phenylarsine oxide induces apoptosis in bax- and bak-de ...apoptosis. experimental design: annexin...

Cancer Therapy: Preclinical

Phenylarsine Oxide Induces Apoptosis in Bax- andBak-Deficient Cells through Upregulation of Bim

Biyun Ni1,2, Qi Ma1,2, Baowei Li1,2, Lixia Zhao1,2, Yong Liu1,2, Yushan Zhu3, and Quan Chen1,3

AbstractPurpose: Bax and Bak are regarded as key mediators for cytochrome c (Cyt c) release and apoptosis. Loss

of Bax or Bak is often reported in human cancers and renders resistance of these cancerous cells to

chemotherapy. Here, we investigated that phenylarsine oxide (PAO) could induce Bax/Bak-independent

apoptosis.

Experimental Design: Annexin V/propidium iodide (PI) staining, terminal deoxynucleotidyl transfer-

ase–mediated dUTP nick end labeling (TUNEL) staining, and caspase activation assays were conducted to

detect apoptosis in Bax/Bak-deficient mouse embryonic fibroblasts (MEF) and HCT116 bax�/� colorectal

cancer cells. Cyt c release and Bim expression were assessed by Western blotting and immunostaining. Bim

was stably knocked down by short hairpin RNA. Immunoprecipitation was applied to detect the interaction

between Bim and Bcl-2. Both subcutaneous and colorectal orthotopic tumor implantation models were

used in nude mice to investigate the effect of PAO in vivo.

Results: PAO triggered Cyt c release and apoptosis in a Bax/Bak-independent manner. Bim and Bcl-2

were both involved in this process. PAO augmented the expression of Bim and strengthened the

interaction between Bim and Bcl-2. Furthermore, PAO attenuated the growth of Bax-deficient cancer

cells in vivo.

Conclusions: Our results showed that PAO induced apoptosis in chemotherapy-resistant cancer cells,

which suggests that PAO has the potential to serve as a chemotherapeutic agent for Bax- and Bak-deficient

cancers. Clin Cancer Res; 18(1); 140–51. �2011 AACR.

Introduction

Most anticancer drugs exert their effects through theinduction of intrinsic apoptosis via mitochondrial pathwaycharacterized by the release of cytochrome c (Cyt c) andcaspase activation (1). Bcl-2 and its relatives play a pivotalrole in determining the apoptotic process.Members of Bcl-2family are divided into 3 subsets: antiapoptotic (Bcl-2,Bcl-xL, Bcl-w, Bfl1/A-1, Bcl-B, and Mcl-1) proteins, proa-poptotic proteins (Bax and Bak), and BH3-only proteins

(Bid, Bim, Bik, Bad, Noxa, and Puma). Overwhelmingevidence has shown that Bax and Bak are indispensable formediating Cyt c release from mitochondria during apopto-sis. Cellswithout Baxor Bak are largely resistant to apoptoticagents and drugs. Mouse embryonic fibroblasts (MEF)isolated from Bax/Bak double knockout (DKO) mice areresistant to multiple death stimuli, including DNA-damag-ing agents, signal transduction through death receptors,growth factor deprivation, and endoplasmic reticulumstress (2–4). On the other hand, several studies includingours suggest the existence of a novel mechanism of intrinsicapoptosis in a Bax/Bak-independent pathway, although themechanism remains elusive (5–7). BH3-only proteins aresuggested to act as proapoptotic molecules which eitherdirectly interact with and activate Bax/Bak for their mem-brane permeabilizing activity or bind to antiapoptoticproteins to suppress their inhibition on Bax/Bak (2, 8).Alternatively, a unified model suggests that the BH3-onlyproteins induced conformational alterations and oligomer-ization of both Bax/Bak and Bcl-2/Bcl-xL (9). The confor-mation-altered Bcl-2/Bcl-xL have the potential to formpores in mitochondrial outer membrane (MOM), but thepore size is not large enough to mediate Cyt c release(10, 11). Functional conversion of Bcl-2 to a proapoptoticprotein has been observed in other circumstances. Uponbinding to Nur77 protein or peptide, Bcl-2 undergoes

Authors' Affiliations: 1Joint Laboratory of Apoptosis and Cancer Biology,State Key Laboratory of Biomembrane and Membrane Biotechnology,Institute of Zoology, Chinese Academy of Sciences; 2Graduate Universityof Chinese Academy of Sciences, Beijing; and 3Tianjin Key Laboratory ofProtein Sciences, College of Life Sciences, Nankai University, Tianjin,China

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

B. Ni and Q. Ma contributed equally to this work.

CorrespondingAuthors:QuanChen, Institute of Zoology, CAS, 1BeichenWest Road, Chaoyang District, Beijing 100101, China. Phone: 861-064-807-321; Fax: 861-064-807-321; E-mail: [email protected]; and YushanZhu, [email protected]

doi: 10.1158/1078-0432.CCR-10-3450

�2011 American Association for Cancer Research.

ClinicalCancer

Research

Clin Cancer Res; 18(1) January 1, 2012140

on March 20, 2020. © 2012 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst November 2, 2011; DOI: 10.1158/1078-0432.CCR-10-3450

http://clincancerres.aacrjournals.org/

conformational changes that convert it to a proapoptoticmolecule and initiates apoptosis in a Bax- or Bak-dependentmanner (12, 13). Our previous studies also revealed thattreatment with gossypol triggered similar conformationalchanges in Bcl-2 which induced apoptosis in the absence ofBax and Bak.Arsenic compounds, such as arsenic trioxide (ATO),

sodium arsenate and monomethylarsonous acid, have suc-cessfully been used in clinical cancer therapies, especially inacute promyelocytic leukemia (APL) therapy. These com-pounds induce either differentiation or apoptosis in cancer-ous cells (14–16). ATO was found to reduce the expressionof Bcl-2 and trigger Cyt c release in a Bax-dependentmanner(17). Several other organic compounds including pheny-larsine oxide (PAO) were found to be effective for APL oreven solid tumors. PAO is a membrane-permeable arseniccompound that has the most potent effects on APL throughinduction of apoptosis in these cancerous cells (18, 19).PAO induced apoptotic cell death via activation of cysteineprotease (18) and dissipation of the mitochondrial mem-brane potential (20), although conflicting reports showedthat PAO inhibited caspase cleavage in vitro (21) or blocksTRAIL-induced cell death (19). It is yet to be determinedwhether and how Bax acts in PAO-induced mitochondrialapoptosis. PAO is also reported to act as a phosphotyrosinephosphatase inhibitor which induced a dramatic accumu-lation of phosphotyrosine in a number of cellular proteins(22), thus altering the cell signaling pathways. It thussuggests the mechanism of which PAO inhibited prolifer-ation of acute myelocytic leukemia (AML) cell lines as wellas freshly isolated cells derived from patients with AML anderythroleukemia (18).Here, we found that PAO triggered Cyt c release in a Bax/

Bak-independent manner. Our data revealed that PAOinduced the increase of the expression of Bim which inter-acted with Bcl-2. Our studies further implicated the poten-tial chemotherapeutic effects of PAO through modulatingthe interaction between Bim and Bcl-2.

Materials and Methods

ReagentsPAO and ATO were purchased from Sigma. Antibodies

(Abs) used for actin, Bim, Bcl-2, Bad, Puma, Bid, Bik, Mcl-1,Cyt c, PARP, andBcl-xLwere purchased fromBD. SecondaryAbs were purchased fromPharmingen. Annexin V kit of wasobtained from Pharmingen. CaspACE In Situ kit was pur-chased from Promega. MitoTracker Red was purchasedfrom Invitrogen. All other chemicals were purchased fromSigma unless otherwise specified.

Cell cultureSV40 T antigen–immortalized Bax/Bak DKO mouse

embryonic fibroblasts (MEF), wild-type MEFs, bim�/�

MEFs, andHCT116 bax�/� cells were cultured inDulbecco’sModified Eagle’sMedium supplementedwith 10%FBS, 100U/mL penicillin, and 100 mg/mL streptomycin. Cells weremaintained in a humidified 5% CO2 atmosphere at 37�C.

Apoptosis analysis by Hoechst, TUNEL, or AnnexinV/propidium iodide staining

For Hoechst staining, cells were grown on glass coverslides at a density of 5 � 104 cells/mL in a 6-well plate.After treatments, cells were stained with Hoechst inPBS for 15 minutes at room temperature in the dark.Cells were then washed 3 times with PBS and analyzedwith a fluorescence microscope. At least 200 cells werecounted.

For terminal deoxynucleotidyl transferase–mediateddUTP nick end labeling (TUNEL) staining, cells were grownon glass coverslips at a density of 5 � 104 cells/mL in a six-well plate. After treatments, cells were stained by the In SituCell Death Detection Kit according to manufacturer’sinstructions. Apoptotic cells were visualized under fluores-cence microscopy.

Quantitative apoptosis was detected by flow cytometricanalysis after staining with fluorescein isothiocyanate(FITC)-conjugated Annexin V and propidium iodide (PI)by a commercially available kit according tomanufacturer’sinstructions. All data were analyzed with Cell Quest soft-ware (BD).

Detection of caspase activityCellswere treated as indicated, then collected andwashed

with PBS. CaspACE In SituMarkerwas added to the cells to afinal concentration of 10 mmol/L and incubated for 20minutes in the dark. Cells were then washed 3 times withPBS and resuspended in 400 mL PBS and analyzed with aFACScan.

Cell fractionation assayCells were homogenized with a Dounce homogenizer,

and the homogenate was centrifuged at 1,000 � g for 5minutes to remove unbroken cells and nuclei. The cyto-solic and mitochondrial fractions were obtained byfurther centrifugation as follows. Collect and spin thesupernatant at 10,000 � g for 15 minutes. Collect the

Translational Relevance

It has beenwell known that both bax and bak genes arefrequent targets for mutation in a subset of humantumors. Loss or inactivation of Bax or Bak is consideredas a mechanism of protection of cancer cells againstapoptosis, and these cancers are largely resistant tochemotherapy. We showed in this study that phenylar-sine oxide (PAO) induced apoptosis in Bax-deficientcolorectal cancer cells which are drug resistant. PAO alsoattenuated the growth of these cells in subcutaneous andorthotopic xenograft tumors without significant con-verse effects on nude mice. These all indicate that PAOhas potential value for development in the therapy ofBax/Bak inactivation cancers. Bim and Bcl-2 were bothinvolved in this process, which provides new targets inovercoming drug resistance during cancer therapy.

PAO Induces Bax/Bak-Independent Apoptosis

www.aacrjournals.org Clin Cancer Res; 18(1) January 1, 2012 141




pellet which contains heavy membrane including mito-chondria. Collect supernatant and spin at 100,000 � g for1 hour to obtain cytosolic fraction and light membranefraction.

Immunostaining assayThe cells were grown on glass cover slips, treated with

PAO and stained with 50 nmol/L MitoTracker Red for 30minutes at 37�C. After washed with PBS, fixed in 3.7%formaldehyde/PBS solution, the cells were incubated in0.1% Triton X-100/PBS to be permeabilized. Primary Abs

were diluted in 1% bovine serum albumin (BSA)/PBS andincubated with the cells at 4�C for 12 hours. The FITC-conjugated secondary Abs were diluted in 1% BSA/PBS andincubated at room temperature for 2 hours. The cells wereexamined by confocal microscopy using the Zeiss LSM 510META.

Reverse transcriptase PCRTotal RNAwas isolated from the cells with PAO treatment

or not for reverse transcription and generation of cDNA.Primers for all the 3 isoforms of mouse Bim were designed

Cont

Cont

Cont

24 h

1.67%

18.39%3.91%

6.5%

60.95%

8.83%

A 36 h

19.1%

41.21%1.67%

3.91%15.04%

68.62%

M1

M2

M1

M2

M1M2

M1M2

M1M2

M1

M2

57.04%17.99%0.95%

96.86%48.94%0.95%

24 h 36 h

2 µmol/L 5 µmol/L

Cont 2 µmol/L 5 µmol/L

B

DC

Cont PAO

1.5 µmol/L

1.5 µmol/L

24 h

24 h

1.5% 13.9%20 µmActin

PARP

0 12 24 36 h

*

**

***

***

***

***

*

*

*

**

**

**

80

60

40

20

0

100

80

60

40

20

0

100

80

60

40

20

0

60

40

20

0

0 12

Ann

exin

V p

ositi

ve (

%)

Ann

exin

V p

ositi

ve (

%)

Act

ivat

ed c

aspa

se (

%)

Act

ivat

ed c

aspa

se (

%)

24 36 h

0 12 24 36 h

5 µmol/L210

5 µmol/L210

Figure 1. PAO inducesBax/Bak-independent apoptosis. A, flowcytometric analysis of apoptosis inDKOMEFs following the treatmentwith 1.5mmol/LPAO forthe indicated times or different doses of PAO for 24 hours. The percentage of apoptotic cells was determined by Annexin V/PI staining. Data aremean� SEMfrom 3 independent experiments. �, P < 0.05; ��, P < 0.01; ��, P < 0.001 versus untreated group. B, cells were treated as in (A). The percentage ofcells with activated caspase was characterized as those that stained with the FITC In SituMarker. Data are mean � SEM from 3 independent experiments.�,P< 0.05; ��,P <0.01; ��,P <0.001 versus untreated cells. C, DKOMEFswere treatedwith 1.5mmol/L PAO for the indicated times, and the cleavage of PARPwasdetected byWestern blotting. b-Actinwas used as a loading control (Cont). D, Hoechst staining shows nucleus condensation and fragmentation (arrows).DKO MEFs were exposed to 1.5 mmol/L PAO for 24 hours. Scale bar represents 20 mm, n ¼ 200 to 300 cells.

Ni et al.

Clin Cancer Res; 18(1) January 1, 2012 Clinical Cancer Research142




as follows: forward (ATGGCCAAGCAACCTTCTGA) andreverse (TCAATGCATTCTCCACACCA). Primers for mouseglyceraldehyde-3-phosphate dehydrogenase (GAPDH):forward (ACCACAGTCCATGCCATCAC) and reverse(TCCACCACCCTGTTGCTGTA).

Stable knockdown of BimThe mouse Bim short hairpin RNA (shRNA) se-

quence (TGATGTAAGTTCTGAGTGTG) was inserted intopSilencer 2.1-CMV-Hygro cut by BamHI and HindIII.Control scrambled and shRNA plasmids (1.5 mg) weretransfected into DKO MEFs plated at 50% confluence insix-well plates using Lipofectamine 2000 (Invitrogen).Transfectants were selected in culture medium containing100 mg/mL hygromycin to enrich the culture for cells thatwere successfully transfected.

Immunoprecipitation for detecting Bim and Bcl-2interactionCells were lysed with 1% NP-40 lysis buffer (10 mmol/

LHEPES, 150mmol/LNaCl, 1%NP-40, pH 7.4) containingprotease inhibitors. Total protein (500 mg) was incubatedwith 2mg of anti-Bimantibody (Ab) in 500mLofNP-40 lysisbuffer at 4�C overnight on a rotator. Immunoprecipitateswere collected by incubating with 20 mL protein A agarosefor 2 hours at 4�C, followed by centrifugation for 1 minute.The pellets werewashed 3 timeswithNP-40 lysis buffer, andbeads were boiled in loading buffer and analyzed by West-ern blotting using the anti-Bcl-2 Ab.

Subcutaneous tumor implantation modelThe DKO MEFs were transformed with KRasV12 and

E1A. The cells were harvested by centrifugation and

suspended in Hank’s balanced salt solution (HBSS). Atumor cell suspension (5 � 105 KRasV12/E1A DKO MEFsor 3 � 106 HCT116 bax�/� cells in 100-mL PBS, respec-tively) was injected into the oxter of 4 to 5 weeks old nudenu/nu mice with a 27-gauge needle. Two groups of mice(5 animals each group) were used and maintained inspecific pathogen-free (SPF) conditions. One week afterimplantation, animals were intraperitoneally treated withPAO (1 mg/kg/2 days) or vehicle control [dimethyl sulf-oxide (DMSO)], respectively. The mice were euthanizedafter PAO treatment for 2 weeks. Tumor size was mon-itored by measurement of the length (a) and width (b)with a slide gauge. Tumor volumes (V) were calculatedaccording to the formula: V ¼ a � b2/2. Tumors wereexcised and stained by TUNEL staining. Apoptotic cellswere visualized under fluorescence microscopy.

Orthotopic tumor implantation modelFour- to 5-week-old nude nu/nu mice were anaesthe-

tized with phenobarbital during the surgical procedure.The caecum was exteriorized through a small midlinelaparotomy and 3 � 106 HCT116 bax�/� cells in 50-mLPBS were injected into the cecal wall with a 27-gaugeneedle. A cotton swab was held cautiously for 1 minuteover the injection site to prevent leakage, and the abdom-inal wall was closed and sutured. One week after implan-tation, mice were randomly assigned into 2 groups (5animals each group) and were intraperitoneally treatedwith PAO (1 mg/kg/2 days) or vehicle control (DMSO),respectively. The mice were euthanized after PAO treat-ment for 2 weeks. Primary tumors in the cecum wereexcised, the final tumor volumes (V) were calculatedaccording to the formula: V ¼ a � b2/2 (a, length; b,

Figure 1. (Continued ) E, PAO induces apoptosis inBax-deficient cancer cells which is resistant to ATO.HCT116 bax�/� cells or HCT116 cells were treatedwith 1.5 mmol/L PAO or 5 mmol/L ATO for the indicatedtimes, respectively. The percentage of apoptotic cellswas detected by Annexin V/PI staining of flowcytometric analysis. Data are mean � SEM from 3independent experiments. �, P < 0.05; ��, P < 0.01;��, P < 0.001 versus untreated group. F, HCT116bax�/� cells were treated with 1.5 mmol/L PAO for24 hours. Fluorescence images show labeling ofapoptotic cells by the TUNEL assay in situ. Scale barrepresents 100 mm. ns, not significant.

HCT116

HCT116 bax–/–

FE

6 12 24 24 h

1.5 µmol/L PAO – + + + –

5 µmol/L ATO –––– + PAO

Cont

100 µm

***

***

ns

**

***

ns

25

20

15

10

5

0

20

15

10

5

0

Ann

exin

V p

ositi

ve (

%)

Ann

exin

V p

ositi

ve (

%)






width), and the number of metastasis colonies wascounted in the intestines. Each tumor tissue excisedfrommice was snap frozen in liquid nitrogen and dividedinto 2 parts. The first part was fixed in formalin andembedded in paraffin. Serial sections of the intestine wereprepared and stained by hematoxylin and eosin (H&E)staining for histopathologic evaluation. The second partwas stained by TUNEL staining. Apoptotic cells werevisualized under fluorescence microscopy. All protocolswere approved by the Institutional Animal Care and UseCommittee of Institute of Zoology accredited by AAALACInternational.

Statistical analysisData are expressed asmean� SEM. Significant differences

between values under different experimental conditionswere determined by paired or unpaired Student t test andANOVA with repeated measurements, and P < 0.05 wasconsidered statistically significant.

Results

PAO induces intrinsic apoptosis in Bax- andBak-deficient cells

We screened a number of compounds for their capacity toinduce cell death in SV40 T antigen–immortalized DKOMEFs by MTT assay and found that PAO induced a signif-icant reduction of viability in these cells (data not shown).However, other agents or drugs including ATOhad no effecton the viability of DKO MEFs. To further examine PAO-induced apoptosis, we used Annexin V/PI double stainingassay. The results showed that the increase of AnnexinV–positive population was in both time- and concentra-tion-dependentmanners after PAO treatment (Fig. 1A). Thetypical apoptotic hallmark, the exposure of phosphatidyl-serine on cell surface, was observed after 1.5 mmol/L PAOtreatment for 24 hours (Fig. 1A).

To show that PAO could induce typical intrinsic apopto-tic cell death in DKO MEFs, we analyzed intracellular

A

0 3 6 12

Cyt c

Cyt c Cytc

Cyt c

Tim23Actin

Cyto fractions

Cyto fractions

Cyto fractions

Mito fractions

hPAO

PAO

PAO

0 3 6 12

BPAOCont

Mit

otr

acker

Merg

e

10 µm

0 3 6 12

VDACActin

Mito fractions

h0 3 6 12

0 6 12 24

VDACActin

Mito fractions

h0 6 12 24

HCT116

HCT116 bax–/–

C

Figure 2. PAO induces Cyt c release from mitochondria in a Bax/Bak-independent manner. A, DKOMEFs were exposed to 1.5 mmol/L PAO for the indicatedtimes and subjected to subcellular fractions. The cytosolic (cyto) and mitochondrial (mito) fractions were analyzed byWestern blotting with Cyt c Ab. b-Actinand Tim23 were used as loading controls. B, confocal images of immunostaining show diffused distribution of Cyt c in cytosol (arrows). DKO MEFs weretreated with 1.5 mmol/L PAO for 12 hours, then fixed and stained with Cyt c Ab and FITC-conjugated secondary Ab. Cells were observed by confocalmicroscopy. Scale bar represents 10 mm. C, HCT116 bax�/� cells or HCT116 cells were exposed to 1.5 mmol/L PAO for the indicated times, respectively.The cytosolic (cyto) and mitochondrial (mito) fractions were analyzed by Western blotting. b-Actin and voltage-dependent anion channel (VDAC) wereused as loading controls.

Ni et al.





caspase activity with CaspACE In Situ Marker. Caspase wasactivated by PAO both in time- and concentration-depen-dent manners (Fig. 1B). PAO also induced the proteolyticcleavage of PARPwhich is the substrate of caspase-3 inDKOMEFs (Fig. 1C). The caspase inhibitor (z-VAD-fmk) inhib-itedPAO-inducedphosphatidylserine exposure and caspaseactivation (data not shown). In addition, nucleus conden-sation and fragmentation, which is a defining characteristicfor apoptosis, was detected by Hoechst staining after PAOtreatment (Fig. 1D). Collectively, the results showed thatPAO induced intrinsic apoptosis in Bax- and Bak-deficientcells.Furthermore, we tested the effect of PAO on cancerous

cells with HCT116 and HCT116 bax�/� cell lines, respec-tively. Dramatically, PAO rather than ATO inducedapoptosis which was in a time-dependent manner in thesecolorectal cancer cells, regardless of Bax absence (Fig. 1E).Data of TUNEL staining (Fig. 1F) and caspase activationassay (Supplementary Fig. S1) also showed that PAO couldinduce apoptotic cell death in Bax-deficient cancer cells,which is resistant to multiple death stimuli.

PAO induces Cyt c release in a Bax/Bak-independentpathwayThe release of Cyt c from mitochondria into cytosol is a

defining event which triggers intrinsic mitochondrialapoptotic signals (23). Previous reports have suggested

the existence of Cyt c release without Bax and Bak (5, 6).We thus studied Cyt c release during PAO-induced apo-ptosis in the absence of Bax and Bak. We first exposedDKO MEFs to 1.5 mmol/L PAO, then fractionated andextracted mitochondria to detect the protein levels of Cytc in the cytosolic and mitochondrial fractions, respective-ly. The Western blotting data revealed that PAO inducedCyt c release in a time-dependent manner, as the amountof Cyt c increased in the cytosolic fraction with anaccompanied decrease in the mitochondrial fraction(Fig. 2A). We also examined intracellular distribution ofendogenous Cyt c by immunostaining. Cyt c showeda diffused distribution in cytosol after 1.5 mmol/L PAOtreatment for 12 hours, whereas it was well colocalizedwith mitochondria in untreated cells (Fig. 2B). Consistentwith the fractionation data, these results indicatethat PAO induced Cyt c release in a Bax/Bak-independentmanner. Cyt c release was also detected in Bax-deficientcolorectal cancer cells (Fig. 2C), which further indicatesthat PAO-induced apoptosis is through a mitochondrialsignaling pathway and PAO-induced Cyt c release is Baxindependent.

Bim is upregulated in Bax/Bak-independent apoptosisNext, we sought to understand the mechanism of

PAO-induced Bax/Bak-independent apoptosis. Despite theabsence of Bax and Bak, other Bcl-2 family members could

0 6 12 24 h

Mcl-1

Bcl-2

Bad

Puma

BimS

Actin

Bid

BclxL

Bik

A

0 6 12 24

BimEL

VDACActin

Cyto fractions Mito fractions

PAO

B

h

C

0 6 12 24

BimL

BimEL

BimLBimS

0 6 12 24

BimS

Actin

BimL

BimEL

0 6 12 24 h

HCT116 bax–/–HCT116

Figure 3. Bim is upregulated during PAO-induced apoptosis. A, DKOMEFs were treated with 1.5 mmol/L PAO for the indicated times, and the expressions ofBcl-2 family proteins were detected by Western blotting with the specific Abs. b-Actin was used as a loading control. B, Cells were treated as in (A) andsubjected to subcellular fractions. The cytosolic (cyto) and mitochondrial (mito) fractions were analyzed by Western blotting with Bim Ab. b-Actin and VDACwere used as loading controls. C, HCT116 bax�/� cells or HCT116 cells were exposed to 1.5 mmol/L PAO for the indicated times, respectively. The proteinlevels of 3 Bim isoforms were detected by Western blotting.






be activated to mediate Cyt c release as we previouslysuggested (7). We thus tested the expressions of severalmembers of Bcl-2 family (Puma, Bik, Bim, Bid, Bad, Bcl-2,Bcl-xL, and Mcl-1) during PAO-induced apoptosis. Inter-estingly, we found the protein expressions of 3 isoforms ofBim including BimEL, BimL, and BimSwere all upregulatedinDKOMEFs after the treatmentwith 1.5 mmol/L PAO for 6hours, whereas the expressions of other Bcl-2 familyproteins had no significant changes upon PAO treatment(Fig. 3A). Similarly, the protein expressions of all 3 isoformsof Bim were upregulated in HCT116 bax�/� cells after PAOtreatment for 12 hours (Fig. 3C). We further analyzedmRNA expression of Bim by reverse transcriptase PCR(RT-PCR) and found that the amount of mRNA of theseisoforms was increased after PAO treatment (Supplemen-tary Fig. S2A). More interestingly, fractionation followed byWestern blotting analysis showed the protein levels of theseisoforms of Bim were increased both in cytosolic andmitochondrial fractions during PAO-induced apoptosis(Fig. 3B). Immunostaining analysis by confocalmicroscopyalso showed that the expression of endogenous Bim wasinduced both in cytosol and in mitochondria in the cellstreated by PAO, compared with control ones (Supplemen-tary Fig. S2B).

Bim and Bcl-2 are both involved inBax/Bak-independent apoptosis

Bim has been characterized as serving as a death ligand,which regulates other members of the Bcl-2 family as aproapoptotic molecule once it has been activated (2). Tofindoutwhether the upregulation of Bim inducedby PAO isrequired for apoptosis in DKOMEFs, we knocked down theexpression of Bim. A shRNA which is specific to all the 3isoforms of Bim was stably transfected into the DKO MEFs(Fig. 4A). As we expected, knockdown of Bim significantlyinhibited PAO-induced apoptosis in DKOMEFs, comparedwith those stably transfected with scrambled shRNA (Fig.4B). To further show the role of Bim in PAO-inducedapoptosis, we treated bim�/� MEFs and the wild-type MEFswith PAO, respectively. Annexin V/PI double staining assayshowed that PAO-induced apoptotic cells were decreasedsignificantly in the absence of Bim, regardless of the pres-ence of Bax/Bak (Fig. 4C). All these data revealed that Bimwas involved in and initiated PAO-induced apoptosis inDKO MEFs.

It has been reported that Bim could suppress Bcl-2 whichis a primary inhibitor of apoptosis and constitutively loca-lizes on outer mitochondrial membrane (2). As shownin Fig. 3B, the protein expression of Bim on mitochondria

WT

bim–/–

0 24 36 h

SC

sh

RN

A

1.74%

1.95%

24.68%

4.81%

0.75%

4.52%

PAOContA

15.01%

3.63%Actin

BimSBimL

BimEL

SC shRNA

Cont PAO

SC

shRNA

C

1.42%

5.4%

9.08%

8.02%

31.93%

5.69%

0.61%

4.52%

1.7%

4.94%

4.52%

4.43%

WT

bim

–/–

0 h 24 h 36 h

B

*********

40

30

20

10

0

50

40

30

20

10

0

Ann

exin

V p

ositi

ve (

%)

Ann

exin

V p

ositi

ve (

%)

Figure 4. Bim is involved inPAO-inducedapoptosis. A, the efficiencyof BimknockdownwasconfirmedbyWestern blotting. B, stableBimknockdown (shRNA)or scrambled (SC) DKOMEFs were treated with 1.5 mmol/L PAO for 30 hours, respectively. The percentage of apoptotic cells was detected by Annexin V/PIstaining of flowcytometric analysis. Data aremean�SEM from3 independent experiments. ��,P < 0.001 versus scramble. C, wild-type (WT) or bim�/�MEFswere treated with 1.5 mmol/L PAO for the indicated times, respectively. The percentage of apoptotic cells was detected by Annexin V/PI staining of flowcytometric analysis. Data are mean � SEM from 3 independent experiments. ��, P < 0.001 versus wild-type.

Ni et al.





was increased after PAO treatment, and immunostainingdata confirmed the localization of Bim on mitochondria(Supplementary Fig. S2B). We thus supposed that PAOinduced apoptosis in Bax- and Bak-deficient cells by aug-menting the expression of Bim on mitochondria where itinhibited Bcl-2. To test this hypothesis, we detected theinteraction between endogenous Bim and Bcl-2 by immu-noprecipitation. The amount of Bim/Bcl-2 complex wasincreased after PAO treatment for 6 hours, indicating thatBim interactedwith Bcl-2 and the interaction between themwas strengthened during PAO-induced apoptosis (Fig. 4D).To further investigate the role of Bcl-2 in Bax/Bak-indepen-dent apoptosis, we used YC137 as a specific inhibitor to Bcl-2 (24). PAO-induced apoptotic cells were significantlyincreased in YC137-pretreated DKO MEFs, compared withcontrol ones in the absence of YC137 (Fig. 4E). This Bcl-2inhibitor augmented PAO-induced apoptosis, suggestingthat Bcl-2 was involved in this process.

PAO attenuates the growth of DKO MEFs in vivoWe next tested the effects of PAO on the growth of

xenograft tumors in vivo. The immunodeficient nude micewere implanted with KRasV12/E1A-transformed DKOMEFs in the oxter and underwent intraperitoneal treatmentwith PAO (1 mg/kg/2 days) or DMSO (the vehicle control)one week later. The tumor volume was measured everyother day, and it was found that PAO inhibited tumorgrowth (Fig. 5A). Twoweeks after PAO treatments, themicewere euthanized, and the xenograft tumors were isolated.The average tumor weight of the treated group was signif-icantly reduced, compared with that of the control group(Fig. 5B and C). Importantly, this dose of PAO inhibitedtumor growth in the mice without significant converse

effects on body weight (Fig. 5D). Moreover, we detectedPAO-induced apoptosis in vivo in tumors formedwithDKOMEFs by TUNEL assay in situ. Fluorescence microscopyimages showed an increase of apoptotic cells in tumorsfrom the group treated with PAO, compared with thosefrom control group (Fig. 5E).

PAO attenuates the growth of Bax-deficient cancer cellsin vivo

Both subcutaneous and orthotopic xenograft tumorimplantation models were used here to test the effects ofPAO on the growth of Bax-deficient cancer cells. In thesubcutaneous tumor model, HCT116 bax�/� cells wereinjected in the oxter of nude mice. One week after implan-tation, mice were treated with PAO or DMSO as the vehiclecontrol, respectively. Two weeks after PAO treatments, themice were euthanized and the xenograft tumors were iso-lated. PAO attenuated the growth of xenograft tumors(Fig. 6A) and reduced the tumor weight dramatically (Fig.6B and C). Consistent with the data fromDKOMEFs in vivoassay, the treatments of PAO in the dose of 1 mg/kg/2 dayshave no significant converse effects on the mice (Fig. 6D).TUNEL assay in situ further revealed that PAO inducedapoptotic cell death inHCT116 bax�/� cells in vivo (Fig. 6E).

In the orthotopic tumormodel, the treatment started oneweek after HCT116 bax�/� cells implantation and wascontinued for 2 weeks. The mice were euthanized, and thetumors were isolated, dissected, and measured. The resultsshowed that PAO decreased orthotopic tumor growth (Fig.6F) and the tumor volume in PAO treatment group wassignificantly lower than that in the control group (Fig. 6G).Furthermore, the presence of orthotopic xenograft tumorsin the cecum was confirmed by H&E staining (Fig. 6H).

Figure 4. (Continued ) D, PAO enhances theinteraction between Bim and Bcl-2. DKO MEFs wereexposed to 1.5 mmol/L PAO for the indicated times,harvested, lysed in NP-40 lysis buffer, andimmunoprecipitatedwith BimAb. Immunoprecipitates(IP) were subjected toWestern blotting usingBcl-2 Ab.The whole-cell lysate was analyzed by Westernblotting to confirm the expression of Bcl-2. b-Actinwas used as a loading control. E, YC137 enhancesPAO-induced apoptosis. After pretreatment with 1mmol/L YC137 for 1 hour or not, DKO MEFs wereincubated with 1.5 mmol/L PAO for 12 hours. Thepercentage of apoptotic cells was detected byAnnexin V/PI staining of flow cytometric analysis. Dataare mean � SEM from 3 independent experiments.��, P < 0.001 versus vehicle control.

0 6 12 24

Bcl-2

Heavychain

IP: BimInput

Actin

PAO

D

0 6 12 24 h

YC

137

PAOCont

1.21%

2.38%

5.54%

4.42%

12.8%

6.6%

1.62%

3.16%

E

DM

SO

DMSO

YC137

Cont PAO

***25

20

15

10

5

0Ann

exin

V p

ositi

ve (

%)






PAO-induced apoptotic cell deathwas confirmedbyTUNELstaining (Fig. 6I), and PAO-induced apoptosis was notdetected with TUNEL assay in normal colorectal tissues(Supplementary Fig. S3).

Discussion

In this study, we found that PAO could induce typicalintrinsic apoptosis in Bax/BakDKOMEFs, which are largelyresistant to multiple chemotherapeutical drugs and apo-ptosis-inducing agents. PAO induced dramatic increase ofBim expression which is involved in Bax/Bak-independentapoptosis. PAO also induced apoptotic cell death in che-motherapy-resistant colorectal cancer cells, such asHCT116bax�/� cells. The results contrast with our previous reportwhich showed that ATO induced apoptosis in a Bax-depen-dent manner (22). Our data also showed that Bim was notessential for ATO-induced apoptosis in MEFs as ATO couldinduce apoptosis in the absence of Bim (Supplementary Fig.S6D), although Bim was reported to be transcriptionalupregulated and activated by ATO in neuronal cell line(25, 26). Clearly, PAO is much more powerful in overcom-ing drug resistant cancers that are refractory to conventionalchemotherapeutical agents. Our data suggested that PAOtreatment had advantages over the conventional anticancertherapies that rely on the Bax or Bak to kill cancer cells.Moreover, the orthotopic tumor implantation model innude mice clearly showed that PAO inhibited the growthof Bax-deficient cancer cells in vivo without significant sideeffects onmice. It hasbeenwell known that both bax and bakgenes are frequent targets formutation in a subset of human

tumors, including hematopoietic malignancies, breast can-cers, gastric cancers, colorectal cancers, and prostate cancers(27–31). Loss or mutational inactivation of Bax or Bak isoften reported and considered as a mechanism of protec-tion against apoptosis in cancer cells, and these cancersare largely resistant to chemotherapy, including arseniccompounds treatments (32–35). Therefore, our studyimplicates that PAO has potential value for overcomingchemotherapy resistance in the treatments of cancers, espe-cially in the treatments of Bax or Bak inactivation cancers.

Our results provide new evidence for the existence of aBax/Bak-independent apoptosis pathway to mediate Cyt crelease. It is recently reported that apoptosis could beinduced through a mitochondrial permeability transitionpore (mPTP)—not Bax/Bak-dependent manner. However,here, specific mPTP inhibitor cyclosporine A (CsA) orbongkrekic acid (BA) fails to inhibit PAO-induced apopto-sis (Supplementary Figs. S4 and S6C). Prior studies showedthat PAO increased the concentration of intracellular cal-cium (20), which was indicated to be involved in Bax/Bak-independent mechanism of Cyt c release (5). Here, wefound that EGTA-am had no effect on PAO-induced apo-ptosis (Supplementary Fig. S5), suggesting that intracellularcalcium is not involved in this process. Ionomycin couldindeed induce cell death in HCT116 bax�/� cells in anEGTA-am–inhibitable manner. However, activated caspaseand other typical intrinsic apoptotic hallmarks were notdetected in ionomycin-induced cell death (data notshown). Intriguingly, we showed that PAO upregulated theexpression of Bim which is involved in PAO-induced apo-ptosis in the absence of Bax/Bak. PAO strengthened the

A B

ContCont

0 2 4 6 8 10 12 14 days

Tu

mo

r w

eig

ht

(g)

Mic

e w

eig

ht

(g)

PAO

PAO

Cont

2.0

1.5

1.0

0.5

0.0

2,000

1,500

1,000

500

0

20

15

10

5

0PAO Cont

*

PAO

C D Cont PAO

E

ns

100 µm

2 cm T

um

or

vo

lum

e (

mm

3)

Figure 5. PAO attenuates the growth of DKO MEFs in nude mice. A, tumor volume curves. The immunodeficient mice were implanted into the oxterwith DKOMEFswhichwere transformedwith KRasV12 and E1A. Oneweek later, themice underwent intraperitoneal treatment with vehicle control (DMSO) orPAO (1 mg/kg/2 days), respectively, for 2 weeks (n ¼ 5). B, representative images of isolated tumors. Two weeks after PAO treatment, the mice wereeuthanized and the xenograft tumors were isolated. Scale bar represents 2 cm. C, the tumor weight of mice at 14 days after treatment. �, P < 0.05 versusvehicle control. D, average body weight of mice at 14 days after treatment. NS, no statistical significance between the control and the treated groups.E, fluorescence images show labeling of apoptotic cells by the TUNEL assay in situ. Scale bar represents 100 mm.

Ni et al.





interaction between Bim and Bcl-2. Moreover, specificsuppression of Bcl-2 by YC137 can enhance PAO-inducedapoptosis. This is in line with our previous finding thatBcl-2 underwent structural change during Bax/Bak-inde-pendent apoptosis, which might convert the protectivemolecule into a killer (7). Our recent results showed that

Bim binding to Bcl-2 could trigger conformational andfunctional conversion of Bcl-2, which permeabilized theMOM, thereby triggering Cyt c release during the apo-ptosis process in the absence of Bax and Bak. The exactmechanism of how Bim interacts with Bcl-2 for theproapoptotic action is still a subject in future study.

1 cm

Cont

PAO

days

Cont

PAO

ns

*

A B

DC E

Cont PAO100 µm

F

100 µm

Cont

1 cm

PAO

G

IH

NT

100 µm PAO

T

N

Cont

Cont PAO

*

Cont PAO

Cont PAOCont PAO

600

400

200

0

0.6

0.4

0.2

0.0

20

15

10

5

0

500

400

300

200

100

0

Tu

mo

r v

olu

me

(m

m3)

Tu

mo

r v

olu

me

(m

m3)

Tu

mo

r w

eig

ht

(g)

Mic

e w

eig

ht

(g)

0 2 4 7 9 11 14

Figure 6. PAOattenuates the growth of Bax-deficient cancer cells in vivo. A, tumor volume curves. Oneweek after the injection of HCT116 bax�/� cells into theoxter, the mice underwent intraperitoneal treatment with vehicle control (DMSO) or PAO (1 mg/kg/2 days), respectively, for 2 weeks (n¼ 5). B, representativeimages of isolated tumors. Two weeks after PAO treatment, the mice were euthanized and the xenograft tumors were isolated. Scale bar represents 1 cm. C,the tumor weight of mice at 14 days after treatment. �, P < 0.05 versus vehicle control. D, average body weight of mice at 14 days after treatment. NS, nostatistical significance. E, TUNEL staining showapoptotic cells in tumors in situ. Scale bar represents 100mm.F, representative necropsy photographs ofmicewith orthotopic xenograft tumors (arrows). One week after orthotopically implantation of HCT116 bax�/� cells into the cecum, the mice underwentintraperitoneal treatment with vehicle control (DMSO) or PAO (1mg/kg/2 days), respectively, for 2weeks. Scale bar represents 1 cm.G, average tumor volumeof mice at 14 days after treatment. �, P < 0.05 versus vehicle control (n ¼ 5). H, H&E staining of intestinal tumors. N, normal tissue; T, tumor. The poorlydifferentiated morphology of tumor cells is typical of high-grade adenocarcinomas. Scale bar represents 100 mm. I, TUNEL staining show apoptotic cells inorthotopic tumors. Scale bar represents 100 mm.






Nevertheless, the unexpected effects of Bim and Bcl-2 onPAO-induced apoptosis provide a novel view to explorethe mechanism of Bax/Bak-independent apoptosis andimply new targets in the treatments of Bax or Bak inac-tivation cancers which are chemotherapy resistant.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Authors' Contributions

Q.Ma andQ. Chen designed the experiments. B. Ni, Q.Ma, B. Li, L. Zhao,Y. Liu, and Y. Zhu carried out the experiments. Q. Mamade the data statisticsand analysis. Q. Ma and Q. Chen drafted the manuscript. All authors readand approved the final manuscript.

Acknowledgments

The authors thank Weixing Zong for generously sharing bax�/� bak�/�

MEFs and David Huang for sharing wild-type and bim�/� MEFs.

Grant Support

This work is supported by grants from the National Key Basic ResearchProgramof China toQ. Chen (2009CB521802, 2011CB910903) and Y. Zhu(2010CB912200), and the National Science Foundation of China to Q. Ma,Y. Liu, and Q. Chen (31000614, 31000615, 81130045).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received January 3, 2011; revised October 17, 2011; accepted October 17,2011; published OnlineFirst November 2, 2011.

References1. Adams JM, Cory S. The Bcl-2 apoptotic switch in cancer development

and therapy. Oncogene 2007;26:1324–37.2. Zong WX, Lindsten T, Ross AJ, MacGregor GR, Thompson CB.

BH3-only proteins that bind pro-survival Bcl-2 family members failto induce apoptosis in the absence of Bax and Bak. Genes Dev2001;15:1481–6.

3. Lindsten T, Ross AJ, King A, Zong WX, Rathmell JC, Shiels HA, et al.The combined functions of proapoptotic Bcl-2 family members bakand bax are essential for normal development of multiple tissues. MolCell 2000;6:1389–99.

4. Wei MC, ZongWX, Cheng EH, Lindsten T, Panoutsakopoulou V, RossAJ, et al. Proapoptotic BAX and BAK: a requisite gateway to mito-chondrial dysfunction and death. Science 2001;292:727–30.

5. Mizuta T, Shimizu S, Matsuoka Y, Nakagawa T, Tsujimoto Y. A Bax/Bak-independent mechanism of cytochrome c release. J Biol Chem2007;282:16623–30.

6. Claveria C,Martinez AC, TorresM. ABax/Bak-independentmitochon-drial death pathway triggered by Drosophila Grim GH3 domain inmammalian cells. J Biol Chem 2004;279:1368–75.

7. Lei X, Chen Y, Du G, Yu W, Wang X, Qu H, et al. Gossypol inducesBax/Bak-independent activation of apoptosis and cytochrome crelease via a conformational change in Bcl-2. FASEB J 2006;20:2147–9.

8. Kroemer G, Galluzzi L, Brenner C. Mitochondrial membrane permea-bilization in cell death. Physiol Rev 2007;87:99–163.

9. Chipuk JE, Moldoveanu T, Llambi F, ParsonsMJ, Green DR. The BCL-2 family reunion. Mol Cell 2010;37:299–310.

10. Dlugosz PJ, Billen LP, Annis MG, Zhu W, Zhang Z, Lin J, et al. Bcl-2changes conformation to inhibit Bax oligomerization. EMBO J2006;25:2287–96.

11. Peng J, Ding J, Tan C, Baggenstoss B, Zhang Z, Lapolla SM, et al.Oligomerization of membrane-bound Bcl-2 is involved in its poreformation induced by tBid. Apoptosis 2009;14:1145–53.

12. Kolluri SK, Zhu X, Zhou X, Lin B, Chen Y, Sun K, et al. A short Nur77-derived peptide converts Bcl-2 from a protector to a killer. Cancer Cell2008;14:285–98.

13. Lin B, Kolluri SK, Lin F, LiuW,Han YH,Cao X, et al. Conversion of Bcl-2from protector to killer by interaction with nuclear orphan receptorNur77/TR3. Cell 2004;116:527–40.

14. ChenGQ, Shi XG, TangW, Xiong SM, Zhu J, Cai X, et al. Use of arsenictrioxide (As2O3) in the treatment of acute promyelocytic leukemia(APL): I. As2O3 exerts dose-dependent dual effects on APL cells.Blood 1997;89:3345–53.

15. Dilda PJ, Hogg PJ. Arsenical-based cancer drugs. Cancer Treat Rev2007;33:542–64.

16. Charoensuk V, Gati WP, Weinfeld M, Le XC. Differential cytotoxiceffects of arsenic compounds in human acute promyelocytic leukemiacells. Toxicol Appl Pharmacol 2009;239:64–70.

17. Oetken C, von Willebrand M, Autero M, Ruutu T, Andersson LC,Mustelin T. Phenylarsine oxide augments tyrosine phosphorylation inhematopoietic cells. Eur J Haematol 1992;49:208–14.

18. Estrov Z, Manna SK, Harris D, Van Q, Estey EH, Kantarjian HM, et al.Phenylarsine oxide blocks interleukin-1beta-induced activation of thenuclear transcription factor NF-kappaB, inhibits proliferation, andinduces apoptosis of acute myelogenous leukemia cells. Blood1999;94:2844–53.

19. Sun XM, Canda-Sanchez A, Manjeri GR, Cohen GM, Pinkoski MJ.Phenylarsine oxide interferes with the death inducing signalingcomplex and inhibits tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induced apoptosis. Exp Cell Res 2009;315:2453–62.

20. Larochette N, Decaudin D, Jacotot E, Brenner C, Marzo I, Susin SA,et al. Arsenite induces apoptosis via adirect effect on themitochondrialpermeability transition pore. Exp Cell Res 1999;249:413–21.

21. Takahashi A, Goldschmidt-Clermont PJ, Alnemri ES, Fernandes-Alnemri T, Yoshizawa-Kumagaya K, Nakajima K, et al. Inhibition ofICE-related proteases (caspases) and nuclear apoptosis by phenylar-sine oxide. Exp Cell Res 1997;231:123–31.

22. Zheng Y, Yamaguchi H, Tian C, Lee MW, Tang H, Wang HG, et al.Arsenic trioxide (As(2)O(3)) induces apoptosis through activation ofBax in hematopoietic cells. Oncogene 2005;24:3339–47.

23. Wang X. The expanding role of mitochondria in apoptosis. Genes Dev2001;15:2922–33.

24. Real PJ, Cao Y,Wang R, Nikolovska-Coleska Z, Sanz-Ortiz J,Wang S,et al. Breast cancer cells can evade apoptosis-mediated selectivekilling by a novel small molecule inhibitor of Bcl-2. Cancer Res2004;64:7947–53.

25. Cai B, ChangSH, Becker EB, Bonni A, Xia Z. p38MAPkinasemediatesapoptosis through phosphorylation of BimEL at Ser-65. J Biol Chem2006;281:25215–22.

26. Cai B, Xia Z. p38 MAP kinase mediates arsenite-induced apoptosisthrough FOXO3a activation and induction of Bim transcription. Apo-ptosis 2008;13:803–10.

27. LeBlanc H, Lawrence D, Varfolomeev E, Totpal K, Morlan J, Schow P,et al. Tumor-cell resistance to death receptor–induced apoptosisthrough mutational inactivation of the proapoptotic Bcl-2 homologBax. Nat Med 2002;8:274–81.

28. Rampino N, Yamamoto H, Ionov Y, Li Y, Sawai H, Reed JC, et al.Somatic frameshift mutations in the BAX gene in colon cancers of themicrosatellite mutator phenotype. Science 1997;275:967–9.

29. Meijerink JP,Mensink EJ,WangK,SedlakTW,SloetjesAW,deWitte T,et al. Hematopoieticmalignanciesdemonstrate loss-of-functionmuta-tions of BAX. Blood 1998;91:2991–7.

30. Kondo S, Shinomura Y, Miyazaki Y, Kiyohara T, Tsutsui S, Kitamura S,et al. Mutations of the bak gene in human gastric and colorectalcancers. Cancer Res 2000;60:4328–30.

Ni et al.





31. Ionov Y, Yamamoto H, Krajewski S, Reed JC, Perucho M. Mutationalinactivation of the proapoptotic geneBAXconfers selective advantageduring tumor clonal evolution. Proc Natl Acad Sci U S A 2000;97:10872–7.

32. Wang GQ, Gastman BR, Wieckowski E, Goldstein LA, Gambotto A,Kim TH, et al. A role for mitochondrial Bak in apoptotic response toanticancer drugs. J Biol Chem 2001;276:34307–17.

33. Brimmell M, Mendiola R, Mangion J, Packham G. BAX frameshiftmutations in cell lines derived from human haemopoieticmalignancies

are associated with resistance to apoptosis and microsatellite insta-bility. Oncogene 1998;16:1803–12.

34. Eguchi H, Suga K, Saji H, Toi M, Nakachi K, Hayashi SI. Differentexpression patterns of Bcl-2 family genes in breast cancer by estrogenreceptor status with special reference to pro-apoptotic Bak gene. CellDeath Differ 2000;7:439–46.

35. Zhang L, Yu J, Park BH, Kinzler KW, Vogelstein B. Role of BAX inthe apoptotic response to anticancer agents. Science 2000;290:989–92.






2012;18:140-151. Published OnlineFirst November 2, 2011.Clin Cancer Res Biyun Ni, Qi Ma, Baowei Li, et al. Cells through Upregulation of BimPhenylarsine Oxide Induces Apoptosis in Bax- and Bak-Deficient

Updated version

10.1158/1078-0432.CCR-10-3450doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2011/11/02/1078-0432.CCR-10-3450.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/18/1/140.full#ref-list-1

This article cites 35 articles, 15 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/18/1/140To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-10-3450

http://clincancerres.aacrjournals.org/content/suppl/2011/11/02/1078-0432.CCR-10-3450.DC1

http://clincancerres.aacrjournals.org/content/18/1/140.full#ref-list-1

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/18/1/140


phenylarsine oxide induces apoptosis in bax- and bak-de ...apoptosis. experimental design: annexin...

Documents