Polymorphisms

PolymorphismA DNA polymorphism is a sequence

difference compared to a reference standard that is present in at least 1%–2% of a population.

Polymorphisms can be single bases or thousands of bases.

Polymorphisms may or may not have phenotypic effects

Polymorphic DNA SequencesPolymorphisms are found throughout the

genome.If the location of a polymorphic sequence is

known, it can serve as a landmark or marker for locating other genes or genetics regions.

Each polymorphic marker has different versions, or alleles.

Types of Polymorphic DNA SequencesRFLP: restriction fragment length

polymorphismsVNTR: variable number tandem repeats (8 to

>50 base pairs)STR: short tandem repeats (1–8 base pairs)SNP: single-nucleotide polymorphisms

Types of Polymorphisms

Single nucleotide polymorphisms (SNPs)A Single Nucleotide Polymorphism, or SNP

(pronounced "snip"), is a small genetic change, or variation, that can occur within a person's DNA sequence.

Common SNPs are defined as >1% in at least one population

Rare SNPs are hard to identify and validateBut, it is estimated that there are a large

number per individualSome areas more variable than others (HLA)

Restriction Fragment Length Polymorphisms

Restriction fragment sizes are altered by changes in or between enzyme recognition sites. GTCCAGTCTAGCGAATTCGTGGCAAAGGCT

CAGGTCAGATCGCTTAAGCACCGTTTCCGA

GTCCAGTCTAGCGAAATCCGTGGCCAAGGCTCAGGTCAGATCGCTTTAGGCACCGGTTCCGA

Point mutationsGTCCAGTCTAGCGAAGCGAATTCGTGGCAAAGGCTCAGGTCAGATCGCTTCGCTTAAGCACCGTTTCCGA

Insertion

Fragment insertion (or deletion)

GTTCTAGCGAATTCGTGGCAAAGGCTGAATTCGTGGTCAGATCGCTTAAGCACCGTTTCCGACTTAAGCACC

GTTCTAGCGAATTCGTGGCAAAAAA GGCTGAATTCGTGGTCAGATCGCTTAAGCACCGTTTTT TCCGACTTAAGCACC

RFLPRFLP (often pronounced "rif lip”) is used to

follow a particular sequence of DNA as it is passed on to other cells.

RFLPs can be used in paternity cases or criminal cases to determine the source of a DNA sample. RFLPs can be used determine the disease status of an individual. RFLPs can be used to measure recombination rates which can lead to a genetic map with the distance between RFLP loci measured in centiMorgans.

RFLPAn RFLP is a sequence of DNA that has a

restriction site on each end with a "target" sequence in between.

A target sequence is any segment of DNA that bind to a probe by forming complementary base pairs.

A probe is a sequence of single-stranded DNA that has been tagged with radioactivity or an enzyme so that the probe can be detected. When a probe base pairs to its target, the investigator can detect this binding and know where the target sequence is since the probe is detectable.

RFLPRFLP produces a series of bands when a

Southern blot is performed with a particular combination of restriction enzyme and probe sequence

RFLP

In the segment of DNA shown below, you can see the elements of an RFLP; a target sequence flanked by a pair of restriction sites. When this segment of DNA is cut by EcoR I, three restriction fragments are produced, but only one contains the target sequence which can be bound by the complementary probe sequence (purple).

Restriction Fragment Length Polymorphisms RFLP genotypes are inherited.For each locus, one allele is inherited from each

parent. Father Mother Locus Locus 1 2 1 2

Parents

Child

Locus 1 2

Southern blot band patterns

Let's look at two people and the segments of DNA they carry that contain this RFLP (for clarity, we will only see one of the two stands of DNA). Since Jack and Jill are both diploid organisms, they have two copies of this RFLP. When we examine one copy from Jack and one copy from Jill, we see that they are identical:

Jack 1: -GAATTC---(8.2 kb)---GCATGCATGCATGCATGCAT---(4.2 kb)---GAATTC-

Jill 1: -GAATTC---(8.2 kb)---GCATGCATGCATGCATGCAT---(4.2 kb)---GAATTC-

When we examine their second copies of this RFLP, we see that they are not identical. Jack 2 lacks an EcoR I restriction site that Jill has 1.2 kb upstream of the target sequence (difference in italics).

Jack 2: -GAATTC--(1.8 kb)-CCCTTT--(1.2 kb)--GCATGCATGCATGCATGCAT--(1.3 kb)-GAATTC-

Jill 2: -GAATTC--(1.8 kb)-GAATTC--(1.2 kb)--GCATGCATGCATGCATGCAT--(1.3 kb)-GAATTC-

Therefore, when Jack and Jill have their DNA subject to RFLP analysis, they will have one band in common and one band that does not match the other's in molecular weight:

Parentage Testing by RFLP Which alleged father’s genotype has the

paternal alleles?

Child Locus 1 2

AF 1 AF2 Mother Locus Locus Locus 1 2 1 2 1 2

Evidence Testing by RFLP Which suspect—S1 or S2—was at the crime

scene? (V = victim, E = crime scene evidence, M = molecular

weight standard) M S1 S2 V E M

M S1 S2 V E M

M S1 S2 V E M

Locus 1 Locus 2 Locus 3

Short Tandem Repeat Polymorphisms (STR)

STRs are repeats of nucleotide sequences.AAAAAA…: mononucleotide ATATAT…: dinucleotide TAGTAGTAG…: trinucleotideTAGTTAGTTAGT…: tetranucleotideTAGGCTAGGCTAGGC…: pentanucleotide

Different alleles contain different numbers of repeats.TTCTTCTTCTTC : four-repeat alleleTTCTTCTTCTTCTTC: five-repeat allele

CAAGATCGCCGGCACCG TCGATCGATCGATCGACGACCCGGCACCGTTCTAGCGGCCGTGGCAGCTAGCTAGCTAGCTGCTGGGCCGTGG

One repeat unit

tandem repeat

Restriction site

Allele 1

AlleleM 1 2 M

Short Tandem Repeat Polymorphisms

STR alleles can be analyzed by fragment size (Southern blot).

GTTCTAGCGGCCGTGGCAGCTAGCTAGCTGCTGGGCCGTGGCAAGATCGCCGGCACCG TCGATCGATCGACGACCCGGCACC

Allele 2

Short Tandem Repeat Polymorphisms STR alleles can also be analyzed by

amplicon size (PCR).

....TCATTCATT CATT CATT CATTCATT CAT....

....AGTAAGTAAGTAAGTAAGTAAGTAAGTA....

....TCAT TCATT CATTCATT CATT CATTCATTCAT....

....AGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTA....

Allele 1

Allele 2

PCR products:Allele 1 187 bp (7 repeats)Allele 2 191 bp (8 repeats)

7/8

(Genotype)

Primers

(Allelic ladder)

11 repeats

5 repeats

Genotype: 7,9 Genotype: 6,8

Short Tandem Repeat Polymorphisms

Allelic ladders are standards representing all alleles observed in a population.

Short Tandem Repeat PolymorphismsMultiple loci are genotyped in the same

reaction using multiplex PCR. Allelic ladders must not overlap in the same

reaction.

FGA

TPOX

D8S1179

vWA

PentaE

D18S51

D2S11

THO1

D3S1358

Amelogenin Locus, HUMAMEL

The amelogenin locus is not an STR.The HUMAMEL gene codes for

amelogenin-like protein.The gene is located at Xp22.1–22.3 and Y.

X allele = 212 bp Y allele = 218 bp

Females (X, X): homozygous Males (X, Y): heterozygous

Analysis of Short Tandem Repeat Polymorphisms by PCR STR genotypes are analyzed using gel or

capillary gel electrophoresis.

Genotype: 7,9

11 repeats

5 repeats11 repeats 5 repeats

(Allelic ladder)

STR-PCR

STR genotypes are inherited.

One allele is inherited from each parent.

Child’s alleles

Mother’s alleles

Father’s alleles

Parentage Testing by STR-PCR

Locus Child Mother 1 2D3S1358 16/17 16 17 17vWA 14/18 16/18 14/15 16/17FGA 21/24 20/21 24 24TH01 6 6/9.3 6/9 6/7TPOX 10/11 10/11 8/11 8/9CSF1PO 11/12 12 11 11/13D5S818 11/13 10/11 13 9/13D13S317 9/12 9 12/13 11/12

Which alleged father’s genotype has the paternal alleles?

Evidence Testing by STR-PCR

Which suspect—S1 or S2—was at the crime scene?

(V = victim, E = crime scene evidence, AL = allelic ladder)

AL S1 S2 V E M AL S1 S2 V E M AL S1 S2 V E M

Locus 1 Locus 2 Locus 3

Short Tandem Repeat Polymorphisms: Y-STRThe Y chromosome is inherited in a block

without recombination.STR on the Y chromosome are inherited

paternally as a haplotype.Y haplotypes are used for exclusion and

paternal lineage analysis.

Short Tandem Repeat Polymorphisms: mini-STR

Mini-STRs are STRs on smaller amplicons.Recommended for degraded specimensUsed to identify remains from mass graves

and disaster areas

MHCMajor histocompatibility complex (MHC) is a cell

surface molecule encoded by a large gene family in all vertebrates. MHC molecules mediate interactions of leukocytes. MHC determines compatibility of donors for organ transplant as well as one's susceptibility to an autoimmune disease via crossreacting immunization. In humans, MHC is also called human leukocyte antigen (HLA).

Protein molecules—either of the host's own phenotype or of other biologic entities—are continually synthesized and degraded in a cell. Occurring on the cell surface, each MHC molecule displays a molecular fraction, called an epitope. The presented antigen can be either self or nonself.

The MHC gene family is divided into three subgroups—class I, class II, and class III.

We will discuss these later…..

SNPs & Function: We know so little..

Majority are “silent”: No known functional change

Alter gene expression/regulation Promoter/enhancer/silencer mRNA stability Small RNAs

Alter function of gene product Change sequence of protein

Large and Small Scale PolymorphismsCopy Number of Polymorphisms

Regional “repeat” of sequence10s to 100s kb of sequenceEstimate of >10% of human genomeMulti-copy in many individuals

Duplicons90-100% similarity for >1 kb5-10% of genome (5% exons elsewhere)Multi-copy (high N) in all individuals

Copy Number VariationAcross the GenomeFrequency of CNVs

Most are uncommon (<5%)Familial vs Unrelated Studies

Associated with DiseaseOPN1LW Red/green colorblindCCL3L1 Reduced HIV InfectionCYP2A6 Altered nicotine metabolismVKORC1 Warfarin metabolism

Engraftment Testing Using STR

Allogeneic bone marrow transplants are monitored using STR.

Autologous transplant

Allogeneictransplant

Recipientreceives his or her own purged cells.

Recipient receives donor cells.

A recipient with donor marrow is a chimera.

Engraftment Testing Using STR There are two parts to chimerism testing:

pretransplant informative analysis and post-transplant engraftment analysis.

RecipientBefore transplant

Donor

After transplant

Complete (full Mixed Graft failurechimerism) chimerism

Engraftment Testing Using STR:Informative AnalysisSTR are scanned to find informative loci

(donor alleles differ from recipient alleles).Which loci are informative?

M D R D R D R D R D R

Locus: 1 2 3 4 5

Engraftment Testing Using STR:Informative AnalysisThere are different degrees of informativity.With the most informative loci, recipient

bands or peaks do not overlap stutter in donor bands or peaks.Stutter is a technical artifact of the PCR

reaction in which a minor product of n-1 repeat units is produced.

Recipient

Donor

Donor

Stutter

Recipient

Donor

Recipient

vWA TH01 Amel TPOX CSF1PO

Engraftment Testing Using STR:Informative Analysis

Which loci are informative?

A(D) A(R)

A(R) + A(D)

Engraftment Testing Using STR:Engraftment Analysis

Using informative loci, peak areas are determined in fluorescence units or from densitometry scans of gel bands.

A(R) = area under recipient-specific peaksA(D) = area under donor-specific peaks

Engraftment Testing Using STR:Engraftment AnalysisFormula for calculation of % recipient or %

donor (no shared alleles).

% Recipient DNA =

A(R) + A(D)

A(R) × 100

% Donor DNA = A(R) + A(D)

A(D)× 100

Engraftment Testing Using STR:Engraftment AnalysisCalculate %

recipient DNA in post-1 and post-2: Use the

area under these peaks to calculate percentages.

Engraftment Analysis of Cellular SubsetsCell subsets (T cells, granulocytes, NK cells,

etc.) engraft with different kinetics.Analysis of cellular subsets provides a more

detailed description of the engrafting cell population.

Analysis of cellular subsets also increases the sensitivity of the engraftment assay.

Engraftment Analysis of Cellular SubsetsT cells (CD3), NK cells (CD56), granulocytes,

myeloid cells (CD13, CD33), myelomonocytic cells (CD14), B cells (CD19), stem cells (CD34)

Methods Flow cytometric sorting Immunomagnetic cell sortingImmunohistochemistry + XY FISH

R D T G

R = recipient allelesD = donor allelesT = T-cell subset (mostly recipient)G = granulocyte subset (mostly donor)

Engraftment Analysis of Cellular SubsetsDetection of different levels of

engraftment in cellular subsets is split chimerism.

Single Nucleotide Polymorphisms (SNPs)Single-nucleotide differences between

DNA sequences.One SNP occurs approximately every

1250 base pairs in human DNA.SNPs are detected by sequencing, melt

curve analysis, or other methods.99% have no biological effect; 60,000 are

within genes.

5′ AGTCTG 5′ AG(T/A)CTG 5′ AGACTG

T/T T/A A/A

SNP Detection by Sequencing

haplotype~10,000 bp

SNP HaplotypesSNPs are inherited in blocks or

haplotypes.

Applications of SNP AnalysisSNPs can be used for mapping genes, human

identification, chimerism analysis, and many other applications.

The Human Haplotype Mapping (HapMap) Project is aimed at identifying SNP haplotypes throughout the human genome.

HV 1(342 bp)

HV 2(268 bp)

Mitochondrial genome16, 600 bp

PL

PH1

PH2

Mitochondrial DNA Polymorphisms

Sequence differences in the hypervariable regions (HV) of the mitochondrial genome

Mitochondrial DNA PolymorphismsMitochondria are maternally inherited.There are an average of 8.5 base

differences in the mitochondrial HV sequences of unrelated individuals.

All maternal relatives will have the same mitochondrial sequences.

Mitochondrial typing can be used for legal exclusion of individuals or confirmation of maternal lineage.

Summary

Four types of polymorphisms are used for a variety of purposes in the laboratory: RFLP, VNTR, STR, and SNP.

Polymorphisms are used for human identification and parentage testing.

Y-STR haplotypes are paternally inherited; maternal relatives have the same mitochondrial DNA alleles.

Polymorphisms are used to measure engraftment after allogeneic bone marrow transplants.

SummarySingle-nucleotide polymorphisms are

detected by sequencing, melt curve analysis, or other methods.

SNPs can be used for the same applications as other polymorphisms.

Mitochondrial DNA typing is performed by sequencing the mitochondrial HV regions.

Mitochondrial types are maternally inherited.