pcr primer desining

PCR & Primer Designing

Karan Veer Singh

NBFGR

04/12/23 NBFGR karan veer singh

What is a primer?

A primer is a short synthetic oligonucleotide which is used in many molecular techniques. These primers are designed to have a sequence which is the reverse compliment a region of template or target DNA to which we wish the primer to anneal.

3’ 5’ TGACCTGAAAAGAC Primer GATGGACTGATTACCGATGACTGGACTTTTCTG Template 5’ 3’

3’ 5’ TGACCTGAAAAGAC : : : : : : : : : : : : : GATGGACTGATTACCGATGACTGGACTTTTCTG Annealing 5’ 3’

Diagram for PCR Primer Design

Primer Design

PCR reaction parameters

Sequence from which to choose primers

Primer Selection Rules

Results of search, including suggested annealing temperatures shown in list

Primer design is an artart when done by human beings, and a far far better done by machinesbetter done by machines.


• Primer uniquenessPrimer uniqueness• Primer lengthPrimer length• Melting temperatureMelting temperature• GC content rangeGC content range• 3'-clamp properties (terminal residue, 3'-clamp properties (terminal residue,

CG-content)CG-content)• Avoid hairpins in primersAvoid hairpins in primers• Length of amplified regionLength of amplified region• Avoid primer-primer interactionAvoid primer-primer interaction• Melting temperature compatabilityMelting temperature compatability

Primer Design CriteriaPrimer Design Criteria


A simple set of rules for primer sequence design is as follows

;Primers should be 17-28 bases in length٭

¼ chance (4ˉ¹) of finding an A, G, C or T in any given DNA sequence;

1/16 chance (4ˉ²) of finding any dinucleotide sequence (eg. AG);

1/256 chance of finding a given 4-base sequence. Thus, a sixteen base sequence will statistically be present only once in every 4¹6 bases (=4 294 967 296, or 4 billion) about the size of the human or maize genome


;Base composition should be 50-60% (G+C)٭

Primers should end (3') in a G or C, or CG or٭GC: this prevents "breathing" of ends and increases efficiency of priming;

;Tms between 55-80ºC are preferred٭

Tm = 4(G + C) + 2(A + T) ºC.


Runs of three or more Cs or Gs at the 3'-ends of primers٭may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided;

ends of primers should not be complementary-'3٭

Primer self-complementarity (ability to form 2º structures٭such as hairpins) should be avoided.

Common problems in primer designCommon problems in primer design


Hairpin formationHairpin formation


When is a “PRIMER” a Primer?


Designing Degenerative Oligonucleotide

A group of degenerate oligonucleotides contain related sequences with differences at specific locations.

One common use of degenerative oligonucletides is when the amino acid sequences of a protein is known. One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence. A set of degenerate oligonucleotides would then be produce matching those DNA sequences .

http:// cvmbs.colostate.edu/molkit/rtranslate/

AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA C G C CT CAGC C C T C C C G

A A A A A G G G G G


Primer3 http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi٭

Web Primer http://seq.yeastgenome.org/cgi-bin/web-primer٭

Gene Fisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/)٭

GeneWalker ((http://www.cybergene.se/primerdesign/)٭

CODEHOP (http://www.blocks.fhcrc.org/codehop.html)٭

Net Primer٭(http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html )

…….and many others

Related Bioinformatics Programs:


PCR Mastermix Box Titration Calculator - http://www.attotron.com/pub/pcrtitr.htm

PCR Optimization Program Helper – http://www.molbiol.ru/eng/scripts/01_14.html

MGH-PGA Proteomic Tools PCR Primer design for٭

peptide sequences

Oligo Calculator -- to calculate Tm, GC%, etc for a٭

given oligo.


http://pga.mgh.harvard.edu/primerbank/index.html

PCR Primers for Gene Expression Detection and Quantification

Primer Bank


RTPrimerDB - Real Time PCR Primer and Probe Database (submitted by researchers).

Real Time PCR Primer Sets Real time PCR primers (submitted by researchers).

The Quantitative PCR Primer Database (QPPD) provides information about primers and probes that can be used for human and mouse real time RT–PCR assays (published articles)

IMGT/PRIMER-DB, the IMGT database for primers of the immunoglobulins (IG), T cell receptors (TR) and related proteins of the immune system (RPI).

Other Primer Databases:


Components Volume Per sample

Concentration reaction

DDW 38.8 µl -

Buffer 5.00 µl 1X

dNTP’s 1.00 µl (0.25 µl each)

200 μM each

Primer F 0.04 µl 5-10 p moles

Primer R 0.04 µl 5-10 p moles

MgCl2 2.00 µl -

Taq Polymerase 0.04 µl 1.5 U

Total Volume 48.00 µl -


1X, usually comes as 10X stock.

For 25µL reactions, this means 2.5µL.

Buffer:


•a 2mM stock of dNTPs means that the final concentration of EACH dNTP (dATP, dCTP, dGTP, and dTTP) is 2mM -- NOT that all dNTPs together make 2mM.

•dNTPs come as 100mM stocks -- thaw and add 10µL of each dNTP to 460µL of ddH20 to make 2mM. Store at -20°C.

dNTP’s:


A good place to start with primer concentration is 50pmol of each primer per reaction.

If you don’t get your desired product, you can increase to 75pmol or 100pmol. This usually does the trick.

Primers:


•Mg2+ ions form complexes with dNTPs, primers and DNA templates, the optimal concentration of MgCl2 has to be selected for each experiment.

Too few Mg2+ ions result in a low yield of PCR product, and too many increase the yield of non-specific products and promote misincorporation.

Lower Mg2+ concentrations are desirable when fidelity of DNA synthesis is critical.

MgCl2 Concentration.


Usually 1-1.5u of Taq DNA Polymerase are used in 50µl of reaction mix. Higher Taq DNA Polymerase concentrations may cause synthesis of nonspecific products.

However, if inhibitors are present in the reaction mix (e.g., if the template DNA used is not highly purified), higher amounts of Taq DNA Polymerase (2-3u) may be necessary to obtain a better yield of amplification products.

Taq DNA Polymerase:


It’s not usually necessary to be incredibly fastidious about how much template you add to a reaction. You can get product with incredibly small amounts of starting DNA.

Template:


Steps Temperature (°C) Time Cycle

Initial denaturation 950 120 sec 1 Cycle

Denaturation 940 30 sec

35 CycleAnnealing 540 30 sec

Extension 720 60 sec

Elongated extended 720 600 sec 1 cycle

Storage 40 Forever -

pcr primer desining

Education