POKEWEED ANTIVIRAL PROTEIN-MEDIATED RESISTANCE TO CITRUS

PATHOGENS

By

YOLANDA PETERSEN

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2003

Copyright 2003

by

Yolanda Petersen

To my parents

ACKNOWLEDGMENTS

The completion of this dissertation would not have been possible without the help

and support of many people. First, I would like to express my sincere gratitude and

appreciation to my advisor Dr. Richard F. Lee for his support and encouragement, and for

having me in his lab. I would like to thank Dr. G. Moore, Dr. D. Pring and Dr. G. Wisler

for serving on my committee and reviewing this manuscript.

I would like to thank Dr. G. Moore and the members of her lab for always

answering my questions; and for their help in facilitating my research. Some people who

deserve special mention are Dr. K.L. Manjunath, Dr. V.J. Febres, A. Guerra, Dr. K.

Biswas. Their help and understanding during two lab relocations is much appreciated. I

want to thank Professor W.O. Dawson and the people in his lab for providing me with the

CTV infectious clone and for assisting me with my CTV replication experiment, which I

conducted in their laboratory. I thank E. Crawford and E. Philmon for taking care of my

plants in the greenhouse and growth rooms, in Gainesville. Without them, a lot more

plants would have died. I also want to thank Neil for helping me graft and inoculate my

transgenic citrus plants as well as for taking care of these plants in Lake Alfred. I would

like to thank the ladies in the main office for their patience and taking care of the

numerous problems that arose.

I want to thank all the wonderful friends I made in Gainesville as well as friends in

Germany, Colorado, New Zealand, and South Africa who were always ready to lend an

ear and give me their unconditional support.

iv

My most sincere thanks and appreciation go to my parents and family, for their

understanding and support, and for always believing in me.

v

TABLE OF CONTENTS Page ACKNOWLEDGMENTS ................................................................................................. iv

LIST OF TABLES............................................................................................................. ix

LIST OF FIGURES .............................................................................................................x

ABSTRACT...................................................................................................................... xii

CHAPTER 1 LITERATURE REVIEW .............................................................................................1

Introduction...................................................................................................................1 Citrus exocortis viroid (CEVd).....................................................................................1

Movement of Viroids ............................................................................................2 Replication of Viroids ...........................................................................................3

Citrus tristeza virus (CTV)...........................................................................................4 Classification and Genome Organisation of CTV.................................................5 Replication and Expression Strategy of CTV .......................................................7 Control of CTV......................................................................................................8 Genetic Engineering for Virus/Viroid Resistance...............................................10 Ribosome-Inactivating Proteins (RIPs) ...............................................................11 Enzymatic Activities of RIPs ..............................................................................12 Antiviral Activity of RIPs ...................................................................................13 RIPs in Transgenic Plants....................................................................................14

2 In vitro TRANSLATION OF A Citrus tristeza virus REPLICON AND THE

EFFECT OF POKEWEED ANTIVIRAL PROTEIN ON ITS TRANSLATION .....16

Introduction.................................................................................................................16 Materials and Methods ...............................................................................................19

Source of Viral Nucleic Acid ..............................................................................19 In vitro Transcription and Translation of CTV-∆Cla..........................................19 In vitro Antiviral Assay .......................................................................................20

Results.........................................................................................................................21 In vitro Translation of CTV-∆Cla .......................................................................21 PAP Inhibits Translation of CTV-∆Cla Transcripts............................................23

Discussion...................................................................................................................24

vi

3 TRANSFORMATION OF Citrus paradisi cv Duncan GRAPEFRUIT WITH POKEWEED ANTIVIRAL PROTEIN......................................................................27

Introduction.................................................................................................................27 Materials and Methods ...............................................................................................32

PAP Gene Constructs and Plasmid Expression Vectors .....................................32 Citrus Transformation and Regeneration ............................................................33

Seed germination..........................................................................................35 Transformation of epicotyl segments ...........................................................35 Selection and regeneration of plantlets ........................................................35

Analysis of Transgenic Plants .............................................................................37 Fluorescent microscopy................................................................................37 Polymerase chain reaction (PCR) analysis...................................................37

Southern hybridization ........................................................................................38 Reverse-transcription (RT) PCR .........................................................................39 Western blot analysis...........................................................................................39 Grafting and Challenge of Transgenic Plants with CTV.....................................40 Challenge of Transgenic Plants with Citrus exocortis viroid (CEVd) ................40

Results.........................................................................................................................42 Transformation and Regeneration .......................................................................42 Southern Blot Analysis and RT-PCR of Transgenic Plants ................................46 Protein Expression Analysis................................................................................48 Virus Challenge of Transgenic Plants .................................................................49 Viroid Challenge of Transgenic Plants................................................................51

Discussion...................................................................................................................51 4 THE EFFECT OF POKEWEED ANTIVIRAL PROTEIN ON THE

REPLICATION OF Citrus tristeza virus IN Nicotiana benthamiana PROTOPLASTS.........................................................................................................57

Introduction.................................................................................................................57 Materials and Methods ...............................................................................................59

Constructs ............................................................................................................59 Tobacco Transformation .....................................................................................59

Explant preparation ......................................................................................59 Transformation and regeneration of tobacco................................................60

Analysis of Transgenic Plants by PCR................................................................60 Southern Hybridization .......................................................................................61 Reverse-Transcription (RT) PCR ........................................................................61 Analysis of Protein Expression ...........................................................................62 Determination of Antiviral Properties of Transgenic Plants ...............................63 Viral Replication in Transgenic Protoplasts........................................................63

Results.........................................................................................................................64 Transformation and Regeneration .......................................................................64 Molecular Analysis of Transgenic Plants............................................................65 CTV Replication in PAPn-Transgenic N. benthamiana Protoplasts...................69

Discussion...................................................................................................................70

vii

5 SUMMARY AND CONCLUSIONS.........................................................................73

LIST OF REFERENCES...................................................................................................78

BIOGRAPHICAL SKETCH .............................................................................................90

viii

LIST OF TABLES

Table page 3-1. Expected properties of PAP and PAP mutants. ..........................................................31

3-2. Sequences of oligonucleotide primers used for amplification and mutagenesis of the PAP gene ............................................................................................................33

3-3. Summary of results for the transformation of Citrus paradisi cv. Duncan grapefruit with pokeweed protein (PAP) antiviral constructs. .................................45

3-4. CTV antigen levels four months post-inoculation.in transgenic Citrus paradisi plants expressing PAPn............................................................................................51

4-1. Summary of N. benthamiana transformation experiments with the PAP constructs..................................................................................................................65

4-2. TMV antigen levels in transgenic N. benthamiana expressing PAPn following infection with the virus.............................................................................................68

ix

LIST OF FIGURES

Figure page 1-1. Symptoms caused by Citrus tristeza virus ...................................................................6

2-1. Schematic representation of the Citrus tristeza virus (CTV) genome........................17

2-2. Optimization of CTV-∆Cla replicon translation in wheat germ extract.....................22

2-3. Optimization of CTV-∆Cla translation in rabbit reticulocyte lysate..........................23

2-4. Effect of wild type PAP on translation.......................................................................24

3-1. Cloning strategy of the PAP constructs for plant transformation...............................34

3-2. Agrobacterium-mediated transformation of etiolated Citrus paradisi cv. Duncan grapefruit and regeneration of plants .......................................................................36

3-3. Analysis of GFP expression in citrus shoots regenerated from epicotyl segments transformed with pCambia2202-PAPc and -PAPn ..................................................43

3-4. PCR analysis of potentially transgenic shoots containing the PAPn transgene ......44

3-5. Phenotypes of plants transformed with the PAPc and PAPv constructs ....................47

3-6. Southern analysis to determine transgene copy number in transgenic grapefruit plants transformed with PAPn..................................................................................48

3-7. RT-PCR analysis of transgenic citrus transformed with PAPn to determine gene expression at the level of transcription.....................................................................49

3-8. Western blot analysis of total soluble proteins from transgenic citrus to determine the expression the PAPn transgene ..........................................................................49

3-9. RT-PCR analysis of representative viroid-infected PAPn-transgenic plants. ............52

4-1. PCR analysis of selected potential transgenic N. benthamiana plants using primers CN444 and CN445 ...................................................................................................65

4-2. Southern analysis of R0 tobacco plants transformed with PAPn. ..............................66

x

4-3. RT-PCR analysis of RNA isolated from selected transgenic plants to determine PAPn expression at the transcriptional level............................................................67

4-4. Northern blot analysis of CTV RNAs in N. benthamiana protoplasts derived from PAPn transgenic R1 plants .......................................................................................69

xi

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

POKEWEED ANTIVIRAL PROTEIN-MEDIATED RESISTANCE TO CITRUS PATHOGENS

By

Yolanda Petersen

December 2003

Chair: Richard F. Lee Major Department: Plant Pathology

Citrus production is adversely affected by a number of diseases caused by viruses

and viroids. This project has employed a ribosome-inactivating protein, pokeweed

antiviral protein (PAP) isolated from Phytolacca americana in an effort to control Citrus

tristeza virus (CTV) and citrus exocortis viroid (CEVd). PAP has antiviral activity and

can act directly on RNA. The applicability of PAP to inhibit CTV translation was

evaluated in vitro. In vitro transcription and translation assays using the CTV replicon,

CTV-∆Cla, and wild type PAP showed that viral translation decreased in the presence of

increasing concentrations of PAP. In vivo experiments required the production of non-

toxic N-terminal (Gly75-Ala), active site (Glu176-Ala) and C-terminal deletion mutants

(Trp237-Stop), which were then used to transform Citrus paradisi cv. Duncan by

Agrobacterium-mediated transformation. The overall transformation efficiency was low,

at 8.6% as determined by the percentage of regenerated plantlets that were PCR-positive

for the PAP transgene. Six surviving transgenic plants containing the N-terminal mutant

xii

were obtained and evaluated by virus/viroid challenge. Molecular characterization of

these plants showed that the plants contain one to four copies of the mutated PAP gene

and that the gene was being expressed at the transcriptional and translational levels. The

transgenic citrus plants were challenged with CTV and CEVd by graft-challenge

inoculation. Four months post-inoculation the transgenic plants had significantly lower

levels of CTV, in comparison to the non-transgenic control plants. All plants supported

viroid replication at levels equivalent to that of the non-transgenic controls. To obtain a

more accurate view of the effect of the N-terminal mutant on CTV replication, Nicotiana

benthamiana was transformed with the mutated PAP gene used for citrus transformation.

Five lines of transformed N. benthamiana were selected for protoplast experiments in

which CTV virions were used as inoculum for transfection. Results showed that the lines

TN5, TN11 and TN23a supported lower levels of CTV replication relative to the non-

transgenic control. Thus, the PAPn mutant does not inhibit CEVd replication; and this

mutant reduces, but does not completely inhibit the replication of CTV in citrus plants

and tobacco protoplasts.

xiii

CHAPTER 1 LITERATURE REVIEW

Introduction

Diseases caused by viruses and viroids have had major impacts on citrus

production. Citrus tristeza virus (CTV) alone has caused the loss of millions of trees

worldwide. The propagation of viroid-infected trees has caused economic losses in the

Florida citrus industry and is a major threat in regions where susceptible rootstocks are

used. Once trees are infected, the disease agents cannot be eliminated. This is of

particular economic importance, since citrus trees should have a long productive life.

Thus the best control measures would be to prevent the introduction of the disease or

propagate plants that are disease resistant.

Citrus exocortis viroid (CEVd)

Viroids are small unencapsidated circular, highly base-paired RNAs which adopt

rod-like structures in their native state (reviewed by Hull, 2001). Viroid RNAs do not

encode any proteins. Citrus viroids are grouped into six classes: Citrus exocortis viroid

(CEVd, 370-375 nucleotides (nt)), Citrus bent leaf viroid (CBLVd, 315-329 nt; formerly

called CVd-I), Hop stunt viroid (HSVd, 295-303 nt; formerly called CVd-II), Citrus

viroid III (CVd-III, 291-297 nt), Citrus viroid IV (CVd-IV, 284-286 nt) and Citrus viroid

OS (CVd-OS, 329-331 nt) (Duran-Vila et al., 2000; Ito et al., 2000, 2002). CEVd is

usually found in combination with other viroids; and in the field causes mild to severe

stunting and bark scaling on susceptible rootstocks. The disease is exacerbated on citrus

trees propagated on rootstock derived from Poncirus trifoliata or hybrids that have P.

1

2

trifoliata as one of their parents. These rootstocks are used in many citrus-growing

regions. The severe stunting results in a reduced canopy with an adverse effect on fruit

yield. Less severe symptoms occur on Citrus sinensis X P. trifoliata (citrange) and Citrus

limonia (Rangpur lime) and only mild symptoms are usually seen on Swingle citrumelo

(Lee et al., 2003). CEVd and viroids in general are spread primarily via infected

budwood and through the use of contaminated cutting tools and equipment. Thus these

agents are relatively easily controlled through budwood certification programs and good

hygienic practices. CEVd can be detected by biological indexing on the indicator host

Citrus medica cv. etrog (Etrog citron), a process that takes 3 to 6 months or via more

rapid molecular methods such as analysis by sequential polyacrylamide gel

electrophoresis and the reverse transcriptase-polymerase chain reaction.

Movement of Viroids

From experiments involving fractionating components of viroid-infected cells,

confocal laser scanning microscopy, transmission electron microscopy, and in situ

hybridisation, it became evident that most viroids are located in the cell nucleus; with the

exception of Avocado sunblotch viroid (ASBVd), which is found in the chloroplasts

(reviewed by Hull, 2001). CEVd accumulates in the nucleoplasm (Bonfiglioli et al.

1996). Systemic movement of viroids that replicate in the nucleus follows four distinct

steps: (1) import into the nucleus via the nuclear pores (2) export out of the nucleus (3)

cell-to-cell movement and (4) long-distance movement.

Experiments with potato spindle tuber viroid (PSTVd) led to the conclusion that

viroids move rapidly from cell to cell via the plasmodesmata; and that the movement is

mediated by a specific sequence or structural motif (Ding et al., 1997). The spread of

PSTVd in tomato and Nicotiana benthamiana followed the pattern of photoassimilate

3

transport, suggesting that PSTVd moves long distance through the phloem. (Palukaitis et

al., 1987; Zhu et al., 2001). Maniataki et al. (2003) and Owens et al. (2001) showed that

PSTVd interacts with host cell proteins and suggested that these proteins might facilitate

systemic movement of the viroid. Maniataki et al. (2003) also showed that the region

interacting with the host cell protein consisted of eight nucleotides in the TR (terminal

right) region of the viroid RNA. The TR region has a bulged hairpin secondary structure

reminiscent of micro-RNA precursors, and it is thought that the micro-RNA precursors

are capable of systemic movement.

Replication of Viroids

Despite their small size, the elucidation of viroid replication is remarkably

complex. Viroid-infected tissue contains a variety of multimeric RNAs, and replication is

thought to proceed via a ‘‘rolling circle’’ mechanism. There are two models for rolling

circle replication: (1) the symmetric pathway in which both circular forms of the (+) and

(-) strands serve as templates for the synthesis of complementary multimers that are

cleaved into monomers and ligated to form circular molecules, and (2) the asymmetric

pathway in which the circular (+) strand serves as a template for synthesis of multimeric

linear (-) strands, which in turn serve as templates for the synthesis of multimeric (+)

strands that are cleaved and ligated to produce the final circular forms. CEVd and other

viroids in the family Pospiviroidae replicate via the asymmetric pathway (reviewed by

Hull, 2001).

Replication does not require a helper virus; and the viroid RNA does not encode

any proteins necessary for replication. This suggests that the information necessary for

replication resides in the unusual secondary structure of the viroid genome. Localization

of CEVd in the nucleus suggests that a host nuclear RNA polymerase may be involved

4

(Bonfiglioli et al., 1996). The fact that viroid RNA synthesis is inhibited by α-amanitin

indicates that a host-encoded RNA polymerase II may be required for replication

(reviewed by Hull, 2001). Warrilow and Symons (1999) obtained direct evidence for the

association of CEVd with a host-encoded RNA polymerase II.

Citrus tristeza virus (CTV)

Citrus tristeza virus is one of the most important pathogens of citrus. CTV is

endemic to most citrus-growing regions and in the past has resulted in devastating

economic losses due to decline of sweet orange scions on sour orange rootstock (Bar-

Joseph et al., 1989). Hence, the name “tristeza” which in Spanish means “sadness”.

CTV causes a number of different symptoms depending on the virus strain and the

host/rootstock combination. Decline strains result in decline and death of citrus species

on sour orange rootstock as a result of phloem necrosis at the graft union which prevents

the movement of nutrients from the canopy to the root system (Figure 1-1 A; Garnsey et

al., 1987). Other strains express stem pitting symptoms on either sweet orange and/or

grapefruit scions irrespective of the rootstock. Stem pitting reduces tree vigor, fruit yield

and quality (Figure 1-1 B and C). Vein corking (Figure 1-1 D) is induced by some strains,

and a syndrome called seedling yellows, which is expressed as stunting and chlorosis of

grapefruit, lemon and other susceptible varieties.

The virus is spread by aphid vectors including Toxoptera citricida (brown citrus

aphid), T. aurantii, Aphis gossypii, and A. spiraecola, and by propagation of infected

tissue (Bar-Joseph et al., 1989; Roistacher and Bar-Joseph, 1987). T. citricida is the most

efficient vector of CTV; and its introduction into Brazil and Argentina in the 1930s

caused the death of 16 million trees on sour orange rootstock as a result of the efficient

5

transmission of decline strains of CTV (Carver, 1978). The brown citrus aphid was first

reported in Florida in 1995 (Halbert and Evans, 1996). This vector has been shown to

transmit CTV strains that cannot be transmitted by other vectors (Roberts et al., 2001).

Thus the presence of the brown citrus aphid may cause a shift in the major viral

populations in the state and result in the appearance of CTV strains causing more severe

symptoms than in the past.

Classification and Genome Organisation of CTV

Citrus tristeza virus belongs to the family Closteroviridae within the order

Nidovirales. The virus structure is a long flexuous rod 2000 x 11 nm in size. The viral

genome consists of a single-stranded, positive-sense RNA and at approximately 19 kb,

this genome is one of the largest known for plant viruses (Karasev et al., 1995). The RNA

is encapsidated by two coat proteins. Ninety-five percent of the genome is encapsidated

by the major coat protein (p25); the remaining 5% is protected by the divergent minor

coat protein (p27), which gives the virus a characteristic “rattlesnake” appearance (Febres

et al., 1996).

The CTV genome has 12 open reading frames with the potential to code for 17

proteins (Karasev et al., 1995; Pappu et al., 1994). Some of the genes have been assigned

functions based on sequence homology to other viral genomes. The arrangement and

expression strategy of the replicase region of CTV (Karasev et al., 1995) resembles that

of the animal Coronaviruses (Lai et al., 1990). ORF1a is expressed as a 349 kDa

polyprotein and encodes two papain-like proteases, a methyltransferase-like and a

helicase-like domain. ORF1b encodes a RNA-dependent RNA polymerase (RdRp). The

protein encoded by the p20 gene is involved in the accumulation of amorphous inclusion

bodies in the phloem (Gowda et al., 2000).

6

The p65 and p61 proteins share homology with the cellular heat shock protein

HSP70 and the cellular chaperone HSP90, respectively (Pappu et al., 1994). There is

evidence that these proteins are required for efficient virus assembly (Satyanarayana et

al., 2000). The gene product of p23 was shown to be an RNA-binding protein involved in

the asymmetric accumulation of RNA (Lopez et al., 2000; Satyanarayana et al., 2002b).

The functions of other genes remain to be elucidated. The ten 3' genes are expressed via

3' co-terminal subgenomic RNAs (Karasev et al., 1997).

Figure 1-1. Symptoms caused by Citrus tristeza virus. A) Decline of sweet orange on

sour orange rootstock (R. F Lee). B) Stem pitting on Pera sweet orange (R. F. Lee). C) Reduced fruit quality of a Marsh grapefruit tree infected by severe stempitting isolates, grafted onto rough lemon rootstock (R. F. Lee). D) Vein corking on leaves of a Mexican lime seedling inoculated with a severe seedling yellows isolate (C. N. Roistacher). Photographs were downloaded from http://www.ecoport.org. The names of the authors are given in parentheses.

7

Replication and Expression Strategy of CTV

The small genome size of viruses has led to the evolution of a number of different

expression strategies that maximize the number of products encoded by the genome. The

genome organization of CTV has similarities with both the animal Coronaviruses and the

alpha-supergroup of viruses. The amino acid sequence of the replicase-associated

domains and the lack of a common 5' leader sequence in the subgenomic RNAs are

similar to the alphavirus supergroup (Dolja et al., 1994). Like the Coronaviruses, the

replicase-associated proteins of CTV are expressed as a polyprotein, which is then

proteolytically processed into equimolar amounts of nonstructural proteins. The

proteolytic activity of the two proteases has been demonstrated in vitro (Vazquez-Ortiz,

2001). The RdRp is expressed via a +1 frameshift that occurs at a frequency of 1-5%

(Cevik, 2001). The 3' ORFs are expressed via positive and negative sense 3' co-terminal

subgenomic RNAs (Karasev et al., 1995), which are temporally and quantitatively

regulated (Navas-Castillo et al., 1997).

The phloem-limited nature of the virus, low concentrations in trees, and large

complex genome has hindered progress towards understanding the replication strategy of

CTV. The development of a full-length cDNA clone and a smaller replicon, designated

CTV-∆Cla (Satyanarayana et al., 1999), has clarified the function of some of the

replication-associated genes such as p23, which is involved in the asymmetrical

accumulation of RNA (Satyanarayana et al., 2002b); and elucidated replication signals

present in the 3' UTR (Satyanarayana et al., 2002a). Also, Satyanarayana et al. (1999)

showed that p23, ORFs 1a and 1b and the 5' and 3' UTRs are sufficient to support viral

replication. Additionally, the infectious cDNA clones have proved useful in determining

8

the gene products required for virion assembly (Satyanarayana et al., 2000). CTV

produces a complex array of RNAs, including a genome-length negative-sense RNA

which acts as a template for further transcription; subgenomic RNAs, both single and

double-stranded (Hilf et al., 1995; Mawassi et al., 1995a); positive-sense low molecular

weight transcripts (LMTs) and large molecular weight transcripts (LaMTs) (Che et al.,

2001; Mawassi et al., 1995b). In total, more than 35 RNA species have been shown to be

produced during the replication of CTV.

Control of CTV

CTV has a complex population structure in its perennial hosts. In nature any one

tree is infected by a CTV population that is made up of a number of genetic variants,

some of which may exhibit great variation in sequence similarity (Ayllόn et al., 1999;

Brlansky et al., 2003; Hilf et al., 1999). One of these variants might predominate, but it is

not known whether the symptoms exhibited by the infected host are due to the

predominant strain or a result of an interaction among the different strains. The structure

of these populations is subject to change with time, since some CTV strains are more

efficiently transmitted by certain aphid species.

A number of strategies have been developed to control CTV. The strategies include

eradication programs to prevent the spread of the virus, quarantine and budwood

certification to prevent the introduction of CTV, the use of CTV-tolerant rootstocks, mild

strain cross protection, breeding for resistance, and genetic engineering (reviewed by

Ferguson and Garnsey, 1993). Mild strain cross protection is the phenomenon in which a

plant is deliberately infected with a mild strain of a virus which then serves to prevent or

delay subsequent infection or expression of more severe strains of that virus (Fulton,

1986). This strategy has been used in a number of countries including Australia, Brazil,

9

South Africa and Florida (Barkley et al., 1990; Costa and Muller, 1980; Lee and Rocha-

Peňa, 1987). However, this type of protection is not the same as resistance and will

eventually break down, resulting in the loss of groves due to the expression of severe

strains that may or may not have been present in the original isolate used to protect the

trees.

A few citrus relatives have been found to be immune to CTV; that is, they do not

support replication of the virus (Garnsey et al., 1987). However, only one species

(Poncirus trifoliata) is sexually compatible with commercial citrus species. Introgression

of the resistance found in P. trifoliata into commercial cultivars has not produced viable

scion varieties since genetic breeding introduced undesirable fruit characteristics along

with CTV-resistance (Ferguson and Garnsey, 1993). Resistance to CTV has been mapped

and shown to be controlled by a single dominant gene, Ctv (Gmitter et al., 1996; Yoshida

et al., 1996). The mechanism of action of this gene is currently unknown, since

protoplasts of resistant plants support viral replication (Albiach-Marti et al., 1999). The

progress that has been made toward mapping the location of Ctv (Deng et al., 1996, 2001;

Fang et al., 1998) makes cloning of the gene and using it to transform commercially

important citrus cultivars a reality. With the development of an efficient Agrobacterium-

mediated citrus transformation protocol (Luth and Moore, 1999), it is now possible to use

molecular methods to engineer resistance to CTV. Thus far an attempt at engineering

pathogen-derived resistance, using the coat protein gene of various CTV isolates as well

as other CTV genomic sequences, has been made (Dominguez et al., 2002; Febres et al.,

2003; Gutierrez, 1997).

10

Genetic Engineering for Virus/Viroid Resistance

Recent advances in plant transformation, the study of the molecular genetics of

both plants and their pathogens, and the elucidation of the interacting components of the

plants’ natural defense mechanisms have given rise to a number of different ways in

which to create virus- or viroid-resistant plants. Pathogen-derived resistance (PDR), a

concept pioneered by Sanford and Johnston (1985), makes use of the information derived

from viral genomes to generate specific host resistance. Since many virus genes involved

in the important functions of replication and encapsidation have been elucidated, PDR

can be achieved by interfering with these processes within host plants. One of the first

successful instances of PDR was achieved through the transformation of tobacco with the

coat protein (CP) gene of Tobacco mosaic virus (TMV) (Powell-Abel et al., 1986).

Successful CP-mediated resistance has since been achieved for a number of RNA viruses

including Potato virus X (PVX), Alfalfa mosaic virus, Cucumber mosaic virus (CMV),

Tobacco rattle virus, with Papaya ringspot virus being one of the most recent

commercial successes (Baulcombe 1996; reviewed in Wilson 1993; Ferreira et al., 2002).

Next to CP-mediated resistance, replicase-mediated resistance technology is the most

widely applied. Different forms (sense/antisense, translatable/nontranslatable) of the

replicase genes from diverse viruses have been used to transform plants and have

exhibited a wide range of host responses to viral infection. In certain virus-host systems,

the full-length sense construct of the replicase gene provides an adequate level of

resistance; while in others it is the antisense, mutated or truncated versions of the

replicase that provide a higher level of resistance (Brederode et al., 1995; Chen et al.,

2001; Huet et al., 1999; Vazquez Rovere et al., 2000; Wintermantel et al., 1997, 2000).

The antisense approach has also been tried for CEVd (Atkins et al., 1995). Instead of

11

complete resistance, the antisense construct, targeting the negative strand of CEVd,

resulted in only a moderate decrease in viroid RNA accumulation, while the construct

targeting the positive strand RNA had no effect.

Ribozymes, which are RNA molecules that have enzymatic activity and can cleave

RNA, have also been used to transform plants in an attempt to produce virus- or viroid-

resistant plants. Resistance to CEVd and PSTVd has previously been achieved (Atkins et

al., 1995; Yang et al., 1997). Varying degrees of resistance were seen in

ribozyme-expressing plants infected with TMV (de Feyter et al., 1996), CMV (Kwon et

al., 1997) and Rice dwarf virus (Han et al., 2001). Sano et al. (1997) and Ishida et al.

(2002) produced plants resistant to PSTVd and chrysanthemum stunt viroid by

expressing a double-stranded RNA-specific ribonuclease (pacI) from

Schizosaccharomyces pombe in transformed potato and chrysanthemums. Thus

transformation of plants with proteins or enzymes that act directly on RNA would

provide protection against virus or viroid infection.

Another approach to engineer resistance is to modify the expression or introduce

genes that activate, regulate or directly contribute to defense responses in plants. These

genes could be resistance (R) genes, general regulators of signal-transduction pathways

or genes that are activated further downstream and confer the actual resistance (for

example, PR genes) (reviewed by Campbell et al., 2002). Ribosome-inactivating proteins

are another group of plant defense-related genes that have been used to transform

heterologous species and shown to confer resistance to viruses.

Ribosome-Inactivating Proteins (RIPs)

Ribosome-inactivating proteins have been reported from over 50 plant species and

include both monocotyledonous and dicotyledonous plants (reviewed by Nielsen and

12

Boston, 2001). The only plant known to definitely not have RIP activity is Arabidopsis

thaliana. RIPs are a group of plant proteins that are toxic to ribosomes as a result of their

specific N-glycosidase depurination of the conserved α-sarcin loop of large rRNAs (Endo

et al., 1987). Depurination of the α-sarcin loop interferes with both the elongation factor

EF-Tu/EF-1-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of

EF-G/EF-2 to ribosomes, arresting protein synthesis at the translocation step and

ultimately resulting in cell death (Montanaro et al., 1975; Osborne and Hartley, 1990).

This translational inhibitory effect was seen as having potential in the medical field, for

use as selective cell-killing agents in anti-tumor therapy (Pastan and Fitzgerald, 1991;

Spooner and Lord, 1990).

RIPs can be divided into three classes based on their physical properties. Type 1

RIPs, such as pokeweed antiviral protein (PAP) from Phytolacca americana and

trichosanthin from Trichosanthes kirilowii, consist of a single polypeptide chain. Type 2

RIPs, such as ricin (from Ricinus communis) have a type 1-like catalytic subunit (A

chain) linked to a galactose-binding lectin (B chain) that facilitates adhesion to and

penetration of cell membranes (Batelli and Stirpe, 1995). As a result, type 2 RIPs are

much more toxic to living cells. Type 3 RIPs, found in maize and barley, are synthesized

as inactive precursors that require proteolytic cleavage for activation (Chaudhry et al.,

1994; Walsh et al., 1991).

Enzymatic Activities of RIPs

Extensive studies of the enzymatic activities of RIPs revealed that RNA N-

glycosidase activity on the α-sarcin loop of rRNA is by no means the only property of

these proteins. All RIPs have the ability to act as polynucleotide:adenosine glycosidases.

That is, they can remove multiple adenine residues from RNA or DNA (Barbieri et al.,

13

1997). In addition to removing adenine residues from nucleic acids, PAP is capable of

deguanylating ribosomal and viral RNA (Rajamohan et al., 1999a, b). The type 1 RIPs

gelonin (from Gelonium multiflorum) and PAP, and the type 2 RIP, ricin, possess DNA

glycosylase/AP lyase activity. These proteins, however, do not act in the traditional

protective manner of DNA glycosylase/AP lyases. Instead of removing potentially

cytotoxic or mutagenic bases, these proteins remove undamaged, non-mispaired bases

(Nicolas et al., 1998). Two novel properties have been demonstrated for ricin and

trichosanthin (from Trichosanthes kirilowii). Ricin has been shown to act as a

phosphatase on lipids and nucleotides (Helmy et al., 1999; reviewed in Peumans et al.,

2001), and trichosanthin possesses chitinase activity (Shih et al., 1997).

Antiviral Activity of RIPs

Perhaps as a consequence of some of the known enzymatic activities, a number of

RIPs have also been shown to possess antiviral and/or antifungal properties. The ability

of RIPs to inhibit viral infection in plants has been known since 1925, when extracts from

Phytolacca americana (pokeweed) were found to inhibit transmission of TMV (reviewed

by Nielsen and Boston, 2001; Peumans et al., 2001). The purified forms of many RIPs

have proven to be effective against both plant and animal viruses (Barbieri et al., 1993).

The antiviral property of the RIPs from pokeweed is being exploited in the medical field

as anti-human immunodeficiency virus (HIV) agents, especially since it was found that

PAP can inhibit viral replication at concentrations which do not inhibit the translation

machinery of the host cells (Rajamohan et al., 1999b; Ucken et al., 1998).

Several explanations have been put forward to explain the antiviral activities of

RIPs. The first is that RIPs act directly on the viral nucleic acid via their

polynucleotide:adenosine glycosidase activity. Second, RIPs could gain selective entry

14

into virus-infected cells when the cell is damaged upon vector feeding and thus inhibit the

protein synthesis machinery of only the infected cell. Third, RIPs may act indirectly

through the activation of signal-transduction pathways involved in plant defense.

Although there is in vitro evidence for the direct action of RIPs on viral nucleic acid

(Rajamohan et al., 1999b), it has not been shown in vivo. Many RIPs are sequestered in

the cell wall or cellular storage compartments from host ribosomes. It is not known how

the RIPs move from these compartments into the cytosol where they can act on either the

viral nucleic acid or the host-cell translational machinery. The most probable theory is

that RIPs are defense-related proteins regulated by signalling pathways in plants. It has

been demonstrated that RIPs from Phytolacca insularis and barley are induced in vivo by

jasmonic acid, a key signalling molecule in the expression of a number of plant defense-

related proteins (Chaudhry et al., 1994; Song et al., 2000). Two type 1 RIPs present in

Beta vulgaris accumulate in response to treatment of plants with salicylic acid and

hydrogen peroxide (two mediators of induced acquired resistance) (Girbés et al., 1996).

RIPs in Transgenic Plants

The role of RIPs in plant defense and promising in vitro results of RIPs as antiviral

proteins prompted exploration into their use as a source of microbial resistance in

heterologous plant hosts. Transgenic plants expressing different isoforms (different gene

products with the same function and similar or identical sequence) of PAP, and other

RIPs including trichosanthin, dianthin, IRIP (Iris-RIP), MOD1 (modified b-32 RIP) and

SNA-I' (Sambucus nigra agglutinin I') have been produced and tested for resistance to

viruses and fungi (Chen et al., 2002; Desmyter et al., 2003; Hong et al., 1996; Kim et al.,

2003; Krishnan et al., 2002; Lodge et al., 1993; Wang et al., 1998). Most researchers

chose to transform the model plants N. benthamiana or N. tabacum and study the

15

antiviral properties of the RIPs by inoculating the plants with TMV. PAP, MOD1 and

trichosanthin have been expressed in economically important crops (such as potato and

rice) to which they conferred resistance to Potato virus Y (PVY) (Lodge et al., 1993),

Rhizoctonia solani (Kim et al., 2003), and Pyricularia oryzae (Yuan et al., 2002),

respectively. PAP has been shown to confer resistance to a number of plant viruses

including TMV, PVY, PVX, and CMV (Lodge et al., 1993); while the expression of

trichosanthin resulted in complete resistance to infection by Turnip mosaic virus (Lam et

al., 1996). Dianthin has proven very effective against the geminivirus, African cassava

mosaic virus (Hong et al., 1996). Transgenic plants expressing PAP-II and MOD1 are

resistant to the fungus, R. solani, with PAP-II also conferring resistance to Sclerotinia

homoeocarpa in a turfgrass species (Wang et al., 1998; Kim et al., 2003; Dai et al.,

2003).

The main objective of this research was to determine the efficacy of PAP as an

antiviral agent against CTV and CEVd. More specifically, the efficacy would be

evaluated using an in vitro system prior to using PAP mutants to transform Citrus

paradisi cv. Duncan grapefruit, which would then be challenged with CTV and CEVd by

graft inoculation. The same PAP mutants would be used to transform Nicotiana

benthamiana for the purpose of studying the effect of PAP in protoplasts on the

replication of CTV.

CHAPTER 2 In vitro TRANSLATION OF A Citrus tristeza virus REPLICON AND THE EFFECT

OF POKEWEED ANTIVIRAL PROTEIN ON ITS TRANSLATION

Introduction

Citrus tristeza virus (CTV), the largest positive stranded RNA virus of plants, has

properties that are intermediate between the animal Nidovirales group, which contains the

family Coronaviridae and the alphavirus supergroup, which contains the Tobamoviruses.

CTV resembles members of the Coronaviridae because of the similarity of the genes,

gene arrangement of ORF1a and 1b, the expression strategy of the RNA-dependent RNA

polymerase (RdRp), and the accumulation of double-stranded (ds) RNAs corresponding

to subgenomic (sg) RNA. The relationship with the alphaviruses is based on amino acid

similarity in the replicase-associated domains and on the lack of a common 5' leader on

the sgRNAs (Karasev et al., 1997; Snijder and Horzinek, 1993). The CTV genome is

organized into 12 open reading frames (Pappu et al., 1994), with ORF1a being expressed

as a 349 kDa polyprotein and ORF1b expressed via a +1 frameshift (Cevik, 2001). The

ten 3' genes are expressed via 3' co-terminal sgRNAs (Hilf et al., 1995; Karasev et al.,

1997).

The study of the biological properties and detailed characterization of CTV at the

molecular level have been hampered by the limited host range, the lack of local lesion

hosts, the fact that CTV is phloem-limited and not easily mechanically transmissible, and

by the large, complex genome of this virus. A full-length infectious cDNA clone was

constructed and amplified in E. coli (Satyanarayana et al., 1999). However, the large size

16

17

of the clone impeded the ready manipulation of the construct and the study of mutants for

elucidation of gene functions. As a result, a smaller, more manageable replicon

designated CTV-∆Cla, was generated (Satyanarayana et al., 1999). This clone, retaining

only the 5' and 3' UTRs, ORFs 1a and 1b, and a gene fusion between ORF11 and part of

ORF2 (Figure 2-1), was able to replicate efficiently in Nicotiana benthamiana mesophyll

protoplasts. The use of the infectious CTV clones has, thus far, been used to study

replication and gene expression at the transcriptional level in a protoplast system.

Figure 2-1. Schematic representation of the Citrus tristeza virus (CTV) genome. A) Full

length CTV genome. B) CTV-∆Cla replicon. Shown are the two papain-like proteases (Pro), the methyltransferase (Met), Helicase (Hel), RNA dependent RNA polymerase (RdRp) and ORFs 2-11. Diagrams were adapted from Satyanarayana et al., 1999.

Although the cDNA clone has been used to examine the effect of the product of the

ORF11 (p23) on viral replication (Satyanarayana et al., 2002), examination of the events

occurring at the translational level in protoplasts is more difficult since visualization of

the viral proteins requires the use of antibodies to distinguish viral proteins from other

plant proteins. Additionally, only one protein can be studied per western blot.

18

Development of an efficient in vitro model system would allow the examination of the

expression levels of viral proteins and also the effect of exogenous agents, such as other

proteins, on the level of translation without the use of antibody-detection methods.

Studies at the translation level have been conducted in an in vitro transcription and

translation system (Cevik, 2001; Vazquez-Ortiz, 2001). However these experiments used

CTV sequences (the two papain-like protease domains and the RdRp, respectively) out of

the viral context. There is a possibility that additional viral sequences further upstream or

downstream of the gene of interest may have an effect on expression. Thus transcription

and translation of the CTV-∆Cla replicon (which allows for the insertion of other genes)

in an in vitro translation system would facilitate the analysis of multiple viral proteins.

This would circumvent the need to dually transfect protoplasts with both CTV-∆Cla and

another transcript to examine the effect of the product of the latter transcript on replicon

replication. When transfecting protoplasts with two different transcripts, it is unlikely that

both transcripts will enter all the cells. This might result in the erroneous interpretation of

data. The in vitro approach should facilitate the study of the effect of potential

resistance/antiviral gene products on viral translation, and give an initial indication of the

efficacy of these proteins without the need for plant transformation and screening of the

resultant plants for resistance to CTV (a lengthy and time-consuming process for citrus).

Pokeweed antiviral protein (PAP) isolated from the leaves of Phytolacca

americana (pokeweed) is a 29 kDa ribosome-inactivating protein that has antiviral

properties (reviewed in Nielsen et al., 2001; Tumer et al., 1999). This antiviral effect is

not limited to a particular virus or virus group, and is effective against both plant and

animal viruses (Chen et al., 1991; Irvin and Uckun, 1992). There is evidence that the

19

antiviral activity is not solely dependent upon the inactivation of ribosomes (Tumer et al.,

1997). In vitro experiments showed that PAP can inhibit translation by directly

depurinating the RNA (Rajamohan et al., 1999a); and that although PAP preferentially

depurinates capped RNA, it is still capable of inhibiting translation of uncapped viral

RNAs by an, as yet, unknown mechanism (Vivanco and Tumer, 2003).

The objective of this study was to express the CTV replicon, CTV-∆Cla, in an in

vitro translation system and to test the efficacy of PAP as a potential inhibitor of the

translation of this replicon.

Materials and Methods

Source of Viral Nucleic Acid

The CTV-∆Cla replicon (kindly supplied by Dr. W.O. Dawson) was transformed

into E. coli JM109 cells. Large-scale DNA isolation was performed using the Qiagen

Midiprep kit according to the manufacturer’s instructions.

In vitro Transcription and Translation of CTV-∆Cla

The first attempt to translate the CTV replicon was done in a wheat germ extract

TNT® coupled in vitro transcription and translation system (Promega, Madison, WI).

Different concentrations of DNA were tested in order to optimize the system. A 20 µl

reaction containing 10 µl of wheat germ extract, 0.75 µl reaction buffer that contained all

the amino acids except leucine, 0.75 µl SP6 RNA polymerase, 0.75 µl RNAsin

ribonuclease inhibitor, and 0.5 µCi/ml 3H-leucine was incubated at 30°C for 1 h. The

reactions were then subjected to SDS-PAGE in 12% Tris Ready gels (Bio-Rad) at 150 V

for 1.5 h. The radio-labeled proteins were detected using the method described by Bonner

and Laskey (1974). Briefly, the gels were fixed in dimethyl sulfoxide (DMSO) and

DMSO-2, 5-diphenyloxazole (PPO), dried under vacuum at 70°C for 40 min, exposed to

20

X-ray film overnight at -80°C, and developed using a Kodak X-Omat Clinic 1 film

processor.

Alternatively, the transcription and translation reactions were conducted separately.

The plasmid DNA was linearized with the restriction enzyme, NotI (New England

Biolabs, Beverly, MA) and transcribed using the RibomaxTM large scale in vitro RNA

production system (Promega, Madison, WI) according to the manufacturer’s instructions.

Briefly, the transcription reaction was done in a final volume of 25 µl, containing 5 µl

SP6 transcription buffer, 5 µl of 25 mM rNTPs, 5 µg DNA template, 2 µl SP6 enzyme

mix and nuclease-free water. The reaction was incubated at 37°C for 3 h, stopped by the

addition of RNAse-free DNAseI and further incubation at 37°C for 15 min. Further

purification of the RNA transcripts was done according to the manufacturer’s

instructions.

Different concentrations of the transcripts were then translated in either wheat germ

extract (Promega, Madison, WI) at 25°C for 2 h or the Flexi® Rabbit reticulocyte lysate

system (Promega, Madison, WI) at 37°C for 1 h. The transcripts were either capped using

the m7GpppG cap analogue (Promega, Madison, WI) or uncapped. For the wheat germ

system, different concentrations of potassium acetate were tested; while for the rabbit

reticulocyte system, potassium chloride and magnesium acetate concentrations were

optimized. The final concentrations of potassium and magnesium used in the translation

reactions were established based on the guidelines stipulated by the manufacturer.

In vitro Antiviral Assay

To determine the direct effect of PAP on CTV-∆Cla RNA, the transcripts were

treated with 0 ng, 20 ng, and 100 ng of wild type (wt) PAP (Worthington, Lakewood, NJ)

21

per 500 ng of RNA in RIP buffer (50 mM Tris, 50 mM KCl, 10 mM MgCl2 pH 7.5) and

incubated at 30°C for 30 min. PAP was removed by phenol-chloroform extraction, and

the translation reaction performed in the rabbit reticulocyte lysate system. RNA from

Brome mosaic virus (BMV) supplied with the translation kits was used as a control.

Results

In vitro Translation of CTV-∆Cla

The first attempt at translating CTV-∆Cla using a wheat germ-based TNT®

coupled transcription and translation system was unsuccessful. This could be due to the

absence of specific co-factors or conditions required by the replicon for translation.

Factors that might have a positive effect on translation include varying salt and

magnesium concentrations as well as the presence of a capped transcript. For this reason,

the transcription and translation reactions were performed separately in two different

systems (plant and animal) to optimize the translation reaction.

The wheat germ system allowed for optimization of the concentration of the salt,

potassium acetate. The combination of 2 µg of the DNA template and 53 mM potassium

acetate yielded translation products (Figure 2-2). The band of approximately 28 kDa in

size might be the product of the fusion of ORF11 with part of ORF2, while the faint high

molecular weight band might be the polyprotein or part of the polyprotein since the

translation system has an upper limit of approximately 200 kDa. The band at 48 kDa does

not correspond to any expected size of products translated from ORF 1a and 1b.

Due to the unexpected sizes of the protein bands in the wheat germ system,

optimization in a rabbit reticulocyte system was undertaken. The rabbit reticulocyte

system allowed for optimization of salt and magnesium concentrations in addition to

supporting the translation of larger RNA templates. Two different RNA concentrations

22

were translated in the absence or the presence of either 70 mM potassium chloride (KCl)

or 0.25 mM magnesium acetate (Figure 2-3).

Figure 2-2. Optimization of CTV-∆Cla replicon translation in wheat germ extract. Lane:

1, 1 µg RNA with 53 mM potassium acetate; 2, 1 µg RNA with 133 mM potassium acetate; 3, 2 µg RNA with 53 mM with potassium acetate; 4, 2 µg RNA with 133 mM potassium acetate; 5, 4 µg RNA with 53 mM potassium acetate; 6, 4 µg RNA with 133 mM potassium acetate.

Although the standard translation reaction (Figure 2-3, lanes 1 and 4) supported

translation of the CTV-∆Cla transcript, with the higher RNA concentration of 2 µg

producing more protein, the addition of KCl to 1 µg RNA increased translation to the

same level produced by 2 µg of RNA without any additives. A strong band of

approximately 56 kDa was observed in all translation reactions. This band fit the

expected size of the proteases and the RdRp expressed by ORF 1a and 1b. The high

molecular weight bands seen on the gel were most likely artifacts since they were not

consistently observed in subsequent experiments. Due to the higher level of translation,

23

the appearance of bands closer to the sizes of expected proteins and the reproducibility of

the results, it was decided to continue using the rabbit reticulocyte system with the

addition of KCl to all further translation reactions.

Figure 2-3. Optimization of CTV-∆Cla translation in rabbit reticulocyte lysate. Lane 1, 1

µg RNA; 2, 1 µg RNA + 70 mM potassium chloride; 3, 1 µg RNA + 0.25 mM magnesium acetate; 4, 2 µg RNA; 5, 2 µg RNA + 70 mM potassium chloride. RNA was transcribed from the NotI-linearized plasmid containing the CTV-∆Cla replicon.

PAP Inhibits Translation of CTV-∆Cla Transcripts

To determine whether PAP would act as an antiviral agent against CTV translation

in vitro, capped CTV-∆Cla transcripts were treated with commercial wtPAP prior to

translation. After incubation with CTV-∆Cla transcripts, PAP was removed by phenol-

chloroform extraction to eliminate the possibility that any observed decrease in

translation might be due to the ribosome-inactivating properties of wtPAP. BMV RNA

was used as a positive control to confirm the inhibitory effect of the wtPAP preparation.

SDS-PAGE analysis of the translation products of wtPAP-treated BMV RNA showed

24

that 20 ng of wtPAP caused a visible decrease in translation (Figure 2-4 A), indicating

that wtPAP had enzymatic activity. The CTV-∆Cla transcripts treated with 20 ng wtPAP

exhibited decreased levels of translation as indicated by the decreased intensity of the

major product of the approximately 56 kDa expressed from the CTV-∆Cla transcript

(Figure 2-4). The translation of both BMV and CTV-∆Cla was completely inhibited by

100 ng of wt PAP (data not shown).

Figure 2-4. Effect of wild type PAP on translation. A) BMV translation products B)

CTV-∆Cla translation products. Lane 1, untreated RNA; 2, RNA treated with 20 ng PAP/500 ng RNA. All RNA samples were incubated at 30°C for 30 min in RIP buffer followed by a phenol-chloroform extraction.

Discussion

In vitro translation has played an important role in the elucidation of requirements

for viral gene expression. For example, in vitro systems have been used to investigate

translational enhancement in Hibiscus chlorotic ringspot virus (Koh et al., 2002),

translational frameshifting in Barley yellow dwarf virus (Di et al., 1993; Paul et al., 2001)

and the mechanism of cap-independent translation in Tomato bushy stunt virus (Wu and

25

White, 1999). In addition, in vitro systems are useful when the translation products of

viral genomic or subgenomic RNAs are not known (Dinesh-Kumar et al., 1992). Schulte

and Kearney (2000) used an in vitro translation system to determine the antiviral

potential of a variety of antisense oligonucleotides (ASO). They were able to identify the

most effective ASOs before doing more time consuming plant transformation

experiments.

The objective of this study was to use CTV-∆Cla transcribed RNA as a reliable

template for in vitro translation followed by rapidly testing the efficacy of PAP as an

inhibitory agent of CTV translation before proceeding with plant transformation

experiments. The results showed that CTV-∆Cla transcripts can be translated in an in

vitro rabbit reticulocyte lysate system. However, the inherent limitations of the system

may have prevented the expression of the large polyprotein. Alternatively the two

proteases located at the N-terminal end of the polyprotein could have processed the 349

kDa polyprotein into functional proteins of a smaller size (Vazquez-Ortiz, 2001).

Using an in vitro translation assay, Hudak et al. (2000) showed that one of the

mechanisms by which wtPAP was able to inhibit viral translation was by acting directly

on the RNA of BMV and Potato virus X (PVX), removing adenine residues at multiple

sites. Therefore, to determine whether PAP could inhibit translation of CTV-∆Cla RNA

by acting directly on the RNA, capped CTV-∆Cla transcripts were treated with

commercial wtPAP prior to translation. A reproducible decrease in the translation of

PAP-treated RNA was observed at a concentration of 20 ng of the antiviral protein

(Figure 2-4 B). At a concentration of 100 ng, wtPAP completely inhibited translation of

BMV and the CTV-∆Cla replicon (data not shown). However, previous research has

26

shown that wtPAP is able to almost completely inhibit the translation of 250 ng BMV

RNA at a concentration of 5 ng (Hudak et al., 2000). The major difference between that

result and the one from this experiment might be explained by differences in the

enzymatic activity of the PAP preparation used. Based on the results obtained from the

translation of BMV RNA and the possibility that the PAP preparation did not have

optimal enzymatic activity, one could extrapolate that a lower concentration of PAP

might also have an inhibitory effect on translation. Since the viral RNA will be exposed

to the intracellular environment in plants, the in vitro translation result demonstrating the

direct effect of PAP on the RNA suggests that transgenic citrus correctly processing and

expressing PAP may exhibit reduced levels of CTV.

CHAPTER 3 TRANSFORMATION OF Citrus paradisi cv Duncan GRAPEFRUIT WITH

POKEWEED ANTIVIRAL PROTEIN

Introduction

Diseases caused by viroids and viruses have had a major impact on citrus

production world-wide. Viroids are the smallest known plant pathogens. They consist of

unencapsidated, circular, single-stranded RNA molecules that exist as highly base paired

rod-like structures. Viroids found in citrus plants can be classified into the following

classes: Citrus exocortis viroid (CEVd, 370-375 nucleotides (nt)), Citrus bent leaf viroid

(CBLVd, 315-329 nt; formerly called CVd-I), Hop stunt viroid (HSVd, 295-303 nt;

formerly called CVd-II), Citrus viroid III (CVd-III, 291-297 nt), Citrus viroid IV (CVd-

IV, 284-286 nt) and Citrus viroid OS (CVd-OS, 329-/331 nt) (Duran-Vila et al., 2000; Ito

et al., 2000, 2002).

In the field, CEVd causes severe stunting and bark scaling of citrus trees on

Poncirus trifoliata rootstock. Less severe symptoms occur on Citrus sinensis x P.

trifoliata (citrange) and Citrus limonia (Rangpur lime) and only mild symptoms are seen

on Swingle citrumelo (Lee et al., 2003). The severe stunting on trifoliate rootstock leads

to reduced canopy size and ultimately a reduction in yield. CEVd is spread primarily via

infected budwood and contaminated cutting tools and equipment.

Resistance to CEVd and potato spindle tuber viroid (PSTVd) has previously been

achieved by transforming plants with ribozymes, which are RNA molecules that have

enzymatic activity (Atkins et al., 1995; Yang et al., 1997). Sano et al. (1997) and Ishida et

27

28

al. (2002) produced potato and chrysanthemum plants resistant to PSTVd and

chrysanthemum stunt viroid, respectively, by expressing a double-stranded RNA–specific

ribonuclease, pacI, from Schizosaccharomyces pombe. Thus transformation of plants with

proteins or enzymes that act directly on RNA may provide protection against viroid

infection.

Citrus tristeza virus (CTV), a member of the genus Closterovirus, is one of the

most economically important virus diseases of citrus and has resulted in widespread

losses in many citrus-growing regions. The virus is transmitted by six aphid vectors, with

Toxoptera citricida being the most efficient vector, as well as by propagation of infected

buds (Bar-Joseph et al., 1989). CTV isolates differ in the symptoms they cause depending

on the scion/rootstock combination. Certain isolates result in decline and death of citrus

species on sour orange rootstock; stem pitting of scions which reduces tree vigour, fruit

yield and quality; and a syndrome called seedling yellows which is expressed as stunting

and chlorosis of susceptible varieties such as lemon and grapefruit.

CTV isolates exist as complex populations consisting of a number of different CTV

genotypes, with large sequence variation among the genotypes. Thus CTV isolates are

populations of CTV genotypes, in which one genotype may predominate (Ayllόn et al.,

1999; Hilf et al., 1999). A number of strategies have been developed to manage the

disease. These strategies include eradication programs, quarantine and budwood

certification to prevent the introduction of CTV into a country, the use of CTV tolerant

rootstocks, and mild strain cross protection (reviewed by Ferguson and Garnsey, 1993).

A source of genetic resistance to CTV has been found in Poncirus trifoliata. This

resistance is known to be controlled by a single dominant gene, Ctv (Yoshida et al.,

29

1996). Although the introgression of the Ctv gene into rootstock species is possible via

sexual hybridization, commercially acceptable scions have not yet been produced as a

result of the concomitant introgression of undesirable fruit characteristics (Ferguson and

Garnsey, 1993). Currently the mechanism of action for Ctv is not known, since

protoplasts of virus resistant plants are still able to maintain viral replication (Albiach-

Marti et al., 1999). However, cloning the Ctv gene and using it to transform commercially

important citrus species should be a successful strategy to develop genetic resistance to

CTV.

Genetic transformation of woody fruit plants is a promising alternative to

conventional breeding practices for the introduction of new traits. This technology

circumvents the limitations imposed on breeding by the heterozygosity, long juvenile

periods and auto-incompatibility of the plants. With the development of an efficient

Agrobacterium-mediated citrus transformation protocol (Luth and Moore, 1999), it is

now possible to use molecular methods not only to engineer resistance to CTV, but also

to introduce other commercially favorable traits. For example, citrus was successfully

transformed with the Arabidopsis thaliana genes LEAFY and APETALA1, both of

which reduced the juvenile period of the resultant plants (Peňa et al., 2001). Thus far

attempts to engineer resistance to CTV has centered on the pathogen-derived resistance

approach (PDR); transforming plants with the coat protein gene of various CTV isolates

as well as other CTV genomic sequences, (Dominguez et al., 2000, 2002; Febres et al.,

2003; Ghorbel et al., 2001; Gutierrez, 1997). Given the complexity of CTV populations,

it is possible that a PDR approach may not produce the expected “CTV resistance”.

30

Ribosome-inactivating proteins (RIPs) with additional antiviral or antifungal

properties have been isolated from many different plant species and are enzymes that

inhibit protein synthesis in many prokaryotic and eukaryotic cells. This inhibition is due

to N-glycosidation activity, which causes the removal of a specific adenine residue from

the α-sarcin loop, a region conserved in the large rRNAs of both prokaryotes and

eukaryotes (Endo et al., 1987; Endo and Tsurugi, 1987). Depurination of the α-sarcin

loop interferes with both the elongation factor EF-Tu/EF-1-dependent binding of

aminoacyl-tRNA and the GTP-dependent binding of EF-G/EF-2 to ribosomes, arresting

protein synthesis at the translocation step (Montanaro et al., 1975; Osborne and Hartley,

1990). RIPs can be divided into three classes based on their physical properties. Type 1

RIPs, such as pokeweed antiviral protein (PAP; from Phytolacca americana) and

trichosanthin (from Trichosanthes kirilowii) consist of a single polypeptide chain. Type 2

RIPs, such as ricin (from Ricinus communis), have a type 1-like catalytic subunit (A

chain) linked to a galactose binding lectin (B chain) that facilitates adhesion to and

penetration of cell membranes (Batelli and Stirpe, 1995). As a result, type 2 RIPs are

much more toxic to living cells. Type 3 RIPs, found in maize and barley, are synthesized

as inactive precursors which require proteolytic cleavage for activation (Chaudhry et al.,

1994; Walsh et al., 1991).

PAP is a 29-kDa protein produced by Phytolacca americana (pokeweed) and has

been shown to exhibit strong antiviral activity against a broad spectrum of plant and

animal viruses, including Southern bean mosaic virus, Potato virus X, Cucumber mosaic

virus, Tobacco mosaic virus, influenza virus (Tomlinson et al., 1974), poliovirus (Ussery

and Hardesty, 1977), herpes simplex virus (Aron and Irvin, 1980) and HIV (Zarling et al.,

31

1990). A number of PAP mutants have been isolated and tested for toxicity to ribosomes

and retention of antiviral properties (Table 3-1; Hur et al. 1995). The most effective

mutants with respect to reduced toxicity and inhibition of viral infection are a C-terminal

deletion mutant, due to a nonsense mutation (Trp237stop), and an N-terminal mutant

(Gly75-Asp). The reason for their efficacy is thought to be due to the fact that the C-

terminal deletion removes a region responsible for PAP toxicity to ribosomes, while the

N-terminal mutation has been shown to adversely affect the binding of PAP to ribosomes

(Zoubenko et al. 2000). Other mutants which have been used include a PAP variant

(PAPv) in which a two amino acid change, Lys20-Arg and Trp49-His, causes a slight

reduction in toxicity to ribosomes while maintaining the wild type ability to inhibit viral

infection, and an active site mutant (PAPx) in which the mutation, Gly176-Val abolished

enzymatic activity.

Table 3-1. Expected properties of PAP and PAP mutants.

Information presented in this table was obtained from Lodge et al. (1993), Tumer et al., (1993) and Zoubenko et al., (2000).

Construct Toxicity to ribosomes Translation inhibition Pathogen resistance Wild type PAP Yes Yes Yes PAPv Yes Yes Yes PAPn No Yes Yes PAPc No Yes Yes PAPx No No No

The broad-spectrum virus resistance displayed by wild type PAP and its mutants

makes it an ideal candidate for the development of virus-resistant plants. To date, PAP

has been used to transform Nicotiana benthamiana, N. tabacum cv. Samsun, Solanum

tuberosum cv. Russet Burbank and Agrostis stolonifera L. (creeping bentgrass), and the

plants have been evaluated for resistance to viruses as well as fungi (Dai et al., 2003;

Lodge et al., 1993; Tumer et al., 1997; Zoubenko et al., 2000). Although the mechanism

32

mediating the antiviral activity of PAP is still under investigation, a number of insights

have been gained. PAP has been shown to inhibit translation by directly depurinating

viral RNA at multiple sites (Rajamohan et al., 1999a), preferentially depurinating capped

RNAs (Hudak et al., 2000; Vivanco and Tumer, 2003), and inhibiting +1 frameshifting in

the yeast retrotransposon, TY1 (Tumer et al., 1998). Since CTV has an RNA genome that

most probably has a 5' guanosine cap and a RdRp that is expressed via a +1 frameshift, it

presents an ideal subject for translational inhibition by PAP in a non-strain specific

manner.

In this study, four PAP mutants (PAPv, PAPc, PAPn and PAPx), the properties of

which are summarized in Table 3-1, were used to transform Citrus paradisi cv. Duncan

grapefruit by Agrobacterium tumefaciens-mediated transfer. The resultant transgenic

plants were characterized by molecular methods and evaluated for resistance to CTV and

CEVd by graft challenge inoculation.

Materials and Methods

PAP Gene Constructs and Plasmid Expression Vectors

All PAP constructs were derived from the PAPv sequence which contains two

mutations, Lys20-Arg and Trp49-His. These mutations make the protein slightly less

toxic to ribosomes than the wild type (wt) PAP (Tumer et al., 1997). Using a series of

oligonucleotide primers (Table 3-2), two mutants, PAPn containing a point mutation that

changed residue Gly75 to Ala, and PAPx with Glu176 and Arg170 changed to Ala, were

constructed by overlap PCR, while the C-terminal deletion mutant was constructed by

changing Trp237 to a translation termination codon, thereby truncating the PAP coding

region. The PCR products were cloned into pGEM-T (Promega, Madison, WI) and

sequenced to verify the presence of the introduced mutations. The PAP insert was

33

removed from pGEM-T by digestion with restriction enzymes ApaI and NotI, flanking

the PAP coding sequence, and subcloned between the Figwort mosaic virus (FMV)

promoter and the Cauliflower mosaic virus (CaMV) 35S termination sequence contained

in the pUC118 vector provided by Dr V. J. Febres (Figure 3-1). The PAP expression

cassettes containing the PAPv, PAPn, PAPx and PAPc genes were released from pUC118

by digestion with PstI and ligated into the PstI-digested binary expression vector,

pCambia2202 (provided by Dr V. J. Febres) which has the kanamycin resistance gene,

nptII, as the selection marker and the green fluorescent protein (GFP) as the reporter gene

(Figure 3-1). The binary vector containing the PAP constructs were introduced into

Agrobacterium tumefaciens strain AGL1 by the cold shock transformation method

(Birnboim and Doly, 1979). The bacteria were incubated on LB-agar plates supplemented

with 50 µg/ml carbenicillin and 100 µg/ml chloramphenicol, at 28°C for two days to

screen for transformants.

Table 3-2. Sequences of oligonucleotide primers used for amplification and mutagenesis of the PAP gene

Primer Sequence Orientation CN442 GGTATCAGcGGCAGCtgcATTCAAGTAC Sense CN443 GTACTTGAATgcaGCTGCCgCTGATACC Antisense CN444 ATTAGGGCCCGGGAAGATGAAGTCAATGCTTGTG Sense CN445 AATTGCGGCCGCTCAGAATCCTTCAAATAGATC Antisense CN446 AATTGCGGCCGCTCACTTGGCACC Antisense CN447 GTATGTGATGGATTATTCTG Sense CN448 CAGAATAATCCATCACATAC Antisense Lower case letters indicate the mutated nucleotides Citrus Transformation and Regeneration

An Agrobacterium-mediated transformation protocol previously developed for

Carrizo citrange and Swingle citrumelo (Moore et al. 1992) and subsequently modified

for Citrus paradisi cv. Duncan (Luth and Moore, 1999) was followed.

34

Figure 3-1. Cloning strategy of the PAP constructs for plant transformation. The

ApaI/NotI-digested gene fragments were ligated into ApaI/NotI-digested pUC118 between the FMV promoter and CaMV 35 terminator. The resulting expression cassettes were cloned into the PstI restriction site of the binary vector pCambia2202. The black lines on the PAP constructs indicate positions of mutations. All constructs had the mutations Lys20-Arg and Trp49-His. Additional mutations were Gly75-Ala for PAPn, Glu176-Ala and Arg170-Ala for PAPx , and Trp237-Stop for PAPc.

35

Seed germination

Seeds were extracted from mature fruit of Citrus paradisi cv. Duncan grapefruit.

The seedcoats were removed from seeds, and the seeds were then sterilized first in 70%

ethanol for 2 min, then in a 0.525% sodium hypochlorite solution with 0.05% Tween 20,

followed by 3 rinses of 2 min each in sterile water. One or two seeds were placed into test

tubes containing half strength MS medium (2.15 g/L MS salts, 50 mg/L myo-inositol, FM

stock, 15 g/L sucrose) and 7 g/L agar. The seeds were germinated in the dark for

approximately six weeks.

Transformation of epicotyl segments

Agrobacterium tumefaciens strain AGL1 containing pCambia2202 with the PAPv,

PAPn, PAPx or PAPc construct was grown overnight at 28°C, in YEP medium (10 g/L

bactopeptone, 10 g/L yeast extract, 5 g/L sodium chloride) supplemented with the

appropriate antibiotics, to an OD620nm between 0.4 and 1.0. The cultures were centrifuged

at 5000 rpm in a Beckman GSA rotor for 5 min and resuspended to a final concentration

of 5x108 cfu in MS medium supplemented with 100 µM acetosyringone.

The epicotyl portions of the etiolated seedlings were cut into 1 cm2 segments and

incubated in the Agrobacterium solution for 1-2 min. The segments were then transferred

to co-cultivation medium (MS medium, 7 g/L agar and 100 µM acetosyringone) and kept

in the dark at room temperature for 2-3 days (Figure 3-2 A and B).

Selection and regeneration of plantlets

Following co-cultivation, the epicotyl segments were placed onto shoot-inducing

medium (MS medium, 7 g/L agar and 0.5 mg/L benzylaminopurine) supplemented with

75 mg/L kanamycin to select for transformed shoots and 500 mg/L claforan to prevent

further growth of Agrobacterium (Figure 3-2 C and D).

36

Figure 3-2. Agrobacterium-mediated transformation of etiolated Citrus paradisi cv.

Duncan grapefruit and regeneration of plants. A) Inoculation of stem segments with Agrobacterium strain AGL1 containing pCambia2202 with the PAP construct. B) Co-cultivation. C-D) Regeneration of shoots on selective medium. E) Shoots on root-inducing medium. F) Transgenic plant transferred to soil in the greenhouse.

37

The plates were incubated at 28°C with a 16 h photoperiod provided by cool-white

fluorescent lights. The segments were transferred to fresh medium every 4 weeks. Shoots

were transferred directly to root-inducing medium (MS medium, 8 g/L agar, 100 mg/L

myo-inositol, 0.5 mg/L naphthalene acetic acid), where they remained until they had

produced roots (Figure 3-2 E). Upon root production, the plantlets were transferred to

covered containers with sterile soil and half strength MS medium and kept at 28°C with a

16 h photoperiod until they outgrew the containers. The plants were acclimated by

placing them in pots covered by clear plastic bags in a humid growth room with a 16 h

photoperiod and a temperature of 28°C. After 1-2 weeks, the plastic bags were slashed

and after another 1-2 weeks, the bags were completely removed, whereupon the surviving

plants were transferred to the greenhouse (Figure 3-2 F).

Analysis of Transgenic Plants

Fluorescent microscopy

The regenerated shoots were examined for GFP expression using a dissecting

microscope (Zeiss) equipped with a fluorescent light source with a 515 nm long pass

emission filter transmitting red and green light and a 450-490 nm excitation filter. The

fluorescent images were captured with a 35 mm camera attached to the microscope.

Polymerase chain reaction (PCR) analysis

All shoots were tested for the presence of the PAP gene by PCR using gene-

specific primers. Some of the shoots were also analysed for the presence of the GFP gene

using the gene-specific primers CN462 5'-ATGGTGAGCAAGGGCGAGGAG-3' and

CN463 5'-CTTGTACAGCTCGTCCATGCC-3'. DNA was extracted from the plants

using a modification of the protocol by Oliveira et al. (2000). Briefly, 0.1 g of tissue was

ground in liquid nitrogen. The tissue was resuspended in 300 µl of extraction buffer

38

(100 mM Tris-HCl pH 8.0, 50 mM EDTA pH 8.0, 500 mM NaCl, 140 mM

ß mercaptoethanol, 80 µl of 10% SDS), incubated at 65°C for 10 min, after which, 100 µl

of potassium acetate was added and the samples further incubated on ice for 20 min. The

samples were centrifuged at 12000 x g for 30 min at 4°C. The supernatant was then

transferred to a new tube and an equal volume of isopropanol added. The DNA was

precipitated by centrifugation at 12000 x g for 20 min at 4°C. The DNA pellet was

washed with 80% ethanol, dried and resuspended in sterile water containing 2 µg/µl

RNAse. PCR was carried out using primers CN444 and CN446 or CN444 and CN445

(Table 3-1) in a Biometra thermocycler using a profile of 94°C for 2 min initial

denaturation, 30 cycles of denaturation at 94°C for 30 sec, primer annealing at 55°C for

45 sec, primer extension at 72°C for 45 sec and a final primer extension step of 72°C for

5 min. The PCR products were analysed by electrophoresis in 1% agarose gels in TAE

buffer.

Southern hybridization

For Southern hybridization 10 µg of total genomic DNA was isolated from

transgenic plants and non-transformed control plants using a modification of the protocol

by Oliveira et al. (2000). The DNA was digested with BglII (New England Biolabs,

Beverly, MA). After agarose gel electrophoresis, the DNA was transferred to nylon

membrane (Hybond N+, Fisher Scientific) by capillary action overnight (Sambrook et al.

1989). Using the gene specific primers CN444 and CN446, a digoxigenin (DIG) -labeled

probe was produced by PCR amplification according to the manufacturer’s instructions

(Roche, Indianapolis, IN). The DIG-labelled probe was denatured and used for a 16 hour

hybridisation after 2-4 hours of prehybridisation in DIG Easy Hyb Buffer (Roche).

Following hybridization, the membrane was washed twice for 5 min in 2x SSC + 0.1%

39

SDS at room temperature, and twice for 15 min in 0.5x SSC + 0.1% SDS at 65°C. The

blot was exposed to X-Ray film and developed using a Kodak X-Omat Clinic 1 film

processor.

Reverse-transcription (RT) PCR

PAP gene expression at the transcriptional level was analysed in the transgenic

plants by RT-PCR. Total RNA was isolated from the plants with TRIzol reagent

(Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Prior to RT-

PCR, the RNA was treated with DNAse I (Promega, Madison, WI) to eliminate any DNA

contaminants, and then phenol-chloroform cleaned to remove the DNAse I. cDNA was

prepared using 5 µg of RNA, the reverse primer CN446, and MMLV reverse

transcriptase (Promega). RNA isolated from a non-transgenic plant was used as a

negative control in the RT-PCR reaction. The parameters for the RT reaction were: 1 h at

42°C and 15 min at 70°C. One tenth of the volume of the RT reaction was used for PCR

and the products were analysed on a 1% agarose gel in TAE buffer.

Western blot analysis

To determine the expression levels of PAP in the transgenic plants, 200 mg of

tissue was homogenized in an equal volume of phosphate buffered saline (PBS, 137 mM

NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4 pH 7.4). Total protein

concentration was determined by the Bradford Assay (BioRad, Hercules, CA). Aliquots

of the soluble plant extracts containing 100 µg total protein were mixed with equal

volumes of dissociation buffer (140 mM SDS, 160 mM Tris-HCl pH 7.8, 1% v/v

glycerol, 142 mM β-mercaptoethanol), boiled for 2 min and separated on a precast 12%

polyacrylamide Tris-HCl gel (BioRad). Proteins were transferred to nitrocellulose

membrane using a BioRad semi-dry horizontal electrotransfer apparatus according to the

40

manufacturer’s instructions.Colorimetric immunodetection of the protein was carried out

using a 1:500 dilution of 0.5 mg/mL anti-PAP-IgG kindly supplied by Dr Maria

Kanieskowski (Monsanto) and the chromogenic substrates ρ-nitro blue tetrazolium

(NBT) and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine (BCIP).

Grafting and Challenge of Transgenic Plants with CTV

Individual transgenic lines were grafted onto Swingle citrumelo rootstock. For

challenge with CTV, eight to twenty-eight plants from each replicated line were graft

inoculated with the severe strain T66 sub-isolate E (Tsai et al., 2000). Two and four

months after inoculation, CTV-inoculated plants on which the grafts had survived were

analyzed for infection by direct antibody sandwich indirect-ELISA (DASI-ELISA) (Tsai

et al., 2000) using the antibodies, CREC1052 and G604 (provided by R. F. Lee). Plates

were coated with a 1:5000 dilution of CREC1052, followed by the addition of 10 mg/100

µl of virus-infected tissue, and then a 1:20,000 dilution of G604. Each antibody

incubation step was carried out overnight at 4°C and was separated from the next step by

vigorous washing with water and phosphate-buffered saline supplemented with 0.05%

Tween 20. The results were analysed using a BioRad Model 680 ELISA plate reader. The

mean absorbance values of the different transgenic citrus lines were compared using the

1-way analysis of variance with Fisher’s Protected Least Significant Difference test.

Statistical analysis was done using the SPSS version 8.0 software (Chicago, Illinois).

Challenge of Transgenic Plants with Citrus exocortis viroid (CEVd)

Ten plants from the transgenic lines, N3, N11, N25, N63 and N71, were challenged

with CEVd by graft inoculation. N9 was omitted from the experiment due to a shortage

of replicated plants. After one month, RNA was extracted from the viroid-inoculated

plants. Briefly, 0.2 g of tissue was ground in liquid nitrogen. Four hundred microliters of

41

STE (0.01 M Tris-HCl pH8.0, 0.1 M NaCl, 0.01 M EDTA) and phenol, chloroform-

isoamyl alcohol (24:1), and 91.4 µl of 10% SDS was added to each sample which was

briefly vortexed, shaken at room temperature for 10 min and centrifuged at maximum

speed at 4°C. The supernatant was transferred to a new tube to which 0.02 g of CF-11

powder and ethanol (final concentration of 35%) were added. The samples were shaken

at 4°C for 30 min, centrifuged and the supernatant discarded. The resultant pellet was

washed four times with 1x STE + 35% ethanol. The RNA was precipitated at -20°C with

0.1 volume of 3 M sodium acetate pH 5.2 and 2.5 volumes of 95% ethanol. The RNA

pellets were resuspended in 20 µl of RNAse-free water. Five microlitres of RNA was

used in RT reactions with primers CEV D-5 5'-ACGAGCTCCTGTTTCTCCGCTG-3'

and CEV D-7 5'CCGGGCGAGGGTGAAAGCCC-3' (Sieburth et al. 2002), and MMLV

reverse transcriptase (Invitrogen, Carlsbad, CA). The following parameters were used for

the RT reaction: 42°C for 15 min, 99°C for 5 min and 5°C for 5 min. One tenth of the

volume of the RT reaction was used for PCR with primers CEV D-5 and CEV D-7. The

PCR parameters were as follows: 92°C for 5 min, and 30 cycles of 92°C for 30 sec, 55°C

for 45 sec and 72°C for 45 sec, with a final extension step at 72°C for 3 min. The

products were analyzed on a 2% agarose gel.

To determine whether there was any difference in the level of viroid in the plants,

1 µl of a 1:10, 1:100 and 1:1000 dilution of each RNA sample was spotted onto a

Hybond+ membrane, and the procedure for Northern blotting as described in the Roche

hybridization manual was followed. The DIG-labeled probe used for hybridization was

synthesized by PCR according to the manufacturer’s instructions (Roche) using the

primers CEV D-5 and CEV D-7.

42

Results

Transformation and Regeneration

For the transformation experiment a total of 10,850 epicotyl segments were used,

of which only 3% produced shoots (Table 3-3). Once the regenerated shoots had been

transferred to root-inducing medium, they were examined for GFP expression. Only

1.44% of the shoots from the PAPc transformation experiment expressed GFP (Figure

3-3), and this expression was not uniform throughout the shoots. The percentage of PAPn

and PAPx-transformed shoots expressing GFP was slightly higher, with two PAPn and

one PAPx seedling expressing GPF in all tissues (Table 3-3).

Since the process for visualization of GFP expression in citrus tissue was not yet

optimized, all shoots were also tested for the presence of the PAP and GFP genes by PCR

(Figure 3-4). It was found that there was a comparatively good association between GFP

expression and the presence of the GFP transgene. PCR analysis for the presence of the

PAP gene in PAPc transformants showed that 9.4% of the regenerated shoots carried the

transgene as opposed to 1.44%, which had both PAP and GFP genes (Table 3-3).

Shoots that produced roots were transferred from the growth chamber to a growth room

with a temperature of 28ºC and light cycle of 16 h light followed by 8 h of darkness.

Once the plants had been acclimatized and transferred to the greenhouse, they were

periodically screened for the presence of the PAP transgene by PCR. Results showed that

all of the PAPc plants that had initially tested positive for the PAP gene were negative.

None of the PAPx and PAPv plants survived after being transferred to soil.

Phenotypically, the PAPn plants were indistinguishable from the

non-transformants. The PAPc-transformed plants did not exhibit any abnormality except

that they grew more slowly than the non-transformed plants (Figure 3-5 A). The PAPv

43

PCR-positive plants that had been transferred to soil exhibited a severely stunted

phenotype (Figure 3-5 B) and did not survive.

Figure 3-3. Analysis of GFP expression in citrus shoots regenerated from epicotyl

segments transformed with pCambia2202-PAPc and -PAPn. A-C) Transgenic shoots expressing GFP. D) Non-transgenic plant exhibiting auto-fluorescence.

44

Figure 3-4. PCR analysis of potentially transgenic shoots containing the PAPn transgene.

The names of the plants are indicated above the lanes. A) PCR amplification of the PAPn gene using the primers CN444 and CN445. B) PCR amplification of the GFP gene using the primers CN462 and CN463. N14, N15, N17, N18, N19, N20 and N21 were negative for GFP. The plasmid used as a positive control was pCambia2202 containing the PAPn gene.

Table 3-3. Summary of results for the transformation of Citrus paradisi cv. Duncan grapefruit with pokeweed protein (PAP) antiviral constructs.

Construct No. Segments used in transformation experiment

No. Segments producing shoots

Total no. shoots regenerated

No. shoots expressing GFP

No. PCR Positive shoots PAP GFP

% shoots PAP and GFP positive

No. Transgenic survivors in soil

PAPc 5000 120 (2.40%) 138 2 13 2 1.44 0 PAPn 4400 196 (4.45%) 215 17 17 22 7.90 6 PAPx 850 11 (1.29%) 14 1 2 1 7.14 0 PAP 600 6 (1.00%) 6 0 2 0 0.00 0 Total 10,850 333 373 20 32 25 6

45

46

Southern Blot Analysis and RT-PCR of Transgenic Plants

Initial information on transgene integration was provided by the PCR results (Table

3-3 and Figure 3-4). However, information on the number of copies of the transgene can

only be provided by Southern blot analysis. Nine surviving plants that were PCR-positive

for the PAPn gene were analyzed for stable integration of the transgene and its copy

number by Southern blot analysis. The plant genomic DNA was digested with BglII,

which does not have a cleavage site within the transgene sequence. There was no

hybridization of the PAP-derived probe to the non-transformed control (Figure 3-6, lane

1). All the plants were found to be stable transformants resulting from independent

integration events and having one to four copies of the PAP sequence present, with the

totally GFP-expressing plant, N101, having just one copy of the gene.

The four plants, N8, N10, N16 and N101 died. The remaining plants were analyzed for

transcript production by RT-PCR. Traditionally, transgene transcripts are analyzed by

Northern blotting. However, RT-PCR is increasingly being used as an alternative method,

especially when only a qualitative result is sought. To eliminate the possibility that PCR

positives might be due to the amplification of contaminating genomic DNA, the RNA

was DNAse-treated prior to the RT reaction, and this RNA was then also used as a

negative control (No-RT reaction) in the PCR amplification of the PAP gene. As seen in

Figure 3-7 no amplification was obtained for the non-transformed control and the No-RT

controls. This confirmed that the RT-PCR amplified products observed for N3, N9, N11,

N63 and N71 were the result of amplification of DNA complementary to PAP mRNA

that had been transcribed in these plants. Plant N25, which has the PAP gene integrated

into its genome, did not yield an RT-PCR product, suggesting that the gene had been

silenced.

47

A

B

Figure 3-5. Phenotypes of plants transformed with the PAPc and PAPv constructs. A)

PAPc transformants are on the right and non-transformed plants are on the left. B) A non transformed plant is on the left and a plant transformed with PAPv is on the right.

48

Figure 3-6. Southern analysis to determine transgene copy number in transgenic

grapefruit plants transformed with PAPn. A) Lane 1, non-transformed negative control; 2, N3; 3, N63; 4, N101; 5, plasmid positive control; 6, N10; 7, N16; 8, N8; 9, N11; 10, N9. B) Lane 1, N25; 2, N71; 3, plasmid positive control.

Protein Expression Analysis

The five plants for which PAP expression had been demonstrated at the level of

transcription were further analysed by western blotting for expression of the recombinant

protein. Faint bands corresponding to the 29 kDa protein obtained for the wild type

positive control were detected for the plants N3, N9, N11, N63, and an extremely faint

band was observed for N71, indicating that the protein was being expressed in the

transgenic plants, albeit at a very low level (Figure 3-8).

49

Figure 3-7. RT-PCR analysis of transgenic citrus transformed with PAPn to determine

gene expression at the level of transcription. Lane 1, lambda-HindIII; 2, plasmid control; 3, no nucleic acid control; 4, non-transgenic-RT; 5, non-transgenic no-RT; 6, N3-RT; 7, N3 no-RT; 8, N9-RT; 9, N9 no-RT; 10, N11-RT; 11, N11 no-RT; 12, N25-RT; 13, N25 no-RT; 14, N63-RT; 15, N63 no-RT; 16, N71-RT; 17, N71 no-RT. Total RNA was isolated from the plants and cDNA was prepared using 5 µg of RNA.

Figure 3-8. Western blot analysis of total soluble proteins from transgenic citrus to

determine the expression the PAPn transgene. Lane 1, molecular weight marker; 2, 250 ng purified commercial PAP; 3, non-transgenic control; 4, N3; 5, N9; 6, N11; 7, N63; 8, N71.

Virus Challenge of Transgenic Plants

In vivo antiviral activity of the five transgenic lines expressing PAP, as well as line

N25 which contained the PAP transgene but did not express it at detectable levels, was

50

tested by graft inoculating the multiplied lines with the severe CTV strain, T66

sub-isolate E. Plant samples were tested for viral antigen levels by ELISA two and four

months after inoculation. Absorbance values twice that of the healthy control were scored

as positive reactions for the presence of CTV.

ELISA results after two months showed that almost all of the multiplied plants

within each of the five PAP-expressing lines as well as line N25 were positive for the

virus as determined by comparison of antigen levels in these lines with that of the

non-infected control (mean = 0.03125). Absorbance values (A405 nm) ranged from

0.0335-1.3235 for N3, 0.0445-1.3915 for N9, 0.0165-0.585 for N25, 0-1.541 for N63 and

0.002-2.165 for N71. Despite scoring an overall positive ELISA reaction for the presence

of CTV, approximately 50% of the replicates of the lines N11, N25, and N71 and 25% of

those in lines N3, N9, and N63 tested negative for CTV. However, statistical analysis of

the absorbance data showed that the viral antigen levels of the transgenic plants were not

significantly different from that of the non-transgenic control.lines.

After four months, CTV antigen levels decreased in comparison to the antigen

levels after two months in lines N3 (87.4%), N9 (105.1%), N11 (115.4%) and N63

(22.3%). An increase in antigen levels was observed for lines N71 (2.4%) and N25

(54.8%) in comparison to the level of CTV antigen present in the plants after two months.

Despite the increased antigen level, line N25 maintained one of the lowest levels of CTV

after four months, when compared to the non-transgenic control. The mean absorbance

values for the transgenic plants were lower than that of the non-transgenic control. The

line N9 showed the lowest CTV antigen level as compared to the control (344.1%),

followed by N11 (270.9%), N25 (251.6%), N63 (142.8%), N3 (90.0%) and N71 (63.0%).

51

Statistical analysis showed that the mean absorbance values obtained after four months

were significantly lower than that of the non-transgenic control (Table 3-4).

Table 3-4. CTV antigen levels four months post-inoculation.in transgenic Citrus paradisi plants expressing PAPn

Plant Line¶ Mean Absorbance at 405 nm§ Non-transgenic control 0.675 a N71 0.414 b N3 0.355 b c N63 0.278 b c d N25 0.192 c d N11 0.182 d N9 0.152 d Mean absorbance values of the different transgenic citrus lines were compared using Fisher’s Protected Least Significant Difference test. Means with the same letter are not significantly different at P=0.05. ¶ Eight to twenty-eight plants per transgenic citrus line were graft-inoculated with CTV strain T66 sub-isolate E § CTV antigen levels were determined by DASI-ELISA four months post-inoculation. Viroid Challenge of Transgenic Plants

Plants were assayed for the presence of viroid RNA by RT-PCR one month after

inoculation. The plants from transgenic lines N3, N11, N24, N63 and N71 tested positive

for the presence of CEVd (Figure 3-9). To determine whether there were differences in

the levels of viroid present in the transgenic plants versus the controls, a Northern dot

blot was done using three different 10-fold dilutions of each RNA sample. The transgenic

and control plants appeared to have similar levels of viroid RNA, indicating that PAPn

had no effect on viroid replication (data not shown).

Discussion

The broad-spectrum virus resistance displayed by wild type PAP and its mutants

makes it an ideal candidate for the development of virus-resistant plants. PAP-expressing

transgenic plants have been obtained for N. benthamiana, N. tabacum cv. Samsun,

Solanum tuberosum cv. Russet Burbank and Agrostis stolonifera L. (creeping bentgrass).

52

Figure 3-9. RT-PCR analysis of representative viroid-infected PAPn-transgenic plants.

A) Lane 1, 100 bp marker; 2, no DNA control; 3, healthy control; 4, positive control; Lanes 6, 9, 11, line N25; 7, 15, line N3; 8, 13, 16, line N71; 10, 14. line N63. B) Lane 1, 100 bp marker; 2, line N63; 3, 4, line N11; 5-11, infected non-transgenic controls. The plants were graft-inoculated with CEVd and assayed for the presence of the viroid RNA one month later.

These plants have been evaluated for resistance to RNA viruses such as TMV,

CMV, PVX and PVY as well as the fungi Rhizoctonia solani and Sclerotinia homeocarpa

(Dai et al., 2003; Lodge et al., 1993; Tumer et al., 1997; Zoubenko et al., 2000). The

objective of this research was to transform Duncan grapefruit with PAP mutants and

53

determine the efficacy of these mutants as antiviral agents against CTV and CEVd. Both

pathogens have RNA-based genomes, albeit with different structures.

The percentage of shoots produced in the transformation experiment as a whole

was very low at 3%. This value is considerably lower than the 23-29% obtained in C.

paradisi transformation experiments by Rosales (2001), Cevik (2001), and Luth and

Moore (1999) using the same protocol. Lower percentages of regeneration, ranging

between 4% and 13%, were obtained by Febres et al. (2003). Collectively very few

transformed shoots were obtained. The only surviving transformants contained the PAPn

construct. PAP mutants, PAPn and PAPc, reportedly retain their antiviral activity without

the toxic rRNA depurination activity, while PAPv retains both properties and PAPx is an

inactive form of the protein (Tumer et al., 1997; Zoubenko et al., 2000). Therefore, one

would expect that only the PAPv construct would produce a low number of

transformants. Tumer et al. (1997) and Zoubenko et al. (2000) were able to obtain

transformation frequencies of approximately 13% in N. tabacum transformed with the

non-toxic forms of PAP. Very few transformed tobacco plants and only one transformed

potato plant containing the PAPv gene were obtained, and only at low expression levels

of PAPv did the plants resemble non-transformed plants (Lodge et al., 1993).

Transformation of creeping bentgrass with PAPc produced very few transgenic plants,

which ultimately did not exhibit the same level of pathogen resistance as their N.

tabacum counterparts (Dai et al., 2003). Therefore, it is possible that the nature of the

gene, combined with the inherent problems of transforming a heterologous host such as

citrus, may have had an impact on the number of transgenic plants produced.

54

PCR analysis of the transgenic plants revealed that not all plants had both PAP and

GFP genes (Table 3-3). Most of the plants contained only the PAP gene. This

discrepancy may be due to the partial integration of T-DNA. It is known that transfer

proceeds from the right border of the T-DNA to the left border (reviewed by Gelvin,

2003). Thus one would expect a higher proportion of plants to be positive for the reporter

gene, which is closest to the right border. However, transfer can occasionally be initiated

from the left border, and the efficiency of transfer depends upon the binary vector and

Agrobacterium strain used. All of the PAPc shoots that had been PCR positive for the

transgene appeared to eventually have lost the gene. This may be due to the fact that

these plants had been chimeras, and new tissue growth did not contain the gene of

interest. Alternatively, the gene may have been deleterious to the plants, and

chromosomal rearrangements may have led to the loss of the PAP gene.

Before evaluating transgenic plants for their performance in field trials, it is

important to first characterize the plants with respect to transgene integration and

transcript production. A number of stably transformed grapefruit containing 1-4 copies of

the transgene per genome were obtained (Figure 3-6) and of the six surviving plants, five

had detectable levels of PAPn transcript and protein. Except for N9, all these plants as

well as the plant, N25, which retained the transgene in its genome but did not express it at

a detectable level, were replicated and challenged with both CEVd and CTV strain T66

sub-isolate E by graft inoculation. The replication of CEVd was not inhibited in the

transgenic plants. A possible reason for this result is that the site of replication for viroids

in the Pospiviroidae group is the cell nucleus. Thus the replicating viroid RNA may have

been protected from PAPn. Vivanco (1999) showed that spraying plants with a RIP from

55

Mirabilis jalapa prior to inoculation with PSTVd, prevented infection of the plants by the

viroid. Thus in this case the RIP had access to the viroid RNA and could have inactivated

it via its N-glycosidase activity.

Using a rule that an A405 nm two times higher than the non-inoculated control

constituted a positive result for the presence of CTV, 25-50% of the transgenic plants

tested negative for the presence of the virus after two months. This result was not

completely unexpected, since in many cases PAP-expressing transgenic plants have been

shown to accumulate lower levels of virus rather than showing total resistance to

infection (Lodge et al., 1993; Tumer et al., 1997). In antifungal tests PAP-expressing

plants also showed a lower percentage of disease incidence (Dai et al., 2003; Zoubenko et

al., 2000) and in virus and fungal-infected plants, the onset of disease was delayed.

Statistical analysis of the ELISA data showed that there was no significant difference in

CTV antigen levels in comparison to the non-transgenic controls after two months.

Surprisingly, line N25, for which no PAPn transcript was detected, had the lowest level

of CTV. After four months, viral antigen levels decreased in lines N3, N9, N11 and N63

and overall, the transgenic plants had significantly lower levels of CTV than the non-

transgenic control. After four months, line N25 still had one of the lowest levels of CTV,

despite a 54.8% increase in antigen levels. Dai et al. (2003) found that two creeping

bentgrass transformants expressing PAPII, an isoform of PAP, showed no detectable

protein expression and only a very low level of PAPII mRNA, and yet these plants

exhibited restance to Sclerotinia homeocarpa. Thus, the levels of PAPn mRNA and

protein in line N25 may have been below the limits of detection by the methods used,

since a low level of CTV antigen was detected, indicating aresistance phenotype. The

56

results obtained suggest that the expression of the PAPn gene in Citrus paradisi causes an

antiviral response. From these results, it can be concluded that the PAPn construct does

not provide complete resistance to CTV. However, the decrease in viral antigen with time

would need to be monitored for a longer period to ascertain the full and accurate effect of

PAPn on CTV infection.

CHAPTER 4 THE EFFECT OF POKEWEED ANTIVIRAL PROTEIN ON THE REPLICATION OF

Citrus tristeza virus IN Nicotiana benthamiana PROTOPLASTS

Introduction

Early attempts to produce virus-resistant plants were based on the pathogen-derived

resistance (PDR) approach, which utilizes genes and defective interfering RNAs or

DNAs of viral origin (reviewed by Baulcombe, 1996). Since then, researchers have tried

to exploit plant genes conferring natural resistance to particular pathogens by

transforming these genes into heterologous plant hosts, and also altering the expression of

genes involved in plant defense-related signal transduction pathways. A group of proteins

that have shown promise as naturally occurring antiviral agents are ribosome-inactivating

proteins (RIPs). However, as a result of their N-glycosidase activity, which results in the

inactivation of ribosomes and ultimately the cessation of translation, many wild type

RIPs cause major phenotypic aberrations when expressed in heterologous hosts.

Pokeweed antiviral protein (PAP) is a RIP that adversely affects plant development

when expressed in tobacco at concentrations higher than 5 ng/mg of total protein (Lodge

et al. 1993). PAP was shown to inhibit infection of plants by seven different viruses, each

representing a different virus group (Chen et al., 1991); thus PAP might confer a broad-

spectrum of resistance to plants. The potential agronomic value of PAP as a

broad-spectrum resistance agent prompted the search for non-toxic mutants that retained

their antiviral activity. Several such mutants were identified by random mutagenesis and

selection in Saccharomyces cerevisiae (Hur et al., 1995). Two of these mutants, viz.

57

58

PAPc (Trp237-stop) and PAPn (Gly75-Val), have been used successfully to transform

tobacco and produce phenotypically normal plants that exhibited resistance to certain

viruses (Tumer et al., 1997; Zoubenko et al., 2000). Two other mutants that were

produced, viz. PAPv and PAPx showed reduced toxicity and no enzymatic activity,

respectively.

Citrus tristeza virus (CTV) is one of the more complex plant viruses. For many

years the fragile virions, the limited host range, lack of local lesion hosts,

phloem-limitation of virions and a single-stranded RNA genome of approximately 20 kb

in size hampered the in depth study of its biology and molecular characteristics. To

facilitate the study of CTV replication, two protoplast systems, one from a CTV host,

Citrus sinensis cv. Hamlin and the other from a non-host, Nicotiana benthamiana, were

developed (Price et al., 1996; Navas-Castillo et al., 1997). Although the general pattern of

CTV replication, with respect to the time of accumulation of the viral products was the

same in both protoplast systems, the final yields of viral RNAs, proteins and virions were

approximately 40 times higher in N. benthamiana (Navas-Castillo et al., 1997). Virions

were found to be a better source of inoculum than purified genomic RNA. The lower

level of replication observed with RNA as the inoculum is most probably due to the

reduced efficiency of protoplast inoculation as a result of the large genome size. The

development of a full-length infectious cDNA clone of CTV and smaller CTV replicons

has further increased the progress towards understanding the gene functions and

replication strategy (Satyanarayana et al., 1999). The smaller replicons are much more

efficient at transfecting N. benthamiana protoplasts, indicating that the large genome size

may have been a limiting factor in previous work.

59

The study of the effect of different genes and genetic mutations on replication of

CTV can be done in either citrus or N. benthamiana protoplasts. However, if the

objective is to study the effect of a stably integrated heterologous gene on CTV

replication, it would be more efficient to use the N. benthamiana protoplast system. The

relatively short generation time and an established transformation protocol make N.

benthamiana an ideal model system in which to study the effect of potential resistance

agents on viral replication.

The objectives of this study were to transform N. benthamiana with PAP mutants,

characterize the resultant transgenic plants by molecular methods and to examine the

effect of the expressed recombinant proteins on CTV replication in a protoplast system.

Materials and Methods

Constructs

The four constructs used for transformation, viz. PAPn, PAPc, PAPv and PAPx

were described in Chapter 3. The plasmids were transformed into Agrobacterium

tumefaciens strain AGL1 by the cold-shock transformation method (Birnboim and Doly,

1979).

Tobacco Transformation

Explant preparation

Nicotiana benthamiana seeds were sterilized by shaking them in 70% ethanol for

10 min, 0.042% sodium hypochlorite solution plus Tween 20 for 20 min and 3 x 2 min in

sterile deionized water. The seeds were germinated on half strength MS medium

(2.15 g/L MS salts, 50 mg/L myo-inositol, 10 g/L sucrose pH 5.8) supplemented with

6 g/L of agar. The plates were kept in a growth chamber that had a constant temperature

of 28°C and white fluorescent lighting with a 16 h day and 8 h night cycle. Once the

60

seedlings had a well developed root, they were transferred to sterile soil in jars and

magenta boxes, and grown until the upper leaves reached a size of 2-3 cm across.

Transformation and regeneration of tobacco

The transformed Agrobacterium cultures were grown overnight at 28°C in YEP

medium (10 g/L yeast extract, 10 g/L Bacto peptone, 5 g/L sodium chloride)

supplemented with 50 µg/ml carbenicillin and 100 µg/ml chloramphenicol. The cultures

were centrifuged at 5000 rpm in a Beckman GSA rotor for 5 min and the cell pellet

resuspended in MS medium containing 100 µM acetosyringone to give a final

concentration of 5x108 cfu/ml. The leaves from sterile explants were cut into 1 cm2,

transferred to the Agrobacterium solution for 1 min, and the excess liquid removed prior

to being transferred to regeneration medium (4.3 g/L MS salts, 100 mg/L myo-inositol,

4 mg/L thiamine, 30 g/L sucrose, 1 mg/L IAA, 2 mg/L kinetin). The plates were

incubated in the growth chamber for 48 h and then transferred to regeneration medium

supplemented with 200 mg/L mefoxin and 50 mg/L kanamycin. The leaf pieces were

transferred to fresh medium every two weeks. Shoots were transferred to rooting medium

(R1/2N) supplemented with 200 mg/L mefoxin and 50 mg/L kanamycin. After the

appearance of the first root, shoots were transferred to soil in pots and covered with a

plastic bag which was slashed after a few days to allow the plants to become acclimated

to the conditions in the growth room (28°C, 16 h photoperiod).

Analysis of Transgenic Plants by PCR

All the regenerated plants were tested for the presence of the transgene by PCR

using either of two gene-specific primer pairs, CN444, 5'

ATTAGGGCCCGGGAAGATGAAGTCAATGCTTGTG 3' and CN445 5'

61

AATTGCGGCCGCTCAGAATCCTTCAAATAGATC 3', or CN444 with CN273 5'-

TTATCTGGGAACTACTCACAC 3’, which is specific for the CaMV 35S termination

sequence. DNA was extracted from the plants using a modification of the protocol by

Oliveira et al. (2000), previously described in chapter 2. PCR was carried out in a

Biometra thermocycler using a profile of 94°C for 2 min initial denaturation, 29 cycles of

denaturation at 94°C for 30 sec, primer annealing at 55°C for 45 sec, primer extension at

72°C for 45 sec and a final primer extension step of 72°C for 5 min. The PCR products

were analysed by electrophoresis in 1% agarose gels in TAE buffer.

Southern Hybridization

For Southern hybridization 10 µg of total genomic DNA from transgenic plants and

non-transformed control plants was digested with BglII (Invitrogen, Carlsbad, CA). After

agarose gel electrophoresis the DNA was transferred to nylon membrane (Hybond N+,

Fisher Scientific) by capillary action overnight (Sambrook et al., 1989). Using the

primers CN444 and CN273, a DIG-labeled probe was produced by PCR amplification

according to the manufacturer’s instructions (Roche, Indianapolis, IN). The DIG-labeled

probe was denatured and used for a 16 h hybridization following 2-4 hours of

prehybridization in DIG Easy Hyb Buffer (Roche). The blot was prepared for

visualization on X-ray film according to the protocol provided by Roche.

Reverse-Transcription (RT) PCR

PAP gene expression at the transcriptional level was analysed in the transgenic

plants by RT-PCR. Total RNA was isolated from the plants with TRIzol reagent

(Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Prior to RT-

PCR, the RNA was treated with DNAse (Promega, Madison, WI) to eliminate any DNA

contaminants, and then phenol-chloroform cleaned to remove the DNAseI. cDNA was

62

prepared using 5 µg of RNA, the reverse primer CN273 and MMLV reverse transcriptase

(Promega). The parameters for the RT reaction were: 1 hour at 42°C and 15 min at 70°C.

One tenth of the volume of the RT reaction was used for PCR with the primers CN273

and CN444 and the products were analysed on a 1% agarose gel run in TAE buffer.

Analysis of Protein Expression

PAP expression was analyzed by both Western blotting and ELISA. Protein

concentration was determined by the Bradford Assay (BioRad, Hercules, CA). For

Western blotting, aliquots of the soluble plant proteins in phosphate buffered saline (PBS,

137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4), were mixed

with equal volumes of dissociation buffer (140 mM SDS, 160 mM Tris-HCl pH 7.8,

1% v/v glycerol, 142 mM β-mercaptoethanol), to give a final concentration of 100 µg

total protein, which was then boiled for 2 min and separated on a precast 12%

polyacrylamide Tris-HCl gel (BioRad). Proteins were transferred to nitrocellulose

membrane using a BioRad semi-dry horizontal electrotransfer apparatus according to the

manufacturer’s instructions. Colorimetric detection of the protein was carried out using a

1:500 dilution of 0.5 mg/ml anti-PAP-IgG (provided by Dr. Maria Kaniewski) and the

substrates NBT and BCIP (Sigma).

For ELISA analysis the 96 well plates were coated with either a 1:500 or 1:1000

dilution of anti-PAP-IgG. The plant tissue was extracted in an equal volume of PBS-

Tween 20 containing polyvinylpyrrolidone (PVP-40). The PAP-alkaline phosphatase

conjugate (provided by Dr Maria Kaniewski) was used at a 1:5000 dilution. All

incubations were carried out overnight at 4°C. The substrate, ρ-nitrophenyl-o-phosphate

63

was used at a concentration of 1 mg/ml. The plates were analyzed using a BioRad Model

680 plate reader and associated software.

Determination of Antiviral Properties of Transgenic Plants

To determine whether the transformed plants exhibited antiviral activity, five plants

from the R0 and one from the R1 generation along with a non-transgenic control plant

were challenged with Tobacco mosaic virus (TMV), a virus known to be inhibited by the

antiviral activity of PAP (Lodge et al., 1993). Infected plant material (0.5 g) was ground

in liquid nitrogen, resuspended in 5 ml of PBS containing carborundum, and applied to

the leaves. Leaf samples were collected and analysed by ELISA at 7 and 14 days post-

inoculation. The 96 well plates were coated with the antigen for 2 h at room temperature,

followed by incubations with the TMV-U strain antibody (provided by Dr. Ernest

Hiebert) and goat-anti-rabbit-alkaline phospatase conjugate (Sigma) used at a 1:5000 and

1:30 000 dilution respectively. Results were analyzed using a Bio-Rad Model 680

microplate reader. The mean absorbance values obtained from the different tobacco lines

were compared using the 1-way analysis of variance with Fisher’s Protected Least

Significant Difference test. Statistical analysis was done using the SPSS version 8.0

software (Chicago, Illinois).

Viral Replication in Transgenic Protoplasts

R1 plants from lines TN5, TN11, TN18, TN23a and TN27a were grown for six

weeks under controlled environmental conditions. Fully expanded leaves were sterilized

in 70% ethanol and 10% sodium hyperchlorite and washed 3 times in sterile water. The

lower surface of the leaves were slashed at approximately 1 mm intervals and incubated

overnight in the dark at 25°C, in an enzyme solution containing 0.5% Onozuka cellulase

RS (Yakult Honsha, Japan) and 0.25% macerase pectinase (Calbiochem, USA) dissolved

64

in 13% MMC buffer (13% D-mannitol, 5 mM MES, 10 mM CaCl2, pH 5.8). The

mesophyll protoplasts were isolated and transfected with CTV virions using polyethylene

glycol (PEG) mediated transfection as described by Navas-Castillo et al. (1997) and

Satyanarayana et al. (1999). The macerated leaves were centrifuged at 100 x g for 3 min

and the supernatant was discarded. The pellet was resuspended in 15 ml of 0.6 MM

buffer (0.6M D-mannitol, 5 mM MES, pH 5.8) and centrifuged for 3 min at 100 x g. The

pellet was resuspended in 0.6 MM buffer, layered over 20.5% sucrose, centrifuged for 7

min at 100 x g. The protoplasts were collected from the top layer and washed twice with

0.6 MM. Ten microliters of purified CTV virions were added to 200 µl of protoplasts.

Five hundred microliters of PEG 1540 was then added, and the solution was gently mixed

for 20 sec, after which 0.6 MM bufferwas added. The protoplasts were allowed to recover

for 10 min and centrifuged at 100 x g for 3 min. The pellet was resuspended in 0.6 MM

AOKI (0.6 M D-mannitol, 5 mM MES, 100 ml of 10x AOKI salts to make 1 L of

solution, pH 5.8) containing a 1:200 dilution of antibiotic/antimycotic solution (Sigma,

St. Louis, MO), centrifuged at 100 x g for 3 min and resuspended in a final volume of 3

ml of 0.6 MM AOKI with antibiotic/antimycotic. The protoplasts were incubated under

light and harvested three days post-inoculation (dpi). Total RNA was isolated and

Northern hybridization was performed as described by Satyanarayana et al. (1999), using

positive and negative sense 3' terminal probes.

Results

Transformation and Regeneration

A total of seventy-four shoots were obtained from all the N. benthamiana

transformation experiments. The majority of the shoots produced had been transformed

with the PAPn construct and no shoots were obtained from leaf disks transformed with

65

PAPv (Table 4-2). The potentially transgenic plants were screened only by PCR for the

presence of the transgene (Figure 4-1). Although 55 plants initially tested positive for the

presence of the transgene, subsequent PCR screens as the plants matured revealed that

only 27 continued to test positive. The plants that maintained the transgene after three

months (as determined by PCR) had all been transformed with the PAPn mutant. No

phenotypic abnormalities were observed for the surviving plants.

Figure 4-1. PCR analysis of selected potential transgenic N. benthamiana plants using

primers CN444 and CN445. Lane 1, 1 kb marker; 2, no DNA control; 3, plasmid control; 4, non-transgenic control; 5, N5; 6, N6; 7, N7; 8, N8; 9, N9; 10, N10; 11, N11; 12, N12; 13, N13.

Table 4-1. Summary of N. benthamiana transformation experiments with the PAP

constructs. Construct Total number of

shoots Initial PCR Positive

PCR positive after 3 months

PAPv 0 0 0 PAPc 24 12 (50.0%) 0 PAPx 9 4 (44.4%) 0 PAPn 55 39 (70.9%) 27 (49.1%) Molecular Analysis of Transgenic Plants

All the transgenic plants that survived and had been transferred to soil were

analyzed by Southern blotting to determine the transgene copy number. No hybridization

of the PAP-specific probe was detected in the genomic DNA sample from the

66

non-transformed control (Figure 4-2). The transgene was stably integrated with the copy

number of the PAPn transgene varying from 1-4 copies per genome (Figure 4-2). Having

established the genomic integration of the transgene, the plants were analyzed for PAPn

transcript production by RT-PCR (Figure 4-3). Total RNA isolated from the transgenic

plants was first treated with DNAseI to remove any contaminating DNA that might result

in a false positive result. The results showed that the transgene was transcribed in 48.1%

of the surviving plants.

Figure 4-2. Southern analysis of R0 tobacco plants transformed with PAPn. The names of

the plants are indicated above the lanes. TUT is a non-transformed control plant. The positive control is a plasmid containing PAPn, digested with PstI.

Since the protein product of the PAP gene is required for antiviral activity, the

plants were further analysed by western blotting and ELISA in order to determine

whether the protein is being expressed. No protein was detected when the plants were

analyzed by western blotting (data not shown). Since ELISA is more sensitive than

67

western blotting, the plants were screened for protein expression using this technique. In

comparison to the colorimetric reaction of purified wild type PAP (Worthington) at

concentrations as low as 1 ng, the level of PAPn in the plants tested was not visually

detectable. Including purified PAP at different concentrations, and using the ELISA

analysis software to construct a standard curve, PAPn levels of 0-25 pg/mg were

determined (Table 4-2).

Figure 4-3. RT-PCR analysis of RNA isolated from selected transgenic plants to

determine PAPn expression at the transcriptional level. Lane 1 is the λ HindIII molecular weight marker. Lanes 2, 4, 6, 8, 10, 12 and 14 are the no-RT controls for each sample during the PCR reaction. Lane 3, non-transformed control; 5, TN5; 7, TN7; 9, TN11; 11, TN18; 13, TN23a; 15, TC27.

The low or undetectable levels of PAPn protein in the transgenic plants raised

questions as to whether it would be viable to continue with the CTV replication studies in

protoplasts derived from the progeny of these plants. Therefore, it was decided to

challenge five R0 plants and one R1 plant with TMV, a virus known to be inhibited by

PAP (Lodge et al., 1993). The second and fourth systemically infected leaves were

evaluated for virus antigen levels by ELISA at 7 dpi and 14 dpi respectively (Table 4-2).

The absorbance values obtained showed that there was no detectable level of TMV in all

68

the test plants after one week, as compared to the non-transgenic control. Statistical

analysis of the mean absorbance values obtained for each plant 14 dpi, using Fisher’s

Protected Least Significant Difference test showed that all five transgenic plants had

significantly lower levels of virus antigen compared to the control and that the level of

virus in TN5, TN11 and TN18 was significantly different from TC27, TN7 and TN23a

(Table 4-2). Comparison of the ELISA data obtained 7 and 14 dpi using a one tailed t-test

assuming equal variance showed that there was no significant difference in virus antigen

levels after the two week period for TN5, TN11, TN18 (Table 4-2). Thus these plants

containing the PAPn transgene showed resistance towards TMV, although this resistance

was not complete since a low level of viral antigen could be detected by ELISA. These

results were the basis for proceeding to study the effect of PAPn on CTV replication.

Table 4-2. TMV antigen levels in transgenic N. benthamiana expressing PAPn following infection with the virus.

Plant Line PAP (pg/ml)§ Mean Absorbance¶ 7 dpi 14 dpi

Infected non-transgenic control 0 0.0705 0.230a TC27* nd 0.008 0.154b TN23a nd 0.005 0.121b TN7 nd 0.0055 0.117b TN11 25.1 0.006f 1.067x10-2cf TN18 5.05 0.0055e 9.33x10-3ce TN5 nd 0.006d 8.667x10-3cd Mean absorbance values of the different plants 14 dpi were compared using the 1-way analysis of variance with Fisher’s Protected Least Significant Difference test. Means with the same letter are not significantly different at P=0.05. dpi: Days post-inoculation. § PAPn levels were quantitated by ELISA. ¶ The second and fourth systemically infected leaves were assayed for virus antigen levels by ELISA 7 and 14 dpi, respectively. *This plant was from the R1 generation. All other plants were from the R0 generation. nd=not detectable

69

CTV Replication in PAPn-Transgenic N. benthamiana Protoplasts

The replication of CTV in the protoplasts was assessed by Northern blot analysis.

Analysis of RNA extracted from the CTV virion-transfected protoplasts, using a 3' minus

sense probe showed no difference between the levels of positive sense RNA in the

transgenic plants when compared to the control (Figure 4-4 A). This result may have

been influenced by the presence of the positive- sense input RNA, which masked the true

level of replication.

Figure 4-4. Northern blot analysis of CTV RNAs in N. benthamiana protoplasts derived

from PAPn transgenic R1 plants. A) Positive sense 3' probe. B) Negative sense 3' probe. Lane 1, inoculated non-transgenic control; 2, TN5; 3, TN7; 4, TN11; 5, TN18; 6, TN23a. Protoplasts were transfected with CTV virions and RNA isolated 3 dpi. The numbers to the left of the figures indicate the subgenomic mRNAs corresponding to ORFs 4-10. The arrow indicates the genomic RNA.

Thus, to obtain a more accurate view of replication, a 3' positive-sense probe was

used to measure the accumulation of minus strand RNA (Figure 4-4 B). The Northern

hybridization results showed that the production of negative-sense subgenomic RNAs

70

and thus replication was considerably reduced in protoplasts derived from TN11 and

TN23a, while replication in TN5 was comparable to that of the control and TN7 and

TN18 had higher levels of replication. These results indicate that two PAPn transgenic N.

benthamiana lines are able to suppress CTV replication.

Discussion

N. benthamiana was transformed with four mutants of PAP, a ribosome-

inactivating protein reported to confer broad-spectrum resistance to viruses (Lodge et al.

1993). In two of the mutants (PAPc and PAPn) the antiviral activity of PAP has been

separated from the toxic ribosome-inactivating activity. The greater proportion of

transgenic shoots obtained were from transformation experiments with these two

constructs. However, repeated PCR analysis showed that the PAPc plants did not retain

the transgene as the plants matured. A similar result was obtained when Citrus paradisi

cv. Duncan grapefruit was transformed with the same construct (Chapter 3). There are

two possible reasons for this result. First, it is possible that this gene construct is

deleterious to the plants. The second reason could be that the plants were chimeras that

did not express the transgene in every cell. Lodge et al. (1993) showed that PAPc

expressed in transgenic N. tabacum did not have a toxic effect on ribosomes nor did it

cause phenotypic abnormalities. Therefore, the most likely reason for the loss of the

transgene appears to be that the PAPc plants had been chimeras. Not obtaining any

transformants for the PAPv construct was not surprising since PAPv, which has antiviral

activity, is only slightly less toxic to ribosomes than wild type PAP.

Approximately 48% of the plants produced the PAPn transcript. However, PAPn

expression at the protein level was almost undetectable for most of the plants. In other

studies where PAP or PAP mutants were expressed in N. tabacum, N. benthamiana or

71

Solanum tuberosum, PAP levels were usually found to be above 0.6 ng/mg (Lodge et al.,

1993; Tumer et al., 1997). However, expression of PAP mutants in creeping bentgrass

was either non-existent or undetectable, yet field trials with those plants resulted in the

observation of different levels of resistance against the test-pathogen (Dai et al. 2003). To

determine whether the transgenic N. benthamiana plants might have any antiviral

activity, the plants were inoculated with TMV. These plants behaved similarly to the

creeping bentgrass, showing very low levels of accumulation of TMV antigen with time

despite having undetectable levels of PAPn.

Protoplast systems have played a pivotal role in elucidating viral infection events

occurring at the single cell level. Using protoplasts, the effects of salicylic acid on

different cell types during the infection process of TMV and Cucumber mosaic virus

(CMV) were demonstrated (Murphy and Carr, 2002). Events involved in cell-to-cell

movement of CMV and the replication of Cowpea mosaic virus (CoMV) have also been

studied in protoplast systems (Carette et al., 2002; Mise et al., 2001). An N. benthamiana

protoplast system was developed to facilitate the study of CTV replication (Navas-

Castillo et al., 1997). The R1 generation of transgenic plants which had shown inhibition

of TMV accumulation was used to produce protoplasts for the study of the effect of

PAPn on CTV replication. This approach was undertaken to quickly determine whether

PAPn affects CTV replication, as well as to decrease the inoculum pressure as compared

to graft inoculation of a plant. Northern blot analysis showed that three lines, TN5, TN11

and TN23a, were able to inhibit replication of CTV. This suggests that PAPn could be an

effective antiviral agent against CTV and provides further evidence that the PAPn

72

construct expressed at very low to undetectable levels does not completely inhibit CTV

replication. A higher level of PAPn expression might completely inhibit CTV replication.

CHAPTER 5 SUMMARY AND CONCLUSIONS

Genetic engineering for resistance is often specific for a particular pathogen, e.g.

pathogen-derived resistance. Natural selection and the fact that the genomes of RNA

viruses are subject to changes as a result of errors introduced by the RNA polymerase

suggest that PDR may not be effective as a durable form of resistance. Targeting signal

transduction pathways that play a role in the plants’ general defense response, expressing

more than one gene in transformed plants or expressing proteins that can function as

antiviral agents by more than one mechanism, may prove effective in the longterm.

The efficacy of a ribosome-inactivating protein (RIP) from Phytolacca americana,

as an antiviral/antiviroid agent against two citrus pathogens was investigated. The RIP,

pokeweed antiviral protein (PAP), was reported to have broad-spectrum antiviral activity

against plant and animal viruses. The protein was reported to inhibit viral accumulation in

a number of ways. In vitro it inhibited viral translation by removing adenine and guanine

residues directly from the viral RNA; it recognised and preferentially depurinated RNA

that had a 5' methyl-guanosine cap structure; and it inhibited +1 frameshifting in the yeast

retrotransposon, TY1. All three of these mechanisms would be applicable to Citrus

tristeza virus (CTV), while only the first could be predicted to inhibit replication of a

viroid, viz. Citrus exocortis viroid (CEVd). CTV alone has caused the loss of millions of

trees worldwide and the propagation of viroid-infected trees has caused economic losses

in the Florida citrus industry, and is a major threat in regions where susceptible

rootstocks are used.

73

74

To determine whether it would be viable to transform citrus with PAP, a

preliminary experiment to observe the effect of PAP on the translation of CTV was

conducted in vitro. The translation of a CTV replicon, CTV-∆Cla, which retains only the

5' and 3' UTRs, ORFs 1a and 1b and a gene fusion between ORF11 and part of ORF2,

was first optimized. CTV-∆Cla RNA was then incubated in the presence of wild type

PAP prior to translation in a rabbit reticulocyte lysate translation system. A decrease in

translation was observed at 20 ng PAP per 500 ng of RNA. Compared to previous

research, the concentration of PAP required to inhibit translation is very high. However,

since a similar result was obtained with the Brome mosaic virus RNA (a virus whose

translation in known to be inhibited by PAP) used as a control in this experiment, it was

concluded that the preparation of wild type PAP that was used may not have had optimal

enzymatic activity or that optimal activity may have been affected by some component of

the antiviral assay. Since the viral RNA will be exposed to the intracellular environment

in plants, the in vitro translation result demonstrating the direct effect of PAP on the

RNA, suggested that transgenic citrus correctly processing and expressing PAP might

exhibit reduced levels of CTV.

Epicotyl segments of etiolated Duncan grapefruit seedlings were transformed with

four PAP mutant constructs by Agrobacterium-mediated transfer. Two of the mutants,

PAPn and PAPc reportedly retained their antiviral activity without the deleterious

ribosome-inactivating property, while PAPx was an inactive form of the protein, and

PAPv which had antiviral activity was only slightly less toxic to ribosomes than wild type

PAP. Very few transformed plants were obtained, and those that survived to the

pathogen-challenge stage contained only the PAPn transgene. It is possible that the nature

75

of the gene, combined with the inherent problems of transforming a heterologous host

such as citrus, may have had an impact on the number of transgenic plants produced.

Southern analysis of the transgenic plants showed them to be stably transformed with 1-4

copies of the PAPn gene per genome. Of the six plants that survived, only five (N3, N9,

N11, N63 and N71) expressed PAPn at the protein level. However, all six transgenic

plants were replicated in preparation for the graft-challenge experiment. Due to a

shortage of plants, all lines except N9 were challenge-inoculated with CEVd. Plants

assayed for the presence of the viroid by RT-PCR one month post-inoculation were all

positive, indicating that PAPn did not inhibit viroid replication. There has been one other

published report of a RIP being tested for antiviroid activity (Vivanco, 1999). However,

the research did not involve the in vivo expression of the RIP in transgenic plants.

Instead, it was shown that an exogenous application of the RIP prevented viroid

infection. Therefore, a possible reason for the failure of PAPn to inhibit CEVd replication

may be due to the fact that the site of replication for CEVd is the cell nucleus. Thus the

viroid RNA may have been inaccessible to PAPn.

All six transgenic plant lines were graft challenged with CTV and viral antigen

levels were determined by DASI-ELISA two and four months post inoculation. Using a

rule that an A405 two times higher than the non-inoculated control constituted a positive

result for the presence of CTV, 25-50% of the transgenic plants tested negative for the

presence of the virus after two months. This result was not completely unexpected, since

in many cases PAP-expressing transgenic plants have been shown to accumulate lower

levels of virus rather than showing total resistance to infection. Statistical analysis of the

ELISA data showed that virus antigen levels were significantly lower than the non-

76

transgenic control plants for the lines N9, N11, N25 and N63. Surprisingly, the plants of

line N25, in which the PAPn transcript was not detected, accumulated the lowest level of

virus. The reason for this may be the result of the location of the transgene in the plant

genome or the RNA transcript levels may have been below the level of detection.

However, after four months CTV antigen levels increased in all the lines, indicating a

delay in virus accumulation in the plants that had tested negative after two months.

Although all the transgenic plants tested positive for the presence of CTV after four

months, the levels of CTV present in the transgenic lines were significantly lower than

that of the control line. In addition, the mean level of CTV antigen present in each

transgenic line was lower than level present after two months. Thus these results indicate

that the PAPn construct does not provide complete resistance to CTV. However,

continued analysis of the transgenic plants for the presence of CTV is required to

determine whether the CTV levels in these plants will continue to decrease or whether

they will maintain a consistently lower level of CTV in comparison to the non-transgenic

control plants.

Replication of CTV in PAPn-transgenic Nicotiana benthamiana protoplasts

indicated that three lines, TN5, TN11 and TN23a supported a lower level of replication

than the non-transgenic control. This was further evidence that the PAPn construct

expressed at very low to undetectable levels did not completely inhibit CTV replication.

Thus, a larger pool of transgenic grapefruit plants expressing higher levels of PAPn may

have produced plants that did not support CTV replication. Alternatively, expression of

PAPn from a phloem-specific promoter or the expression of other RIP candidates that

77

have antiviral activity, in citrus, may provide resistance to CTV and other pathogens of

citrus.

LIST OF REFERENCES

Albiach-Marti M., Grosser J.W., Hilf M., Gowda S., Mawassi M., Satyanarayana T., Garnsey S., and Dawson W.O. 1999. CTV resistant plants are not immune at the cellular level. Abstract of the 18th Annual Meeting of the American Society for Virology. University of Massachusetts, Amherst, Mass., July 10-14, 1999, pp 192.

Aron G.M., and Irvin J.D. 1980. Inhibition of herpes simplex virus multiplication by the pokeweed antiviral protein. Antimicrob. Agents Chemother. 17:1032-1033.

Atkins D., Young M., Uzzell S., Kelly L., Fillatti J., and Gerlach W.L. 1995. The expression of antisense and ribozyme genes targeting citrus exocortis viroid in transgenic plants. J Gen Virol. 76: 1781-1790.

Ayllon M.A., Rubio L., Moya A., Guerri J., and Moreno P. 1999. The haplotype distribution of two genes of citrus tristeza virus is altered after host change or aphid transmission. Virology 255: 32-39.

Barbieri L., Battelli M.G., and Stirpe F. 1993. Ribosome-inactivating proteins from plants. Biochim. Biophys. Acta 1154: 237-282.

Barbieri L., Valbonesi P., Bonora E., Gorini P., Bolognesi A., and Stirpe F.. 1997. Polynucleotide:adenosine glycosidase activity of ribosome-inactivating proteins:effect on DNA, RNA and poly(A). Nucl. Acids Res. 25: 518-522.

Bar-Joseph M., Marcus R., and Lee R.F. 1989. The continuous challenge of citrus tristeza virus control. Annu. Rev. Phytopathol. 27: 291-316.

Batelli M.G. and Stirpe F. 1995. In Chessin M, Deborde D, and Zipf A (eds). Antiviral proteins in higher plants. CRC Press, Boca Raton, FL, pp 39-64.

Baulcombe D.C. 1996. Mechanisms of pathogen-derived resistance to viruses in transgenic plants. The Plant Cell 8: 1833-1844.

Birnboim H.C., and Doly J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucl. Acids Res. 7: 1513-1523.

Bonfiglioli R., Webb D.R., Symons R.H. 1996. Tissue and intrcellular distribution of coconut cadang cadang viroid and citrus exocortis viroid determined by in situ hybridization and confocal laser scanning and transmission microscopy. Plant J. 9: 457-465.

78

79

Bonner W.M., and Laskey R.A. 1974. A film detection method for tritium-labelled proteins and nucleic acids in polyacrylamide gels. Eur. J. Biochem. 46: 83-88.

Brederode F.T., Taschner P.E., Posthumus E., and Bol J.F. 1995. Replicase-mediated resistance to Alfalfa mosaic virus. Virology 207: 467-474.

Brlansky R.H., Damsteegt V.D., Howd D.S., Roy A. 2003. Molecular analyses of Citrus tristeza virus subisolates separated by aphid transmission. Plant Dis. 87: 397-401.

Campbell M.A., Fitzgerald H.A., and Ronald P.C. 2002. Engineering pathogen resistance in crop plants. Transgenic Research 11: 599–613.

Carette J.E., Gühl K., Wellink J., and Van Kammen A. 2002. Coalescence of the Sites of Cowpea mosaic virus RNA Replication into a Cytopathic Structure. J Virol. 76: 6235-6243.

Carver M. 1978. The black citrus aphids, Toxoptera citricidus (Kirkaldy) and T. aurantii (Boyer de Fonscolombe) (Homoptera: Aphididae). Journal of the Australian Entomological Society 17:263-270.

Cevik, B. 2001. Characterization of the RNA-dependent RNA polymerase gene of citrus tristeza closterovirus. PhD. Dissertation. University of Florida, Gainesville.

Chaudhry B., Müller-Uri R., Cameron-Mills V., Gough S., Simpson D., Skriver K., and Mundy J. 1994. The barley 60 kDa jasmonate-induced preotin (JIP60) is a novel ribosome-inactivating protein. Plant J. 6: 815-824.

Che X., Piestun D., Mawassi M., Yang G., Satyanarayana T., Gowda S., Dawson W.O., and Bar-Joseph M. 2001. 5'-coterminal subgenomic RNAs in citrus tristeza virus-infected cells. Virology 283: 374-381.

Chen Y., Peumans W.J., Van Damme E.J.M. 2002. The Sambuscus nigra type-2 ribosome-inactivating protein SNA-I' exhibits in planta antiviral activity in transgenic tobacco. FEBS Lett. 516: 27-30.

Chen G., Ye C.M., Huang J.C., Yu M., and Li B.J. 2001. Cloning of the Papaya ringspot virus (PRSV) replicase gene and generation of PRSV-resistant papayas through the introduction of the PRSV replicase gene. Plant Cell Reports 20: 272-277

Chen H., Wang Y., Yan M.G., Yu M.K., and Yao Q.Z. 1996. The phosphatase activity of five ribosome-inactivating proteins. Chin. Biochem. J. 12: 125-129.

Chen Z.C., White R.F., Antoniw J.F., and Lin Q. 1991. Effect of pokeweed antiviral protein (PAP) on the infection of viruses. Plant Pathology 40: 416 620.

Costa, A.S., and Muller G.W. 1980. Tristeza control by cross protection: a US-Brazil cooperative success, virus disease. Plant Dis. 64:538-541.

80

Dai W.D., Bonos S., Guo Z., Meyer W.A., Day P.R., and Belanger F.C. 2003. Expression of pokeweed antiviral proteins in creeping bentgrass. Plant Cell Rep 21:497.502.

de Feyter R., Young M., Schroeder K., Dennis E.S., Gerlach W. 1996. A ribozyme gene and an antisense gene are equally effective in conferring resistance to tobacco mosaic virus on transgenic tobacco. Mol. Gen. Genet. 250: 329-338.

Deng Z., Huang S., Xiao S., and Gmitter F.G. 1996. Development and characterization of scar markers linked to the citrus tristeza virus resistance gene from Poncirus trifoliata. Genome 40:697-704.

Deng Z., Tao Q., Chang Y.L., Huang S., Ling P., Yu C., Chen C., Gmitter F.G., and Zhang H.B. 2001. Construction of a bacterial artificial chromosome (BAC) library for citrus and identification of BAC contigs containing resistance gene candidates. Theor. App. Genet. 102: 1177-1184.

Desmyter S., Vandenbussche F., Hao Q., Proost P., Peumans W.J., and Van Damme E.J.M. 2003. Type-1 ribosome-inactivating protein from iris bulbs: a useful agronomic tool to engineer virus resistance? Plant Mol. Biol. 51: 567–576.

Di R., Dinesh-Kumar S.P., and Miller W.A. 1993. Translational frameshifting by Barley yellow dwarf virus RNA (PAV serotype) in Escherichia coli and in eukaryotic cell-free extracts. Mol. Plant-Microbe Interact. 6: 444-452.

Dinesh-Kumar S.P., Brault V., and Miller W.A. 1992. Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Virology 187: 711-722.

Ding, B., Itaya, A., and Woo, Y.-M. 1999. Plasmodesmata and cell-tocell communication in plants. Int. Rev. Cytol. 190, 251-316.

Ding B., Kwon M-O., Hammond R., Owens R. 1997. Cell-to-cell movement of potato spindle tuber viroid. Plant J. 12: 931-936.

Dolja V.V., Karasev A.V. and Koonin E.V. 1994. Molecular biology and evolution of closteroviruses: Sophisticated build-up of large RNA genomes. Annu. Rev. Phytopathol. 32: 261-285.

Dominguez A., de Mendoza A.H., Guerri J., Cambra M., Navarro L., Moreno P., Pena L. 2002. Pathogen-derived resistance to Citrus tristeza virus (CTV) in transgenic Mexican lime (Citrus aurantifolia (Christ.) Swing.) plants expressing its p25 coat protein gene. Mol. Breeding 10: 1-10.

Dominguez A., Guerri J., Cambra M., Navarro L., Moreno P., and Peña L. 2000. Efficient production of transgenic citrus plants expressing the coat protein gene of citrus tristeza virus. Plant Cell Rep. 19: 427-433.

81

Duran-Vila N., Semancik J.S., Broadbent P., 2000. Viroid diseases, cachexia, and exocortis. In: Timmer L.W., Garnsey S.M., Graham J.H. (Eds.), Compendium of Citrus Diseases, second ed. The American Phytopathological Society, St. Paul, MN, pp. 51-54.

Endo Y., Mitsui K., Motizuki M., and Tsurugi K. 1987. The mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. The site and the characteristics of the modification in 28S ribosomal RNA caused by the toxins. J. Biol. Chem. 262: 5908-5912.

Endo Y., and Tsurugi K. 1987. RNA N-glycosidase activity of ricin A-chain. Mechanism of action of the toxic lectin ricin on eukaryotic ribosomes. J. Biol. Chem. 262: 8128-8130.

Fang D.Q.; Federici C.T.; Roose M.L. 1998. A high-resolution linkage map of the citrus tristeza virus resistance gene region in Poncirus trifoliata (L.) raf. Genetics 150: 883-890.

Febres V.J., Ashoulin L., Mawassi M., Frank A., Bar-Joseph M., Manjunath K.L., Lee R.F., and Niblett C.L. 1996. The p27 protein is present at one end of the citrus tristeza virus particles. Phytopathology 86: 1331-1335.

Febres V.J., Niblett C., Lee R., and Moore G. 2003. Characterization of grapefruit plants (Citrus paradisi Macf.) transformed with citrus tristeza closterovirus genes. Plant Cell Rep. 21: 421-428.

Ferguson J.J., and Garnsey S.M. 1993. Citrus viruses and virus-like diseases. Circular 1131. Florida Cooperative Extension Service. University of Florida.

Ferreira S.A., Pitz K.Y., Manshardt R., Zee F., Fitch M., and Gonsalves D. 2002. Virus coat protein transgenic papaya provides practical control of papaya ringspot virus in Hawaii. Plant Dis. 86: 101-105.

Fulton R.W. 1986. Practies and precautions in the use of cross protection for plant virus disease control. Annu. Rev. Phytopathol. 67: 965-968.

Garnsey S.M., Barrett H.C., and Hutchison D.J. 1987. Identification of citrus tristeza virus resistance in citrus relatives and potential applications. Phytophylactica 19: 187-191.

Gelvin S.B. 2003. Agrobacterium-Mediated Plant Transformation: the Biology behind the “Gene-Jockeying” Tool. Microbiol and Mol Biol Reviews 67: 16-37.

Ghorbel R., Lopez C., Fagoaga C., Moreno P., Navarro A., Flores R., and Peña L. 2001. Transgenic citrus plants expressing the citrus tristeza virus p23 protein exhibit viral-like symptoms. Mol. Plant Pathol. 2: 27-36.

82

Girbés T., de Torre C., Iglesias R. and Ferreras J.M. 1996. RIP for viruses. Nature 379: 777-778.

Gmitter F.G., Xiao S.W., Huang S., Hu X.L., Garnsey S.M., and Deng Z. 1996. A localized linkage map of the citrus tristeza virus resistance gene region. Theor. Appl. Genet. 92: 688-695.

Gowda S., Satyanarayana T., Davis C.L., Navas-Castillo J., Albiach-Marti M.R., Mawassi M., Valkov N., Bar-Joseph M., Moreno P., Dawson W.O. 2000. The p20 gene product of Citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology 274: 246-54.

Gutierrez M.A., Luth D., and Moore G.A. 1997. Factors affecting Agrobacterium-mediated transformation in Citrus and production of sour orange (Citrus aurantium L.) plants expressing the coat protein gene of citrus tristeza virus. Plant Cell Rep. 16: 745-753.

Halbert S.E., and Evans G.A. 1996. Establishment of the brown citrus aphid, Toxoptera citricida in Florida. Proceedings of the 1996 International Congress of Aphidology.

Han S., Wu Z., Yang H., Wang R., Yie Y., Xie L., and Tien P. 2000. Ribozyme-mediated resistance to Rice dwarf virus and the transgene silencing in the progeny of transgenic rice plants. Transgenic Res. 9: 195-203.

Helmy M., Lombard S., and Pieroni G. 1999. Ricin RCA60: evidence of its phospholipase activity. Biochem. Biophys. Res. Commun. 258: 252-255.

Hilf M.E., Karasev A.V., Albiach-Marti M.R., Dawson W.O., and Garnsey S.M. 1999. Two paths of sequence divergence in the citrus tristeza complex. Phytopathology 89: 336-342.

Hilf M.E., Karasev A.V., Pappu H.R., Gumpf D.J., Niblett C.L., and Garnsey S.M. 1995. Characterization of Citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208: 576-582.

Hong Y., Saunders K., Hartley M.R., and Stanley J. 1996. Resistance to geminivirus infection by virus-induced expression of dianthin in transgenic plants. Virology 220: 119-127.

Hudak K.A., Wang P., and Tumer N.E. 2000. A novel mechanism for inhibition of translation by pokeweed antiviral protein: depurination of the capped RNA template. RNA 6: 369 380.

Huet H., Mahendra S., Wang J., Sivamani E., Ong C.A., Chen L., de Kochko A., Beachy R.N., and Fauquet C. 1999. Near immunity to Rice tungro spherical virus achieved in rice by a replicase-mediated resistance strategy. Phytopathology 89: 1022-1027.

83

Hull R. 2001. Viroids, Satellite Viruses and Satellite RNAs. Chapter 14 pp. 593-609 in Matthews’ Plant Virology. Fourth Edition. Academic Press.

Hur Y., Hwang D-J., Zoubenko O., Coetzer C., Uckun R.M., and Tumer N.E. 1995. Isolation and characterization of pokeweed antiviral protein mutations in Saccharomyces cerevisiae: identification of residues important for toxicity. Proc. Natl. Acad. Sci. USA 92: 8448-8452.

Irvin J.D., and Uckun F.M. 1992. Pokeweed antiviral protein: ribosome inactivation and therapeutic applications. Pharmacol. Ther. 55: 279-302.

Ishida I., Tukahara M., Yoshioka M., Ogawa T., Kakitani M., and Toguri T. 2002. Production of antivirus, viroid plants by genetic manipulation. Pest. Management Science 58: 1132-1136.

Ito T., Ieki H., and Ozaki K. 2000. A population of variants of a viroid closely related to citrus viroid-I in citrus plants. Arch. Virol. 145: 2105-2114.

Ito T., Ieki H., Ozaki K., Iwanami T., Nakahara K., Hataya T., Ito T., Isaka M., and Kano T. 2002. Multiple citrus viroids in citrus from Japan and their ability to produce exocortis-like symptoms in citron. Phytopathology 92: 542-547.

Karasev A.V., Boyko V.P., Gowda S., Nikolaeva O.V., Hilf M.E., Koonin E.V., Niblett C.L., Cline K., Gumpf D.J., and Lee R.F. 1995. Complete sequence of the Citrus tristeza virus RNA genome. Virology 208: 511-520.

Karasev A.V., Hilf M.E., Garnsey S.M., and Dawson W.O. 1997. Transcriptional strategy of closteroviruses: mapping the 5' termini of the citrus tristeza virus subgenomic RNAs. J. Virol. 71: 6233-6236.

Kim J-K., Jang I-C., Wu R., Zuo W-N., Boston R.S., Lee Y-H., Ahn I-P., and Nahm B.H. 2003. Co-expression of a modified maize ribosome-inactivating protein and a rice basic chitinase gene in transgenic rice plants confers enhanced resistance to sheath blight. Transgenic Research 12: 475-484.

Koh D.C-Y,Liu D.X., and Wong S-M. 2002. A Six-Nucleotide Segment within the 3' Untranslated region of hibiscus chlorotic ringspot virus plays an essential role in translational enhancement. J. Virol.76: 1144-1153.

Kwon C.S., Chung W.I., and Paek K.H. 1997. Ribozyme mediated targeting of cucumber mosaic virus RNA 1 and 2 in transgenic tobacco plants. Mol. Cells. 7: 326-34.

Lee R.F., Brlansky R.H., and Timmer L.W. 2003. SP-43. 2003 Florida Citrus Pest Management Guide: Exocortis, Cachexia and Other Viroids.

Lodge J.K., Kaniewski W., and Tumer N.E. 1993. Broad-spectrum resistance in transgenic plants expressing pokeweed antiviral protein. Proc. Natl. Acad. Sci. USA. 90: 7089-7093.

84

Lopez C., Navas-Castillo J., Gowda S., Moreno P., and Flores R. 2000. The 23-kDa protein coded by the 3'-terminal gene of citrus tristeza virus is an RNA-binding protein. Virology 26: 462-470.

Luth D., and Moore G. 1999. Transgenic grapefruit plants obtained by Agrobacterium tumefaciens-mediated transformation. Plant Cell Tissue Organ Culture 57: 219-222.

Maniatakis E., Tabler M., and Tsagris M. 2003. Viroid RNA systemic spread may depend on the interaction of a 71-nucleotide bulged hairpin with the host protein VirP1. RNA 9: 346-354.

Mawassi M., Gafny R., Gagliardi D., and Bar-Joseph M. 1995a. Populations of citrus tristeza virus contain smaller-than-full-length particles which encapsidate sub-genomic RNA molecules. J. Gen. Virol. 76: 651-659.

Mawassi M., Mietkiewska E., Hilf M.E., Ashoulin L., Karasev A.V., Gafny R., Lee R.F., Garnsey S.M., Dawson W.O., and Bar-Joseph M. 1995b. Multiple species of defective RNAs in plants infected with citrus tristeza virus. Virology 214: 264-268.

Montanaro L., Sperti S., Mattioli A., Testoni G., and Stirpe F. 1975. Inhibition by ricin of protein synthesis in vitro. Inhibition of the binding of elongation factor 2 and of adenosine diphosphate-ribosylated elongation factor 2 to ribosomes. Biochem. J. 146: 127-131.

Moore G.A., Jacono C.C., Neidigh J.L., Lawrence S.D., and Cline K. 1992. Agrobacterium-mediated transformation of citrus stem segments and regeneration of transgenic plants. Plant Cell Rep. 11: 238-242.

Murphy A.M., and Carr J.P. 2002. Salicylic acid has cell-specific effects on Tobacco mosaic virus replication and cell-to-cell movement. Plant Physiol. 128: 552–563.

Nagano H., Mise K., Furusawa I., Okuno T. 2001. Conversion in the requirement of coat protein in cell-to-cell movement mediated by the Cucumber mosaic virus movement protein. J. Virol. 75: 8045-8053.

Navas-Castillo J., Albiach-Marti M.R., Gowda S., Hilf M.E., Garnsey S.M., and Dawson W.O. 1997. Kinetics of accumulation of Citrus tristeza virus RNAs. Virology 228: 92-97.

Nicolas E., Beggs J.M., Haltiwanger B.M., and Taraschi T.F. 1998. A new class of DNA glycosylase/apurinic/apyrimidinic lyases that act on specific adenines in single-stranded DNA. J. Biol. Chem. 273: 17216 17220.

Nielsen K., and Boston R.S. 2001. Ribosome-inactivating proteins: A plant perspective. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52: 785-816.

85

Oliveira A.C., Garcia A.N., Takita M.A., and Machado M.A.. 2000. Adaptation of minipreps-SDS and single-step in the extraction of citrus DNA for PCR analysis. International Citrus Congress (9th : 2000 : Orlando, Florida), , 2003. p. 105-107.

Osborne R.W., and Hartley M.R. 1990. Dual effects of the ricin A chain on protein synthesis in rabbit reticulocyte lysate. Inhibition of initiation and translocation. Eur. J. Biochem. 193: 401-417.

Owens R.A., Blackburn M., Ding B. 2001. Possible involvement of the phloem lectin in long-distance viroid movement. Mol. Plant-Microbe Int. 14: 905-909.

Palukaitis, P. 1987. Potato spindle tuber viroid: Investigation of the long-distance, intra-plant transport route. Virology 158: 239-241.

Pappu H.R., Karasev A.V., Anderson E.J., Pappu S.S., Hilf M.E., Febres V.J., Eckloff M., McCaffery M., Boyko V., and Gowda S. 1994. Nucleotide sequence and organization of eight 3' open reading frames of the citrus tristeza closterovirus genome. Virology 199: 35-46.

Pastan I., and Fitzgerald D. 1991. Recombinant toxins for cancer treatment. Science 254: 1173-1176.

Paul C.P., Barry J.K., Dinesh-Kumar S.P., Brault V., and Miller W.A. 2001. A sequence required for -1 ribosomal frameshifting located four kilobases downstream of the frameshift site. J. Mol. Biol. 310: 987-999.

Peña L., Martín-Trillo M.,Juárez J., Pina JA, Navarro L., and Martínez-Zapater J.M. 2001. Constitutive expression of Arabidopsis LEAFY or APETALA1 genes in citrus reduces their generation time. Nature Biotech. 19: 263-267.

Peumans W.J., Hao Q., Van Damme E.J.M. 2001. Ribosome-inactivating proteins: More than RNA N-glycosidases? FASEB J. 15: 1493-1506.

Powell-Abel P., Nelson R.S., De B., Hoffman N., Rogers S.G., Fraley R.T., and Beachy R.N. 1986. Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232: 738-743.

Rajamohan F., Kurinov I.V., Venkatachalam T.K., and Uckun F.M. 1999a. Deguanylation of human immunodeficiency virus (HIV-1) RNA by recombinant pokeweed antiviral protein. Biochem. Biophys. Res. Commun. 263: 419-24.

Rajamohan F., Venkatachalam T.K., Irvin J.D., and Uckun F.M. 1999b. Pokeweed antiviral protein isoforms PAP-I, PAP-II and PAP-III depurinate RNA of human immunodeficiency virus (HIV)-1. Biochem. Biophys. Res. Commun. 260: 453-458.

Roberts P.D., McGovern R.J., Lee R.F., and Niblett C.L. 2001. Tristeza. Publication CH089. Plant Pathology Department. Cooperative Extension Services. Institute for Food and Technology. University of Florida.

86

Roistacher C.N., and Bar-Joseph M. 1987. Aphid transmission of citrus tristeza virus: a review. Phytophylactica. 19: 163-167.

Rosales I-M. 2001. Characterization of the HSP70 protein homolog (HSP70h) of citrus tristeza closterovirus. PhD. Dissertation. University of Florida.

Sambrook J., Fritsch E.F., Maniatis T. 1989. Molecular Cloning. A laboratory Manual. (C. S. H. Laboratory, Ed.) Cold Spring Harbor, N.Y.

Sanford J.C., and Johnston S.A. 1985. The concept of parasite-derived resistance genes from the parasite’s own genome. J. Theoretical Biol. 113: 395-405.

Sano T., Nagayama A., Ogawa T., Ishida I., and Okada Y. 1997. Transgenic potato expressing a double-stranded RNA-specific ribonuclease is resistant to potato spindle tuber viroid. Nat. Biotechnol. 15:1290-1294.

Satyanarayana T., Gowda S., Ayllon M.A., Albiach-Marti M.R., and Dawson W.O. 2002a. Mutational analysis of the replication signals in the 3'-nontranslated region of Citrus tristeza virus. Virology 300: 140-152.

Satyanarayana T., Gowda S., Ayllon M.A., Albiach-Marti M.R., Rabindran S., Dawson W.O. 2002b. The p23 protein of Citrus tristeza virus controls asymmetrical RNA accumulation. Virology 76: 473-483.

Satyanarayana T., Gowda S., Boyko V.P., Albiach-Marti M.R., Mawassi M., Navas-Castillo J., Karasev A.V., Dolja V., Hilf M.E., Lewandowski D.J., Moreno P., Bar-Joseph M., Garnsey, S.M., and Dawson W.O. 1999. An engineered closterovirus RNA replicon and analysis of heterologous terminal sequences for replication. Proc Natl Acad Sci USA 96: 7433-7438.

Satyanarayana T., Gowda S., Mawassi M., Albiach-Marti M.R., Ayllon M.A., Robertson C., Garnsey S.M., and Dawson W.O. 2000. Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology 278: 253-265.

Schulte J., and Kearney C. 2002. Mapping of antisense inhibition sites in the leader region of Brome mosaic virus RNA 3. Texas J. Sci. 52: 213-222.

Sieburth P.J., Irey M., Garnsey S.M., Owens R.A. 2002. The use of RT-PCR in the Florida citrus viroid indexing program. In: Proceedings of the 15th Conference of the IOCV. pp230-239.

Shih N.R., McDonald K.A., Jackman A.P., Girbés T., and Iglesias R. 1997. Bifunctional plant defence enzymes with chitinase and ribosome inactivating activities from Trichosanthes kirilowii cell cultures. Plant Sciences 130: 145-150.

87

Snijder E.J., and Horzinek M.C. 1993. Toroviruses: Replication, evolution and comparison with other members of the coronavirus-like superfamily. J. Gen. Virol. 74: 2305-2316.

Song S-K., Choi Y., Moon Y.H., Kim S-G., Choi Y.D., Lee J.S. 2000. Systemic induction of a Phytolacca insularis antiviral protein gene by mechanical wounding, jasmonic acid, and abscisic acid. Plant Mol Biol 43: 439 450.

Spooner R.A., and Lord J.M. 1990. Immunotoxins: status and prospects. Trends Biotechnol. 8: 189-193.

Tomlinson J.A., Walker V.M., Flewett T.H., and Barclay G.R. 1974. The inhibition of infection by Cucumber mosaic virus and influenza virus by extracts from Phytolacca americana. J. Gen. Virol. 22: 225-232.

Tsai J.H., Liu Y.H., Wang J.H., and Lee R.F. 2000. Recovery of orange stem pitting strains of Citrus tristeza virus (CTV) following single aphid transmissions with Toxoptera citricida from a Florida decline isolate of CTV. Proc. Florida State Hort. Soc. 113: 75-78.

Tumer N.E., Hwang D-J., and Bonness M. 1997. C-terminal deletion mutant of pokeweed antiviral protein inhibits viral infection but does not depurinate ribosomes. Proc. Natl. Acad. Sci. USA 94: 3866 3871.

Tumer N.E., Hudak K., Di R., Coetzer C., Wang P., and Zoubenko O. 1999. Pokeweed antiviral protein and its applications. Curr. Top. Microbiol. Immunol. 240: 139–158.

Tumer N.E., Parikh B.A., Li P., and Dinman J.D. 1998. The pokeweed antiviral protein specifically inhibits Ty1-directed +1 ribosomal frameshifting and retrotransposition in Saccharomyces cerevisiae. Virology 72: 1036-1042.

Uckun F.M, Chelstrom L.M., Tuel-Ahlgren L., Dibirdik I., Irvin J.D., Langlie M.C., and Myers D.E. 1998. TXU (anti-CD7)-pokeweed antiviral protein as a potent inhibitor of human immunodeficiency virus. Antimicrob. Agents Chemother. 42: 383-388.

Ussery M.A., Irvin J.D., and Hardesty B. 1977. Inhibition of poliovirus replication by a plant antiviral peptide. Ann NY Acad Sci 284: 431 440.

Vazquez Rovere C., Asurmendi S., and Hopp H.E. 2001. Transgenic resistance in potato plants expressing potato leaf roll virus (PLRV) replicase gene sequences is RNA-mediated and suggests the involvement of post-transcriptional gene silencing. Arch. Virol. 146:1337-1353.

Vazquez-Ortiz J. 2001. Proteolytic processing of the N-terminus of citrus tristeza virus open reading frame 1. PhD. Dissertation. University of Florida.

88

Vivanco J.M. 1999. antiviral and antiviroid activity of MAP-containing extracts from Mirabilis jalapa roots. Plant Dis. 83: 1116-1121.

Vivanco J.M., and Tumer N.E. 2003. Translation inhibition of capped and uncapped viral RNAs mediated by ribosome-inactivating proteins Phytopathology 93: 588-595.

Vivanco J.M., Savary B.J., and Flores H.E. 1999. Characterization of two novel type I ribosome-inactivating proteins from the storage roots of the Andean crop Milabilis expansa. Plant Physiol. 119: 1447 1456.

Walsh T.A. , Morgan A.E., and Hey T.D. 1991. Characterization and molecular cloning of a proenzyme form of a ribosome-inactivating protein from maize: novel mechanism of proenzyme activation by proteolytic removal of a 2.8-kilodalton internal peptide segment. J. Biol. Chem. 266: 23422-23427.

Wang P.W., Zoubenko O., and Tumer N.E. 1998. Reduced toxicity and broad spectrum resistance to viral and fungal infection in transgenic plants expressing pokeweed antiviral protein II. Plant Mol. Biol. 38: 957-964.

Warrilow D., and Symons R.H. 1999. Citrus exocortis viroid RNA is associated with the largest subunit of RNA polymerase II in tomato in vivo. Arch. Virol. 144: 2367–2375.

Wilson T.M.A. 1993. Strategies to protect crop plants against viruses: pathogen-derived resistance blossoms. Proc. Natl. Acad. Sci. USA 90: 3134-3141.

Wintermantel W.M., Banerjee N., Oliver J.C., Paolillo D.J., and Zaitlin M. 1997. Cucumber mosaic virus is restricted from entering minor veins in transgenic tobacco exhibiting replicase-mediated resistance. Virology 231: 248-257.

Wintermantel W.M., and Zaitlin M. 2000. Transgene translatability increases effectiveness of replicase-mediated resistance to Cucumber mosaic virus. J. Gen. Virol. 81: 587-595.

Wu B., and White K.A. 1999. A Primary Determinant of Cap-Independent Translation Is Located in the 3′-Proximal Region of the Tomato Bushy Stunt Virus Genome. J. Virol. 73: 8982-8988.

Yang X., Yie Y., Zhu F., Liu Y., Kang L., Wang X., and Tien P. 1997. Ribozyme-mediated high resistance against potato spindle tuber viroid in transgenic potatoes. Proc. Natl. Acad. Sci. USA. 94: 4861-4865.

Yoshida T. 1996. Graft comptibility of citrus with plants in the Aurantioideae and their susceptibility to Citrus tristeza virus. Plant Dis. 80: 414-417.

Yuan H.; Ming X.; Wang L.; Hu P.; An C.; Chen Z. 2002. Expression of a gene encoding trichosanthin in transgenic rice plants enhances resistance to fungus blast disease. Plant Cell Rep. 20:992-998.

89

Zarling J.M, Moran R.A., Haffar O., Sias J., Richmann D.D., Spina C.A., Myers D.E., Kuelbeck V., Ledbetter J.A., and Uckun F.M. 1990. Inhibition of HIV replication by pokeweed antiviral protein targeted to CD4+ cells by monoclonal antibodies. Nature 347: 92 95.

Zoubenko O., Hudak K., and Tumer N.E. 2000. A non-toxic pokeweed antiviral protein mutant inhibits pathogen infection via a novel salicylic acid-independent pathway. Plant Mol. Biol. 44: 219-229.

Zhu Y., Green L.,Woo Y-M.,Owens R., and Ding B. 2001. Cellular basis of Potato spindle tuber viroid systemic movement. Virology 279: 69-77.

BIOGRAPHICAL SKETCH

Yolanda Petersen was born in 1973 in Cape Town, South Africa. She earned a

Bachelor of Science degree in Microbiology and Botany at the University of Cape Town,

in December 1994. Her Bachelor of Science (Honors) and Master of Science theses were

entitled: “The Characterisation of a novel bacteriophage from the the causal agent of

chocolate spot disease of cabbage” and “The Characterisation of a novel Xanthomonas

bacteriophage”. The degrees were awarded at the University of Cape Town in 1995 and

1999, respectively. In 1999 she was awarded a scholarship by the USDA-ARS

International Programs to pursue the Doctor of Philosophy degree in the field of plant

pathology at the University of Florida.

90