Vidit Bhandarkar June 5, 2014

  Page  2  

Background I got the opportunity to work, as an intern, with Strand Life Sciences. This furthered my interest in molecular biology. My exposure to molecular biology began when I started studying for the Biology Advance Placement (AP). However, the hands on experience I got while working with Strand, was unparalleled. I worked in their lab and carried out a Polymerase Chain Reaction. This report describes the entire process I went through while working at Strand. Strand Life Sciences (http://www.strandls.com/), with their slogan ‘Algorithms for life’, are the pioneers in the field of biotechnology in India. They have recognized the need to automate and integrate life science data analysis through an algorithmic and computational approach. Strand has been expanding its focus to include clinical genomics, both in terms of data analytics and sequencing. Clinical labs to conduct sequencing based diagnostic services are being set up throughout India. This will enable Strand to provide personalized medicines to people. Introduction The Polymerase Chain Reaction (PCR) is a biochemical technology used to amplify a single or a few copies of a piece of DNA, generating thousands to millions of copies of a particular DNA sequence. These millions of copies produced are then sequenced to check if any mutation has occurred or not. The mutations are all gene mutations (i.e. changes in one or more of the bases of a gene). Mutations could be insertions, deletions or duplications. They are further categorized into homozygous or heterozygous mutations. Humans contain two copies of each gene, one from the father and one from the mother, which sometimes are referred to as the alleles of a gene. If a mutation occurs in just one copy of the gene, then that individual is considered heterozygous. On the other hand if both copies of a gene are mutated, then that individual is has a homozygous genotype.

Process The entire process of conducting a PCR and then sequencing the DNA is a long and painstaking one.

1. It starts when an enquiry, stating that the concerned individual could have a gene mutation at a

specific region in the DNA sequence, is received. The enquiry consists of the name of the gene that is believed to have undergone a mutation, the mutation number and what the mutation is, the chromosome number and the chromosome co-ordinates of the mutation (the nucleotide number at which the mutation starts and ends).

2. The second step is primer designing. This is the most important step in a PCR. Primers are oligonucleotides that hybridize to complementary strands of the DNA template and identify the region to be amplified. A set of two primers (forward and reverse) is designed against the opposite strand (5 prime and 3 prime), spanning the region of interest. The forward primer binds to the reverse strand and the reverse primer binds to the forward strand, spanning the region of amplification. In order to see the region that the primer spans the chromosome co-ordinates of the mutation are entered into Ensembl (a DNA data base consisting of the complete DNA sequences of all the organisms whose DNA has been sequenced). Primers are then designed with the help of softwares like Primer-Blast, Reverse Complement tools and an Oligo Calculator. The calculator gives the length, G-C concentration percentage, molecular weight and the melting temperature of

  Page  3  

the DNA strand that the primers span, whereas Primer Blast gives similar information about the primer itself.

Things to remember while designing primers:

• The primers should have a length of 18-25 base pairs. • They should be complementary to the region they are going to bind with (Ensembl helps

locate the binding region and thereby deciding the nucleotides that make up the primer). • The region that is being enclosed for replication by the primers should be of maximum 500-

600 bp for accurate Sanger Sequencing. • The G-C content of the primer should ideally be 40% to 50%. • The melting temperature (Tm) of the primers should be between 55-65 degrees Celsius. An

approximate Tm (called manual Tm) can be calculated by using the formula 4(C+G) + 2(A+T).

• The Tm of both the primers should be within 5 degrees Celsius of each other. • Annealing temperature (Ta) is the temperature at which the primers bind to the

complementary DNA strand. The Ta for a primer pair should be generally 5 degrees Celsius lower than the Tm of the pair and like the Tm, the Ta of the primers should also be within 5 degrees Celsius of each other. The Ta of primers can also be calculated by the given formula: Ta=0.3x(Tm of primer) + 0.7(Tm of product) - 25.

• G-C form triple bonds, while A-T form doubles bonds. Thus, to promote specific bonding, there should be C’s and G’s evenly distributed among the last 5-10 bases. (In case of uneven distribution, non-specific binding will take place).

• Self dimers could form if the ends of a single primer have bases that are complementary to each other.

• Cross dimers can be formed between the forward and reverse primers if they have complementary regions within their strands.

• The forward and reverse primers should be at least 50 base pairs away from the mutation. The reason for this is that in Sanger Sequencing, the first 30-40 bases get compressed.

3. Once the primers are designed, primer reconstitution is carried out. The synthesized primers are in

an amorphous form. This powder needs to then be converted to a 100 micro molar solution with the help of 1X TE (Tris EDTA) buffer. The solution is then kept in a dry bath for 10 minutes at 56 degrees Celsius. From the dry bath, the primer solution is kept in ice for 5 minutes. This is the stock solution and it’s converted to a 2 micro molar working solution whenever required.

4. Prior to conducting a PCR, the following protocol is followed:

• Preparation of the Master Mix (MM)

Components of MM with stock concentration Working concentration

10X Buffer A 1X

100 mili molar (mM) dNTP 200 micro molar

2 micro molar forward primer 0.2 micro molar

2 micro molar reverse primer 0.2 micro molar

5 unit/micro liter KAPA Taq Polymerase* 1 unit^2 (1 unit^2 = 1unit/

DNA (conc. depends on amount extracted) 20-50 nano grams

  Page  4  

Components of MM with stock concentration Working concentration

PCR Grade Water -

Volumes of the components of the MM for a 25 micro liter reaction:

- Buffer A: 10X x V = 1X x 25 micro liters (let V= volume) V= 2.5 micro liters

- dNTP: 100mM x V = 200 x 10^-3 mili molar x 25 micro liters V= 0.05 micro liters - Forward Primer: 2 micro molar x V = 0.2 micro molar x 25 micro liters V= 2.5 micro liters - Reverse Primer: 2 micro molar x V = 0.2 micro molar x 25 micro liters V= 2.5 micro liters - Taq Polymerase: for a 50 micro liter reaction- 5 unit/micro liter x V = 1 unit/ micro liter V= 0.2 micro liter

Therefore, for a 25 micro liter reaction, V= (25/50) x 0.2 micro liter V= 0.1 micro liter

- DNA: If the amount of DNA extracted is 250 nano gram and the final concentration required is 20 nano gram, 250 nano gram x V = 20 nano gram x 25 micro liters

V= 0.08 micro liters (Similar calculations need to be made to calculate the volume of DNA required using different initial

and final concentrations) - PCR Grade Water: PCR grade water is double distilled water. The volume changes from

reaction to reaction. It is essentially added in order to have a final reaction volume of 25 micro liters.

V + 7.73 micro liters= 25 micro liters V= 25 micro liters

*KAPA Taq Polymerase: DNA Polymerase is the enzyme that is responsible for the replication of DNA. KAPA Taq Polymerase is obtained from thermus aquaticus which is a thermophilic bacterium. (They need to be thermophilic as they are subjected to high temperatures) This KAPA Taq Polymerase can replace any commercial Taq Polymerase. The only difference between human DNA Polymerase and KAPA Taq Polymerase is that the KAPA polymerase only replicates a DNA strand, whereas human DNA Polymerase not only replicates, but also proof reads after replicating, thereby fixing any errors. However, this shortcoming of the KAPA Taq Polymerase does not affect the PCR because the error rate of the polymerase is approximately 1 error per 2.2 x 10^5 nucleotides and the length of the DNA strand being replicated is maximum 600 bases. (If Sanger Sequencing is being used to sequence the DNA)

• Setting up individual reactions

Depending upon the amount of DNA required for sequencing, a number of PCR reactions are set-up by transferring appropriate volumes of the PCR MM to individual PCR tubes.

• Running the PCR

PCR is carried out in a machine called the thermal cycler. This machine keeps different temperatures for different steps of the PCR, depending on requirements of the various components of the PCR. These requirements include: the denaturation temperature of

  Page  5  

the DNA strand, annealing temperature of the primers, and optimal temperature for the enzyme KAPA Taq Polymerase.

Steps Temperatures Duration Cycles

Initial Denaturation >95 degrees Celsius 3 mins 1

Denature 95 degrees Celsius 30 sec

Anneal Tm - 5 degrees Celsius 30 sec 35

Extension 72 degrees Celsius 1 min/kilo base pairs

Final Extension 72 degrees Celsius 1 min/kilo base pairs 1

Final Hold 4 degrees Celsius Infinity

Initial Denaturation: The DNA loaded into the thermal cycler is genomic DNA. It is highly coiled and double-stranded. This denaturation step un-coils the DNA and splits the two strands, thus making all the DNA single-stranded molecules.

Denature: This step helps maintain the single-stranded structure of the DNA by

preventing it from binding it with its complementary strand. Since it is the first step of the 35 cycles, it denatures the double stranded amplicons so that each can act as a template in the extension step. This ensures exponential amplification. Each DNA strand gets amplified to produce 2 amplicons and since steps 2 to 4 are repeated for 35 cycles, 2^35 amplicons are produced.

Anneal: This is the step in which the primers bind with the specific DNA region, marking

the region of interest. (The region containing the mutation. i.e. the region being amplified) The temperature at which this step is carried out is the temperature at which the primers bind the best to the DNA strand. Though the approximate Ta of the primers can be found by using the formula given above, the exact annealing temperature is found by conducting a Gradient/Standardization/Test PCR prior to the actual PCR. This PCR uses all the materials that the regular PCR uses except Promega/Coriell DNA (i.e. regular DNA; not the sample). Multiple PCR reactions with the same set of primers are set up at different temperatures and the amplicons (amplified DNA) of each reaction are then run on different lanes of the gel. Whichever lane has the brightest band and least non-specific binding indicates the exact/optimum annealing temperature.

Extension: This step involves Taq Polymerase amplifying the DNA strands by adding

dNTPs to the single stranded DNA molecules and then to the amplicons produced. The temperature is chosen to be 72 degrees Celsius because this is the temperature at which Taq Polymerase functions optimally

Final Extension: The Taq Polymerase, in this step, finishes replicating any strands of DNA

that it did not completely replicate or miss out. Final Hold: This is the last step of a PCR reaction and is carried out in order to store the amplified DNA.

  Page  6  

5. Gel Electrophoresis: This is the process conducted after a PCR. It is used to separate the amplicons from the primers, non-specifics and the Taq Polymerase and also to determine the length of the amplicons with the help of a DNA ladder. Preparation of the gel: The gel used is 1% Agarose in 1X TAE Buffer. The stock concentration of the TAE Buffer is 50X and this needs to be converted to a working solution of concentration 1X and volume 1000ml. This is done in the following manner:

50X x V = 1X x 1000ml V= 20ml (this means that 20ml of 50X TAE Buffer is required to produce 1000ml of 1X TAE Buffer) From the 1000ml of the 1X buffer prepared, 100ml is used to make 1% Agarose solution (1% by weight). The amount of Agarose that needs to be added is: 1% x 100 = 1g Agarose powder To this solution, 0.005% (of volume of Agarose solution) of gel red dye is added so that fluorescence is produced under a U.V light. After this the solution is placed in a gel plate and allowed to set to become the gel. After the gel is set, the gel plate is immersed in 1X TAE Buffer and is connected to two electrodes (anode and cathode). The amplicons obtained after PCR are combined with 1 micro liter of 6X gel loading dye (tracking dye) and then loaded into different lanes on the gel. The dye is used so that the otherwise transparent amplicons can be seen. Composition of the dye: 30% (v/v) glycerol 0.25% (v/v) bromophenol blue, 0.25% (v/v) xylene cyanol. Gel Electrophoresis works on the two principles: • Opposite charges attract and like charges repel. • Shorter the amplicons (i.e. the lighter they are), the further they will run on the gel. DNA is negatively charged and thus it is placed at the cathode, the negatively charged electrode. The anode (positively charged electrode) is placed at the other end of the gel plate. Thus the amplicons run from the cathode towards the anode. Along with the amplicons loaded in their respective lanes, a DNA ladder is loaded in a separate lane and allowed to run alongside the amplicons. This ladder consists of DNA strands of particular lengths and thus the length of the various amplicons can be determined by comparing the position of the amplicons with the corresponding DNA strand of the ladder. (Each position is marked by a DNA strand of the ladder, of a particular length) A variety of ladders can be used but the most common ones are the 1 kilo base pair ladder and the 100 base pair ladder. The amplicons run on the gel for approximately 2/3rd the length. This takes about half an hour, after which the gel is removed from the gel plate and viewed under U.V light. The amplicons of different samples are cut and placed in various tubes. (Note: they are still mixed with small amounts of Agarose gel)

6. Gel Elution: It is a process by which the amplicons are separated from the Agarose gel after Gel Electrophoresis has been carried out.

Gel Elution consists of the following steps: • 3 volume of QG Buffer is added to the amplicons. This buffer is used to dissolve the Agarose gel

present. (3 volume means that the volume of QG is thrice the weight of the amplicons + Agarose)

  Page  7  

• Next, 1 volume (volume which is the same as the initial gel + amplicon weight) of isopropanol is added to the mixture. Isopropanol is used to precipitate the amplicons (i.e. separate from the gel).

• Vortex the mixtures so that they will be mixed well and then transfer each of the mixtures into different columns (tubes consisting of a mesh to precipitate the DNA).

• The columns are then placed in a centrifuge machine for one minute at 12,000-14,000 rotations per minute (rpm).

• 700 micro liters of PE/Wash Buffer is added to each of the columns and then the columns are centrifuged again for a minute. The PE/Wash Buffer removes salts and other impurities from the mixture.

• A free spin in the centrifuge machine is carried out to remove any residual ethanol. (ethanol is a major component of the PE/Wash Buffer) Now, only the amplicons will remain and they will be stuck to the mesh.

• The amplicons are then transferred to different columns after which 15 micro liters of Elution Buffer or warm water is added to each of the columns.

• The columns are then incubated for 2 minutes and then centrifuged again. The amplicons then get eluted into the water (or Elution Buffer) and you finally have a mixture of the amplicons with 15 micro liters of water (or Elution Buffer).

7. Quantification: This process is carried out to determine the concentration/quantity of amplicons present in 15 micro liters of water/Elution Buffer and to determine the purity of the amplicons.

It involves the usage of two machines, namely: • NanoVue: This machine is able to determine the concentration per micro liter of both single and

double stranded amplicons present in the 15 micro liter mixture. 1 micro liter of the mixture is placed in the machine and the machine gives three readings: - concentration per micro liter - 260nm/280nm*: This value determines the purity of the amplicons. Values between 1.8 and

2 indicate pure DNA. If the value is less that 1.8 then the sample is contaminated with proteins and if the value is greater than 2 then the sample is contaminated with RNA.

- 260nm/230nm: This value indicates carbohydrate and phenol contamination and ranges from 2-2.2. Anything above or below this value indicates contamination.

• Qubit: This machine is able to determine the concentration per micro liter of only double

stranded amplicons. Its reading is more accurate than the readings provided by the NanoVue.

*The NanoVue and the Qubit (photo-spectrometers) both work on the principle of photo spectroscopy, and on Beer-Lambert’s law. In essence, the law states that light absorbed has a linear relation with the concentration of the substance absorbing the light. DNA absorbs U.V light of wavelength 260nm and protein absorbs U.V light of wavelength 280nm. Thus when light of 260nm is incident on the mixture, only the DNA absorbs it and when light of 280nm is shone on the mixture, only the protein absorbs the light. Hence, the ratio of light absorbed by DNA to the light absorbed by proteins (260/280) gives the purity of the DNA solution. The 260/230 ratio works on the same principle.

8. Cycle PCR: This process is conducted after quantification, and it is the prelude to the final

Sanger Sequencing. Cycle PCR involves amplification by either the forward or reverse primer.

The choice of the primer is based on: • The complexity/nature of the region to be amplified. There should not be long stretches of the

same base between the primer chosen and the mutation. The reason for this is that the polymerase gets confused, falls down, and doesn't know where to re-start, because all the bases are the same.

• The distance of the primers from the mutation. The primer closer to the mutation, keeping the 50 base rule in mind, is chosen.

  Page  8  

Contents of the Cycle PCR (Reaction Volume = 20 micro liters): • Purified DNA after elution + PCR Grade water.

The volume of both these components combined should add up to 10 micro liters. Once elution is carried out, DNA + Water = 15 micro liters. If the concentration of DNA is 200ng per micro liter and the required concentration is 300ng, then: 200ng/micro liter x V = 300ng V= 1.5 micro liter Therefore, volume of water= 10 micro liters - 1.5 micro liters= 7.5 micro liters.

• Ready Reaction Mix (RRM): RRM consists of:

- dNTPs: dNTP stands for deoxynucleotide triphosphate. dNTPs are attached to the template DNA strand by the Polymerase. When deoxyribonucleotides polymerize to form DNA, the phosphate group from one nucleotide will bond to the 3' carbon on another nucleotide, forming a phosphodiester bond via dehydration synthesis. New nucleotides are always added to the 3' carbon of the last nucleotide, so synthesis always proceeds from 5' to 3'. The dNTPs are colored so that they can be recognized easily during Sanger Sequencing. (A-green, T-red, G-black, C-blue)

- ddNTPs: Dideoxynucleotides are chain-terminating inhibitors of DNA polymerase. The absence of the 3'-hydroxyl group means that, after being added by a DNA polymerase to a growing nucleotide chain, no further nucleotides can be added as no phosphodiester bond can be created. This means that the DNA chain gets terminated and thus ddNTPs are used to increase the number of reads during Sanger Sequencing.

- Polymerase: This is the enzyme which carries the dNTPs and the ddNTPs and attaches them to the template DNA strand.

• Big Dye Buffer

The RRM + Buffer volume should be 8 micro liters. The Buffer volume is decided depending on the RRM volume. For a full reaction (i.e. sequencing 1000 base pairs) 8 micro liters of RRM is required. (therefore 0 micro liters of the buffer is required) However, normally amplicons are much shorter that 1000 base pairs therefore only 1/2, 1/3, 1/4 etc reactions are carried out and the volume of RRM is decided accordingly.

• 2 micro liters of the chosen primer (either forward of reverse). The 2 micro liters are taken from

the 2 mili molar 100 micro liters stock of the primer.

Prior to conducting a Cycle PCR, the following protocol is followed:

Steps Temperatures Duration Cycles

Initial Denaturation 96 degrees Celsius 1 min 1

Denature 96 degrees Celsius 10 sec

Anneal Tm - 5 degrees Celsius 5 sec 25

Extension 60 degrees Celsius 4 min

Final hold 4 degrees Celsius Infinity

  Page  9  

(Steps 2-4 are repeated for 25 cycles. The ddNTPs, along with the usage of only one primer, ensures that only single stranded DNA is formed, and the second denaturation step prevents any amplicons from binding with each other. However, since the last step of the 25th cycle is extension, some amplicons will be double stranded.)

9. Clean-up: This is the process carried out after Cycle PCR in order to remove all the dNTPs,

ddNTPs, primers, Polymerase etc., because the Sanger Sequencer requires only purified DNA, otherwise, it will either give wrong readings by sequencing the primer instead of the amplicons or its capillaries will get choked resulting in no readings at all.

The clean-up process involves the following steps:

• Preparation of the 2 Master Mixes (MMs):

- 1st MM: This MM is prepared by adding 4 micro liters of 125mM EDT to 20 micro liters of distilled water.

- 2nd MM: This MM is prepared by adding 4 micro liters of 3 molar sodium acetate to 100 micro liters of 100% ethanol.

• The next step is to aliquot the PCR product into centrifuge tubes and add 24 micro liters of MM 1 and 104 micro liters of MM 2.

• Vortex and mix. • Incubate at room temperature for 15 minutes. • Centrifuge at 12,000rpm for 20 minutes. This will cause DNA to form pellets and settle at the

bottom of the tube. • Gently discard the supernatant. (liquid on top) • Add 250 micro liters of 70% ethanol to remove salts from DNA. The ethanol is prepared in the

following manner: V x 100% = 70% x 250 micro liters V= 175 micro liters. This means that 175 micro liters of 100% ethanol is needed to prepare 250

micro liters of 70% ethanol by adding the required amount (75 micro liters) of double-distilled water.

• Centrifuge for 15 minutes. • Completely discard the ethanol and air dry the pellets. • Re-suspend the pellets in 10 micro liters of formamide (HiDi). HiDi helps the amplicons remain

single-stranded by preventing different amplicons from binding with each other and preventing different parts of the same amplicons from binding with each other. HiDi also separates the few double-stranded amplicons into single-stranded ones.

10. Sanger Sequencing: It is the final step of this entire process, and it is this step which helps

determine whether the individual has the proposed mutation or not. After the pellets are re- suspended in HiDi, the mixture is placed in a 96 well-plate and incubated at 96°C for 5 min. Then remove the plate and immediately keep it on ice for 2-3 min. The well plate is then loaded into the Sanger Sequencer.

How the Sanger Sequencer (3500Dx Genetic Analyzer) functions: The Sanger Sequencer is a machine that sequences the amplicons after clean-up. It is a short-range sequencer and can sequence amplicons up to 1000 bases. The 3500Dx Genetic Analyzer is an eight capillary sequencing machine that sequences 8 samples at a time. A CCD camera, that reads the bases of the amplicons, is present. Once the well plates have been filled with the re-suspended amplicons, the capillaries pull the amplicons, from the HiDi, into them. Due to the ddNTPs the amplicons are of different sizes and thus the smallest amplicon enters the capillary first. Amplicons move slowly through the capillary while the CCD camera incidents white light on the bases of the amplicon as they pass it. The bases will reflect only the colors that they are i.e. each base will reflect a specific wavelength of light. (Adenine reflects green light, Thymine reflects red light, Guanine reflects black and Cytosine reflects Blue light)

  Page  10  

This is how the amplicons are sequenced. The entire process of one amplicon moving through a capillary and getting sequenced is called a read. Since there millions of amplicons of different lengths (due to the ddNTPs) the number of reads increases and the same bases are sequenced by the CCD countless times, making the sequencing more accurate (i.e. increasing the coverage). The sequenced DNA is then studied to check whether the individual has the mutation.

  Page  11  

Experiment Mutation Query:

Gene Name

Mutation Type

Mutation Position

Zygosity Chromosome Number

Start End Strand Sample Name

BRCA1 M c.5440dupG

Het (45.2%) chr17 41199687 41199687 Negative P000457-S131400277-GlcT1

Primer Designing: • The sequence for BRCA1 was retrieved from the database Ensembl. • The mutation c.5440dupG was found to be present in Exon 22 (E22) of the gene. • The primers were designed to span the mutation.

BRCA1 Primer Design

Mutation position: c.5440dupG in Exon22 at chr co-ordinate: 41199687 of Transcript ID: ENST00000357654 Description: breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Location: Chromosome 17: 41,196,312-41,277,387 reverse strand. Gene: This transcript is a product of gene ENSG00000012048 having total of 23 Exons. Intron21 + Exon22 + Intron22 41200297 cagtgagccaagatcgcgccactgcactccagcccgggcgacagagcgagactccgtctc 41200238 41200237 aaaaaaaaagagagagagagaaatgatgggctgggccagtgccccacccctgtaatcaca 41200178 41200177 acactgggaggccaaggtgggagaatcgcttgagcctgggagctgaagaccagcctgggc 41200118 41200117 aatacagtaggacctcatgtctacaaaaaaattattaaaaattagccaaggctgggtgcg 41200058 41200057 gtggctcatgcctataatcccgggggtgaagttgagcccaggagtttgagaccagcctgg 41199998 41199997 gcaacatggcaaaaccctgtctctaccaaaaatacaaaaaaattagccaggggtggtggt 41199938 41199937 acgtgtctgtagttccagctacttaggaggctgagatggaaggattgcttgagcccagga 41199878 41199877 ggcagaggtggcagtgagctgagatcacaccactgcactccagcctgggtgacagagcaa 41199818 41199817 gaccctgtctcaaaaacaaacaaaaaaaatgatgaagtgacagttccagtagtcctactt 41199758 SPBRCA1-E22-F 41199757 tgacactttgaatgctctttccttcctggggatccag 41199721 41199720 GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCAT 41199661 c.5440dupG at chr co-ordinate: 41199687 41199660 G 41199660 41199659 gtaaggtgcctgcatgtacctgtgctatatggggtccttttgcatgggtttggtttatca 41199600 41199599 ctcattacctggtgcttgagtagcacagttcttggcacattttaaatatttgttgaatga 41199540 SPBRCA1-E22-R 41199539 atggctaaaatgtctttttgatgtttttattgttatttgttttatattgtaaaagtaata 41199480 41199479 catgaactgtttccatggggtgggagtaagatatgaatgttcatcacaaaaacataaatc 41199420 41199419 aaggccgggcatggtggctcatgcctataattccagcactttgggaggtcaagatggagg 41199360 41199359 tcaaggtgggagcctagaagttcgagaccagcctgggcaacataaggagacttcatctgt 41199300 41199299 acaacaaatttaaaaagtagctgggtgtggtggcagatgcctgtagtcgcagctacttgg 41199240 41199239 gaagctgaggtgggaggatcacttgagctcaggaggttgatgcttcagtgagccacgatc 41199180 41199179 acaccactgtactccagcctgggcgacagagcgagaccgtgtctcaaaaagaaaaaagaa 41199120 41199119 agtataaatttacacaaaaacaataaaataatcccagtaattccaccacttggagatgat 41199060 Note: GCC codes for Alanine is highlighted in yellow, Highlighted in green is the duplication of G at chr co-ordinate: 41199687.

  Page  12  

Primer Details:

Primer Name Sequence / strand identity Primer

length Tm (Primer

blast/manual) GC% Product size

SPBRCA1-E22-F 5’-CTTCCTGGGGATCCAGGGTGTC -3’ 22 64.07/72 63.64

157bp SPBRCA1-E22-R

5’- CTCAAGCACCAGGTAATGAGTG -3’ 22 58.99/66 50

Primer Blast Result:

Note: The above primers are for sequencing purpose.

Primer Reconstitution: Add the following amounts of 1X TE Buffer to both the forward and reverse primers to make a 100 micro molar mixture. • SPBRCA1-E22-F: 363 micro liters • SPBRCA1-E22-R: 373 micro liters

Standardization of the primers using Gradient PCR: Date: 27/05/2014 Name: BRCA1 – E22 Primers: SPBRCA1-E22-F/R Expected amplicon size: 157 bp Set up Details: Sample Volume (micro

litres) NTC (Negative

Control) DNA 1 0 Water 0 1

2uM Primers[fp+rp] 2.5 + 2.5 2.5 + 2.5 Master Mix 19 19

  Page  13  

Master Mix:

Reaction Component Per 25ul reaction (vol./rxn)

No. of reactions vol. To add (ul)

10X Buffer 2.5 10 25 100mM dNTPs 0.05 10 0.5 Taq DNA Pol. 0.1 10 1

PCR grade water 16.35 10 163.5 Total Vol. 19 190

PCR cycling parameters:

Step Temp. (0C) Duration 1. Initial denaturation 95 3 mins 2. Denaturation 95 30 sec 3. Annealing 56-64 30 sec 4. Extension 72 10 sec 5. Go to step 2 35 times 6. Final extension 72 1 min 7. Incubation 4 Infinity 8. End

Standardization Gel Picture:

Observation: Maximum amplification (i.e. brightest bands) was observed to be in the temperature range of 61°C-64°C. Result: Thus the annealing temperature of the primers was found to be in the range of 61°C-64°C. So, the samples will be amplified using this temperature as the annealing temperature.

PCR set-up for the actual sample: P000457-S131400277-GlcT1

Date: 29/05/2014 Name: BRCA1 – E22 Primers: SPBRCA1-E22-F/R Expected amplicon size: 157 bp Set up Details: Sample Volume (micro

litres) NTC (Negative

Control) DNA 1 0 Water 0 1

2uM Primers[fp+rp] 2.5 + 2.5 2.5 + 2.5 Master Mix 19 19

  Page  14  

Master Mix:

Reaction Component Per 25ul reaction (vol./rxn)

No. of reactions vol. To add (ul)

10X Buffer 2.5 5 12.5 100mM dNTPs 0.05 5 0.25 Taq DNA Pol. 0.1 5 0.5

PCR grade water 16.35 5 81.75 Total Vol. 19 95

PCR cycling parameters:

Step Temp. (0C) Duration 1. Initial denaturation 95 3 mins 2. Denaturation 95 30 sec 3. Annealing 61 30 sec 4. Extension 72 10 sec 5. Go to step 2 35 times 6. Final extension 72 1 min 7. Incubation 4 Infinity 8. End

Observation: The samples were amplified at 61°C and the amplicons gave bright and intense bands when they were made to run on gel. Result: The bright and intense bands along with minimum non-specifics are an indication of correct and good amplification. Gel Elution: Gel weight: 0.17g Volume of QG Buffer added: 0.17 x 3 = 0.51ml Volume of Isopropanol added: 0.17ml The elution procedure mentioned above was performed to obtain pure DNA.

Quantification:

NanoVue Qubit ng/micro liters A260/280 A260/230 ng/micro liters

79.5 1.7 2.1 56.2

Cycle PCR Set Up: Sr. No.

Gene Name Sample Name

NanoVue 260/280 Qubit DNA + Water

RRM + Buffer

Primer (2 micro

  Page  15  

liters) 1. BRCA1-E22 P457-

S277-GlcT1

79.5 1.7 56.2 7 + 3 1 + 7 Reverse Primer

PCR Clean-UP: The Clean-Up step was performed as mentioned above and the amplicons were re-suspended in HiDi formamide and loaded into the 96 well-plate. Sanger Sequence Output:

Primer used for sequencing: Reverse Ref Seq.: GCAGCCAGATGCCTGGACAGA Sample details:

Sr. No. Sample Mutation status 1. P000457-S131400277-GlcT1 Het.

1. P000457-S131400277-GlcT1 Sanger output: (ABI file viewed in FinchTV)

Observation: The highlighted region in the sequence output (GC) shows two peaks at the C region. The blue peak indicates the base C and the black peak indicates the base G. Result: The presence of two peaks at the position of a single base (in this case the C base) is an indication of heterozygosity. The reference sequence is GCCTG but the presence of another G after the base G in the highlighted part of the sequence output, reads the sequence as GGCCTG. This is a case of duplication of the base G at that position.