Low-Molecular-Weight Thiols and Thioredoxins Are ImportantPlayers in Hg(II) Resistance in Thermus thermophilus HB27

J. Norambuena,a Y. Wang,a T. Hanson,b,c J. M. Boyd,a T. Barkaya

aDepartment of Biochemistry and Microbiology, Rutgers University, New Brunswick, New Jersey, USAbSchool of Marine Science and Policy, Delaware Biotechnology Institute, University of Delaware, Newark,Delaware, USA

cDepartment of Biological Sciences, University of Delaware, Newark, Delaware, USA

ABSTRACT Mercury (Hg), one of the most toxic and widely distributed heavy metals,has a high affinity for thiol groups. Thiol groups reduce and sequester Hg. Therefore,low-molecular-weight (LMW) and protein thiols may be important cell components usedin Hg resistance. To date, the role of low-molecular-weight thiols in Hg detoxification re-mains understudied. The mercury resistance (mer) operon of Thermus thermophilus sug-gests an evolutionary link between Hg(II) resistance and low-molecular-weight thiol me-tabolism. The mer operon encodes an enzyme involved in methionine biosynthesis,Oah. Challenge with Hg(II) resulted in increased expression of genes involved in thebiosynthesis of multiple low-molecular-weight thiols (cysteine, homocysteine, andbacillithiol), as well as the thioredoxin system. Phenotypic analysis of gene replace-ment mutants indicated that Oah contributes to Hg resistance under sulfur-limitingconditions, and strains lacking bacillithiol and/or thioredoxins are more sensitive toHg(II) than the wild type. Growth in the presence of either a thiol-oxidizing agent ora thiol-alkylating agent increased sensitivity to Hg(II). Furthermore, exposure to 3 �MHg(II) consumed all intracellular reduced bacillithiol and cysteine. Database searchesindicate that oah2 is present in all Thermus sp. mer operons. The presence of a thiol-related gene was also detected in some alphaproteobacterial mer operons, in whicha glutathione reductase gene was present, supporting the role of thiols in Hg(II) de-toxification. These results have led to a working model in which LMW thiols act asHg(II)-buffering agents while Hg is reduced by MerA.

IMPORTANCE The survival of microorganisms in the presence of toxic metals is cen-tral to life’s sustainability. The affinity of thiol groups for toxic heavy metals drivesmicrobe-metal interactions and modulates metal toxicity. Mercury detoxification (mer)genes likely originated early in microbial evolution in geothermal environments. Littleis known about how mer systems interact with cellular thiol systems. Thermus spp.possess a simple mer operon in which a low-molecular-weight thiol biosynthesisgene is present, along with merR and merA. In this study, we present experimentalevidence for the role of thiol systems in mercury resistance. Our data suggest that,in T. thermophilus, thiolated compounds may function side by side with mer genesto detoxify mercury. Thus, thiol systems function in consort with mer-mediated resis-tance to mercury, suggesting exciting new questions for future research.

KEYWORDS low-molecular-weight thiols, thioredoxins, mercury, mer operons,bacillithiol, Thermus thermophilus, thioredoxin-thioredoxin reductase systems

Mercury (Hg) is one of the most toxic and widely distributed heavy metals. Mercurytoxicity is due in part to its high affinity for low-molecular-weight (LMW) thiols,

including homocysteine, N-acetylcysteine, and cysteine, as well as thiol-based cellularredox buffers, such as glutathione (GSH) (1, 2). Not surprisingly, free thiol groups have

Received 6 September 2017 Accepted 24October 2017

Accepted manuscript posted online 17November 2017

Citation Norambuena J, Wang Y, Hanson T,Boyd JM, Barkay T. 2018. Low-molecular-weightthiols and thioredoxins are important players inHg(II) resistance in Thermus thermophilus HB27.Appl Environ Microbiol 84:e01931-17. https://doi.org/10.1128/AEM.01931-17.

Editor Maia Kivisaar, University of Tartu

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to J. Norambuena,javiera.norambuenamorales@rutgers.edu.

PHYSIOLOGY

crossm

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 1Applied and Environmental Microbiology

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

a high binding constant for Hg(II) (3, 4). Mercury can also bind thiols present in proteins(1, 2, 5) and can oxidize thioredoxins (6, 7). Thus, the main biological effects of Hg arerelated to this high affinity for sulfhydryl groups (2).

Bacteria commonly possess two main thiol systems that maintain the redox state ofthe cell. The first is an LMW thiol system, typically utilizing GSH (8) or bacillithiol (BSH)(9), and the second is a thioredoxin system (10). LWM thiol systems vary amongbacteria, are present at millimolar concentrations, and act as redox buffers in the cell(10, 11). Thioredoxins are present among all kingdoms, and the system consists of athioredoxin protein(s) and an enzyme, thioredoxin reductase (10, 12). In Escherichia coli,there are two thioredoxins, Trx1 (encoded by trxA) and Trx2 (encoded by trxC), whichdiffer in an extra N-terminal extension (10). Thioredoxins become oxidized when theirtargets are reduced, and thioredoxin reductase (encoded by trxB) uses electrons fromNADPH to maintain thioredoxins in a reduced state (10, 12).

To overcome Hg toxicity, some bacteria and archaea employ the Hg resistance (mer)operon (13). The composition of the mer system varies among organisms, but they allhave merA, which encodes a mercuric reductase that reduces inorganic Hg(II) to Hg(0);Hg(0) is volatile and is partitioned out of the cell. Proteobacterial mer operons are themost studied of these operons (13). These operons have several genes that can encodetranscriptional repressors/activators (merR and merD) or specific transporters (merC,merE, merF, merG, merP, and merT), as well as merA (14). Some mer operons can detoxifyorganomercurial compounds, in addition to Hg(II), by the inclusion of an organomer-curial lyase (encoded by merB). With the advance of whole-genome sequencing, newmer operons were discovered, and simpler operons were found in early microbiallineages (14). These simpler operons were found in some thermophilic microbes, suchas the crenarchaeote Sulfolobus solfataricus (15), some bacteria belonging to theAquificaceae (16), and Thermus thermophilus (17). These organisms were subsequentlyshown to have merA-dependent resistance to Hg(II).

The mer operon in T. thermophilus HB27 is unique because it consists of two classicalmer operon genes (merA and merR) and the thiol biosynthesis-related gene (oah2) (Fig.1A) (17). In the mer operon of T. thermophilus HB27, merA encodes a mercuric reductase,as suggested by protein homology to other MerA proteins (17, 18), a higher suscepti-bility of the ΔmerA mutant to Hg(II), and the lack of MerA activity in this mutant (17).Although the function of MerR in T. thermophilus has not been established, proteinhomology suggests that it is a transcriptional regulator encoded in the mer operon. Thethird member of the mer operon, oah2, encodes an O-acetyl-L-homoacetylserine sulf-hydrylase (Oah) that synthesizes homocysteine (Fig. 1C) (19), an intermediate in me-thionine biosynthesis (20). Our previous work found that oah2, merR, and merA areexpressed as a polycistronic unit in the presence of Hg(II) (17). The colocalization andcoexpression of oah2 with the mer genes suggest a link between Hg(II) resistance andthe biosynthesis of LMW thiol compounds.

The genome of T. thermophilus carries two oah gene orthologs: oah2 and oah1. oah1is located in an operon with met2, which encodes an enzyme that catalyzes the firststep in methionine biosynthesis (Fig. 1B and C) (20). It was determined that Oah1 andOah2 have sulfhydrylase activity in vitro (19, 21); however, Oah2 has a lower Km for thesubstrates homoserine and sulfide (19). This information suggested that these enzymesmay have similar, but possibly not identical, cellular functions. In the present study, thehypothesis that LMW thiols and the thioredoxin system play a role in Hg(II) resistancein T. thermophilus was tested by using a combination of gene expression, phenotypic,and metabolite analyses. We report that exposure to Hg(II) induced the expression ofLMW thiol biosynthesis and thioredoxin genes and decreased the bioavailability ofreduced bacillithiol and cysteine. Moreover, phenotypic analysis found that strainslacking Oah, BshA/C, or TrxA were more sensitive to Hg(II) than the wild-type (WT)strain. Database searches indicate that all Thermus sp. mer operons have an oah2 geneand that this phenomenon is not exclusive to Thermus spp.

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 2

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

RESULTSTranscription of thiol-related genes is induced by Hg(II). To begin to examine

the role of thiols in Hg(II) resistance in T. thermophilus, the effects of Hg(II) on transcriptlevels of genes that encode thiol-related enzymes were evaluated. Bioinformatic anal-ysis determined that the genome of strain HB27 lacks GSH biosynthesis genes, as hasbeen reported for Deinococcus radiodurans (another member of the Deinococcus-Thermus phylum) (22). Three putative genes for the biosynthesis of bacillithiol (BSH)were detected (bshA, bshB, and bshC), as were the cysE (23) and cysK/oas (24) cysteinebiosynthesis genes and the met2, oah2, oah1, and metH methionine biosynthesis genes(Fig. 1C) (20). Also, gene homologs encoding two thioredoxins (trxA1 and trxA2) andone thioredoxin reductase (trxB) were present in the genome (for locus tag identifiersof these genes, see Materials and Methods).

mRNA transcripts in WT cells exposed to 0 or 1 �M Hg(II) for 7.5, 15, or 60 min werequantified, and transcript abundances were normalized to that of gyrA (see Table S1 inthe supplemental material) (25). Mercury treatment increased transcript levels of allthiol-related genes tested, from over 10-fold for oah1 and trxA1 to about 2-fold for bshC(Fig. 2). For LMW thiol genes, the highest induction was achieved after 7.5 min of Hg(II)exposure, followed by a decrease at 15 min. With regard to methionine biosynthesisgenes (Fig. 2A), met2 showed fold inductions similar to those for oah1 at all time pointstested, suggesting that these two genes are likely expressed from an operon. Asexpected, oah2 was induced (17), showing �5-fold induction, which was the same foldinduction reached by metH. These data suggest that methionine and homocysteinebiosynthesis genes are induced by short exposure to Hg(II). Likewise, oas was induced�7-fold by Hg(II). Transcript levels of bshA and bshB increased approximately 4-fold(Fig. 2B) upon Hg(II) exposure. Furthermore, transcript levels of thioredoxin-relatedgenes were increased at 7.5 min (Table S2), but the highest fold induction was seen at15 min, reaching �10-fold for trxA1 and trxB and �7-fold for trxA2 (Fig. 2C).

FIG 1 mer and met operons and methionine metabolism pathways in T. thermophilus. (A) Diagram of themer operon in HB27, which is composed of oah2 (TT_C0792), merR (TT_C0791), and merA (TT_C0789). (B)Diagram of the met operon in HB27, composed of oah1 (TT_C0408) and met2 (TT_C0407). Arrows indicatethe direction of transcription. (C) Methionine metabolism in T. thermophilus (20). The met2 gene encodeshomoserine O-acetyltransferase, and the oah genes encode O-acetyl-homoserine sulfhydrylases.

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 3

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

GSH and thioredoxins are oxidized or consumed when they reduce and sequesterHg(II) (5, 6, 26, 27), and this interaction with Hg can lead to disulfide stress. Mercuryexposure can also produce reactive oxygen species (ROS), such as superoxide andhydrogen peroxide (6, 26, 27). Therefore, we evaluated the possibility that, in T.thermophilus, the 7.5-min induction of LMW thiol genes was due to these indirecteffects triggered by Hg(II). For this purpose, known stressor agents that producedisulfide stress (diamide) and ROS were used. Exposure to 4 mM diamide (a thiol-oxidizing agent), 160 �M paraquat (a superoxide generator), or 1 mM hydrogenperoxide for 7.5 min did not induce oah1, oah2, oas, or bshA transcript levels in WT cells(Fig. S1). However, exposures induced expression of control genes for each stressoragent. Addition of diamide increased transcript levels of trxA1 (Fig. S1, control gene),suggesting that an increase in thioredoxin transcripts by Hg(II) could be an effect ofdisulfide stress. On the other hand, paraquat and hydrogen peroxide did increase SODtranscript levels (Fig. S1, control gene). These results suggest that induction of LMWthiol biosynthesis genes was likely triggered directly by Hg(II) rather than indirectly bydisulfide stress (diamide) or accumulation of ROS (superoxide or hydrogen peroxide).Furthermore, the fast induction of LMW thiol genes caused by Hg(II) (7.5 min postex-posure) suggests that this effect is not a consequence of unrelated Hg(II)-triggeredresponses that would likely require longer incubation times to be manifested. However,induction of protein-thiol systems, such as thioredoxins (Fig. 2C), might be related toHg(II)-induced disulfide stress.

To evaluate if Hg(II) induction of thiol-related genes was unique to Thermus, theinduction of homologous systems (thioredoxin, glutathione, cysteine, and methioninebiosynthesis) was tested in Escherichia coli strain K-12, which lacks a mer system. When

FIG 2 Thiol systems are induced by Hg(II). Abundances of mRNA transcripts involved in methionine andcysteine biosynthesis (A), BSH biosynthesis (B), and the thioredoxin system (C) were measured in the WTstrain after 7.5, 15, or 60 min of exposure to 1 �M Hg(II). Gene expression was normalized to theabundance of the gyrA transcript and graphed as fold induction relative to the control level (ΔΔCT

method). Averages and standard deviations represent triplicate samples from three independent trials.Statistical analysis was conducted using the two-tailed t test. *, P � 0.05; **, P � 0.03; ***, P � 0.001.

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 4

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

cells were exposed to 2 �M Hg(II) for 7.5 or 30 min, no increase in transcript level of anyof the tested thiol genes was observed when the ssrA gene (Fig. S2) or rrsB (not shown)was used as a reference gene (28). There was no increase in transcript levels of genesinvolved in the biosynthesis of glutathione (gshA and gshB) or cysteine/homocysteine(cysK, cysM, or malY) or in protein thiol systems, such as glutathione reductase (GR) (gor)or thioredoxin reductase (trxB) (Fig. S2). It has previously been shown that zntA isinduced by Hg(II) in E. coli (29), and as expected, Hg(II) exposure resulted in a 12-foldinduction of the transcript level of this gene (Fig. S2).

In summary, exposure to Hg(II) elicited two distinct but complementary responsesin T. thermophilus, but not in E. coli. First, LMW thiol biosynthesis genes showed a rapidincrease in transcript levels followed by a rapid decline. Second, the thioredoxin systemappeared to be induced more slowly than LMW biosynthesis genes, possibly as aconsequence of disulfide stress that results from Hg exposure.

Thiol genes are involved in Hg(II) resistance. A role for Oah and BSH in Hg(II)

resistance has not been described. Thioredoxins are known to be oxidized by Hg(II) (6,7), but little is known about their physiological role in modulating Hg(II) toxicity inbacteria. To begin to examine their roles in Hg(II) resistance, thiol-related genes wereindividually replaced with a thermostable kanamycin resistance gene (HTK gene) (30) inthe WT HB27 background. These included two genes for the biosynthesis of methio-nine/homocysteine (oah1 and oah2), two genes involved in the biosynthesis of BSH(bshA and bshC), and two thioredoxin genes (trxA1 and trxA2).

When the role of the methionine/homocysteine biosynthesis pathway in Hg(II)resistance was evaluated in complex medium, the Δoah2 and Δoah1 strains were asresistant to Hg(II) as the WT strain (Fig. S3A). For reasons that are not currentlyunderstood, these mutant strains were unable to grow with sulfate as the sole sulfursource (data not shown), and therefore growth and Hg(II) resistance were analyzed ina chemically defined medium supplemented with 10 �M homocysteine. As illustratedin Fig. 3A, the Hg(II) 50% inhibitory concentrations (IC50s) for the Δoah1 and Δoah2strains were �2 �M, and the IC50 for the WT strain was �4.5 �M. These results suggestthat the cell’s ability to synthesize homocysteine/methionine affects its Hg(II) resistancein defined medium. Thermus is found in hot springs, where the sulfur source is mostlysulfide or sulfate (31–33), indicating that these genes may have environmental rele-vance to Hg(II) resistance.

oah2 is part of the mer operon in T. thermophilus (17) (Fig. 1A); therefore, thedifference in Hg(II) resistance between the Δoah2 strain and the WT strain may be dueto a polar effect on merA expression. To test this possibility, we measured MerAactivities in crude cell extracts of the WT, Δoah, and ΔmerA strains. MerA activities werestatistically indistinguishable between the WT and Δoah2 strains in the presence ofHg(II), while the ΔmerA strain displayed negligible activity (Fig. S4).

The BSH mutant strains were slightly more sensitive to Hg(II) than the WT strainwhen they were grown in complex medium (Fig. S3B), and this difference was en-hanced when cells were grown in defined medium containing sulfate as the sulfursource. The Hg(II) IC50s for the ΔbshA and ΔbshC mutants were �0.2 �M, whereas theWT had an IC50 of �1 �M (Fig. 3B). The lower Hg(II) resistance of the strains in definedmedium than that in complex medium was likely due to a decrease in exogenous Hg(II)ligands, which affect Hg(II) bioavailability (34). Furthermore, the higher sensitivity of theWT to Hg(II) in the defined medium supplemented with sulfate (Fig. 3B and C) than thatin medium supplemented with homocysteine (Fig. 3A) (1.6 times more sensitive) mayhave been due to the fact that homocysteine can bind Hg(II) (1, 2).

For the study of the thioredoxin system, ΔtrxA1 and ΔtrxA2 strains were constructed.Similar to the Δbsh strains, the ΔtrxA strains were slightly more susceptible to Hg(II)than the WT strain in complex medium (Fig. S3C). In defined medium, the ΔtrxAmutants were significantly more sensitive to Hg(II) than the WT. The Hg(II) IC50 was�0.2 �M for the ΔtrxA1 and ΔtrxA2 mutants and �1 �M for the WT (Fig. 3C).

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 5

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Taken together, the results in Fig. 3 and Fig. S3 clearly show that LMW thiols andthioredoxins enhance Hg(II) resistance in T. thermophilus HB27. It is environmentallysignificant that these genes have a larger impact on Hg(II) toxicity when sulfate is usedas a sulfur source. In natural springs, Thermus spp. do not have access to complex sulfursources to use as substrates (31–33).

Oxidation state of BSH and alternate LMW thiols is affected by Hg(II). Due tothe higher sensitivity of LMW thiol biosynthesis mutants to Hg(II), we examined howHg(II) affected intracellular LMW thiol pools. The intracellular concentrations of LMWthiols were measured by utilizing the fluorescent probe monobromobimane (mBrB) (35,36), and products were identified and quantified by high-pressure liquid chromatog-raphy (HPLC) analysis coupled with a fluorescence detector. mBrB reacts with free thiols(reduced thiols) to produce a fluorescent derivative, which is detected in the elute.Thus, this assay detects only reduced thiols.

The main redox buffer detected in T. thermophilus was BSH, which was present at27.1 � 8.5 nmol/g cellular dry weight (Fig. 4A; Table S3 and Fig. S5A and B). Two other

FIG 3 Sensitivity to Hg(II) increases in mutant strains lacking LMW thiol synthesis genes or thiolhomeostasis systems. The graphs show the effects of Hg(II) on growth in defined medium supplementedwith 10 �M homocysteine after 24 h (A) or in defined medium supplemented with 5.2 mM sulfate after20 h (B and C). Each point represents the average for three independent experiments, and standarddeviations are shown. Statistical analysis was conducted using one-way ANOVA followed by the Tukeytest. *, P � 0.001.

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 6

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

LMW thiols were detected: cysteine (6.1 � 3.1 nmol/g) and a large pool of sulfide(324.1 � 88.4 nmol/g) (Fig. 4A; Fig. S5 and Table S3). The sulfide:BSH:Cys molar ratio inthe WT strain was � 12:1:0.2 (Fig. S5A and Table S3). As expected, BSH was not detectedin the LMW thiol pools from the ΔbshA and ΔbshC strains (Fig. 4A; Table S3), confirmingthe role for both genes in the BSH biosynthetic pathway.

We next examined whether the LMW thiol pool is affected by exposure to Hg(II).Cells were incubated with Hg(II) for 1 h prior to determining the concentrations of free(reduced) LWM thiols. The addition of Hg(II) decreased free thiol pools in the WT strain(Fig. 4B; Table S3 and Fig. S5B) and the ΔmerA strain (Table S3). Upon exposure to 1 �MHg(II), cysteine was undetected, and only 2% of reduced BSH remained in the WT strain(Fig. 4B; Table S3). BSH was undetected upon exposure of cells to 3 �M Hg(II) (Fig. 4B;Table S3 and Fig. S5B). On the other hand, BSH and Cys were undetected when theΔmerA strain was exposed to 1 �M Hg(II) (Table S3), suggesting that Hg(II) removal byMerA in the WT strain alleviates Hg(II)-induced disulfide stress.

These results suggest that LMW thiols scavenge Hg(II). In T. thermophilus, BSH is theprimary Hg(II) buffer, although cysteine, which is present at a much lower concentra-tion, also acts as a Hg(II) buffer. The sequestration of Hg(II) by intracellular thiols isconsistent with the hypothesis that induction of LMW thiol biosynthesis genes uponHg(II) exposure (Fig. 2A and B) may serve to increase the concentration of thiol ligandsas a primary response to Hg(II) toxicity. Expression of thioredoxins (Fig. 2C) may help toregenerate LMW thiol pools (37) that are sequestering Hg(II).

Cellular redox state modulates Hg resistance. The depletion of LMW thiols byHg(II) and the importance of thioredoxins in Hg(II) resistance led us to hypothesize thata disturbance in the balance of reduced/oxidized thiols would affect Hg(II) resistance.Diamide is a thiol-oxidizing agent that produces disulfide stress (38) by interfering withthiol-dependent processes in the cell. In the presence of diamide at either 1 mM (Fig.S6) or 2 mM (Fig. 5A), the WT, Δoah2, and ΔmerA strains were more sensitive to Hg(II).Resistance to Hg(II), as measured by the IC50, decreased with increasing diamideconcentrations in both the WT and ΔmerA strains. As expected, the WT strain was more

FIG 4 BSH is the primary LMW thiol in T. thermophilus, and LMW thiols are responsive to Hg(II). (A)Cultures were grown in complex medium to an OD600 of �0.4, and LMW thiols were quantified for theWT, Δoah1, Δoah2, and ΔbshC strains. (B) The WT strain was grown in complex medium to an OD600 of�0.4, cells were exposed to different Hg(II) concentrations for 60 min, and small thiols were quantified.The thiol concentrations in cultures not exposed to Hg(II) were considered 100%. Averages and standarddeviations represent triplicate samples from at least three independent trials. ND, not detected.

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 7

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

resistant than the ΔmerA strain at all diamide concentrations (Fig. 5A; Fig. S6). Theaddition of diamide had the same effect as growth under sulfur-limiting conditions (Fig.3A) in the Δoah2 strain: the Δoah2 strain was more sensitive to Hg(II) than the WT strain(Fig. 5A; Fig. S6).

N-Ethylmaleimide (NEM) is a thiol-blocking agent that irreversibly binds to freethiols. When cells were exposed to 0.2 or 0.4 mM NEM, no difference in growth wasdetected compared to that of unexposed cells (not shown), indicating that NEM did notaffect growth in the absence of Hg(II). When cells were coexposed to Hg(II) and NEM,they were more susceptible to Hg(II) than NEM-unexposed cells (Fig. 5B). The Hg(II)IC50s for 0.2 mM and 0.4 mM NEM-exposed cells were �3 and �2.5 �M Hg(II),respectively, but the Hg(II) IC50 was more than 4 �M for NEM-unexposed cells. Takentogether, these findings clearly indicate that the intracellular redox state and thiolavailability greatly affect Hg(II) toxicity.

Evolutionary aspects of thiol genes and mercury. The presence of a gene relatedto the biosynthesis of thiol compounds, as we reported for oah2 in T. thermophilus’s meroperon, has not been reported for other mer operons. To examine how general thisphenomenon is, genomes from organisms belonging to the Deinococcus-Thermusphylum were searched for the presence of oah2 homologs or other thiol-related genesin the mer operons. Of the 75 Deinococcus-Thermus genomes available in June 2017, 32belonged to Deinococcales and 43 to Thermales. Of the Thermales genomes, 30 ge-nomes were from Thermus spp., and nine of them had mer operons (Table S4). All theThermus sp. mer operons had the oah2 gene or, as annotated, O-acetylhomoserine

FIG 5 Decreased thiol availability enhances Hg(II) toxicity. (A) The effect of diamide on Hg(II) toxicity wasevaluated in the presence (2 mM) (empty symbols) or absence (filled symbols) of diamide after 16 h ofgrowth of the WT (circle), Δoah2 (triangle), and ΔmerA (square) strains. (B) The effect of the thiol-alkylating agent NEM on Hg(II) toxicity was evaluated after 24 h of growth of the WT strain. The cultureoptical density (A600) with 0 �M Hg(II) in complex medium was considered 100% growth. Averages andstandard deviations for at least 5 independent trials are shown. Statistical analysis was conducted usingthe two-tailed t test. *, P � 0.035; **, P � 0.001.

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 8

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

(thiol)-lyase. Only four other Thermales genomes, all belonging to the Thermaceaefamily, had mer operons, but none of them included the oah2 gene. Only one Deinococcalesgenome had a mer operon lacking oah2. Thus, oah2 is exclusive and always present inmer operons of Thermus spp. In all of these operons, oah2 is located upstream of merRand merA. As in HB27, the genomes of all mer-containing Thermus spp. also had oah1.A phylogenetic analysis performed with Oah1 and Oah2 sequences showed a clearseparation of the two proteins to two unique clades (Fig. 6; Fig. S7), suggesting thatthese two genes are evolving independently of each other.

In a survey of 272 mer operons available in databases in December 2011 (14), theonly taxon containing a thiol-related gene, aside from T. thermophilus, was the Alpha-proteobacteria (T. Barkay, unpublished data), where 8 of 25 operons had an openreading frame (ORF) annotated gor, which encodes a glutathione reductase (GR). Themain LMW redox buffer in Alphaproteobacteria is GSH, and GR keeps GSH reduced byusing NADPH as an electron donor (10). In April 2017, there were 505 finished andassembled alphaproteobacterial genomes, and when they were searched for thepresence of MerA, 40 additional mer operons were found, 5 of which included GR.Among the 65 alphaproteobacterial genomes that had a mer operon, only 13 genomeshad a GR gene present in the mer operon (Table S5). With one exception, GR was alwayslocated downstream from mer transport genes. Another commonality between Alpha-proteobacteria and Thermus spp. is the presence of a GR-paralogous gene elsewhere inthe genome. As designated for Thermus, GRs encoded in the mer operons were namedGR2, and the non-mer-operon GRs were designated GR1. Similar to the Oah proteins,the GR2 proteins appear to be evolving independently from GR1, as suggested by theclustering pattern of the alphaproteobacterial GR phylogeny (Fig. S8).

FIG 6 Molecular phylogenetic analysis of Oah proteins in Thermus spp. by the maximum likelihood method. TheOah proteins encoded in the Thermus sp. genomes were associated with mer operons (Oah2) or met operons(Oah1). The figure shows an enlargement of the original tree (see Fig. S7 in the supplemental material), presentedto highlight the diversification of Oah homologs. Oas (CysK) protein sequences were used as an outgroup (for thefull phylogenetic tree, refer to Fig. S7). The phylogeny with the highest log likelihood (�3,752.97) is shown. The treeis drawn to scale, with branch lengths measured in numbers of substitutions per site. Numbers at bifurcation pointsindicate bootstrap values. Protein IDs or locus tags are provided in Table S6.

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 9

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

These data indicate that the presence of a thiol gene in a mer operon is not uniqueto Thermus spp. The role of the GR system in Hg(II) resistance in Alphaproteobacteriaremains to be studied.

DISCUSSION

The prior observation that in T. thermophilus HB27 oah2 is cotranscribed with themer genes in response to Hg(II) (17) led us to discover the following about thisbacterium: (i) expression of LMW and protein thiol genes are induced by Hg(II), (ii) BSHis the primary redox buffer, and (iii) BSH, along with other LMW thiols and thioredoxins,increases cellular resistance to Hg(II). Together these results highlight a role of LMW andprotein thiols in mitigating Hg(II) toxicity, supporting their integration into the para-digm of cellular defense against this highly toxic heavy metal.

The interaction of thiols with metals is one of life’s foundations; this interaction controlsfunctional and structural attributes of molecules and cells. In fact, sequestration of softmetals by thiol compounds, such as metallothioneins and phytochelatins, is a well-established mechanism of metal resistance in which the biosynthesis of the sequesteringmolecules is induced by exposure to the metals (39). The central paradigm for microbialresistance to Hg(II) is transformation to Hg(0) (13), but although the role of GSH in Hg(II)resistance is known (27, 40), not much information is available about other thiol agents. TheThermus system combines MerA-dependent reduction (17) with thiol-based sequestration(this study). Upon Hg exposure, the induction of genes encoding LMW and protein thiolsystems along with merA suggests a role for both in Hg(II) detoxification. Note thatmercury-dependent induction of thiol biosynthesis genes did not occur in E. coli (see Fig.S2 in the supplemental material), consistent with a previous study in which Hg(II) exposuredid not induce expression of the glutathione transferase gene (28).

This study showed an induction of various LMW thiol biosynthesis genes by Hg(II).Moreover, knockout mutants of all thiol biosynthesis genes were more susceptible toHg(II) than the WT was, connecting these genes and their Hg(II)-induced expressionwith a role in resistance to Hg(II). We propose the following model (Fig. 7) to explainhow Hg(II) sequestration by thiols and reduction work together. In Hg(II)-exposed cells, theexpression of thiol biosynthesis and mer genes is induced. LMW thiols bind Hg(II) andprevent Hg(II) from damaging sensitive targets in the cell. Oah synthesizes homocysteinethat can be used as a precursor in cysteine biosynthesis (Fig. 7, dashed arrow); homocys-teine may also bind Hg(II) with its free thiol (not shown). Cysteine availability is ensured by

FIG 7 Proposed model for a two-tiered response to Hg(II) toxicity in T. thermophilus. Hg(II) exposure(black arrows) induces expression of mer, LMW thiols, and thioredoxin systems. The latter two aid insequestering Hg(II) until reduction of Hg(II) to the less toxic form Hg(0) by MerA. Abbreviations: BSH,bacillithiol; Hcys, homocysteine; Cys, cysteine; hp, hypothetical protein; TR, thioredoxin reductase; Trx,thioredoxin.

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 10

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Hg(II)-induced overexpression of oas, and this cysteine can be used by BshC to finalize thebiosynthesis of BSH. In addition, thioredoxins might directly reduce or sequester Hg(II), andthe resulting thioredoxin-Hg complex can be resolved by NADPH-dependent thioredoxinreductase leading to Hg detoxification. The expression of merA results in the reduction ofHg(II) to Hg(0), leading to removal of the metal. This model accounts for the two cellularlines of defense against Hg(II) toxicity, i.e., sequestration by thiol-based redox buffers anda mer-based detoxification system. The role of LMW thiol agents, including BSH, in Hg(II)resistance among prokaryotes warrants additional study.

The important question raised by this model is how thiol agents interact with MerAin Hg detoxification. One possibility is suggested by the fact that in Thermus MerA lacksNmerA, the N-terminal extension of 70 amino acids (41). In proteobacterial MerA,NmerA delivers Hg(II) to the catalytic core of the enzyme; when NmerA is absent, Hg(II)can be transferred, less efficiently, by thioredoxins and GSH (41). Generally, taxacarrying the core MerA exhibit millimolar concentrations of LMW thiols, but thosecarrying full-length MerA (i.e., including NmerA) exhibit lower concentrations of LMWthiols (18). The lack of the NmerA domain in Thermus spp. might suggest that inaddition to their role in intracellular sequestration of Hg(II), thioredoxins and/or BSHmay play a role in tolerance by delivering Hg(II) to the enzyme.

Our results demonstrate a role for the thioredoxin/thioredoxin reductase system inHg(II) resistance. Most studies on thioredoxin systems and Hg(II) have been performedin eukaryotic cells. These studies found that Hg(II) induces trx expression (42) but notenzymatic activities (7, 42), likely due to inhibition of the proteins by Hg(II) (7). Bacterialthioredoxin systems are different from those of mammalian cells. The little that isknown about bacterial thioredoxin systems under Hg(II) stress indicates that bacterialthioredoxin, unlike the human enzyme, does not dimerize in the presence of Hg(II) (7).Moreover, Hg(II) oxidizes thioredoxin in Geobacter sulfurreducens but not in Shewanellaoneidensis (6), and Hg(II) exposure increases the amount of thioredoxin reductase inCorynebacterium glutamicum (43). Whereas our study adds new information on the roleof the thioredoxin system in response to Hg(II) in a thermophilic bacterium, additionalstudies are needed to better understand the role of thioredoxin interactions with toxicmetals, considering the diversity in redox homeostasis systems among prokaryotes (11).

Identification of BSH as a major LMW thiol agent in Thermus is another new findingof our research. Whereas this was expected because BSH was reported to be the mainLMW thiol agent in the related taxon Deinococcus (22), we showed that Δbsh mutantsare more susceptible to Hg(II) than the WT. We also determined that similar to what hasbeen reported for Bacillus subtilis (44), T. thermophilus BSH mutants were more sensitiveto Zn(II) than the WT strain (data not shown). This information suggests that BSH hasa general role in metal ion tolerance and/or buffering (45). Thermus mer operons are notthe only ones that contain thiol-related genes; some alphaproteobacterial mer operonsinclude gor, a glutathione reductase gene. Although studies have reported Hg resis-tance in environmental alphaproteobacterial isolates (46, 47) and the presence ofalphaproteobacterial merA in soil metagenomes (48), the roles of gor and the meroperons in managing alphaproteobacterial Hg(II) stress have received little attention.Nevertheless, the presence of the gor gene (see Fig. S8 and Table S5 in the supple-mental material) clearly suggests that the mer operon of T. thermophilus may not be theonly example of the integration of genes involved in thiol systems. It is possible that insome alphaproteobacteria the supply of reduced glutathione is increased upon Hg(II)exposure, but this remains to be tested. Interestingly, Thermus sp. and alphaproteo-bacterial genomes carry a second copy of the thiol-related gene, and in both the twoparalogs appear to be evolving independently of each other (Fig. 6; Fig. S8), suggestingthe occurrence of evolution in response to different selective pressures. If this is so, themer-associated thiol gene might have a unique function that is not shared with thechromosomally located gene.

In our prior research on the evolution of mer operons (14), we suggested a gradualevolution from simple, constitutively expressed operons (merA and a possible trans-porter gene) in early thermophilic lineages to a highly efficient and more complex

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 11

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

detoxification system in the Proteobacteria. It is possible that LMW and protein thiolsare another line of defense against Hg toxicity in at least one early bacterial lineage. Wepreviously argued that the mer system originated among thermophilic bacteria fromgeothermal environments (14, 18) with high Hg levels of geological origin (32). Thediscovery of an LMW thiol-based defense against Hg toxicity in Thermus may suggestthat the thiol-dependent cellular defense strategy originated early in the evolution ofmicrobial life as well.

MATERIALS AND METHODSBacterial stains and growth conditions. T. thermophilus HB27 (DSMZ 7039) and its mutants were

cultured at 65°C in 461 Castenholz TYE medium (complex medium) as described by Wang et al. (17).Chemically defined medium was prepared as described by Tanaka et al. (49). For culture in liquidmedium, cells were grown in 3 ml of medium in 13-ml test tubes shaken at 200 rpm. Solid culturemedium was supplemented with 1.5% noble agar (Sigma). Where present, kanamycin (Kan) was used at25 �g/ml (Sigma). E. coli strains were grown at 37°C in Luria-Bertani (LB) medium. Liquid cultures wereshaken at 180 rpm, and solid medium was supplemented with 1.5% agar.

Mutant construction. Construction of the ΔmerA mutant was described previously (17). To creategene replacements of the oah2, oah1, bshA, bshC, trxA1, and trxA2 genes with a kanamycin resistancegene (“Δgene::HTK”; denoted “Δgene” strains), the upstream and downstream flanking regions of thetarget gene were PCR amplified and the products fused with the thermostable Kan resistance gene, HTK(30) (see Fig. S9 in the supplemental material). Two strategies were used to fuse the PCR products. Forthe oah2 gene, different restriction sites were added to the 3= ends of PCR fragments; for the other fivegenes, fusion PCR was performed (50). The final constructs were cloned into pUC19 and used totransform Max Efficiency DH5� competent cells (Invitrogen), with transformants selected on LB platessupplemented with 100 �g/ml ampicillin (Amp; Sigma). Transformants were grown in liquid LB mediumsupplemented with 100 �g/ml Amp, plasmids were extracted using a Wizard Plus SV miniprep DNApurification system (Promega), and purified plasmids were used to transform T. thermophilus as describedby Koyama et al. (51). T. thermophilus was grown for 2 to 3 days on complex medium plates containing25 �g/ml Kan until transformed colonies appeared. The in-frame replacement of the gene was confirmedby sequencing of the insert by use of primers 5 and 6 for each strain (Table 1). All transformants had therespective native promoter controlling the expression of the HTK gene cassette. Primers used forconstruction of the knockout strains are listed in Table 1.

Mercury resistance in complex and defined media. Cells were grown overnight (O/N) in complexmedium and diluted to an optical density at 600 nm (OD600) of 0.1 in fresh complex medium or in definedmedium supplemented with sulfate, and HgCl2 was added to individual tubes at concentrations rangingfrom 0 to 10 �M. Growth was monitored by use of the OD600 (Spectronic 20 Genesys spectrophotometer;Spectronic Instruments). Resistance was assessed as the percentage of growth observed 18 or 20 h afterHg(II) addition relative to the growth of no-Hg(II) control cultures (100% growth). All experiments wereperformed in triplicate unless stated otherwise.

Mercury resistance under sulfur-limiting conditions. All strains were grown O/N in complexmedium, washed twice in chemically defined medium without sulfate, and resuspended in this mediumto an OD600 of 0.1. Cell suspensions were divided into different tubes, and 10 �M homocysteine (aconcentration determined in preliminary experiments to be growth limiting) was added to each tube.Finally, HgCl2 was added from 0 to 6 �M. Resistance was assessed as the percentage of growth (OD600)observed 24 h after the addition of Hg(II) relative to the growth of no-Hg(II) control cultures.

Diamide and NEM assays. Cells were grown O/N in complex medium, diluted to an OD600 of 0.1, anddivided into different tubes containing 0 to 2 mM diamide (Sigma) or 0 to 0.4 mM N-ethylmaleimide(NEM). HgCl2 was added (at concentrations ranging from 0 to 4 �M), and growth (OD600) was measuredafter 16 (diamide) or 24 (NEM) h. For exposed cultures, including those exposed only to diamide or NEM,growth in the absence of Hg(II) was considered 100% growth.

RNA extraction and cDNA synthesis. Cells from O/N cultures of T. thermophilus were diluted to anOD600 of 0.1 in complex medium and incubated to an OD600 of �0.4, and then 1 �M HgCl2 was added.For E. coli K-12 strains, an O/N culture was diluted to an OD600 of 0.1 in LB medium and incubated to anOD600 of �0.8, and then 2 �M HgCl2 was added. Three-milliliter aliquots of cell suspensions wereremoved 7.5, 15, 30, or 60 min after the addition of Hg(II); an unexposed control was included at eachtime point. The removed aliquots were mixed with 0.5 volume of RNAprotect (Qiagen) and incubated for5 min at room temperature. Cells were washed once with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0),resuspended in 300 �l of lysis buffer (20 mM sodium acetate, 1 mM EDTA, 0.5% SDS, pH 5.5), andincubated for 5 min at 65°C. One milliliter of TRIzol (Invitrogen) was added, and RNA extraction wasperformed as instructed by the manufacturer. RNA integrity was checked in a 1.5% agarose gel, and theconcentration was measured by NanoDrop spectrophotometry (ND-1000 spectrophotometer; NanoDropTechnologies Inc., Wilmington, DE). RNA was treated with a Turbo DNA-free kit (Ambion) to remove DNA,and the DNA-free RNA was used to synthesize cDNA by use of a high-capacity cDNA reverse transcriptionkit (Applied Biosystems), using 1 �g of RNA for T. thermophilus. For E. coli, 2 �g of RNA was used tosynthesize cDNA by use of the SuperScript III first-strand synthesis system (Life Technologies). For bothkits, cDNAs were synthesized following the manufacturers’ instructions.

Quantitative PCR. T. thermophilus transcripts of oah2 (WP_011173224), oah1 (WP_011172856),met2 (WP_041443334), metH (WP_041443334), oas (WP_011174005), bshA (WP_011173182), bshB

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 12

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

(WP_011173270), bshC (WP_011173609), trxA1 (WP_011173768), trxA2 (WP_011173531), and trxB(WP_011173929) were quantified by qPCR, using cDNA as the template and primers specific for eachgene (Table 2). For E. coli, transcripts of gor (Ga0175964_11222), trxB (Ga0175964_112966), gshA(Ga0175964_111051), gshB (Ga0175964_11784), cysK (Ga0175964_111321), malY (Ga0175964_112139), cysM(Ga0175964_111314), and zntA (Ga0175964_11254) were quantified as described for T. thermophilus. Reactionmixtures contained 12.5 �l of 2� SYBR Green JumpStart Taq ReadyMix (Sigma), 1 �l cDNA, and an optimizedconcentration of each primer set (Table 2) in a final volume of 25 �l. Thermal cycling (iCycler iQ; Bio-RadLaboratories Inc., Hercules, CA) conditions were as follows: initial denaturation at 95°C for 5 min; 30 cycles ofdenaturation (95°C for 15 s), annealing (at the temperature shown in Table 2, for 15 s), and extension (72°Cfor 15 s); fluorescence measurement; and a final melt curve (60 to 99°C). Results for at least three biological

TABLE 1 PCR primers used for construction of T. thermophilus HB27 knockout mutants

Mutant strain Primer name Primer sequencea

Productsize (bp) Target

Δoah2 strain oas 720 RI for1 GGATGCAGCAGCCCTGGAATTCGTAGTAGG 418 oah2 upstream sequenceoas 1100 KpnI Rev1a GTCTTCGGGAAGCCCGGCGAGGGTACCGAGGGTGGTGTApUC-HTK 670 for GCTTGCATGCGGGGTACCCTAGAATTCAT 800 HTK genepUC-HTK 1450 Xba Rev GAGGTCATCGTCTAGAATGGTATGCoas 2310 XbaI for2 CCTGGAGGCGGTCCATATGCTCTAGACCAT 470 oah2 downstream sequenceoas 2750 PstI Rev2 GGTTCTTCTCCATGCCTGCAGGCTAGACCoas del for3 GGTCTTCACGGGCTTGCCCTGAAAGG 595 SequencingHTK 5= rev GCTGAACTCTACTCCCTCTGTTGACAGAACAC

Δoah1 strain A HTKoah1upfor GACTTTGGAAAGGAGGCCAAGGATGAAAGGACCAATAATAATGA 761 HTK geneB HTKmet2rev CGAGGGCGATCTCGCTCATTCAAAATGGTATGCGTE oah1uprev TCATCCTTGGCCTCCTTTCCAAAGT 559 oah1 upstream sequence1 oah1 ecoRI CCTCGAATTCCACGTCCCCGF met2for ATGAGCGAGATCGCCCTCG 366 oah1 downstream sequence4 met2rev GGCGGGGTCCAGGATCChtkoah1uprev TCATTATTATTGGTCCTTTCATCCTTGGCCTCCTTTCCAAAGTC 1,772 Sequencinghtkmet2for ACGCATACCATTTTGAATGAGCGAGATCGCCCTCG

ΔbshC strain B spo htk rev CTAACCCTTCTTCAAAATGGTATGCGTTTTGAC 786 HTK geneA crp htk for TAGGCTTTAAAGCATGAAAGGACCAATAATAATGACE htk crp rev GGTCCTTTCATGCTTTAAAGCCTAAAGTTCC 513 bshC upstream sequence1 crp bamHI for CTCGTCGGGATCCACCGGF htk spo for GCATACCATTTTGAAGAAGGGTTAGGATGTTCG 378 bshC downstream sequence4 spodown psti rev AGGTAGTCCTGCAGGGGAAGG5 bshC for GTCCTTTGCGCTTGAGGCG 1,774 Sequencing6 bshC rev ACGGCCTGGGCCTTCA

ΔbshA strain A perm HTK for CTAGGCTTAGGGCATGAAAGGACCAATAATA 785 HTK geneB bshA htk rev GGGCGTAGACTCAAAATGGTATGCGE htk perm rev TTATTGGTCCTTTCATGCCCTAAGCCTAG 458 bshA upstream sequence1perm ecoR1 for GCGCCGGGAATTCCGGF HTK bshA for ACCATTTTGAGTCTACGCCCAGG 714 bshA downstream sequence4 prot PstI rev GAGAAGGACCTGCAGGCCTAC5 perm upins for AGACCCTCACCCTCAAGGACT 2,062 Sequencing6 pro downins rev GCCCTCCTCCGCAAGG

ΔtrxA2 strain A trx2upHTK GCGGAGGGGGTACCTATGAAAGGACCAATAATAAT 796 HTK geneB hsp20HTK rev TCCCTTCTAGGTAGGGCCTTCAAAATGGTATGCGE HTKuptrx2 rev ATTATTGGTCCTTTCATAGGTACCCCCTCCG 539 trxA2 upstream sequence1 trx2 ecoR1 for GAAAGGGAATTCCAGCTTGCGGG4 hsp20 bamH1 rev CGGGGGATCCGCACCT 403 trxA2 downstream sequenceF HTKtrx2for GCATACCATTTTGAAGGCCCTACCTAGAAGG5 trx2upst for CTTCTGGACCTGAGGGCGA 1,465 Sequencing6 hsp20downst rev TTTCCTGAATGGGTATCCGCACG

ΔtrxA strain A trx1 htk for CGTAGAGTAGGGGGGTATGAAAGGACCAATAATAATG 791 HTK geneB2 trx1 GTCCAGGGCGATGCGCATCCTCAAAATGGE htktrx1 rev ATTGGTCCTTTCATACCCCCCTACT 486 trxA1 upstream sequence1 trx1 ecoR1 for CGCGGGTGAATTCCGCGF htkphos for CATACCATTTTGAGGATGCGCATCGC 397 trxA1 downstream sequence4 phos bamH1 rev TCAAGCTGGGGATCCCCAC5 trx1 upsisn for GGACCTTCGCCGAGCTCC 1,752 Sequencing6 Phos downins rev GGACGAGGAAGGAAGGGCG

aUnderlined sequences indicate restriction enzyme cutting sites.

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 13

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

replicates were averaged in all cases. A reaction mixture with DNA-free RNA was run as a control for detectionof DNA contamination. Transcript abundance was normalized to that of gyrA (TT_C0990) for T. thermophilus(25) and to that of ssrA (Ga0028711) for E. coli (28), using the ΔΔCT method (52).

Mercuric reductase assay. Cells from an O/N culture were diluted in fresh complex medium to anOD600 of 0.1 and grown to an OD of �0.4, 1 �M HgCl2 was added, and cultures were incubated for 30additional minutes. Each experiment included an unexposed control. Cultures (35 ml) were centrifugedand washed once in phosphate-buffered saline (PBS; 8.01 g/liter NaCl, 0.2 g/liter KCl, 1.78 g/liter Na2HPO4,0.27 g/liter KH2PO4, pH 7.4), and cell pellets were frozen until further use. Crude cell extracts wereprepared as previously described (53). MerA assays were performed at 70°C as described by Wang et al.(17), using 200 �M NADH and 20 �l of protein extract. Oxidation of NADH was monitored spectroscop-ically at 340 nm (Aviv model 14 UV-VI biomedical spectrophotometer) each second for 1 min. Controlreaction mixtures were set up with NADH and cell extract but no HgCl2, and the cell extract-only activitieswere subtracted from rates for complete assay mixtures to determine Hg(II)-dependent NADH oxidation.Specific activities were defined in units per milligram of protein, with 1 U corresponding to 1 �mol ofNADH oxidized per min. The Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA) was used todetermine protein concentrations.

TABLE 2 qPCR primers used to measure gene expression of the listed genesa

Primer SequenceFinal concn(�M)

Annealingtemp (°C)

Productsize (bp)

gyrase-F GGGCGAGGTCATGGGC 1 61 134gyrase-R CGCCGTCTATGGAGCCG 0.25oah2-F3 GAGCTCTGGCGGAACTAC 0.25 56 104oah2-R3 AAGGTGCGGACCCTTTC 1merR4-F AGCTTGAGGACATCGCCTGGAT 0.5 61 214merR4-R TCCAAATAGACGCAGCGGTCCC 1merA for GCCTTCAAGATCGTGGTGGACGAAGAG 0.5 62 186merA rev CCTGGGCCACGAGCCTTATCC 0.25oah1-F2 GGAGCTCGCCTTCATCGTCA 1 59 137oah1-R2 TGTTTTCCACGTGACGCTCG 0.25met2-F GAATCGCCATGATGAGCTACC 1.25 57 92met2-R CTGGTAGTCCAGGTAGGTTTCC 1.25oas-F CGCTACCTCAAGGAAAGGATC 1.25 56 145oas-R GGGAAAGGTCCAGGTTCTCG 1.25metH-F CCTCTTTGACCTCCTTACCTTCC 2.5 57 98metH-R TCTCCCGTAGCTCCTCTATGG 2.5bshA-F CTAGACCTGAGCGCAAGAGG 2.5 58 128bshA-R GAGGCGCTTCCGGATTT 2.5bshB-F CGCCGTTACTTTGGGAACTA 2.5 58 76bshB-R GCACGTAGAGCACGGGAAG 2.5bshC-F2 GGAGGCGGAGACGCTTTC 1.25 55 81bshC-R2 GGGTCAAAGGGCACAAGC 1.25trxB-F GGTGCGGCTTAAGAACCTAAAG 1.25 58 100trxB-R CTTGAGGAAAGCGGTGTTGG 1.25trxA1-F GACCAGAACTTTGACGAGACCC 1.25 60 132trxA1-R AAGCTTCCCCTCGTACTCTTTGG 1.25trxA2-F CCCACCCTGGTCCTCTTCC 1.25 60 105trxA2-R CCTCCCTTCTAGGTAGGGCCTG 1.25gor-R e coli GCCGTGAATACCGACAATCT 0.4 60 130gor-F e coli CGACGATCAGGTGAAAGTGTAT 0.4trxB-F e coli ACAGTCGGGTATTCATGGTAATG 0.4 60 110trxB-R e coli CTGTACCGGCCGAAGTAATG 0.4gshB-F e coli CCCATCGCAAACATCAACATC 0.4 60 101gshB-R e coli AGATCGCCCATCTCCATATAGT 0.4gshA-F e coli CGGATGTGGCCGTTAAGTAT 1 60 91gshA-R e coli TAAAGCGTCCGGTGTTAGAAG 1zntA-F ATCAGGTGCAGGTGTTGTT 1 60 113zntA-R TTCATCGCGCAGGGAATAG 1cysM-F ecoli ATACGCCTCTGGTGAAGTTG 0.5 60 89cysM-R ecoli CGAACCTGCCGGGTTATT 0.5cysK-F ecoli CGATCTCAAGCTGGTCGATAAA 0.4 60 116cysK-R ecoli CAGCTGCTCCAGAAGAGATAC 0.4MalY-F ecoli GATGAGTTTCTCGCGGCTATT 0.5 60 93MalY-R ecoli GATGACAGAAGGGCCATACAC 0.5ssrA-F Ecoli CGCCCGTCACGAATACTTTA 0.4 60 110ssrA-R Ecoli ACGTAGCTGTCGCTGATATTG 0.4aAll primers were designed for this study, except for the merA primers, which were from the work of Wanget al. (17).

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 14

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Thiol content assay. Cells from an O/N culture were diluted to an OD600 of 0.1 and grown to an ODof �0.4, 0 to 3 �M HgCl2 was added, and growth was continued for an additional 30 or 60 min. Cells froma 25-ml culture were harvested and washed twice with PBS. Cell pellets were resuspended in 500 �l ofD-mix (9.4 mM monobromobimane [mBrB; Sigma], 50% acetonitrile, 50 mM HEPES, 5 mM EDTA, pH 8.0)and incubated for 15 min at 60°C in the dark. Derivatization was stopped by adding methanesulfonic acidto a final concentration of 25 mM. Samples were stored at �20°C until high-performance liquidchromatography (HPLC) analysis. Reversed-phase HPLC analysis and fluorescence detection of thebimane derivatization products were performed as previously described by Rethmeier et al. (35).

Bioinformatic analysis. The presence of oah2 gene homologs in all finished, permanent draft, anddraft Deinococcus-Thermus genomes available in the IMG/MER database (https://img.jgi.doe.gov/cgi-bin/mer/main.cgi) on 8 June 2017 was determined as follows. First, mer operons were identified by use ofBLASTX (https://img.jgi.doe.gov/cgi-bin/mer/main.cgi?section�FindGenesBlast&page�geneSearchBlast),with MerA of HB27 (accession number TTC0789) as a query and a cutoff value of 1e�50. Hits weremanually examined for the presence of amino acid residues characteristic of MerA (13), and neighboringgenes were examined for the presence of Oah2 homologs in the JGI’s gene detail page.

The presence of the GR gene in the finished and assembled alphaproteobacterial genomeswas determined on 18 April 2017 using a blastp search (https://img.jgi.doe.gov/cgi-bin/mer/main.cgi?section�FindGenesBlast&page�geneSearchBlast), with MerA of Aurantimonas manganoxydans S185-9A1 (accession no. EAS49959.1) as a query and a cutoff value of 1e�50. Hits were manually examinedfor the presence of amino acid residues characteristic of MerA (13) and neighboring genes for thepresence of GR homologs using the Joint Genome Institute’s gene detail page.

Phylogenetic analysis. Protein sequences of Oah and GR were aligned using ClustalX (ver. 2.0) (54,55). The resulting alignments were used for phylogenetic analysis, which was inferred by using themaximum likelihood method based on the JTT matrix-based model (56). The initial tree(s) for theheuristic search was obtained automatically by applying neighbor-joining and BioNJ algorithms to amatrix of pairwise distances estimated using a JTT model and then selecting a topology with a superiorlog likelihood value. Evolutionary analyses were conducted in MEGA7 (57).

For both trees, all positions containing gaps and missing data were eliminated. The Oah tree wasconstructed of 21 amino acid sequences, with a total of 248 positions in the final data set. The outgroupused was O-acetylserine sulfhydrylase (Oas) enzymes because they carry out reactions similar to those ofOah but have substrate specificity different from that of Oah (21). Met17 was used as an internaloutgroup for the Oah1 proteins due to its high homology to the latter (21). For the GR tree, the analysisincluded 30 amino acid sequences, with a total of 323 positions in the final data set. LpdA was used asthe outgroup because it is considered to be ancestral to GR in the FAD-dependent pyridine nucleotide-disulfide oxidoreductase family (58, 59).

Statistical analysis. One-way analysis of variance (ANOVA) followed by Tukey test analysis wasperformed for multiple-group comparisons. For two-group comparisons, the t test was run.

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.01931-17.

SUPPLEMENTAL FILE 1, PDF file, 1.7 MB.

ACKNOWLEDGMENTSWe thank P. C. Kahn at Rutgers University for providing access to and guidance

in the use of the spectrophotometer used to measure MerA activity. We appreciate theconstructive comments of three anonymous reviewers that helped to improve themanuscript.

This research was supported by National Science Foundation award PLR-1304773and by a Hatch/McIntyre-Stennis grant through the New Jersey Agricultural ExperimentStation (to T. Barkay). J. Norambuena was funded by a BECAS Chile doctoral fellowship.

REFERENCES1. Jan AT, Ali A, Haq Q. 2011. Glutathione as an antioxidant in inorganic

mercury induced nephrotoxicity. J Postgrad Med 57:72–77. https://doi.org/10.4103/0022-3859.74298.

2. Valko M, Morris H, Cronin MTD. 2005. Metals, toxicity and oxidative stress.Curr Med Chem 12:1161–1208. https://doi.org/10.2174/0929867053764635.

3. Oram PD, Fang X, Fernando Q, Letkeman P, Letkeman D. 1996. The forma-tion of constants of mercury�II-glutathione complexes. Chem Res Toxicol9:709 –712. https://doi.org/10.1021/tx9501896.

4. Helbig K, Bleuel C, Krauss GJ, Nies DH. 2008. Glutathione and transition-metal homeostasis in Escherichia coli. J Bacteriol 190:5431–5438. https://doi.org/10.1128/JB.00271-08.

5. LaVoie SP, Mapolelo DT, Cowart DM, Polacco BJ, Johnson MK, Scott RA,Miller SM, Summers AO. 2015. Organic and inorganic mercurials have

distinct effects on cellular thiols, metal homeostasis, and Fe-bindingproteins in Escherichia coli. J Biol Inorg Chem 20:1239 –1251. https://doi.org/10.1007/s00775-015-1303-1.

6. Wang Y, Robison T, Wiatrowski H. 2013. The impact of ionic mercury onantioxidant defenses in two mercury-sensitive anaerobic bacteria. Bio-metals 26:1023–1031. https://doi.org/10.1007/s10534-013-9679-2.

7. Carvalho CM, Chew EH, Hashemy SI, Lu J, Holmgren A. 2008. Inhibitionof the human thioredoxin system. A molecular mechanism of mer-cury toxicity. J Biol Chem 283:11913–11923. https://doi.org/10.1074/jbc.M710133200.

8. Quastel JH, Stewart CP, Tunnicliffe HE. 1923. On glutathione. IV. Consti-tution. Biochem J 17:586 –592.

9. Gaballa A, Newton GL, Antelmann H, Parsonage D, Upton H, Rawat M,

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 15

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Claiborne A, Fahey RC, Helmann JD. 2010. Biosynthesis and functions ofbacillithiol, a major low-molecular-weight thiol in bacilli. Proc Natl AcadSci U S A 107:6482– 6486. https://doi.org/10.1073/pnas.1000928107.

10. Ritz D, Beckwith J. 2001. Roles of thiol-redox pathways in bacteria. AnnuRev Microbiol 55:21– 48. https://doi.org/10.1146/annurev.micro.55.1.21.

11. Fahey RC. 2013. Glutathione analogs in prokaryotes. Biochim BiophysActa 1830:3182–3198. https://doi.org/10.1016/j.bbagen.2012.10.006.

12. Lu J, Holmgren A. 2014. The thioredoxin antioxidant system. Free RadicBiol Med 66:75– 87. https://doi.org/10.1016/j.freeradbiomed.2013.07.036.

13. Barkay T, Miller SM, Summers AO. 2003. Bacterial mercury resistancefrom atoms to ecosystems. FEMS Microbiol Rev 27:355–384. https://doi.org/10.1016/S0168-6445(03)00046-9.

14. Boyd ES, Barkay T. 2012. The mercury resistance operon: from an originin a geothermal environment to an efficient detoxification machine.Front Microbiol 3:349. https://doi.org/10.3389/fmicb.2012.00349.

15. Schelert J, Drozda M, Dixit V, Dillman A, Blum P. 2006. Regulation ofmercury resistance in the crenarchaeote Sulfolobus solfataricus. J Bacte-riol 188:7141–7150. https://doi.org/10.1128/JB.00558-06.

16. Freedman Z, Zhu C, Barkay T. 2012. Mercury resistance and mercuricreductase activities and expression among chemotrophic thermophilicAquificae. Appl Environ Microbiol 78:6568 – 6575. https://doi.org/10.1128/AEM.01060-12.

17. Wang Y, Freedman Z, Lu-Irving P, Kaletsky R, Barkay T. 2009. An initialcharacterization of the mercury resistance (mer) system of the thermo-philic bacterium Thermus thermophilus HB27. FEMS Microbiol Ecol 67:118 –129. https://doi.org/10.1111/j.1574-6941.2008.00603.x.

18. Barkay T, Kritee K, Boyd E, Geesey G. 2010. A thermophilic bacterialorigin and subsequent constraints by redox, light and salinity on theevolution of the microbial mercuric reductase. Environ Microbiol 12:2904 –2917. https://doi.org/10.1111/j.1462-2920.2010.02260.x.

19. Iwama T, Hosokawa H, Lin W, Shimizu H, Kawai K, Yamagata S. 2004.Comparative characterization of the oah2 gene homologous to the oah1of Thermus thermophilus HB8. Biosci Biotechnol Biochem 68:1357–1361.https://doi.org/10.1271/bbb.68.1357.

20. Kosuge T, Gao D, Hoshino T. 2000. Analysis of the methionine biosyn-thetic pathway in the extremely thermophilic eubacterium Thermusthermophilus. J Biosci Bioeng 90:271–279. https://doi.org/10.1016/S1389-1723(00)80081-X.

21. Shimizu H, Yamagata S, Masui R, Inoue Y, Shibata T, Yokoyama S,Kuramitsu S, Iwama T. 2001. Cloning and overexpression of the oah1gene encoding O-acetyl-L-homoserine sulfhydrylase of Thermus thermo-philus HB8 and characterization of the gene product. Biochim BiophysActa 1549:61–72. https://doi.org/10.1016/S0167-4838(01)00245-X.

22. Newton GL, Rawat M, La Clair JJ, Jothivasan VK, Budiarto T, Hamilton CJ,Claiborne A, Helmann JD, Fahey RC. 2009. Bacillithiol is an antioxidantthiol produced in bacilli. Nat Chem Biol 5:625– 627. https://doi.org/10.1038/nchembio.189.

23. Kobayashi S-I, Masui R, Yokoyama S, Kuramitsu S, Takagi H. 2004. A novelmetal-activated L-serine O-acetyltransferase from Thermus thermophilusHB8. J Biochem 136:629 – 634. https://doi.org/10.1093/jb/mvh170.

24. Mizuno Y, Miyashita Y, Yamagata S, Iwama T, Akamatsu T. 2002. Cysteinesynthase of an extremely thermophilic bacterium, Thermus thermophi-lus HB8. Biosci Biotechnol Biochem 66:549 –557. https://doi.org/10.1271/bbb.66.549.

25. Cusick KD, Fitzgerald LA, Cockrell AL, Biffinger JC. 2015. Selection andevaluation of reference genes for reverse transcription-quantitative PCRexpression studies in a thermophilic bacterium grown under differentculture conditions. PLoS One 10:e0131015. https://doi.org/10.1371/journal.pone.0131015.

26. Cappello T, Brandão F, Guilherme S, Santos MA, Maisano M, Mauceri A,Canário J, Pacheco M, Pereira P. 2016. Insights into the mechanismsunderlying mercury-induced oxidative stress in gills of wild fish (Lizaaurata) combining (1)H NMR metabolomics and conventional biochem-ical assays. Sci Total Environ 548 –549:13–24. https://doi.org/10.1016/j.scitotenv.2016.01.008.

27. Rodríguez-Rojas F, Díaz-Vásquez W, Undabarrena A, Muñoz-Díaz P, Are-nas F, Vásquez C. 2016. Mercury-mediated cross-resistance to tellurite inPseudomonas spp. isolated from the Chilean Antarctic territory. Metal-lomics 8:108 –117. https://doi.org/10.1039/C5MT00256G.

28. Onnis-Hayden A, Weng H, He M, Hansen S, Ilyin V, Lewis K, Gu AZ. 2009.Prokaryotic real-time gene expression profiling for toxicity assessment.Environ Sci Technol 43:4574 – 4581. https://doi.org/10.1021/es803227z.

29. Babai R, Ron EZ. 1998. An Escherichia coli gene responsive to heavy

metals. FEMS Microbiol Lett 167:107–111. https://doi.org/10.1111/j.1574-6968.1998.tb13215.x.

30. Hoseki J, Yano T, Koyama Y, Kuramitsu S, Kagamiyama H. 1999. Directedevolution of thermostable kanamycin-resistance gene: a convenient selec-tion marker for Thermus thermophilus. J Biochem 126:951–956. https://doi.org/10.1093/oxfordjournals.jbchem.a022539.

31. Henley RW. 1996. Chemical and physical context for life in terrestrialhydrothermal systems: chemical reactors for the early development oflife and hydrothermal ecosystems. Ciba Found Symp 202:61–76.

32. Geesey GG, Barkay T, King S. 2016. Microbes in mercury-enriched geo-thermal springs in western North America. Sci Total Environ 569 –570:321–331. https://doi.org/10.1016/j.scitotenv.2016.06.080.

33. Wang X, Zhou X, Zhao J, Zheng Y, Song C, Long M, Chen T. 2015.Hydrochemical evolution and reaction simulation of travertine deposi-tion of the Lianchangping hot springs in Yunnan, China. Quat Int 74:62.https://doi.org/10.1016/j.quaint.2014.09.046.

34. Farrell RE, Germida JJ, Huang PM. 1993. Effects of chemical speciation ingrowth media on the toxicity of mercury(II). Appl Environ Microbiol59:1507–1514.

35. Rethmeier J, Fischer U, Rabenstein A, Langer M. 1997. Detection of tracesof oxidized and reduced sulfur compounds in small samples by combi-nation of different high-performance liquid chromatography methods.J Chromatogr A 760:295–302. https://doi.org/10.1016/S0021-9673(96)00809-6.

36. Rao B, Simpson C, Lin H, Liang L, Gu B. 2014. Determination of thiolfunctional groups on bacteria and natural organic matter in environ-mental systems. Talanta 119:240 –247. https://doi.org/10.1016/j.talanta.2013.11.004.

37. Grant CM. 2001. Role of the glutathione/glutaredoxin and thioredoxinsystems in yeast growth and response to stress conditions. Mol Micro-biol 39:533–541. https://doi.org/10.1046/j.1365-2958.2001.02283.x.

38. Hondorp ER, Matthews RG. 2004. Oxidative stress inactivates cobalamin-independent methionine synthase (MetE) in Escherichia coli. PLoS Biol2:e336. https://doi.org/10.1371/journal.pbio.0020336.

39. Lemire JA, Harrison JJ, Turner RJ. 2013. Antimicrobial activity of metals:mechanisms, molecular targets and applications. Nat Rev Microbiol11:371–384. https://doi.org/10.1038/nrmicro3028.

40. Latinwo LM, Donald C, Ikediobi C, Silver S. 1998. Effects of intracellularglutathione on sensitivity of Escherichia coli to mercury and arsenite.Biochem Biophys Res Commun 242:67–70. https://doi.org/10.1006/bbrc.1997.7911.

41. Ledwidge R, Patel B, Dong A, Fiedler D, Falkowski M, Zelikova J, Sum-mers AO, Pai EF, Miller SM. 2005. NmerA, the metal binding domain ofmercuric ion reductase, removes Hg2 from proteins, delivers it to thecatalytic core, and protects cells under glutathione-depleted conditions.Biochemistry 44:11402–11416. https://doi.org/10.1021/bi050519d.

42. Branco V, Godinho-Santos A, Gonçalves J, Lu J, Holmgren A, Carvalho C.2014. Mitochondrial thioredoxin reductase inhibition, selenium status,and Nrf-2 activation are determinant factors modulating the toxicity ofmercury compounds. Free Radic Biol Med 73:95–105. https://doi.org/10.1016/j.freeradbiomed.2014.04.030.

43. Fanous A, Weiss W, Görg A, Jacob F, Parlar H. 2008. A proteome analysisof the cadmium and mercury response in Corynebacterium glutamicum.Proteomics 8:4976 – 4986. https://doi.org/10.1002/pmic.200800165.

44. Ma Z, Chandrangsu P, Helmann TC, Romsang A, Gaballa A, Helmann JD.2014. Bacillithiol is a major buffer of the labile zinc pool in Bacillussubtilis. Mol Microbiol 94:756 –770. https://doi.org/10.1111/mmi.12794.

45. Rosario-Cruz Z, Boyd JM. 2016. Physiological roles of bacillithiol inintracellular metal processing. Curr Genet 62:59 – 65. https://doi.org/10.1007/s00294-015-0511-0.

46. Rasmussen LD, Zawadsky C, Binnerup SJ, Oregaard G, Sørensen SJ, KroerN. 2008. Cultivation of hard-to-culture subsurface mercury-resistant bac-teria and discovery of new merA gene sequences. Appl Environ Micro-biol 74:3795–3803. https://doi.org/10.1128/AEM.00049-08.

47. Møller AK, Barkay T, Al-Soud WA, Sørensen SJ, Skov H, Kroer N. 2011.Diversity and characterization of mercury-resistant bacteria in snow,freshwater and sea-ice brine from the High Arctic. FEMS Microbiol Ecol75:390 – 401. https://doi.org/10.1111/j.1574-6941.2010.01016.x.

48. Oregaard G, Sørensen SJ. 2007. High diversity of bacterial mercuricreductase genes from surface and sub-surface floodplain soil (Oak Ridge,USA). ISME J 1:453– 467. https://doi.org/10.1038/ismej.2007.56.

49. Tanaka T, Kawano N, Oshima T. 1981. Cloning of 3-isopropylmalatedehydrogenase gene of an extreme thermophile and partial purification

Norambuena et al. Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 16

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

of the gene product. J Biochem 89:677– 682. https://doi.org/10.1093/oxfordjournals.jbchem.a133245.

50. Lau PC, Sung CK, Lee JH, Morrison DA, Cvitkovitch DG. 2002. PCR ligationmutagenesis in transformable streptococci: application and efficiency. JMicrobiol Methods 49:193–205. https://doi.org/10.1016/S0167-7012(01)00369-4.

51. Koyama Y, Furukawa K, Hoshino T, Tomizuka N, Furukawa K. 1986.Genetic transformation of the extreme thermophile Thermus thermophi-lus and of other Thermus spp. J Bacteriol 166:338 –340. https://doi.org/10.1128/jb.166.1.338-340.1986.

52. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2�ΔΔCT method. Methods 25:402. https://doi.org/10.1006/meth.2001.1262.

53. Vetriani C, Chew YS, Miller SM, Yagi J, Coombs J, Lutz RA, Barkay T. 2005.Mercury adaptation among bacteria from a deep-sea hydrothermal vent.Appl Environ Microbiol 71:220 –226. https://doi.org/10.1128/AEM.71.1.220-226.2005.

54. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, Mc-William H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, GibsonTJ, Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics23:2947–2948. https://doi.org/10.1093/bioinformatics/btm404.

55. Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. 1998.Multiple sequence alignment with Clustal X. Trends Biochem Sci 23:403– 405. https://doi.org/10.1016/S0968-0004(98)01285-7.

56. Jones DT, Taylor WR, Thornton JM. 1992. The rapid generation of mutationdata matrices from protein sequences. Comput Appl Biosci 8:275–282.

57. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular EvolutionaryGenetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870 –1874. https://doi.org/10.1093/molbev/msw054.

58. Fahey RC, Sundquist AR. 1991. Evolution of glutathione metabolism. AdvEnzymol Relat Areas Mol Biol 64:1–53.

59. Gleason FK, Holmgren A. 1988. Thioredoxin and related proteins inprocaryotes. FEMS Microbiol Rev 4:271–297. https://doi.org/10.1111/j.1574-6968.1988.tb02747.x.

Thiol Systems Increase Hg Resistance in T. thermophilus Applied and Environmental Microbiology

January 2018 Volume 84 Issue 2 e01931-17 aem.asm.org 17

on Decem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from