by

phenotypical and genotypical methods. Mikrobiyol. Bul. 49(1):1-14.

25. Novotna, G., Adamkova,V., Janata, J., Melter, O. and Spizek, J. 2005. Prevalence of resistance

mechanisms against macrolides and lincosamides in methicillin-resistant coagulase-negative

staphylococci in the Czech Republic and occurrence of an undefined mechanism of resistance to

lincosamides. J. Antimicrob. Agents Chemother. 49(8): 3586-3589.

26. Bozdogan, B. and Leclercq, R. 1999. Effects of genes encoding resistance to streptogramins A

and B on the activity of quinupristin-dalfopristin against Enterococcus faecium. J. Antimicrob.


27. Mendez, E., Baroni,M., Mendosa, M., Segovia, G., Bellon, A., Mollerach, A.and Alicia, A. 2015.

Staphylococcus aureus: an unusual resistance mechanism. J. Bacteriol. Parasitol. 6: 213.

28. Gherardi, G., De Florio, L., Lorino, G., Fico, L. and Dicuonzo, G. 2009. Macrolide resistance

genotypes and phenotypes among erythromycin resistant clinical isolates of Staphylococcus

aureus and coagulase-negative staphylococci, Italy. FEMS. Immunol Med. Microbiol. 55: 62-

67.

29. Delialioglu, N., Aslan, G., Ozturk, C., Baki, V., Sen, S. and Emekdas, G. 2005. Inducible

clindamycin resistance in staphylococci isolated from clinical samples. Jpn. J. Infect. Dis. 58(2):

104-6.

30. Kaplan, S. L. 2004. New antibiotics and bacterial resistance.In : Hot Topics in Infection and

Immunity in Children.P:5-8.Vol.549.(eds. Pollard,A.J.;MacCracken,G.H. and Finn,A.).Springer

Science, LLC.

31. King,T. L., Mitchell, A. M., Lannen, B. J. and Daly, M. 2010. Essential drug categories.

In:Phamacology for Women’s Health.P:249-306 .Vol.11 (eds. King,T.L. and Brucher,M.C.).Jones

and Bartlent Publishers. Texas.

32. Kluytmans, J., Belkum, A. and Verbrugh, H. 1997. Nasal carriage of Staphylococcus aureus:

epidemiology, underlying mechanisms, and associated risks. J. Clin. Microbiol. Rev. 10(3): 505-

520.

33. Cain, C. L. 2013. Antimicrobial resistance in staphylococci in small animals. In: Clinical

Dermatology.P:19-34.Vol.43. (eds.Morris,D.O. and Kennis, R.A.).Elsevier.Philadelphia.


DOI:10.24996.ijs.2017.58.2B.4

814

34. Kirst, H. A. 2014. Protein synthesis inhibitors from smaller antibiotic classes. In:Antimicrobials

,New and Old Molecules in the Fight Against Multi-Resistance Bacteria. P: 267-283.Vol.14

(eds.Marinelli,F.and Genilloud,O.). Springer Heidelberg.London.

35. Qin, X., Poon, B., Kwong, J., Niles, D., Schmidt, B. Z., Rajagopal, L. and Gantt, S. 2011. Two

paediatric cases of skin and soft-tissue infections due to clindamycin-resistant Staphylococcus

aureus carrying a plasmid-encoded vga (A) allelic variant for a putative efflux pump. Inter. J.

Chemother. 38(1): 81-83.

36. Adams L.V. and Taylor,T. H. 2013. Evaluation and management of infectious diseases.

In:Primery Care . A Collection Practice.P:1242-1263. Vol.4 (eds.Buttaro,T.M.;Trybulski,J.;

Bailey,P.P. and Sandberg-Cook,J.). Elsevier.United State.

37. Petinaki, E., Guerin-Faublee, V., Pichereau, V., Villers, C., Achard, A., Malbruny, B., and

Leclercq, R. 2008. Lincomycin resistance gene lnu (D) in Streptococcus uberis .J. Antimicrob.


38. Osman, M., Al Nasbeh, A., Rafei, R., Mallat, H., Achkar, M., Dabboussi, F. and Hamze, M. 2015.

Characterization of resistance genes to macrolides, lincosamides and streptogramins (MLS)

among clinical isolates of Staphylococcus aureus in North Lebanon. Inter. J. Antimicrob. Agents.

5(4):1-8, 2(2): 626-630.

39. Kim, H. B., Lee, B., Jang, H. C., Kim, S. H., Kang, C. I., Choi, Y. J., Park, S.W., Kim, B. S.,

Kim, E. C., Oh, M. D. and Choe, K.W. 2004. A high frequency of macrolide-lincosamide-

streptogramin resistance determinants in Staphylococcus aureus isolated in South Korea. Microb.

Drug. Resist. 10(3): 248-254.

40. Durmaz, S., Kiraz, A., Ozer,T.T. and Percin, D. 2014. Macrolide-lincosamide-streptogramin B

resistance phenotypes in Staphylococcus aureus. Eur. J. Gen. Med. 11(4): 217-220.

41. Sakar, H., Mumcuoglu, I., Aksu, N., Karahan, Z. C., Kursun, S. and Kustimur, S. 2012. The rare

genes related to resistance to macrolide-lincosamide and streptogramin B group antibiotics among

coagulase-negative staphylococci. Mikrobiyol. Bul. 46(2):170-179.

42. Heidari, M., Momtaz, H., and Madani, M. 2011. Detection of the antibiotic resistance genes in

Staphylococcus aureus isolated from human infections and bovine mastitis. Afr. J. Microbiol. Res.

5(31): 5745-5749.

43. Momtaz, H. and Hafezi, L. 2014. Meticillin-resistant Staphylococcus aureus isolated from

Iranian Hospitals: virulence factors and antibiotic resistance properties. Bosn. J. Basic. Med. Sci.

14(4): 219-226.

patterns of phenotypic and genotypic resistance to ... · lincosamides and streptogramins group of...

Documents