Iowa State UniversityDigital Repository @ Iowa State University

Graduate Theses and Dissertations Graduate College

2013

Porcine Reproductive and Respiratory SyndromeVirus: Diagnostic update and search for novelmodified live vaccinesJoshua Scott EllingsonIowa State University

Follow this and additional works at: http://lib.dr.iastate.edu/etd

Part of the Veterinary Medicine Commons, and the Virology Commons

This Thesis is brought to you for free and open access by the Graduate College at Digital Repository @ Iowa State University. It has been accepted forinclusion in Graduate Theses and Dissertations by an authorized administrator of Digital Repository @ Iowa State University. For more information,please contact hinefuku@iastate.edu.

Recommended CitationEllingson, Joshua Scott, "Porcine Reproductive and Respiratory Syndrome Virus: Diagnostic update and search for novel modified livevaccines" (2013). Graduate Theses and Dissertations. Paper 13006.

Porcine Reproductive and Respiratory Syndrome Virus: Diagnostic update and

search for novel modified live vaccines

by

Joshua Scott Ellingson

A thesis submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

Major: Veterinary Microbiology

Program of Study Committee:

James A. Roth, Co-Major Professor

Michael B. Roof, Co-Major Professor

Kay S. Faaberg

Iowa State University

Ames, Iowa

2013

Copyright © Joshua Scott Ellingson, 2013. All rights reserved.

ii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS vi

ABSTRACT vii

CHAPTER 1. GENERAL INTRODUCTION 1

Introduction 1

Thesis Organization 4

References 7

CHAPTER 2. PRRSV DIAGNOSITICS: REVIEW OF LITERATURE 9

Abstract 9

1. Introduction 9

2. Diagnostic Approach 11

2.1 Determine Objective 11

2.2 Determine Population 11

2.3 Determine Test and Interpret Individual Test Results 12

2.4 Determine Sample Size 39

2.5 Interpretation of All Available Test Results 41

2.6 Classification of the Herd 41

3. Conclusion 43

References 50

CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE

AND RESPIRATORY SYNDROME VIRUS CHIMERAS 62

Abstract 62

1. Introduction 63

2. Materials and Methods 65

2.1 Cells and Viruses 65

2.2 Construction of PRRSV cDNA Clones 66

2.3. Rescue of Viruses 67

2.4 Swine Study 68

2.5 Clinical Evaluation 70

2.6 Serology 70

2.7 Viremia Detection by Virus Isolation and Quantitative RT-PCR 70

2.8 Nucleotide Sequence Analysis 71

2.9 Statistics/biometrics 71

3. Results 72

3.1 Recovery of Viruses 72

3.2. HerdChek ELISA 73

3.3. Virus Isolation 74

3.4. Real Time RT-PCR 75

3.5. Nucleotide Sequence Analysis 76

iii

3.6. Average Daily Weight Gain 76

3.7. Clinical Observations 77

3.8 Lung Pathology 78

4. Discussion 78

Acknowledgements 81

References 91

CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE 94

REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS ISOLATES

THROUGH CONTINUOUS CELL PASSAGE BY LIMITING DILUTION

Abstract 94

1. Introduction 94

2. Materials and Methods 97

2.1 Cell Passage 97

2.2 Viral Isolates 98

2.3 Nucleotide Sequence Analysis 98

2.4 Respiratory Safety Trial 100

2.5 Reproductive Safety Trial 101

2.6 Serology 102

2.7 Average Daily Weight Gain 102

2.8 Reproductive Safety Trial Viremia 102

2.9 Reproductive Safety Study Animal Clinical Observations 103

2.10 Statistics/biometrics 103

3. Results 104

3.1 Sequence Analysis 104

3.2 Respiratory Safety Trial Lung Pathology 104

3.3 Average Daily Weight Gain 105

3.4 HerdChek ELISA 105

3.5 Gilt Reproductive Performance 106

3.6 Mortality of Piglets, Pigs, and Gilts 106

3.7 Viremia 107

3.8 Reproductive Safety Study Clinical Observations 107

4. Discussion 108

References 120

CHAPTER 5. DISCUSSION 124

General Conclusions 124

References 125

iv

LIST OF TABLES

CHAPTER 2. PRRSV DIAGNOSITICS: REVIEW OF LITERATURE

Table 1. Sample Size to Detect at Least One Positive Sample from Herd 45

Table 2. Sample Size Required to Estimate Prevalence Where the 45

Expected True Prevalence is 50%.

Table 3. Criteria Required for PRRS Status Categorization of 46

Breeding Herds

CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE AND

RESPIRATORY SYNDROME VIRUS CHIMERAS

Table 1. Primers Used in Preparation of Recombinant PRRSV 82

Infectious Clones

Table 2. Nucleotide and Amino Acid Changes to Recombinant Viral

Parent Due to Clone Construction 83

Table 3. Treatment List 84

CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE

REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS ISOLATES

THROUGH CONTINUOUS CELL PASSAGE BY LIMITING DILUTION

Table 1. Primers Used in Preparation and Sequencing of PRRSV 112

Isolates

Table 2. Summary of Statistical Methods of Analysis for Collected 113

Parameters

Table 3. Nsp2 Mutations Causing Amino Acid Changes from 114

Positive Piglets at Twenty-one Days of Age

Table 4. Mean Gilt Reproductive Performance per Litter 115

v

LIST OF FIGURES

CHAPTER 1. GENERAL INTRODUCTION

Figure 1. PubMed identified PRRSV manuscripts published per year 6

CHAPTER 2. PRRSV DIAGNOSITICS: REVIEW OF LITERATURE

Figure 1. Guidelines for PRRS Antigen and Serological Test Selection 47

and Interpretation in Accordance with Natural Progression of Infection

Figure 2. Detection of Virus: PRRS Diagnostic Decision Tree 48

Figure 3. Detection of Antibody: PRRS Diagnostic Decision Tree 49

CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE AND

RESPIRATORY SYNDROME VIRUS CHIMERAS

Figure 1. Genome Schematic of PRRSV, the Two Infectious Clones 85

Initially Derived, Chimeras, and Deletion Mutant Prepared for the

Present Study

Figure 2. Mean PRRS ELISA 2XR S/P ratios 86

Figure 3. Viral Load, Determined by Virus Isolation on MARC-145 87

cells, in Swine Serum at All Time Points After Intramuscular

Inoculation with 4.79 Logs of Virus

Figure 4. Viral Load as Determined by qRT-PCR and Plotted as Viral 88

RNA Copies/ml Serum

Figure 5. Growth Effects of Chimeric and Parental Viruses on Swine 89

Figure 6. Average Lung Scores Recorded at 35 Days Post Vaccination 90

and 14 Days Post Challenge

CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE

REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS ISOLATES

THROUGH CONTINUOUS CELL PASSAGE BY LIMITING DILUTION

Figure 1. Pig Respiratory Trial: Lung Pathology 116

Figure 2. Pig Respiratory Trial: Development of PRRSV Specific 117

Antibody as Measured by IDEXX ELISA

Figure 3: Gilt Reproductive Trial: Gilt Viremia as Detected by RT-PCR 118

Figure 4. Gilt Reproductive Trial: Piglet Viremia as Detected by 119

RT-PCR

vi

ACKNOWLEDGEMENTS

I would like to thank my major professors, Drs. James Roth and Michael Roof,

and Dr. Kay Faaberg, for serving on my committee and for all of their guidance,

knowledge, and support throughout the course of this research.

In addition, I would also like to thank my friends and colleagues at Iowa State

University, Boehringer Ingelheim Vetmedica Inc., and AMVC for their willingness to

provide great collaboration, assistance, mentorship, and direction throughout my studies

and professional development.

Finally, thanks to my family for their steadfast encouragement and to my wife for

her hours of patience, support, and love.

vii

ABSTRACT

Porcine reproductive and respiratory syndrome virus continues to be a significant

problem for pork producers. The aim of this body of work was to help stakeholders

control and prevention infection with this virus. A literature review of currently

available diagnostic tests and guidelines for their interpretation serves as a resource for

producers, practitioners, and researchers. The research focus was to evaluate two novel

methods to develop improved modified live vaccines. The efficacy of viral chimeras

constructed from a commercially available vaccine and a virulent wild-type isolate and

the ability to attenuate wild-type isolates with a unique cell passage process are reported.

Both techniques proved to be capable of developing potential vaccine candidates.

1

CHAPTER 1. GENERAL INTRODUCTION

Introduction

Porcine reproductive and respiratory syndrome virus (PRRSV) was first

recognized in the early 1990s as a cause of severe reproductive losses, respiratory

disease, increased mortality, and reduced growth rates in pigs [1-3]. Current control and

prevention strategies rely heavily on the use of diagnostics to develop herd health

management strategies to optimize production. A thorough understanding of the

diagnostic approach, available tests, and test result interpretation are vital components to

developing the best strategies for disease control. However, diagnostic tests are rapidly

changing and it is a challenge for veterinarians and other stakeholders to remain current

with available techniques and technologies. Another challenge to successful control and

prevention programs revolves around the imperfect tools currently available to increase

and stabilize herd immunity against PRRS. Current commercial vaccines are widely

used and help limit losses but have room for improvement. This research focuses on the

search for improved vaccines.

PRRSV is an enveloped, single stranded RNA virus classified within the family

Arteriviridae under the order Nidovirales. Species of PRRSV form two major genetic

lineages and are classified into two genotypes, type 1 (European) or type 2 (North

American). There is a large amount of genetic diversity within PRRS isolates, which

creates problems for diagnostic testing and developing cross protective vaccines. The

prototype genomes for type 1 (Lelystad virus) and type 2 (VR-2332) genotypes vary by

approximately 44% in nucleotide sequence composition. Known sequence variation

2

within a genotype varies by up to 30% in type 1 and 21% in type 2 viruses [4]. The

PRRSV genome is approximately 15,000 kilobases and is organized into at least 10 open

reading frames, numbered (1a, 1b, 2, 2b, 5a, and 3-7,) [4, 5]. Transmission of the virus

occurs via intranasal, intramuscular, oral, intrauterine, and vaginal exposure. Pigs can

develop infection via parenteral exposure, direct contact with infected pigs, contact with

contaminated fomites, exposure to insect vectors, and exposure via infectious aerosols

[6-8].

Clinically, PRRS causes problems in swine breeding herds and in growing pigs

which can vary from asymptomatic to devastating disease. The large variety of clinical

signs are influenced by isolate virulence, susceptibility of host animals, host immune

status, concurrent infections, and other management factors. Disease in the breeding

herd is characterized initially by anorexia, pyrexia, and hyperpnea which are followed by

reproductive failure (abortions, irregular returns to estrus, and reduced live born piglets)

and high preweaning mortality in suckling piglets. In growing pig herds infection is

characterized by anorexia, lethargy, cutaneous hyperemia, hyperpnea, rough hair coats,

reduced weight gains, and increased severity of endemic infections.

To prevent disease associated with PRRS, producers focus on preventing the

entrance of new viral isolates into herds through strict biosecurity measures for all

materials, people, and pigs entering the farm. Other prevention strategies focus on

increasing the host adaptive immune system for potential future infections. Immune

enhancement can be accomplished through contact with other infected animals,

intentional exposure with infectious virus, or vaccination. Contact with infected animals

3

becomes difficult to routinely accomplish as the herd becomes immune to the virus over

time and may stop shedding virus. Intentional exposure to infectious virus has

significant inherent risks and requires high quality standard controls. Use of vaccine is a

much safer and more consistent approach to increase herd immunity.

There are a variety of PRRSV vaccines available around the world which

includes modified live vaccine (MLV) products, killed products, and subunit vaccines.

In general, there is scant evidence that immunization with non-replicating or subunit

products by themselves provide protection against homologous or heterologous

infection. However, numerous studies have shown that live attenuated isolates are

capable of reducing clinical signs and lesions by homologous and heterologous virus [9].

Further, in-depth reviews of killed vs. MLV products, strategies, and results have been

completed elsewhere and thus are not reviewed in this thesis [9-14].

Currently available MLV products were attenuated by continuous passage of an

isolate in cell culture until random genetic changes decreased the virulence of the virus

in pigs. This process is a proven technique to develop effective vaccines, but is

laborious, time consuming, and relatively low yielding. The final products replicate to

some degree in pigs, and provide an unpredictable level of efficacy against subsequent

heterologous challenges. The safety of vaccines prone to mutation and capable of

replicating in the pig host has raised some concern over the possibility of reverting to

virulence in the field. Furthermore, attenuated vaccines are generally indistinguishable

from pathogenic wild type isolates with most diagnostic testing options making it

difficult to differentiate vaccinated from infected animals. Clearly, the swine industry

4

would benefit from the development of vaccines capable of being produced quickly,

with increased safety, and with characteristics allowing for the differentiation of pigs

vaccinated from those infected. The original research reported in this thesis focuses on

the development of these technologies.

Thesis Organization

Chapter 2 serves as a literature review of PRRSV diagnostics. A comprehensive

review of PRRS diagnostics has not been completed since 2002 [15]. Since then, the

growing quantity of available research continues to add to our expanding knowledge of

the virus. The PubMed® database identified 1,216 articles published in peer-reviewed

journals since 2002 pertinent to PRRSV [figure 1][16]. Of those, many report

significant advances in technologies and techniques to collect/transport/detect viral

antigens, viral RNA, and anti-PRRSv antibodies in a growing amount of samples. A

review of diagnostics is pertinent to the evaluation of vaccine efficacy, development of

future vaccines, and is extremely important for development of management strategies to

control and/or eliminate PRRSV from a herd. This manuscript is to be submitted for

publication to Animal Health Research Reviews.

The following chapters cover original work which focused on strategies to

develop improved PRRSV MLVs. Chapter 3 contains original research on the

development and efficacy of PRRSV chimeras within a growing pig controlled challenge

model. This manuscript was published in Vaccine 28 (2010) 2679-2686. The first

author’s role in the research was to develop, execute, interpret, and document the animal

testing phases of the study. The infectious chimeras were provided by Dr. Kay

5

Faaberg’s laboratory for testing. Chapter 4 contains original research on the generation

of attenuated isolates and their screening for virulence within pregnant gilt and growing

pig challenge models. The first author’s role in this work included the development,

execution, interpretation, and documentation of the animal testing phases of the study.

The passaged isolates were created and provided by the Boehringer Ingelheim

Vetmedica Incorporated Research and Development team.

For both trials, the daily animal care was executed by an unbiased third party

while the first author was involved with the animal vaccinations, euthanasia, and

necropsies. Diagnostics were performed by the first author with the exception of

ELISAs and sequencing which were performed by external third parties.

6

Figure 1. PubMed identified Porcine Reproductive and Respiratory Syndrome

Virus manuscripts published per year.

0

50

100

150

200

250

PRRSV Manuscripts Produced/Year

7

References

[1] Terpstra C, Wensvoort G, Pol JM. Experimental reproduction of porcine epidemic

abortion and respiratory syndrome (mystery swine disease) by infection with Lelystad

virus: Koch's postulates fulfilled. The Veterinary quarterly. 1991;13:131-6.

[2] Collins JE, Benfield DA, Christianson WT, Harris L, Hennings JC, Shaw DP, et al.

Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in

North America and experimental reproduction of the disease in gnotobiotic pigs. Journal

of veterinary diagnostic investigation : official publication of the American Association

of Veterinary Laboratory Diagnosticians, Inc. 1992;4:117-26.

[3] Dea S, Bilodeau R, Athanassious R, Sauvageau RA, Martineau GP. Quebec.

Isolation of the porcine reproductive and respiratory syndrome virus in Quebec. The

Canadian veterinary journal La revue veterinaire canadienne. 1992;33:552-3.

[4] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW Diseases of Swine. In:

Zimmermann JJ BD, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, Torremorell

M,, editor. Porcine Reproductive and Respiratory Syndrome Virus (Porcine Arterivirus).

10 ed: Wiley-Blackwell; 2012. p. 461-86.

[5] Oh J, Lee C. Proteomic characterization of a novel structural protein ORF5a of

porcine reproductive and respiratory syndrome virus. Virus research. 2012;169:255-63.

[6] Pitkin A, Deen J, Dee S. Further assessment of fomites and personnel as vehicles for

the mechanical transport and transmission of porcine reproductive and respiratory

syndrome virus. Canadian journal of veterinary research = Revue canadienne de

recherche veterinaire. 2009;73:298-302.

[7] Otake S, Dee S, Corzo C, Oliveira S, Deen J. Long-distance airborne transport of

infectious PRRSV and Mycoplasma hyopneumoniae from a swine population infected

with multiple viral variants. Veterinary microbiology. 2010;145:198-208.

[8] Yoon KJ, Zimmerman JJ, Chang CC, Cancel-Tirado S, Harmon KM, McGinley MJ.

Effect of challenge dose and route on porcine reproductive and respiratory syndrome

virus (PRRSV) infection in young swine. Veterinary research. 1999;30:629-38.

[9] Murtaugh MP, Genzow M. Immunological solutions for treatment and prevention of

porcine reproductive and respiratory syndrome (PRRS). Vaccine. 2011;29:8192-204.

[10] Hocker J. Evaluation of protection provided by inactivated Porcine Reproductive

and Respiratory Syndrome Virus (PRRSV) vaccines Iowa State University; 2006.

8

[11] Johnson W. Porcine reproductive and respiratory syndrome virus (PRRSV)

immunization strategies, virulence of various isolates, and efficacy of DNA vaccination:

Iowa State University; 2009.

[12] Kimman TG, Cornelissen LA, Moormann RJ, Rebel JM, Stockhofe-Zurwieden N.

Challenges for porcine reproductive and respiratory syndrome virus (PRRSV)

vaccinology. Vaccine. 2009;27:3704-18.

[13] Thanawongnuwech R, Suradhat S. Taming PRRSV: revisiting the control strategies

and vaccine design. Virus research. 2010;154:133-40.

[14] Hu J, Zhang C. Porcine reproductive and respiratory syndrome virus vaccines:

current status and strategies to a universal vaccine. Transboundary and emerging

diseases. 2013.

[15] Christopher-Hennings J, Faaberg KS, Murtaugh MP, Nelson EA, Roof MB,

Vaughn EM, Yoon KJ, Zimmerman JJ. Porcine reproductive and respiratory syndrome

(PRRS) diagnostics: Interpretation and limitations. J Swine Health Prod. 2002;10:213-8.

[16] PubMed.gov. Porcine Reproductive and Respiratory Syndrome Virus Search

Results. National Center for Biotechnology Information (NCBI); 2013. p. Search results

for Porcine Reproductive and Respiratory Syndrome Virus.

9

CHAPTER 2: PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME

VIRUS: A REVIEW OF TEST MECHANISMS, DIAGNOSTIC STRATEGIES

AND INTERPRETATION

A paper to be submitted to Animal Health Research Reviews

Joshua Scott Ellingson

Abstract

Porcine Reproductive and Respiratory Syndrome is one of the most economically

devastating pathogens affecting the swine industry. Prevention, control, and elimination

strategies rely on the proper application of diagnostics to describe the current infection

and exposure status of individual pigs and herds. The correct use of diagnostics includes

determining the diagnostic objective, identifying the animal subpopulation to sample,

choosing appropriate tests to use, calculating the number of samples necessary, and

classifying the herd in a meaningful way based on all available data. Diagnostic

technologies and strategies are evolving with each new research discovery which

challenges veterinarians, researchers, producers, and other stakeholders to remain

current with best practices. Diagnostic approaches, available tests, and guidelines for

interpretation are reviewed herein.

1. Introduction

Porcine Reproductive and Respiratory Syndrome (PRRS) is one of the most

economically significant pathogens affecting the swine industry worldwide. PRRS has

been reducing producer profits since the late 1980’s and has since become endemic in

most pork producing regions. A recent economic analysis estimated the total cost to the

United States swine industry at $664 million annually or $1.8 million per day [1].

10

Current prevention and control strategies include intensive biosecurity practices,

vaccination and rigorous diagnostic surveillance strategies at the individual farm level.

Recognizing the difficulty in preventing the transmission of porcine reproductive and

respiratory syndrome virus (PRRSV) from positive farms to adjacent negative farms,

larger scale “area regional control and elimination” (ARC&E) projects have been

initiated. These programs have been developed to coordinate the communication of

PRRS status, control strategies, and elimination plans for large geographic regions

including as many as 500 individual farms. To date, the success of PRRS control and

elimination programs at the individual farm and regional level has had variable results.

Effective PRRS control, elimination, and prevention plans require significant

capital investment of producers, steadfast commitment from the farm staff, and effective

diagnostic tests to correctly classify the status of animals. Equally important as having

rapid, sensitive, and specific diagnostic tests available is the requirement for correct test

result interpretation. Interpretation is the final piece to the diagnostic process which

helps safeguard producers from economic losses associated with infection.

Significant time and financial resources have been invested to continually

improve and refine diagnostic approaches and assays. Available PRRSV diagnostics

evolve regularly, making it challenging for veterinarians and industry stakeholders to

remain current. This paper reviews diagnostic approaches, available assays, and

guidelines for interpretation.

11

2. Diagnostic Approach

2.1 Determine objective

Diagnostics are performed to satisfy a defined objective. Objectives may include:

detection of infection, determination of prevalence within a population, confirmation of

exposure/vaccination, or to determine the timing of infection [2]. All diagnostic

approaches can have an effect on management decisions for individual animals or the

entire herd or funds are being wasted. For example, if a boar tests positive for PRRSV

via PCR semen would not be sold, but semen would be sold and distributed if the test

result was negative. Discretion must be used to ensure the prudent use of producer funds

for diagnostic workups. Diagnostic approaches should be synthesized to answer a

particular objective with an acceptable level of confidence in the most efficient manner.

2.2 Determine Population

Once the objective has been defined, the next step is to determine the population

to sample. Testing can either be directed at an individual animal or an entire population.

When testing individuals, assays with the highest sensitivity are sought to attain the

highest level of confidence. Timing plays a critical role in testing individuals as viremia,

viral shedding, antibody responses, and histological lesions have finite durations.

Likewise, interpreting individual test results may not reflect the status of the entire herd

as the timeline of infection will vary for each individual animal. With herd level testing,

animal selection is very important. Objectives should determine the animal population

to target which can include: young, old, recently comingled, or diseased animals.

12

Individual test results provide specific animal status while herd level diagnostics provide

an inference of the population.

2.3 Determine test and interpret individual test results in light of clinical signs

Once the objective and targeted population has been determined, the appropriate

test should be selected. PRRSV diagnostic tests can be broken up into two main

categories: 1) viral detection or 2) viral exposure. Viral detection requires collection of

virus laden tissue, bronchoalveolar lavage (BAL) fluid, thoracic fluid, semen, blood, oral

fluid, or environmental samples and relies heavily on molecular techniques, but can also

be accomplished with virus isolation and less specific techniques such as electron

microscopy or tissue immunohistochemistry. Detection of viral exposure is based on

antibody production and requires blood, oral fluid collection, or muscle transudate.

Detection of Virus

RT-PCR

Molecular technologies have been an area of rapid development and extensive

use by pig producers for detection of PRRSV. Numerous (polymerase chain reaction)

PCR assays have been described since the first assays were developed in the mid-1990s

[3, 4]. The reverse transcriptase (RT-PCR) is used to detect PRRS ribonucleic acid

(RNA) in clinical specimens, now including: serum, oral fluid, lung, tonsil, lymph node,

BAL fluid, heart, kidney, spleen, thymus, semen, and thoracic fluid. Compared with

other available tests, RT-PCR is also the test of choice for fetuses when vertical

transmission is suspected [5]. Viral RNA is first extracted from the specimen, converted

to DNA through a reverse transcriptase step, and then the complementary viral DNA is

13

exponentially amplified by polymerase chain reaction. A variety of methods can then be

used to detect the presence of amplified DNA in samples.

Many swine focused laboratories can complete RT-PCR for same day the

results. The structural proteins coded for by open reading frame (ORF) 6 and 7 are

typically targeted for detection as these regions of the genome are highly conserved.

ORF 6 codes for the matrix protein (M) while ORF 7 codes for the nucleocapsid protein

(N) [6, 7]. The benefits of PCR include: rapid detection of PRRS RNA, ability to

quantify viral loads, high sensitivity, high specificity, ability to identify most

heterologous isolates, and ability to test numerous diagnostic specimens (tissue

homogenates, serum, and body fluids/secretions). Oral fluid samples should be tested

using RT-PCRs verified to function adequately in the oral fluid matrix for ensured

results quality [8, 9].

The disadvantages of PCR assays include: high sensitivity (relatively easy for

contaminates to cause false positives), inability to identify some genetically diverse

isolates (due to primer or probe mismatching), lack of uniform performance between

laboratories, and inability to differentiate infectious from inactivated virus [10]. Pooling

of serum, semen, blood swabs or tissue specimens is routinely performed in the field to

reduce diagnostic cost, but does reduce the sensitivity of RT-PCR, especially when the

prevalence of infection is low and samples contain relatively small viral quantities [9,

11].

Currently, two commercial real-time reverse transcriptase-polymerase chain

reaction assays are available in North America and other parts of the world (VetMax NA

14

and EU PRRS, Applied Biosystems, Foster City, California and VetAlert NA and EU

PRRSV PCR, Tetracore, Rockville, Maryland) [12]. Both kits detect both type 1

(European; EU) and type 2 (North American; NA) PRRSV isolates. Samples are

identified as positive when the amplification curve of DNA crosses the threshold limit

(<37) for a positive sample. The quantitative (qRT-PCR) assays give each positive

sample a cycle threshold (Ct) value which is the cycle at which the curve crosses the

threshold limit of detection. Lower Ct values indicate higher levels of viral RNA in the

sample. Both assays have multiple primers and probes to detect a variety of isolates, but

neither is perfect. Of 423 clinical cases evaluated with both assays, 27 cases tested

positive with one assay and negative for the other [12].

A recently developed multiplex assay includes primers and probes to detect and

differentiate infection with type 1, type 2, and a highly pathogenic type 2 strain (HP-

PRRSV) with good sensitivity and specificity [13]. The HP-PRRSV strain emerged in

China in 2006 and is characterized by high fever, morbidity, and mortality. The 90

nucleotide deletion in the nonstructural protein 2 (nsp2) coding region of HP-PRRSV

serves as a marker to differentiate HP-PRRSV from other strains [14]. Additional

differential molecular assays have also been described to differentiate HP-PRRSV from

other type 2 isolates with the use of either a duplex real-time RT-PCR using minor

groove binder probes or a SYBR Green-based RT-PCR [15, 16]. Similar strategies

could be employed in the future to help differentiate infected from vaccinated animals if

a differential modified live vaccine can be developed.

15

Flinders Technology Associates (FTA) cards have been assessed for potential use

as a transport medium for PRRS RT-PCR. FTA cards contain a mixture of chemicals

which lyse cells and inactivate bacterial and viral pathogens while preserving nucleic

acids. Samples held within FTA cards can be used for molecular diagnostics and can be

shipped in standard letter mail envelopes at room temperature, which may facilitate

testing in remote locations. The cards are reported to be a safe, simple, and sensitive

alternative method to transport serum, blood, and tissue samples for PRRSV RT-PCR.

However, a significant decrease in sensitivity should be expected from oral fluid samples

[17].

The development of loop-mediated isothermal amplification (LAMP) reduces the

need for advanced equipment necessary to perform PCR. This technology allows

amplification of DNA at a constant temperature in simple devices (water bath or heat

block) and eliminates the need for expensive laboratory equipment such as thermal

cyclers [10]. The amplified product is directly related to sample turbidity or a change of

color when color indicator systems are used [18, 19]. This advance in technology does

come with lower test sensitivity as compared to other RT-PCR assays, but may allow for

additional production systems and veterinary clinics to perform more of their own in-

house testing for presence of PRRS virus [19].

RT-PCR Interpretation

The individual kinetics of PRRS isolate replication varies significantly in vivo.

In general, virus can be expected to be found at higher levels and for longer periods

when naïve animals are infected [10]. Pig age also has an effect on viremia. For both

16

virulent and attenuated PRRSV, peak viremia and duration were substantially greater

than those in finishing pigs and mature adult animals [20]. Serum viral levels typically

peak at 4-7 days post inoculation (DPI) before declining to undetectable levels by 29-35

DPI in individual pigs while virus does persist longer in tonsil and lymph nodes than in

serum, lung, and other specimens [figure 1] [10, 20]. RT-PCR can be used to identify

PRRS RNA in infected pigs for up to 86 DPI in lymph nodes [21], 92 DPI in semen [4],

[22], 105 DPI in oropharyngeal scrapings [23], and 251 DPI in serum and tonsil

homogenates [24]. However, testing tonsils, oropharyngeal scrapings and lymph nodes

generally has a poor success rate when beyond 90 DPI [10]. Oral fluid samples can be

expected to be positive for 14-90 days after infection [25]. Individual oral fluid samples

from boars were positive for at least 21 days [26]. Viral RNA can also be found with

RT-PCR in most tissues from viremic live born piglets and occasionally in fetal thoracic

fluid and tissues from mummies and stillborn piglets.

The inability of RT-PCR to differentiate infectious from non-infectious virus is

important to consider when interpreting test results. Inactivated PRRS RNA is stable in

solutions while the infectivity of virus has a half-life of approximately 6 days in cell

culture medium [27]. Aerosolized virus maintains infectivity best at low temperatures

and low humidity, with a peak of about 3 hours under experimental conditions [28].

Differentiating infectious from inactivated virus is typically only important when

evaluating environmental samples (transportation equipment, air samples, etc.).

Interpretation of negative results may include: no viral nucleic acid present (pig

not infected), inability of PCR primers or probes (real-time RT-PCR) to detect

17

genetically diverse isolates (present but not detected), degradation of virus due to poor

sample quality, individual pig not currently infected despite a low prevalence of virus in

population, and pig is infected but the tested specimen does not contain viral nucleic

acid. False negative results are a major concern with RT-PCR, as no assay is capable of

detecting all field strains especially in regard to type 1 isolates [12, 29]. Coupling

molecular testing strategies with antibody based techniques are recommended for

surveillance of negative herds to increase the probability of detecting infection.

Furthermore, determination of herd statuses with pooled samples tested via RT-PCR

should be executed with caution as pooled samples can test negative, while individual

samples may be positive.

Interpretation of positive results includes the following scenarios: pig is viremic

with infectious virus (vaccinated or wild type infection), inactivated virus recovered and

amplified, and virus contamination from sample collection or testing process (false

positive) due to high sensitivity. All unexpected results should be immediately

communicated to the laboratory for follow up testing and to alert diagnosticians of a

potential need for assay improvement to recognize the continually mutating PRRS

viruses [12, 30].

Virus isolation (VI)

Virus isolation can be performed on any virus laden tissues (after

homogenization) or fluids. Samples should be chilled and held at (4°C) for less than 48

hours due to the sensitivity of the virus to pH and temperature changes [27, 31-33] or

frozen at -70°C for future testing. For best results samples should be received at the

18

laboratory within 48 hours. Virus isolation can be performed on Pulmonary Alveolar

Macrophages (PAMs) or sublines (CL-2621, MARC-145) of the African Green Monkey

kidney cell line (MA-104) [31, 34]. In addition to the established cell types used for in

vitro growth, additional permissive cell types have been reported. Several genetically

modified cell lines have recently been developed to facilitate PRRSV replication in vitro

including: immortalized PAM cells expressing the CD163 protein, immortalized porcine

monomyeloid cells expressing the human telomerase reverse transcriptase, PK-15 cells

expressing sialoadhesin protein, and porcine, feline, and baby hamster kidney cells

expressing the CD163 protein [35-38]. Other non-genetically modified cell lines have

also been identified to support PRRSV replication in vitro. St. Jude porcine lung (SJPL)

epithelial cells are phenotypically distinct and react differently to PRRS infection as

compared to MARC-145 cells [39]. Porcine endometrial endothelial (PEE) cells have

also proven to be permissive to PRRSV replication in vitro and may provide future

insights into associated reproductive disease pathogenesis [40].

The presence of Fc receptors on PAMs may account for their increased

sensitivity for isolating virus in the presence of antibodies as compared to MA-104 cell

types. For optimum recovery of virus, VI should be performed on both PAMs and

subline cell types as isolates vary significantly in their ability to replicate in each [41,

42]. The pig source of PAMs is also important as those from Landrace breeds poorly

support the growth of PRRSV in vitro [43]. MA-145 cells may preferentially favor

replication of modified live vaccine viruses as MA-104 cells were used for in vitro cell

19

adaption. Furthermore, it has been reported PAMs are required for the successful

isolation of some European and European-like viruses [44, 45].

The positive indicator for virus isolation, cytopathic effects (CPE), is not

pathognomonic for PRRSV replication. Therefore secondary confirmation steps can

include: RT-PCR, negative-stain electron microscopy (EM), or visualization of viral

antigens within cells by fluorescent antibody (FA) techniques using PRRS-specific

monoclonal antibodies [46]. Lot to lot validation should be performed with samples

known to contain specific concentrations of virus to verify results.

VI Interpretation

Timelines to detect infection in vivo via VI are essentially the same as those

described for RT-PCR, with the exception of having to wait 5-8 days for test results with

the VI procedure versus potential same day results for RT-PCR. Possible explanations

for negative results from VI assay include: pig has not been infected, pig is infected but

no infectious virus in sample (neutralizing antibodies/degradation of virus in sample), or

pig is infected but virus is unable to infect cell culture line used. For fetal samples, virus

isolation is approximately half as sensitive as RT-PCR and is more prone to the negative

effects of sample autolysis [5].

Antigen Labeled Microscopy (IHC and FA)

The typical gold standard for a pathological diagnosis is to correlate the

suspected disease agent with identifiable tissue lesions. Microscopic evaluation of fixed

tissues allows for histopathological evaluation and the utilization of

immunohistochemistry (IHC) techniques to visualize viral antigens within cells or

20

contiguous to microscopic lesions [47]. IHC can be performed on fresh and properly

fixed (10% neutral buffered formalin) lung, tonsil, lymph nodes, heart, brain, thymus,

spleen, and kidney [47-49]. Immunohistochemistry is reported to be highly specific

(100%) and moderately sensitive (67%) [50]. Identification of PRRSV antigen in lung

tissue by IHC has been found to require the examination of a minimum of five sections

of anterioventral lung to identify >90% of PRRS infected pigs [49]. The highest

sensitivity is appreciated when tissues are processed within 48 hours of fixation, which

helps prevent antigen degradation and loss of positive cells [48].

If not feasible to get tissues into the laboratory promptly, antigen can also be

detected in frozen lung sections by fluorescent antibody (FA) or indirect fluorescent

antibody (IFA) techniques [31, 50, 51]. BAL fluid and cell cultures can also be analyzed

by FA or IFA for detection/confirmation of PRRSV. The FA test is quicker to perform

and less expensive than IHC, but has the disadvantage of requiring fresh or frozen tissue.

Both the IHC and FA tests require monoclonal antibodies to detect viral nucleocapsid

antigen in the cytoplasm of infected cells and thus both tests may not detect genetically

diverse isolates. Both tests also rely on the laboratory operator’s ability to detect antigen

and differentiate it from nonspecific background staining. To increase test specificity,

positive tests can be confirmed with VI and/or RT-PCR.

IHC and FA Interpretation

Identification of virus using IHC is best in the early stages of infection (1-28

DPI), limited in the mid stages of infection (30-70 DPI) and not recommended in the

latter stages (> 90 DPI) due to low sensitivity [10]. IHC can identify vertically

21

transmitted virus in most tissues from infected live-born piglets. Evaluation of BAL

samples with FA can be performed directly (without first amplifying potential virus in

cell culture) in the early stages of infection, directly or immediately after incubation in

cell culture of lavage fluid in the mid stages of infection, and is not recommended in the

latter stages of infection. Evaluation of lungs from live-born piglets can also be

successful with FA.

Interpretation of negative samples may include the following scenarios: pig is not

infected, pig is infected but has no virus in sections examined, operator is unable to

identify antigen-antibody complexes, or pig is infected with a genetically diverse isolate

not bound by monoclonal antibodies. Positive FA results can either be due to true

infection or due to the poor specificity of antibody used in the assay (false positive).

Field Test Strips

The recent development of immunochromatographic test strips for the detection

of PRRS virus has been described [52]. The strip tests have the benefits of speed,

convenience, and requiring less technical skill or sophisticated laboratory equipment.

The test is performed by adding serum or tissue homogenate to a mixture of gold-labeled

monoclonal antibodies to the PRRSV N and M proteins. If present, virus binds to the

antibody and the antigen-antibody complexes are captured on chromatographic test

strips. Positive samples are detected using a labeled antibody which binds to the

monoclonal antibodies. Unbound monoclonal antibodies move past the test line and are

captured by a separate set of monoclonal antibodies which produce a band representing a

control line. From trial work performed in China, a sensitivity of >93% and specificity

22

of >96% was reported when samples were compared to RT-PCR testing [53]. However,

these assays are not currently commercially available in the USA.

Test Strip Interpretation

Field test strips have not been widely used to date. Caution should be taken

when interpreting results in light of reported sensitivity and specificity data due to

relative lack of diversity of viruses tested. Positive results could be due to: true presence

of virus, sample contamination, or result of poor specificity of monoclonal antibodies

used in the test strip. Negative results could be the result of: true negative specimens,

positive animals not shedding virus currently, positive animals with no virus in tissue

examined, inability of the test to identify low levels of virus, and inability of the

monoclonal antibodies to identify genetically diverse isolates.

Swine Bioassay

The swine bioassay is a variation of the third fulfillment of Koch’s postulates

which states “the pathogen from a pure culture must cause disease when inoculated into

a healthy susceptible animal.” The swine bioassay was first described to evaluate semen

for PRRSV, where 15 ml of whole semen is injected intraperitoneally into 4-8 week old

PRRSV naïve pigs [4]. The inoculated pigs are placed in strict isolation and monitored

weekly for seroconversion for a total of 5 weeks. The bioassay is very laborious,

requires additional use of animals for diagnostic purposes, and is very slow. This assay

is no longer of routine diagnostic value, but could be used with modifications if

genetically diverse PRRS isolates surface in the future as it is the most sensitive

diagnostic assay available to date to find live virus.

23

Bioassay Interpretation

The swine bioassay interpretation relies on the ability of the virus from the

presumed positive animals to infect naïve pigs. Potential causes of negative results

include: no infectious virus present, virus is present in host but neutralizing antibodies

prevent infection, or virus is present in host but absent/in low concentrations in sample.

Positive results could be due to presence of infectious virus in sample, contamination of

naïve pigs with a different strain or false positive reaction on the confirmatory test used

on the sentinels.

Electron Microscopy

Electron microscopy (EM) was used as an early diagnostic tool shortly after

PRRS was first described. Evaluation of virus isolated on PAMs with an electron

microscope should reveal spherical, enveloped, 45-55 nm in diameter, virus particles

with a 30-35 nm nucleocapsid [54]. Electron microscopy is not used for routine

diagnostics due to the time constraints for testing, sophisticated equipment necessary,

and requirement of specialized technologists. However, similar to the swine bioassay it

could have some utility if variant isolates emerge which can’t be recognized by current

molecular or antibody based techniques.

EM Interpretation

Interpretation of negative results could include the following: no virus present,

viral particles present but morphologically unidentifiable, viral particles present but not

in sufficient concentration to be identified by operator, or virus is present in host but

unable to grow in cell culture medium used for amplification of virus.

24

Detection of Antibody

Serology

Serology has historically been favored by swine practitioners because serum is

easily collected in large quantities for multiple tests which are readily available. Oral

fluid samples and muscle transudate can now also be used to detect antibodies in pigs

[55, 56]. The documentation of seroconversion using acute and convalescent samples is

the definitive method to diagnose PRRS exposure. Increasing titers of PRRS specific

antibody provides good evidence for recent PRRSV exposure. However, serology is not

a valid approach for a diagnosis of PRRS in previously infected or vaccinated herds,

because current serological assays cannot clearly differentiate among antibodies

resulting from an initial infection, reinfection, or vaccination [10]. Single serum samples

can be used to confirm exposure or vaccination compliance in previously naïve pigs, but

cannot be used to prove PRRS is the clinical diagnosis. The tests used to detect the

presence of PRRS specific antibodies include: enzyme-linked immunosorbent assay

(ELISA), indirect fluorescent assay (IFA), virus neutralization (VN), immunoperoxidase

monolayer assay (IPMA), and immunochromographic test strips. Multiple serological

assays are often used for confirmation of questionable samples. The three most

commonly utilized serologic diagnostic tests include the ELISA, IFA, and VN assay. To

put the use of these tests in perspective, the Iowa State University Veterinary Diagnostic

Laboratory ran the following serological tests for PRRSV in 2012: 146,560 HerdCheck®

X3 PRRS ELISA, 7,658 HerdCheck® X3 PRRS ELISA for oral fluids, 2,977 indirect

25

fluorescent antibody tests (1,786 North American and 1,191 for European strains), and

395 PRRS neutralization assays [57].

ELISA

The ELISA is the most commonly used serological test for detection of PRRS

antibodies due to its sensitivity, specificity, speed, and reproducibility. The commonly

used commercial ELISA (HerdChek® X3 PRRS ELISA, IDEXX Laboratories,

Westbrook ME) is considered the reference standard for the detection of antibodies to

PRRSV [10]. This is an indirect ELISA which utilizes the N protein as the target

antigen for both North American and European viral strains. The N protein is the most

abundant viral protein, is highly immunogenic, and induces an early antibody response

in pigs [58]. Recombinant N protein is coated on plates, serum is added, and anti-

PRRSV antibodies are visualized with the addition of an anti-pig Horseradish

Peroxidase-Conjugated Immunoglobulin G (IgG-HRP) conjugate as a second step

(making this an indirect assay). This test replaces the PRRS 2XR kits (IDEXX

Laboratories) and offers significantly improved specificity (99.9%) while maintaining a

high level of sensitivity (98.8%) [59]. Per kit instructions, results are expressed as a

sample-to-positive (S:P) ratio, which is calculated by taking the optical density (OD) of

a given sample on the PRRSV coated well minus the sample OD on the normal host cell

(NHC) antigen coated well divided by the positive control OD on the PRRSV antigen

coated well minus the positive control OD on the NHC coated well. For the HerdChek®

X3 PRRS ELISA S:P ratios ≥ 0.4 are considered positive.

26

The HerdChek® X3 PRRS ELISA protocol can be adapted to the oral fluid

matrix to calibrate the reactivity of the assay to the lower concentration of antibody

present in oral fluids relative to serum. Immunoglobulins M (IgM), IgA, and IgG can all

be readily detected in oral fluid and from a population of animals. The kinetics of each

immunoglobulin in oral fluid are very similar to those found in serum, with the

exception of IgA being identified quicker and for a longer duration in oral fluids [60].

Furthermore, the PRRSV oral fluid ELISA has proven to have a high level of

repeatability and reproducibility amongst laboratories [61]. Testing of oral fluids for

antibodies using pen-based oral fluids is a non-technically demanding and cost-effective

approach for monitoring commercial herds.

A double recognition (DR) ELISA (Ingezim PRRS DR, Inmunología y Genética

Aplicada SA, Madrid, Spain) has recently been developed and is commercially available

for detection of European isolate generated antibodies. The principle of the DR-ELISA

is based on the simultaneous binding of antibody sandwiched between precoated and

enzyme-conjugated antigens [62]. Plates are coated with recombinant N protein,

washed, serum (diluted with horseradish peroxidase-conjugated N protein) is added for

one step incubation, and finally the reaction is revealed by addition of substrate and

stopped prior to reading [63]. Per kit instructions, S:P ratios > 0.175 are considered

positive. The DR-ELISA has a reported specificity of 99% and drastically increased

sensitivity for detecting antibody at 7 DPI (88% vs. 22% for HerdChek® X3 PRRS

ELISA) [64]. The DR-ELISA is better suited to identify IgM due to the use of coated

and conjugated antigen. The pentameric conformation of IgM allows one antibody to

27

bind up to ten antigens as compared to IgG which is theoretically limited to binding two

antigens. The DR-ELISA performance beyond 21 DPI is reportedly very similar to the

HerdChek® X3 PRRS ELISA [63]. The higher sensitivity for detection of early

infection makes the DR-ELISA a more suitable test for naïve farms.

Other ELISA tests have been described, including CIVTEST Suis: PRRS which

uses native proteins of Lelystad virus (EU prototype strain) for antigen (Laboratorios

HIPRA, SA, Girona, Spain) and Ingezim PRRS Compac which utilizes an E.coli-

expressed nucleocapsid protein from a type 1 isolate as an antigen (Inmunología y

Genética Aplicada SA, Madrid, Spain). As well as the blocking ELISAs Bio-Vet PRRS-

Blocking which uses an E.coli-expressed nucleocapsid protein as an antigen (Bio-Vet

Laboratories, Saint-Hyacinthe, Quebec) and Ingezim PRRS Europa/America/Universal

which utilize viral proteins produced in E.coli as antigen (Inmunología y Genética

Aplicada SA, Madrid, Spain).

Blocking ELISAs are performed by coating test plates with an antigen lysate as

for the indirect ELISA. Diluted test serum is then added and allowed to react with the

test antigen if containing antigen specific antibodies. After washing, specific enzyme-

labeled antibody directed against the test antigen is added, resulting in competition with

the test serum antibodies. Negative serum samples result in maximum color

development, whereas samples with specific antibodies specific antibodies show less

color development with increasing antibody.

Numerous studies have shown nonstructural proteins 1, 2, and 7 also induce high

levels of antibody during PRRSV infections [65-67]. An ELISA was developed with

28

nsp2 and nsp7 as the target antigens for pigs infected with both North American and

European isolates. The assay was positive 14 through 126 DPI. The results using nsp2

or nsp7 as target antigens correlated well with the commercial 2X ELISA kit.

Furthermore, the nsp7 ELISA resolved 98% of samples with suspected false-positive

results from the 2X ELISA and was able to differentiate type 1 versus type 2 infection in

469 of 470 samples [67]. Therefore, these other antigen targets may have use as future

commercial, confirmatory, or differentiating tests.

Several differential ELISAs have been developed to distinguish viral exposure to

PRRS isolates with nsp2 deletions from other isolates [68, 69]. An indirect ELISA to

differentiate HP-PRRSV from other Chinese type-2 strains has been developed with

reportedly good sensitivity and specificity [69]. This assay uses the lack of antibodies

against the 30 amino acid deletion sequence within the nsp2 portion of the HP-PRRS

genome as a target for differentiation. A similar approach could be utilized to

differentiate infected from vaccinated animals if a modified live vaccine with significant

genomic changes from field strains can be developed in the future.

ELISA Interpretation

It is important to keep in mind the high degree of variation in individual animal

immune responses and to use care not to over interpret the significance of differences

between S:P ratios [44, 65, 70, 71]. These ratios are not generally considered a “titer”

since it does not use a serial dilution of the serum to obtain a result that is

immunologically meaningful [72]. The level of antibody also cannot be used as an

indicator of isolate virulence [20]. ELISA samples collected at a single time point can

29

be difficult to interpret and should not be used to estimate the particular stage of

infection [73].

Maternally derived antibodies will persist for 3-5 weeks, while new infections

will first become positive for IgM at 5-7 DPI and IgG 7-10 DPI [74-76]. Antibody

levels typically peak at 30-50 DPI prior to declining to negative levels by ~ 300 DPI [10,

77]. Antibodies in oral fluids have been detected for up to 126 DPI [60]. Oral fluids

have also been found to detect exogenous PRRSV antibody in pigs fed diets including

spray-dried porcine plasma [78]. If exogenous sources are suspected to be causing false

positives, feed samples can be submitted and assayed for PRRSV antibody directly or

serum samples can be tested since the feed antibodies are not expected to reach the

serum intact. Positive sample interpretations can include: exposure to PRRS virus or

vaccine, detection of maternally derived antibodies, detection of exogenous antibody, or

classification due to low specificity of the test (false positive).

Possible causes for negative samples can include: no exposure, pigs recently

exposed but have not seroconverted (prior to day 7 of infection for DR-ELISA and day 9

for HerdChek® X3 PRRS ELISA), pigs are harboring virus in lymphoid tissues yet have

become seronegative, pigs have cleared the infection and reverted to seronegative, or

pigs are negative due to low test sensitivity [79]. Persistently infected pigs which are

negative by ELISA can be revealed through isolation of infectious virus or detection of

viral RNA in tonsil, lymphoid tissues, or oropharyngeal scraping [23, 80].

The impact of pooling samples should also be considered when evaluating test

results. Compared to testing samples individually, pooling serum samples to detect

30

antibodies results in a decreased sensitivity and increased specificity. Reducing the S:P

cutoff value recommended by the manufacturer has the opposite effect (increases

sensitivity and decreases specificity). A recommended protocol which increases herd

level sensitivity and specificity compared to testing samples individually includes testing

samples in pools of 2-10 and keeping the total number of tests the same [81]. However,

this does result in increased sample collection costs as more samples are required.

FMIA

The fluorescent microsphere immunoassay (FMIA) uses multiple fluorescent

microspheres for the simultaneous detection of multiple antibodies or antigens in

biological samples. These assays use multiple beads which each have a distinct dye to

distinguish them from each other when using flow cytometry. Individual beads can be

conjugated to different antigens or antibody to capture specific molecules within a

sample. Samples are measured using the fluorescence of a secondary antibody if the

target successfully binds with the bead. The advantage of FMIA is the ability to detect

multiple antigens or antibodies simultaneously with small sample volumes.

The ability of FMIA to detect antibodies in oral fluids was evaluated due to the

relatively low sensitivity of antibody detection in oral fluid samples when using

traditional assays [82]. Recombinant nsp7 and N proteins of type 1 and 2 genotypes

were coupled to microspheres. Serum or oral fluid was combined with the antigen-

coupled microspheres and allowed to incubate to allow for antigen-antibody binding. A

secondary labeled antibody was then added as an indicator and the combination was

again allowed to incubate. The results showed the oral fluid-based FMIAs achieved

31

>92% sensitivity and 95% specificity while the serum samples had greater than 98%

sensitivity and 95% specificity. Antibodies against the N protein were more sensitive

for the detection of early infection while the nsp7 directed antibodies were detected at

higher concentrations and for a longer duration. In serum the antibodies against both

proteins were detected as early as day 7 and persisted for greater than 202 days [82].

FMIA Interpretation

Interpretation of results for the FMIA assay is very similar to those for the

ELISA. The exceptions would be the FMIA is more sensitive for the detection of early

infections as compared to the traditional ELISA.

IFA

The indirect fluorescent antibody (IFA) test is performed by placing serum onto

virus-infected cells in microtiter plate wells, adding fluorescein-labeled anti-porcine

antibodies, and then screening for antigen-antibody reactions with the use of a

fluorescent microscope. This procedure can provide relative antibody titers by using

serial dilution of samples. The IFA detects IgM and IgG antibodies. The IFA generally

has good specificity, but sensitivity is impacted by the technical skill of laboratory

technicians, cell types used, laboratory protocol (media, incubation times, etc.) and

antigenic differences between the PRRS isolate used in the IFA and the field virus

inducing antibodies in the pig [44]. Typically, the IFA is used to confirm suspected

false-positive ELISA results, but has also been used to detect PRRS antibodies in muscle

transudate (meat juice) and oral fluid samples in surveillance programs [55, 56].

32

IFA Interpretation

The IFA is typically able to detect antibodies earlier in the infection stage than

available commercial ELISAs. An IFA can detect IgM as early at 5 DPI and IgG as

early as 9-14 DPI [74]. The duration of antibody detection is slightly different than the

ELISA as the IFA will detect IgM for 21-28 DPI and IgG for 90-145 DPI prior to going

negative. Peak IgG levels will be detected at 30-50 DPI, similar to ELISA. Antibodies

can be detected in piglet umbilical cord blood but typically only in those which are VI or

RT-PCR positive [10].

Potential scenarios for negative tests include: pigs not exposed, pigs recently

exposed but have not seroconverted (prior to 5 DPI for IgM and 9 DPI for IgG), pigs are

persistently infected (harboring virus in lymphoid tissues) and have become

seronegative, pigs have cleared the infection and reverted to seronegative, pigs are

negative due to low test sensitivity, pig was exposed to a genetically diverse isolate

compared to the isolate used to in the test, or operator is unable to detect/differentiate

antigen-antibody complex.

VN

Virus neutralization assays detect antibody capable of neutralizing a given

amount of PRRSV in cell culture. A combination of sample serum dilutions and a

constant amount of virus are incubated to allow any neutralizing antibodies present to

bind to infectious virus. After incubation, the mixture is then added to sensitive cells

which are assessed for visible CPE 3-5 days later. If no neutralizing antibody is present,

CPE should be apparent. However, in the presence of neutralizing antibodies, no CPE

33

will be apparent at lower serum dilutions and a titer can be determined where CPE

becomes apparent. Use of both PAMs and celllines are recommended due to the

significant differences in the infectious process of the two cell types [83]. The VN test is

highly specific, but has poor sensitivity. VN tests have no standardized protocols or set

of reagents to be used, and most laboratories have developed similar but independent

systems [44]. VN assays are typically used only for research purposes due to its time-

consuming nature, technical difficulty, and cost to perform.

VN Interpretation

Neutralizing antibodies have not been clearly linked to immunity or protection

against virulent virus, thus the interpretation to clinical situations is difficult. If the

homologous virus is not used in the assay, results should be interpreted with caution due

to the varying ability of neutralizing antibodies to bind heterologous virus. Neutralizing

antibodies have been identified as early as 11 DPI [84], but often do not develop until

30-60 DPI, if at all [31]. Furthermore, some pigs develop relatively low levels of

neutralizing antibody [58]. Neutralizing antibodies typically peak 60-90 DPI and persist

for up to 365 DPI. Possible explanations for negative VN assays include: pigs were not

exposed, pigs were recently exposed but have not seroconverted (prior to 30 DPI), pigs

are persistently infected and have become seronegative, pigs have cleared the infection

and reverted to seronegative, or the isolate used in the assay is genetically diverse to the

field isolate and unable to bind.

34

Field Test Strips

Similarly to the recent development of immunochromatographic test strips to

detect viral antigen are lateral test strips to detect PRRSV specific antibodies. This assay

(Biosign™PRRSV) uses Escherichia coli-expressed viral N protein for detecting

PRRSV specific antibodies in serum. Strip test sensitivity and specificity were

compared for serum from both clinical and experimentally infected pigs with a

commercially available ELISA kit (HerdChek® PRRS ELISA). The test was able to

detect anti-PRRS antibodies with greater than 93% sensitivity and 98% specificity when

compared to the commercial ELISA [85]. Another described lateral test strip uses

recombinant N and M protein for the detection of anti-PRRS antibodies, reported a

sensitivity and specificity of >97.8% when compared to the commercially available

indirect ELISA (CIVTEST™ SUIS PRRS) kit [86]. Benefits of these tests include: no

requirements for highly trained technicians or sophisticated laboratory equipment, speed,

ability to store the kits at room temperature, and relatively low cost [85, 86]. Like other

antibody assays these tests may not recognize genetically diverse antibodies. These test

kits are not commercially available in the USA currently, but could have utility for

stakeholders.

Test Strip Interpretation

Similarly to the antigen detection field test strip, these tests have also not been

widely used to date. Caution should be used when interpreting results in light of

reported sensitivity and specificity data due to relative lack of diversity of isolate based

testing. Positive results could be due to true presence of antibody or nonspecific

35

reactivity to target antigens on strip. Negative results could be the result of: no pig

exposure, recent exposure but inadequate time for seroconversion, pigs are persistently

infected and have become seronegative, pigs have cleared the infection and reverted to

seronegative, or pigs are negative due to inability to identify genetically diverse isolates.

IPMA

The immunoperoxidase monolayer assay (IPMA) is very similar to the IFA, but

utilizes a peroxidase-labeled secondary antibody and chromogen for color visualization

of positive samples. These assays can be read with a standard light microscope. The

IPMA was the first serological test reported for the diagnosis of PRRS [45]. This assay

is sometimes used to differentiate between genotypes for ELISA positive samples [87].

The IPMA has a high specificity and sensitivity, but is laborious to perform, requires

sophisticated equipment, and can’t be automated for large-scale use [88]. The IPMA is

mainly used in Europe while the similar IFA test is most commonly used for PRRS

diagnostics in North America [89].

IPMA Interpretation

The IPMA by design incorporates more potential epitopes for antibody binding

than most ELISA tests which may improve detection of heterologous isolates. However,

the choice of virus used in the assay greatly affects the results and can lead to false

negatives with very heterologous strains [87]. The IMPA can first detect PRRSV

specific antibodies at 7-14 DPI [89]. IMPA based assays have identified IgA first in

serum at 14 DPI and maximum concentrations at 25 DPI prior to declining to negative

levels at 35 DPI [90].

36

Isolate Characterization

Often producers and veterinarians need more information than qualitative or

quantitative results of presence of virus to facilitate management decisions such as

moving animals onto another farm, tracking isolate spread, and determining if a new

isolate is present in a population of pigs.

RFLP

The first technology which attempted to further characterize isolates came with

the use of ORF 5 restriction fragment length polymorphism (RFLP) [91, 92]. This

technology utilizes three different restriction enzymes (MluI, HincII, and SacII) to cut at

specific sequences of nucleic acids. Results are reported as a numerical code with the

cut pattern of each respective enzyme [92]. Current known possibilities for the codes

include: 4 possibilities for the first code, 96 possibilities for the second code, and 11

possible different cut patterns for the third code [93]. For example, an isolate with a cut

pattern report of 1-8-4 would have no cut sites for MluI (code 1), three specific cut sites

for HincII (code 8), and four cut sites for SacII (code 4). This technology was originally

designed to differentiate vaccine virus from challenge viral strains [92]. However, it is

increasingly being recognized as an insensitive method for characterizing genetic

relatedness among viruses, as RFLP patterns unpredictably and inconsistently change

through conversion and reversion during in vivo replication [10, 94-96]. Theoretically,

a single nucleotide change can alter the RFLP cut pattern without changing the

pathogenicity, antigenicity, replication kinetics, or other clinically relevant viral

characteristics.

37

RFLP Interpretation

Isolate characterization by RFLP has limitations due to the relative amount of

significant data they provide. Many laboratories still report the expected RFLP patterns

for isolates which underwent sequence analysis. This information is provided as a result

of frequent customer requests if such information is not provided with initial results.

Sequence analysis

The use of sequencing and phylogenetic analysis is now widely available and

provides a much more precise and accurate description of isolate genetic makeup by

providing an exact genomic composition for the section examined. Sequences are

attained directly from PCR products of diagnostic samples to avoid potential bias of

selection, mutation, or nucleotide changes by passage in cell culture [10]. Sequencing is

typically only performed on ORF5 and may or may not include ORF6. ORF5 has been

identified as one of the most variable genes while ORF6 is the most conserved gene

[97]. Sequencing of ORF5 allows for monitoring of herd level viral changes over time.

To complete sequence analysis viral RNA must be intact and in sufficient quantity.

Generally, sequencing requires more viral RNA than is necessary for RT-PCR and it is

fairly common for a sample to be RT-PCR positive, but unable to be sequenced.

Attaining genomic sequences from infected tissues and serum generally has good results,

while oral fluids can be troublesome. To optimize the ability to get sequence analysis

from oral fluids, current recommendations are to freeze the samples and transfer to the

laboratory immediately to preserve sample integrity [55].

38

Sequences of ORF5 are highly variable and with the widespread use of PRRSV

sequencing, there is now an extensive library of sequences available for comparison.

Diagnostic laboratories typically provide the sequence analysis information in

comparison to known modified-live vaccine strains for comparison to help differentiate

wild type virus from vaccine isolates. Dendrograms and identity matrices are additional

tools which can help depict phylogenetic relationships based on isolate similarity to

facilitate comparison of noteworthy isolates. Laboratories can typically generate farm

specific dendrograms upon request. Dendrograms are created by aligning the nucleotide

sequence or predicted amino acids sequence of a sample set in an ordered fashion

according to the similarity of sequences. Specialized computer programs evaluate all

possible sequences and groups them accordingly with the end result being a

phylogenetic tree (dendrogram). The relationship of samples is based on all changes

being the result of random, independent mutations during the natural evolution of the

virus. Dendrograms can help determine if the reappearance of PRRS on a farm is due to

the introduction of a new strain or due to the reemergence of a strain previously

identified. Sequence analysis can’t be used to predict virulence of isolates or select the

most efficacious vaccines due to the lack of information on genes responsible for

pathogenesis and clinical immunity.

Sequence Analysis Interpretation

Sequence analysis data is interpreted in light of evaluating relatively small

amounts of genetic information (600-603bp for ORF5) in comparison to the entire

genome (~15,000bp). PRRSV sequence changes within 1% or less are consistent with

39

known amounts of changes over short periods of time (100-730 days), as defined by

experimental studies [44, 98, 99]. A rate of change outside this range increases the

likelihood of the isolates being unrelated. Additionally, it is possible for a sample to

contain more than 1 isolate.

Dendrograms should be considered with caution, as it is important to consider the

possibility of nonrandom mutations. Recombination and genetic selection through

immunological resistance have both been reported and would have a significant effect on

the construction of a dendrogram and the conclusion of a whether a new virus is present

within the herd [100-104].

2.4 Determine Sample Size

Once the objective (detection vs. prevalence) is determined, target population is

defined, and test is selected, the number of animals to sample needs to be determined.

When the objective is to detect at least 1 positive sample from a population, the number

of animals to sample depends on the number of animals in the group (may include a

particular room, barn, or site), estimated prevalence of disease in the population (0% -

50%) (any prevalence greater than 50% will require the same number of samples),

confidence level of detection, in addition to test sensitivity and specificity [2, 105]. A

recommended strategy for ongoing surveillance of breeding herds is to test a

representative sample on a monthly basis to achieve a probability of detection of 95%

[106]. When the objective is to detect infection, sampling does not need to be random,

but can be directed to higher-prevalence groups. Necessary sample sizes can be

calculated with the use of spreadsheets, specialized computer programs, or through the

40

use of available tables (for which the calculations have already been completed) such as

those included [tables 1 and 2].

For example, 95 times out of 100, thirty random samples will contain at least one

positive sample if the true prevalence is 10% or greater. If the prevalence is reduced to

5% sampling 60 animals randomly is required to detect 1 positive sample with a 95%

confidence level. For negative herds, to prove with 100% certainty the herd is truly

negative, all animals would have to be sampled. These tables assume 100% test

sensitivity, which rarely occurs for any test.

When the objective is to determine prevalence within a population similar criteria

need to be defined and include: population size, expected disease prevalence, confidence

level of detection, and accuracy of your prevalence estimation. Estimating group

prevalence is performed by picking a number between 0% - 100%. Recommendations

are to error towards 50% prevalence, as a 50% prevalence carries the greatest standard

error of a proportion which decreases as the prevalence goes in either direction.

Choosing a sample size closer to 50% will require more samples to be tested and result

in the most accurate estimation of the true prevalence. Likewise, the smaller the

accuracy level the more samples are required which results in a more accurate final

prevalence estimation [105]. Sample sizes to estimate prevalence of disease can also be

calculated with the use of spreadsheets, specialized computer programs, or through the

use of tables. For example, with an expected prevalence of 50%, an accuracy of 10%,

confidence level of 95%, and a population of 2,000, 92 samples would be required to

41

estimate the prevalence of disease. However, if the accuracy level is increased to 5%,

the sample size jumps to 322.

Tests with lower sensitivities can be overcome by testing more animals to attain a

higher level of confidence in results, while tests with poor specificity should be avoided

altogether. To compensate for tests with imperfect sensitivity, take the calculated

sample size and divide it by the actual or estimated sensitivity of the planned test. If the

samples are to be used for more than one test, divide by the test with the lowest reported

sensitivity to adjust the necessary sample size [105].

2.5 Interpretation of All Available Test Results

Upon receipt of test results, it is important to evaluate each as a separate piece of

evidence given each test’s inherent limitations discussed previously. If multiple test

results are available, all results should be considered to make a clinical diagnosis. Over

the course of infection, some tests will be positive while others will still be negative

[figure 1]. Along with the individual animal variation, when testing populations, the

infection dynamics of the entire population is likely not exactly the same. Figures 1-3

summarize the potential causes of each possible test outcome and describe the expected

test outcome depending on state of infection at the time of sample collection.

2.6 Classification of the Herd

The final piece to the diagnostic process is the selection of terminology to

classify a population of animals. Standardized terminology has been recommended to

facilitate communication between veterinarians, swine producers, genetic companies,

and other industry stakeholders [107]. The following guidelines are those which have

42

been proposed as minimum requirements for testing to classify herds and do not

necessarily reflect the best approach to attain a diagnosis for a particular herd.

Breeding herd classifications include: positive unstable, positive stable, positive

stable and undergoing elimination, provisional negative, and negative [107]. PRRSV

shedding status is classified as negative, uncertain, or positive. An uncertain status is

used when diagnostic data suggests a negative shedding status, but there is insufficient

statistical power to generate enough confidence for the official negative status.

Exposure status is classified as negative or positive. The default status is positive

unstable when herds have not been tested. To be classified as undergoing elimination,

herds must have initiated an elimination procedure which begins when the last

seropositive breeding replacements are introduced or when the last intentional exposure

occurs in the herd, whichever event occurs later. Herd classification is based on both

shedding and exposure status of the herd [107].

Recommended testing criteria for assessment of PRRSV shedding status of

weaning-age pigs for inclusion into positive stable categories include: testing a minimum

of 30 serum samples per testing event, pooling samples in groups of 5 (if pooling),

testing a minimum of 4 times to account for variation in prevalence, and not more

frequent than every 30 days to confirm status. If a herd has no positive samples over a

90 day period or after completion of 4 consecutive negative herd tests (if sampling every

30 days) and with no clinical signs in the breeding herd, then the herd can be

appropriately classified into a positive stable category [107].

43

Growing pig population categories are more straightforward with only positive

and negative categories. Negative populations must have no positive ELISA tests from

30 submitted samples taken from multiple age groups if present and have no clinical

signs consistent with PRRSV infection. All other populations are classified as positive,

including: those with positive ELISA tests, clinical signs consistent with PRRS, and

herds without sufficient diagnostics [107].

3. Conclusion

The diagnostic approach for Porcine Reproductive and Respiratory Syndrome

virus is a complicated process. The nature of the virus, dynamics of pig flow

management, variety of control measures utilized in the field, and the continually

evolving available technologies for testing make PRRS control and prevention strategies

difficult. However, routine surveillance and disease diagnostics are an essential

component to successful control and elimination programs [108].

Available tests have improved significantly over the years, but no available test is

perfect. The possibility of false positive and negative results should always be

considered. If results are different from those expected, additional testing should be

requested if necessary for the clinical case. Molecular techniques are capable of

detecting viral RNA from a growing list of specimens which also allow for evaluation of

viral epidemiology through sequencing. Antigen detection techniques can be utilized to

confirm virus in cell cultures or clinical samples and to correlate the presence of virus

with pathological lesions. Serological approaches are used to detect previous exposure

44

to virus and also can be performed on a growing list of more conveniently collected

sample types.

It is vital for veterinarians and stakeholders to have an understanding of the

diagnostic approach to PRRS which includes determination of: diagnostic objective,

population to test, appropriate test, required sample size, test results, and herd status.

Test selection and interpretation of results are vital components towards the ongoing

success of pork production within PRRSV endemic regions. PRRS will likely remain a

difficult problem to solve for producers, especially with limited knowledge of

pathogenesis and imperfect tools to prevent and manage infections. However, having a

thorough understanding of PRRSV diagnostic procedures is undoubtedly an important

part of the equation.

45

Table 1. Sample Size to Detect at Least One Positive Sample from Herd [105]

Table 2. Sample Size Required to Estimate Prevalence Where the Expected True

Prevalence is 50%. [105]

46

Table 3. Criteria Required for PRRS Status Categorization of Breeding Herds

[107].

Category Shedding

Status

Exposure

Status

Clinical

Signs

Evidence Required

I Positive

Unstable

Positive Positive Current

clinical

outbreak

Chronically recurring viral

shedding

II-A

Positive

Stable

Uncertain Positive No clinical

signs

> 90 days of PCR (-) weaning

age and growing pigs if present

(> 4 consecutive PCR (-) tests,

30 days apart or sooner

II-B

Positive

Stable

(Undergoing

Elimination)

Uncertain Positive No clinical

signs,

elimination

program

started

> 90 days of PCR(-) weaning

age and growing pigs if present

(> 4 consecutive PCR (-) tests,

30 days apart or sooner

III

Provisional

Negative

Negative Positive No clinical

signs, herd

rollover

started

> 60 days after the initial

introduction of ELISA (-)

breeding replacements with

proof of maintained (-) exposure

status

IV Negative Negative Negative

(new premise

startup or

total

depop/repop)

No clinical

signs

> 365 days of No ELISA (+)

adult breeding animals after the

category III status

or

> 30 days of no ELISA (+) after

complete population with

negative replacements

47

Figure 1. Guidelines for PRRS Antigen and Serological Test Selection and

Interpretation in Accordance with Natural Progression of Infection.

1Adapted and expanded upon from [109]

48

Figure 2. Detection of Virus: PRRS Diagnostic Decision Tree

Detection of VirusInfectious virus present (vaccine or wt strain)

Positive Noninfectious virus present

Sample contamination, no virus in pig

PCR

No viral RNA present

Inability to detect low levels of virus present

Negative Sample degradation, unable to detect virus in sample

Primer/probe mismatch, unable to detect virus in sample

No viral RNA in sample, but pig is persistently infection

No viral RNA in sample, but low prevalence of virus in herd

Positive Infectious PRRSv virus present

CPE present, but no infectious PRRS in sample

VI Infectious virus not present

PRRS isolate not capable of replicating in cell line used

Negative Infectious virus present, but bound with neutralizing antibody

Sample degraded, virus unable to replicate

Technician unable to identify CPE

Positive PRRS antigen in tissue

Poor specificity of monoclonal antibodies, no PRRS antigen in tissue

IHC No antigen in tissues

Pig acutely viremic with insufficient time to deposit antigen in tissue

Negative No antigen in tissue section examined, but antigen present in tissue

Operator unable to identify antigen present in tissue

Monoclonal antibodies unable to bind heterologous isolate present in tissue

Positive PRRS antigen identified

FA Poor specificity of monoclonal antibodies, no PRRS antigen in sample

No antigen in sample

Pig acutely viremic with insufficient time to deposit antigen in sample

Negative No antigen in sample section examined, but antigen present in sample

Operator unable to identify antigen present in sample

Monoclonal antibodies unable to bind heterologous isolate present in sample

Viral antigens present in sample

Positive Sample contamination

Non-specific binding of monoclonal antibodies, no PRRS viral antigens present

Test Stips

No viral antigens present in sample

Negative No viral antigens in sample, but positive pig

Viral antigens present in low quantity

Inability to identify antigens from heterologous isolates

Positive Infectious virus present

Contamination of susceptible pigs with a different strain of PRRS

Swine Bioassay

No infectious virus present

Negative Virus present, but bound by host neutralizing antibodies

Virus present in host, but absent/low quantity in naïve pig inoculum

Positive PRRS particles present

Particles identified with similar size, shape, and morphology

EM

No particles present

Negative Particles present, but morphologically unidentifiable

Particles present, but below threshold of identification

Virus present in host, but isolate not capable of replicating in cell culture used

49

1Adapted and expanded upon from [72]

Figure 3. Detection of Antibody: PRRS Diagnostic Decision Tree

1Adapted and expanded upon from [72]

Test Result Potential Cause

Detection of AntibodyExposure to PRRSv (vaccine or wt virus)

Positive Detection of maternally derived antibodies (persist for 3-5 wks), no PRRSv exposure

Non-specific antibody binding to antigens on plate, no PRRSv exposure

Detection of exogenous sources of PRRSv antibody (oral fluid only), no exposure

ELISA

No exposure to PRRSv

Recent exposure to PRRSv, but no antibodies developed yet (<9 DPI)

Negative Inability to detect low quantity of antibodies

Infection cleared, now seronegative

Persistently infected pig, now seronegative

Inability to detect antibodies against very heterologous isolates

Exposure to PRRSv (vaccine or wt virus)

Positive Detection of maternally derived antibodies, no PRRSv exposure

Non-specific antibody binding to antigens on plate, no PRRSv exposure

IFA

No exposure to PRRSv

Recent exposure to PRRSv, but no antibodies developed yet (<5 DPI (IgM) & <9 DPI (IgG))

Negative Inability to detect low quantity of antibodies

Exposure to a heterologous isolate of PRRS as compared to isolate used in test

Infection cleared, now seronegative

Persistently infected pig, now seronegative

Positive Neutralizing antibodies present

Loss of assay viral infectivitiy

VN No exposure to PRRSv

Inability to neutralize heterologous isolate used in test

Negative Exposure to PRRSv, but insufficient time to develop neutralizing antibodies (<11 DPI))

Inability to identify quantity of neutralizing antibodies

Infection cleared, now seronegative

Persistently infected pig, now seronegative

Positive Exposure to PRRSv (vaccine or wt virus)

Non-specific antibody binding to antigens on strip, no PRRSv exposure

Test Stips

No exposure to PRRSv

Exposure to PRRSv, but insufficient time to develop antibodies

Negative Inability to identify quantity of neutralizing antibodies

Infection cleared, now seronegative

Persistently infected pig, now seronegative

Inability to identify heterologous antibodies against heterologous isolates

Exposure to PRRSv (vaccine or wt virus)

Positive Detection of maternally derived antibodies, no PRRSv exposure

Non-specific antibody binding to antigens on plate, no PRRSv exposure

IPMA

No exposure to PRRSv

Recent exposure to PRRSv, but no antibodies developed yet (<5 DPI (IgM) & <9 DPI (IgG))

Negative Inability to detect low quantity of antibodies

Exposure to a heterologous isolate of PRRS as compared to isolate used in test

Infection cleared, now seronegative

Persistently infected pig, now seronegative

50

References:

[1] Holtkamp D KJ, Zimmerman J, et al. An economic evaluation of PRRS elimination

in the United States swine herd. Project 10-158. Clive, IA: National Pork Board; 2011.

[2] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW. Diseases of Swine. 10

ed: Wiley-Blackwell; 2012.

[3] Van Woensel P, Van der Wouw J, Visser N. Detection of porcine reproductive

respiratory syndrome virus by the polymerase chain reaction. Journal of virological

methods. 1994;47:273-8.

[4] Christopher-Hennings J, Nelson EA, Nelson JK, Hines RJ, Swenson SL, Hill HT, et

al. Detection of porcine reproductive and respiratory syndrome virus in boar semen by

PCR. Journal of clinical microbiology. 1995;33:1730-4.

[5] Benson JE, Yaeger MJ, Christopher-Hennings J, Lager K, Yoon KJ. A comparison

of virus isolation, immunohistochemistry, fetal serology, and reverse-transcription

polymerase chain reaction assay for the identification of porcine reproductive and

respiratory syndrome virus transplacental infection in the fetus. Journal of veterinary

diagnostic investigation : official publication of the American Association of Veterinary

Laboratory Diagnosticians, Inc. 2002;14:8-14.

[6] Meulenberg JJ, Hulst MM, de Meijer EJ, Moonen PL, den Besten A, de Kluyver EP,

et al. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory

syndrome (PEARS), is related to LDV and EAV. Virology. 1993;192:62-72.

[7] Meng XJ, Paul PS, Halbur PG, Lum MA. Phylogenetic analyses of the putative M

(ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus

(PRRSV): implication for the existence of two genotypes of PRRSV in the U.S.A. and

Europe. Archives of virology. 1995;140:745-55.

[8] Chittick WA, Stensland WR, Prickett JR, Strait EL, Harmon K, Yoon KJ, et al.

Comparison of RNA extraction and real-time reverse transcription polymerase chain

reaction methods for the detection of Porcine reproductive and respiratory syndrome

virus in porcine oral fluid specimens. Journal of veterinary diagnostic investigation :

official publication of the American Association of Veterinary Laboratory

Diagnosticians, Inc. 2011;23:248-53.

[9] Gerber PF, O'Neill K, Owolodun O, Wang C, Harmon K, Zhang J, et al. Comparison

of commercial real-time RT-PCR assays for reliable, early and rapid detection of

heterologous strains of porcine reproductive and respiratory syndrome virus (PRRSV) in

experimentally infected or negative boars using different sample types (semen, oral

fluids, serum, blood swabs). Journal of clinical microbiology. 2012.

51

[10] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW Diseases of Swine. In:

Zimmermann JJ BD, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, Torremorell

M,, editor. Porcine Reproductive and Respiratory Syndrome Virus (Porcine Arterivirus).

10 ed: Wiley-Blackwell; 2012. p. 461-86.

[11] Rovira A, Clement T, Christopher-Hennings J, Thompson B, Engle M, Reicks D, et

al. Evaluation of the sensitivity of reverse-transcription polymerase chain reaction to

detect porcine reproductive and respiratory syndrome virus on individual and pooled

samples from boars. Journal of veterinary diagnostic investigation : official publication

of the American Association of Veterinary Laboratory Diagnosticians, Inc. 2007;19:502-

9.

[12] Harmon KM, Abate SA, Chriswell AJ. Comparison of two commercial real-time

reverse transcriptase polymerase chain reaction assays for porcine reproductive and

respiratory syndrome virus. JSHAP. 2012;20:184-8.

[13] Wernike K, Hoffmann B, Dauber M, Lange E, Schirrmeier H, Beer M. Detection

and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by

multiplex real-time rt-PCR. PloS one. 2012;7:e38251.

[14] Zhou L, Zhang J, Zeng J, Yin S, Li Y, Zheng L, et al. The 30-amino-acid deletion in

the Nsp2 of highly pathogenic porcine reproductive and respiratory syndrome virus

emerging in China is not related to its virulence. Journal of virology. 2009;83:5156-67.

[15] Chai Z, Ma W, Fu F, Lang Y, Wang W, Tong G, et al. A SYBR Green-based real-

time RT-PCR assay for simple and rapid detection and differentiation of highly

pathogenic and classical type 2 porcine reproductive and respiratory syndrome virus

circulating in China. Archives of virology. 2012.

[16] Chen NH, Chen XZ, Hu DM, Yu XL, Wang LL, Han W, et al. Rapid differential

detection of classical and highly pathogenic North American Porcine Reproductive and

Respiratory Syndrome virus in China by a duplex real-time RT-PCR. Journal of

virological methods. 2009;161:192-8.

[17] Linhares DC, Rovira A, Torremorell M. Evaluation of Flinders Technology

Associates cards for collection and transport of samples for detection of Porcine

reproductive and respiratory syndrome virus by reverse transcription polymerase chain

reaction. Journal of veterinary diagnostic investigation : official publication of the

American Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:328-32.

[18] Li Q, Zhou QF, Xue CY, Ma JY, Zhu DZ, Cao YC. Rapid detection of porcine

reproductive and respiratory syndrome virus by reverse transcription loop-mediated

isothermal amplification assay. Journal of virological methods. 2009;155:55-60.

52

[19] Rovira A, Abrahante J, Murtaugh M, Munoz-Zanzi C. Reverse transcription loop-

mediated isothermal amplification for the detection of Porcine reproductive and

respiratory syndrome virus. Journal of veterinary diagnostic investigation : official

publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

2009;21:350-4.

[20] Klinge KL, Vaughn EM, Roof MB, Bautista EM, Murtaugh MP. Age-dependent

resistance to Porcine reproductive and respiratory syndrome virus replication in swine.

Virology journal. 2009;6:177.

[21] Bierk MD, Dee SA, Rossow KD, Otake S, Collins JE, Molitor TW. Transmission of

porcine reproductive and respiratory syndrome virus from persistently infected sows to

contact controls. Canadian journal of veterinary research = Revue canadienne de

recherche veterinaire. 2001;65:261-6.

[22] Christopher-Hennings J, Nelson EA, Hines RJ, Nelson JK, Swenson SL,

Zimmerman JJ, et al. Persistence of porcine reproductive and respiratory syndrome virus

in serum and semen of adult boars. Journal of veterinary diagnostic investigation :

official publication of the American Association of Veterinary Laboratory

Diagnosticians, Inc. 1995;7:456-64.

[23] Horter DC, Pogranichniy RM, Chang CC, Evans RB, Yoon KJ, Zimmerman JJ.

Characterization of the carrier state in porcine reproductive and respiratory syndrome

virus infection. Veterinary microbiology. 2002;86:213-28.

[24] Wills RW, Doster AR, Galeota JA, Sur JH, Osorio FA. Duration of infection and

proportion of pigs persistently infected with porcine reproductive and respiratory

syndrome virus. Journal of clinical microbiology. 2003;41:58-62.

[25] Ramirez A, Wang C, Prickett JR, Pogranichniy R, Yoon KJ, Main R, et al. Efficient

surveillance of pig populations using oral fluids. Preventive veterinary medicine.

2012;104:292-300.

[26] Kittawornrat A, Prickett J, Chittick W, Wang C, Engle M, Johnson J, et al. Porcine

reproductive and respiratory syndrome virus (PRRSV) in serum and oral fluid samples

from individual boars: will oral fluid replace serum for PRRSV surveillance? Virus

research. 2010;154:170-6.

[27] Zimmerman JJ, Jacobs AC, Hermann JR, Munoz-Zanzi C, Prickett JR, Roof MB, et

al. Stability of Porcine reproductive and respiratory syndrome virus at ambient

temperatures. Journal of veterinary diagnostic investigation : official publication of the

American Association of Veterinary Laboratory Diagnosticians, Inc. 2010;22:257-60.

53

[28] Hermann J, Hoff S, Munoz-Zanzi C, Yoon KJ, Roof M, Burkhardt A, et al. Effect

of temperature and relative humidity on the stability of infectious porcine reproductive

and respiratory syndrome virus in aerosols. Veterinary research. 2007;38:81-93.

[29] Wernike K, Bonilauri P, Dauber M, Errington J, LeBlanc N, Revilla-Fernandez S,

et al. Porcine reproductive and respiratory syndrome virus: interlaboratory ring trial to

evaluate real-time reverse transcription polymerase chain reaction detection methods.

Journal of veterinary diagnostic investigation : official publication of the American

Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:855-66.

[30] Indik S, Schmoll F, Sipos W, Klein D. Genetic variability of PRRS virus in Austria:

consequences for molecular diagnostics and viral quantification. Veterinary

microbiology. 2005;107:171-8.

[31] Benfield DA, Nelson E, Collins JE, Harris L, Goyal SM, Robison D, et al.

Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate

ATCC VR-2332). Journal of veterinary diagnostic investigation : official publication of

the American Association of Veterinary Laboratory Diagnosticians, Inc. 1992;4:127-33.

[32] Bloemraad M, de Kluijver EP, Petersen A, Burkhardt GE, Wensvoort G. Porcine

reproductive and respiratory syndrome: temperature and pH stability of Lelystad virus

and its survival in tissue specimens from viraemic pigs. Veterinary microbiology.

1994;42:361-71.

[33] Van Alstine WG, Kanitz CL, Stevenson GW. Time and temperature survivability of

PRRS virus in serum and tissues. Journal of veterinary diagnostic investigation : official

publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

1993;5:621-2.

[34] Kim HS, Kwang J, Yoon IJ, Joo HS, Frey ML. Enhanced replication of porcine

reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of

MA-104 cell line. Archives of virology. 1993;133:477-83.

[35] Lee YJ, Park CK, Nam E, Kim SH, Lee OS, Lee du S, et al. Generation of a porcine

alveolar macrophage cell line for the growth of porcine reproductive and respiratory

syndrome virus. Journal of virological methods. 2010;163:410-5.

[36] Sagong M, Park CK, Kim SH, Lee KK, Lee OS, Lee du S, et al. Human telomerase

reverse transcriptase-immortalized porcine monomyeloid cell lines for the production of

porcine reproductive and respiratory syndrome virus. Journal of virological methods.

2012;179:26-32.

54

[37] An TQ, Tian ZJ, He YX, Xiao Y, Jiang YF, Peng JM, et al. Porcine reproductive

and respiratory syndrome virus attachment is mediated by the N-terminal domain of the

sialoadhesin receptor. Veterinary microbiology. 2010;143:371-8.

[38] Calvert JG, Slade DE, Shields SL, Jolie R, Mannan RM, Ankenbauer RG, et al.

CD163 expression confers susceptibility to porcine reproductive and respiratory

syndrome viruses. Journal of virology. 2007;81:7371-9.

[39] Provost C, Jia JJ, Music N, Levesque C, Lebel ME, Del Castillo JR, et al.

Identification of a new cell line permissive to porcine reproductive and respiratory

syndrome virus infection and replication which is phenotypically distinct from MARC-

145 cell line. Virology journal. 2012;9:267.

[40] Feng L, Zhang X, Xia X, Li Y, He S, Sun H. Generation and characterization of a

porcine endometrial endothelial cell line susceptible to porcine reproductive and

respiratory syndrome virus. Virus research. 2012.

[41] Bautista EM, Goyal SM, Yoon IJ, Joo HS, Collins JE. Comparison of porcine

alveolar macrophages and CL 2621 for the detection of porcine reproductive and

respiratory syndrome (PRRS) virus and anti-PRRS antibody. Journal of veterinary

diagnostic investigation : official publication of the American Association of Veterinary

Laboratory Diagnosticians, Inc. 1993;5:163-5.

[42] de Abin MF, Spronk G, Wagner M, Fitzsimmons M, Abrahante JE, Murtaugh MP.

Comparative infection efficiency of Porcine reproductive and respiratory syndrome virus

field isolates on MA104 cells and porcine alveolar macrophages. Canadian journal of

veterinary research = Revue canadienne de recherche veterinaire. 2009;73:200-4.

[43] Ait-Ali T, Wilson AD, Westcott DG, Clapperton M, Waterfall M, Mellencamp MA,

et al. Innate immune responses to replication of porcine reproductive and respiratory

syndrome virus in isolated Swine alveolar macrophages. Viral immunology.

2007;20:105-18.

[44] Christopher-Hennings J, Faaberg KS, Murtaugh MP, Nelson EA, Roof MB,

Vaughn EM, Yoon KJ, Zimmerman JJ. Porcine reproductive and respiratory syndrome

(PRRS) diagnostics: Interpretation and limitations. J Swine Health Prod. 2002;10:213-8.

[45] Wensvoort G, Terpstra C, Pol JM, ter Laak EA, Bloemraad M, de Kluyver EP, et al.

Mystery swine disease in The Netherlands: the isolation of Lelystad virus. The

Veterinary quarterly. 1991;13:121-30.

[46] Nelson EA, Christopher-Hennings J, Drew T, Wensvoort G, Collins JE, Benfield

DA. Differentiation of U.S. and European isolates of porcine reproductive and

55

respiratory syndrome virus by monoclonal antibodies. Journal of clinical microbiology.

1993;31:3184-9.

[47] Halbur PG, Andrews JJ, Huffman EL, Paul PS, Meng XJ, Niyo Y. Development of

a streptavidin-biotin immunoperoxidase procedure for the detection of porcine

reproductive and respiratory syndrome virus antigen in porcine lung. Journal of

veterinary diagnostic investigation : official publication of the American Association of

Veterinary Laboratory Diagnosticians, Inc. 1994;6:254-7.

[48] Van Alstine WG, Popielarczyk M, Albregts SR. Effect of formalin fixation on the

immunohistochemical detection of PRRS virus antigen in experimentally and naturally

infected pigs. Journal of veterinary diagnostic investigation : official publication of the

American Association of Veterinary Laboratory Diagnosticians, Inc. 2002;14:504-7.

[49] Yaeger MJ. The diagnostic sensitivity of immunohistochemistry for the detection of

porcine reproductive and respiratory syndrome virus in the lung of vaccinated and

unvaccinated swine. Journal of veterinary diagnostic investigation : official publication

of the American Association of Veterinary Laboratory Diagnosticians, Inc. 2002;14:15-

9.

[50] Halbur PG, Paul PS, Frey ML, Landgraf J, Eernisse K, Meng XJ, et al. Comparison

of the antigen distribution of two US porcine reproductive and respiratory syndrome

virus isolates with that of the Lelystad virus. Veterinary pathology. 1996;33:159-70.

[51] Rossow KD, Collins JE, Goyal SM, Nelson EA, Christopher-Hennings J, Benfield

DA. Pathogenesis of porcine reproductive and respiratory syndrome virus infection in

gnotobiotic pigs. Veterinary pathology. 1995;32:361-73.

[52] Zhou SH, Cui SJ, Chen CM, Zhang FC, Li J, Zhou S, et al. Development and

validation of an immunogold chromatographic test for on-farm detection of PRRSV.

Journal of virological methods. 2009;160:178-84.

[53] Li XS, Fu F, Lang YK, Li HZ, Wang W, Chen X, et al. Development and

preliminary application of an immunochromatographic strip for rapid detection of

infection with porcine reproductive and respiratory syndrome virus in swine. Journal of

virological methods. 2011;176:46-52.

[54] Botner A, Nielsen J, Bille-Hansen V. Isolation of porcine reproductive and

respiratory syndrome (PRRS) virus in a Danish swine herd and experimental infection of

pregnant gilts with the virus. Veterinary microbiology. 1994;40:351-60.

[55] Prickett JR, Cutler S, Kinyon JM. Stability of porcine reproductive and respiratory

syndrome virus and antibody in swine oral fluid. JSHAP. 2010;18:187-95.

56

[56] Molina RM, Chittick W, Nelson EA, Christopher-Hennings J, Rowland RR,

Zimmerman JJ. Diagnostic performance of assays for the detection of anti-Porcine

reproductive and respiratory syndrome virus antibodies in serum and muscle transudate

("meat juice") based on samples collected under experimental conditions. Journal of

veterinary diagnostic investigation : official publication of the American Association of

Veterinary Laboratory Diagnosticians, Inc. 2008;20:735-43.

[57] Johnson J. Prevalence of PRRSV Serological Tests Performed in 2012 at the ISU

VDL. Personal Communication. 2013.

[58] Nelson EA, Christopher-Hennings J, Benfield DA. Serum immune responses to the

proteins of porcine reproductive and respiratory syndrome (PRRS) virus. Journal of

veterinary diagnostic investigation : official publication of the American Association of

Veterinary Laboratory Diagnosticians, Inc. 1994;6:410-5.

[59] Iowa State University University. Improved PRRS ELISA (HerdChekX3®

Introduced. Veterinary diagnostic and production animal medicine on line report. Ames,

IA: Iowa State University College of Veterinary Medicine; 2010.

[60] Kittawornrat A, Prickett J, Wang C, Olsen C, Irwin C, Panyasing Y, et al. Detection

of Porcine reproductive and respiratory syndrome virus (PRRSV) antibodies in oral fluid

specimens using a commercial PRRSV serum antibody enzyme-linked immunosorbent

assay. Journal of veterinary diagnostic investigation : official publication of the

American Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:262-9.

[61] Kittawornrat A, Wang C, Anderson G, Ballagi A, Broes A, Carman S, et al. Ring

test evaluation of the repeatability and reproducibility of a Porcine reproductive and

respiratory syndrome virus oral fluid antibody enzyme-linked immunosorbent assay.

Journal of veterinary diagnostic investigation : official publication of the American

Association of Veterinary Laboratory Diagnosticians, Inc. 2012;24:1057-63.

[62] Watcharatanyatip K, Boonmoh S, Chaichoun K, Songserm T, Woratanti M,

Dharakul T. Multispecies detection of antibodies to influenza A viruses by a double-

antigen sandwich ELISA. Journal of virological methods. 2010;163:238-43.

[63] Diaz I, Venteo A, Rebollo B, Martin-Valls GE, Simon-Grife M, Sanz A, et al.

Comparison of two commercial enzyme-linked immunosorbent assays for the diagnosis

of Porcine reproductive and respiratory syndrome virus infection. Journal of veterinary

diagnostic investigation : official publication of the American Association of Veterinary

Laboratory Diagnosticians, Inc. 2012;24:344-8.

[64] Venteo A, Rebollo B, Sarraseca J, Rodriguez MJ, Sanz A. A novel double

recognition enzyme-linked immunosorbent assay based on the nucleocapsid protein for

57

early detection of European porcine reproductive and respiratory syndrome virus

infection. Journal of virological methods. 2012;181:109-13.

[65] Johnson CR, Yu W, Murtaugh MP. Cross-reactive antibody responses to nsp1 and

nsp2 of Porcine reproductive and respiratory syndrome virus. The Journal of general

virology. 2007;88:1184-95.

[66] Jankova J, Celer V. Expression and serological reactivity of Nsp7 protein of PRRS

genotype I virus. Research in veterinary science. 2012;93:1537-42.

[67] Brown E, Lawson S, Welbon C, Gnanandarajah J, Li J, Murtaugh MP, et al.

Antibody response to porcine reproductive and respiratory syndrome virus (PRRSV)

nonstructural proteins and implications for diagnostic detection and differentiation of

PRRSV types I and II. Clinical and vaccine immunology : CVI. 2009;16:628-35.

[68] Kim DY, Kaiser TJ, Horlen K, Keith ML, Taylor LP, Jolie R, et al. Insertion and

deletion in a non-essential region of the nonstructural protein 2 (nsp2) of porcine

reproductive and respiratory syndrome (PRRS) virus: effects on virulence and

immunogenicity. Virus genes. 2009;38:118-28.

[69] Xiao YH, Wang TT, Zhao Q, Wang CB, Lv JH, Nie L, et al. Development of

Indirect ELISAs for Differential Serodiagnosis of Classical and Highly Pathogenic

Porcine Reproductive and Respiratory Syndrome Virus. Transboundary and emerging

diseases. 2012.

[70] Molina RM, Cha SH, Chittick W, Lawson S, Murtaugh MP, Nelson EA, et al.

Immune response against porcine reproductive and respiratory syndrome virus during

acute and chronic infection. Veterinary immunology and immunopathology.

2008;126:283-92.

[71] Johnson W, Roof M, Vaughn E, Christopher-Hennings J, Johnson CR, Murtaugh

MP. Pathogenic and humoral immune responses to porcine reproductive and respiratory

syndrome virus (PRRSV) are related to viral load in acute infection. Veterinary

immunology and immunopathology. 2004;102:233-47.

[72] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW. Diseases of Swine.

10 ed: Wiley-Blackwell; 2012.

[73] J. R. Serological monitoring in infected sow herds. The PRRS Compendium.

2003;2:75-86.

[74] Joo HS, Park BK, Dee SA, Pijoan C. Indirect fluorescent IgM antibody response of

pigs infected with porcine reproductive and respiratory syndrome syndrome virus.

Veterinary microbiology. 1997;55:303-7.

58

[75] Park BK, Joo HS, Dee SA, Pijoan C. Evaluation of an indirect fluorescent IgM

antibody test for the detection of pigs with recent infection of porcine reproductive and

respiratory syndrome virus. Journal of veterinary diagnostic investigation : official

publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

1995;7:544-6.

[76] Loemba HD, Mounir S, Mardassi H, Archambault D, Dea S. Kinetics of humoral

immune response to the major structural proteins of the porcine reproductive and

respiratory syndrome virus. Archives of virology. 1996;141:751-61.

[77] Manickam C, Dwivedi V, Patterson R, Papenfuss T, Renukaradhya GJ. Porcine

reproductive and respiratory syndrome virus induces pronounced immune modulatory

responses at mucosal tissues in the parental vaccine strain VR2332 infected pigs.

Veterinary microbiology. 2013;162:68-77.

[78] Johnson JK MR, Zimmerman JJ. Exogenous source of PRRSV antibody in positive

oral-fluid ELISA results. Journal of Swine Health & Production2012. p. 215.

[79] Yoon KJ, Christopher-Hennings J, Nelson EA. Diagnosis. The PRRS Compendium.

2003;2:59-74.

[80] Fangman TJ KS, Coleman M. Tonsilar crypt exudate to evaluate shedding and

transmission of porcine reproductive and respiratory syndrome virus after inoculation

with live field virus or vaccination with modified live virus vaccine J Swine Health Prod.

2007;15:219-23.

[81] Rovira A, Cano JP, Munoz-Zanzi C. Feasibility of pooled-sample testing for the

detection of porcine reproductive and respiratory syndrome virus antibodies on serum

samples by ELISA. Veterinary microbiology. 2008;130:60-8.

[82] Langenhorst RJ, Lawson S, Kittawornrat A, Zimmerman JJ, Sun Z, Li Y, et al.

Development of a fluorescent microsphere immunoassay for detection of antibodies

against porcine reproductive and respiratory syndrome virus using oral fluid samples as

an alternative to serum-based assays. Clinical and vaccine immunology : CVI.

2012;19:180-9.

[83] Van Breedam W, Costers S, Vanhee M, Gagnon CA, Rodriguez-Gomez IM,

Geldhof M, et al. Porcine reproductive and respiratory syndrome virus (PRRSV)-

specific mAbs: supporting diagnostics and providing new insights into the antigenic

properties of the virus. Veterinary immunology and immunopathology. 2011;141:246-

57.

[84] Yoon IJ, Joo HS, Goyal SM, Molitor TW. A modified serum neutralization test for

the detection of antibody to porcine reproductive and respiratory syndrome virus in

59

swine sera. Journal of veterinary diagnostic investigation : official publication of the

American Association of Veterinary Laboratory Diagnosticians, Inc. 1994;6:289-92.

[85] Lyoo YS, Kleiboeker SB, Jang KY, Shin NK, Kang JM, Kim CH, et al. A simple

and rapid chromatographic strip test for detection of antibody to porcine reproductive

and respiratory syndrome virus. Journal of veterinary diagnostic investigation : official

publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

2005;17:469-73.

[86] Cui S, Zhou S, Chen C, Qi T, Zhang C, Oh J. A simple and rapid

immunochromatographic strip test for detecting antibody to porcine reproductive and

respiratory syndrome virus. Journal of virological methods. 2008;152:38-42.

[87] Frossard JP, Fearnley C, Naidu B, Errington J, Westcott DG, Drew TW. Porcine

reproductive and respiratory syndrome virus: antigenic and molecular diversity of

British isolates and implications for diagnosis. Veterinary microbiology. 2012;158:308-

15.

[88] Nodelijk G. Porcine reproductive and respiratory syndrome (PRRS) with special

reference to clinical aspects and diagnosis. A review. The Veterinary quarterly.

2002;24:95-100.

[89] Botner A. Diagnosis of PRRS. Veterinary microbiology. 1997;55:295-301.

[90] Labarque GG, Nauwynck HJ, Van Reeth K, Pensaert MB. Effect of cellular

changes and onset of humoral immunity on the replication of porcine reproductive and

respiratory syndrome virus in the lungs of pigs. The Journal of general virology.

2000;81:1327-34.

[91] Umthun AR, Mengeling WL. Restriction fragment length polymorphism analysis of

strains of porcine reproductive and respiratory syndrome virus by use of a nested-set

reverse transcriptase-polymerase chain reaction. American journal of veterinary

research. 1999;60:802-6.

[92] Wesley RD, Mengeling WL, Lager KM, Clouser DF, Landgraf JG, Frey ML.

Differentiation of a porcine reproductive and respiratory syndrome virus vaccine strain

from North American field strains by restriction fragment length polymorphism analysis

of ORF 5. Journal of veterinary diagnostic investigation : official publication of the

American Association of Veterinary Laboratory Diagnosticians, Inc. 1998;10:140-4.

[93] Rossow KD. PRRS ORF5 Cut Patterns. Personal communicaiton. 2013.

[94] Cha SH, Chang CC, Yoon KJ. Instability of the restriction fragment length

polymorphism pattern of open reading frame 5 of porcine reproductive and respiratory

60

syndrome virus during sequential pig-to-pig passages. Journal of clinical microbiology.

2004;42:4462-7.

[95] Yoon KJ, Chang CC, Zimmerman J, Harmon K. Genetic and antigenic stability of

PRRS virus in pigs. Field and experimental prospectives. Advances in experimental

medicine and biology. 2001;494:25-30.

[96] Cai HY, Alexander H, Carman S, Lloyd D, Josephson G, Maxie MG. Restriction

fragment length polymorphism of porcine reproductive and respiratory syndrome viruses

recovered from Ontario farms, 1998-2000. Journal of veterinary diagnostic investigation

:official publication of the American Association of Veterinary Laboratory

Diagnosticians, Inc. 2002;14:343-7.

[97] Kapur V, Elam MR, Pawlovich TM, Murtaugh MP. Genetic variation in porcine

reproductive and respiratory syndrome virus isolates in the midwestern United States.

The Journal of general virology. 1996;77 ( Pt 6):1271-6.

[98] Rowland RR, Steffen M, Ackerman T, Benfield DA. The evolution of porcine

reproductive and respiratory syndrome virus: quasispecies and emergence of a virus

subpopulation during infection of pigs with VR-2332. Virology. 1999;259:262-6.

[99] Yuan S, Mickelson D, Murtaugh MP, Faaberg KS. Complete genome comparison

of porcine reproductive and respiratory syndrome virus parental and attenuated strains.

Virus research. 2001;79:189-200.

[100] Liu D, Zhou R, Zhang J, Zhou L, Jiang Q, Guo X, et al. Recombination analyses

between two strains of porcine reproductive and respiratory syndrome virus in vivo.

Virus research. 2011;155:473-86.

[101] Murtaugh MP, Yuan S, Faaberg KS. Appearance of novel PRRSV isolates by

recombination in the natural environment. Advances in experimental medicine and

biology. 2001;494:31-6.

[102] Yuan S, Nelsen CJ, Murtaugh MP, Schmitt BJ, Faaberg KS. Recombination

between North American strains of porcine reproductive and respiratory syndrome virus.

Virus research. 1999;61:87-98.

[103] Xu Z, Chang X, Xiao S, Chen H, Zhou R. Evidence for the adaptive evolution of

ORF5 gene of Porcine reproductive and respiratory syndrome virus isolated in China.

Acta virologica. 2010;54:281-5.

[104] Murtaugh MP, Stadejek T, Abrahante JE, Lam TT, Leung FC. The ever-expanding

diversity of porcine reproductive and respiratory syndrome virus. Virus research.

2010;154:18-30.

61

[105] Chase C PD. Sampling the Herd: When is Enough? AASV Annual Meeting2000.

p. 465-77.

[106] Dufresne L, Polson DD, Holck JT, Roberts J. . PRRS Compendium. Des Moines,

IA: National Pork Board; 2003.

[107] Holtkamp DJ, Polson DD, Torremorell M. Terminology for classifying swine

herds by porcine reproductive and respiratory syndrome virus status. JSHAP.

2011;19:44-56.

[108] Velasova M, Alarcon P, Williamson S, Wieland B. Risk factors for porcine

reproductive and respiratory syndrome virus infection and resulting challenges for

effective disease surveillance. BMC veterinary research. 2012;8:184.

[109] Dufresne L, Polson DD, Holck JT, Roberts J. Serological Monitoring in Negative

and Low Prevalence Populations. Des Moines, IA: National Pork Board; 2003.

62

CHAPTER 3. VACCINE EFFICACY OF PORCINE REPRODUCTIVE AND

RESPIRATORY SYNDROME VIRUS CHIMERAS

A paper published in Vaccine 28 (2010) 2679-2686

Joshua S. Ellingson, Yue Wang, Sarah Layton, Janice Ciacci-Zanella, Michael B. Roof

and Kay S. Faaberg

Abstract

The vaccine efficacy of six PRRSV Type 2 infectious clones, including five

chimeras and a strain-specific deletion mutant, were examined using a respiratory

challenge model in growing swine. The chimeras were constructed from different

combinations of a licensed modified live vaccine (Ingelvac® PRRS MLV) and a virulent

field isolate (wt MN184) which differ by 14.3% on a nucleotide basis, while the deletion

mutant tested had a broad deletion in the nsp2 region of strain MN184. The appearance

of antibodies and virus characterization revealed regions of the genome that could

influence PRRSV replication in vivo. Swine growth, clinical signs and lung lesions were

also monitored. Average daily weight gain was negatively and directly impacted by

some vaccines, and after challenge, vaccination with different constructs led to variable

weight gain. We determined that 3 of the tested chimeras, including two previously

published chimeras [1] and one in which strain MN184 ORF5-6 was placed on the

background of Ingelvac® PRRS MLV were able to prevent lung consolidation to a

similar extent as traditionally prepared cell-passaged attenuated vaccines. The study

suggested that only specific chimeras can attenuate clinical signs in swine and that

attenuation cannot be directly linked to primary virus replication. Additionally, the strain

MN184 deletion mutant was not found to have been sufficiently attenuated nor

63

efficacious against heterologous challenge with strain JA-142.

1. Introduction

Porcine reproductive and respiratory syndrome virus (PRRSV) emerged to cause

clinical problems in animals in the early 1990s on separate continents [2, 3]. Since then,

the virus has spread to most swine producing regions of the world. PRRSV has been

found to vary as much as 40% in nucleotide sequence and has been separated into two

genotypes, European (Type 1) and North American (Type 2), based upon their original

isolation location and date. As a result of this overwhelming diversity, the swine immune

response is often not cross protective. PRRSV also induces a poor immune response in

most animals. This incomplete protection appears to be due to several factors including

the nature of the virus, the genetics of swine host and the complication of co-infection

with other pathogens [4, 5]. One traditional method of vaccine preparation, culturing the

virus over several in vitro cell passages in order to attenuate clinical symptoms, has

resulted in several available products for use in the field [6, 7]. However, this can lead to

incomplete protection against heterologous PRRSV strains and an uncertainty in

selection of the appropriate vaccine for routine use [5]. A newer approach has been to

evaluate infectious cDNA clones of PRRSV, which can represent chimeras or site-

specific changes that may potentially increase the immune response, and may also have

specifically engineered deletions and/or insertions to provide markers for vaccine

identification [1, 8-16].

Limited reports using this new approach have suggested that specific PRRSV

chimeras can provide direct attenuation of clinical signs in either a respiratory model or

64

a reproductive failure model [1, 10]. Our previous studies have demonstrated that two

reciprocal chimeras (rMLVORF1/MN184 and rMN184ORF1/MLV) of Type 2 PRRSV

strains, Ingelvac®

PRRS MLV and wild-type (wt) isolate MN184, could attenuate

clinical signs of young swine after heterologous challenge with PRRSV strain SDSU73

in a respiratory challenge model [1]. Therefore, it was hypothesized that additional

chimeras created from the same parent strains, but with different regions of the genome

exchanged, would be more efficacious in the face of virulent challenge than

commercially available products and perhaps provide an alternate method of PRRSV

attenuation.

To extend these original studies, we examined the two original [1] as well as

three additional chimeras, plus a deletion mutant recombinant of wt strain MN184, under

different challenge conditions. The new genomic areas of study were chosen to consider

the contributions of key regions of a virulent strain in inducing protection against

subsequent heterotypic virus exposure. PRRSV ORF5-6 code for the major viral

attachment domain, ORF7 encodes the nucleocapsid protein that surrounds the genome

and interacts with the structural proteins in the virion, and the 3'UTR is critical to

successful transcription of subgenomic RNAs and replication [17, 18]. The additional

chimeras were synthesized using an Ingelvac® PRRS MLV backbone. In addition, the

replicase region known as nonstructural protein 2 (nsp2) has been shown to be

immunogenic, contains hypervariable segments, encodes a protease responsible for

replicase cleavage and harbors B-cell epitopes [12, 19-25]. Thus, in order to examine a

possible role for nsp2 in protection, recombinant strain MN184 was modified by

65

removing 618 bases of the nsp2 coding region. The six engineered viruses were used as

vaccines in parallel with two conventionally attenuated PRRSV strains, Ingelvac® PRRS

MLV and newly prepared MN184 (MN184-P102). The vaccinated animals were then

challenged with wt Type 2 strain JA-142. The appearance of antibodies and virus

characterization were followed over the course of the study. The results of these assays

revealed regions of the genome that influence PRRSV replication in vivo. Swine growth,

clinical signs and lung lesions were also monitored. Average daily weight gain was

negatively and directly impacted by some vaccines, and after challenge, vaccination with

different constructs led to variable weight gain. We also found that only the original

chimeras and the one in which strain MN184 ORF5-6 was placed on the background of

Ingelvac® PRRS MLV were able to prevent lung consolidation after strain JA142

challenge to a similar extent as the cell-passaged attenuated vaccines. The outcomes of

this study suggested that only specific chimeras can attenuate clinical signs in swine and

that attenuation cannot be directly linked to primary virus replication. Additionally, a

large deletion in the nsp2 region of strain MN184 was not sufficient to reduce the

pathogenicity of that strain, or serve as an adequate vaccine against heterologous

challenge with strain JA-142.

2. Materials and methods

2.1. Cells and Viruses

MA-104 cells (ATCC CRL2621) or MARC-145 cells, both African Green

monkey kidney cell lines which support the growth of PRRSV, were cultured in

minimum essential medium (EMEM, SAFC Biosciences M56416) with 10% fetal

66

bovine serum (Invitrogen) at 37°C, 5% CO2. PRRSV vaccine Ingelvac® PRRS MLV and

wt isolate MN184 were previously described [1, 26]. Two recombinant viruses, rMLV

and rMN184, and two chimeric viruses, rMLVORF1/MN184 and rMN184ORF1/MLV,

were rescued from cDNA clones (GenBank EF484031-EF484034) described previously

[1]. Other recombinant viruses were generated as described below. MN184-P102 was

prepared by successive passages of MN184C (GenBank EF488739) on MARC-145 cells

at Boehringer Ingelheim Vetmedica, Incorporated. PRRSV strain JA-142 (AY424271)

was used as a heterologous challenge virus for the swine studies and has also been

characterized previously [27, 28].

2.2. Construction of PRRSV cDNA Clones

Different sections of pMLV were replaced with comparable sections of pMN184

using specific restriction enzyme sites (Fig. 1) or the primers listed in Table 1. The

correct nucleotides of the exchanged regions of every clone were confirmed by DNA

sequencing. The nucleotide and amino acid changes as a result of the cloning are listed

in Table 2.

pMLV/MN184ORF5-6 (GenBank Accession FJ629369) possessed nucleotides

(nt) 1-13650 and 14823-15452 of pMLV; nt 13651-14822 were exchanged for pMN184

13257-14429 by PciI and SmaI restriction digest of subclone IV of each full-length

plasmid (Fig. 1). pMLV/MN184ORF7-3’UTR (GenBank Accession FJ629370)

consisted of nt 1-14822 of pMLV; nt 14823-15452 were replaced by pMN184 14430-

15060 by SmaI digestion of subclone IV of each full-length plasmid. In both constructs,

the new subclone IV replaced its counterpart in pMLV. The specific regions targeted

67

span nucleotides 13,789-14,391 (ORF5), 14,376-14,900 (ORF6) and 14,890-15,452

(ORF7 and 3'UTR) of the parental virus, Ingelvac® PRRS MLV.

pMLV/MN184-3’UTR (GenBank Accession FJ629371) was obtained in the

following manner. One PCR product was amplified using pMLV and primer pair MLV-

ORF6-F/MLV-ORF7-R and another product representing the 3'UTR of MN184 was

amplified from pMN184 using 184-3′UTR-F/184-3′UTR-R. Overlapping PCR was then

completed with both PCR products and MLV-ORF6-F/184-3′UTR-R. The PCR product

was then digested with SmaI and PacI and cloned into subclone IV of pMLV, which was

then used to replace part IV in pMLV. The final pMLV/MN1843’UTR construct

possessed nucleotides nt 1-15261 of MLV with only the 3’UTR (15262-15452) replaced

with 14869-15058 of pMN184.

As reported, wt strain MN184 has a tripartite deletion totaling 393 bases in the

nsp2 region when compared to other sequenced viruses [20]. It was of interest to assess

additional nucleotide deletions in regards to MN184 strain virulence reduction and the

capacity of the mutated virus to protect against strain JA-142 challenge. One PCR

product was amplified using pMN184 and primer pair 184-3122-F/184-4083-R, which

was then digested with XhoI and AgeI, cloned into subclone II of pMN184 and then into

a full-length viral plasmid. As a result, a 618 nucleotide segment of nonstructural protein

2 (nt 2504-3121) was removed from pMN184 to produce the final pMN184Δ618

construct (14, 440 bp; GenBank Accession FJ629372).

2.3. Rescue of Viruses

The cDNA clones were linearized with PacI and then transcribed in vitro

68

(mMessage Machine Kit, Applied Biosystems). RNA transcripts (2.5 g) of each clone

were subsequently transfected into confluent MA-104 cells using DMRIE-C

(Invitrogen), as described previously [1]. The transfection supernatants were collected

when cytopathic effect (CPE) was approximately 80% and cell debris was then removed

by centrifugation at 4000 x g. Recombinant viruses were passaged on MA-104 cells a

total of 4 times to yield viral stocks sufficient in volume and titer to allow for

vaccination studies. The rescued viruses were named rMLV/MN184ORF5-6,

rMLV/MN184ORF7-3’UTR, rMLV/MN184-3’UTR and rMN184Δ618. Total RNA was

extracted from an aliquot of passage 4 supernatant of each rescued virus and analyzed by

RT-PCR followed by 3’ end sequencing of approximately 4000 bases.

2.4. Swine Study

The study utilized 100, healthy 3-week old, commercial crossbred piglets from a

PRRSV seronegative herd to examine PRRSV vaccine efficacy in a respiratory

challenge model. Animals were housed in a conventional setting at Veterinary Resources

Inc. in Ames, Iowa and were under the supervision of a veterinarian. Throughout the

duration of the study, all animals received food and water ad libitum. All laboratory

personnel and animal caretakers involved with the study were blinded to the treatments

given to the respective groups.

The study consisted of 10 groups, including 6 infectious clones (groups 1-6), wt

MN184 at passage 102 (MN184-P102; group 7), Ingelvac® PRRS MLV (group 8),

heterologous challenge virus wt JA-142 (group 9), and a strict control group (group 10)

(Table 3). Animals were required to test negative for PRRSV antibody by HerdChek®

69

PRRS ELISA 2XR and then randomly assigned by weight into each treatment group

prior to vaccination (IDEXX Laboratories Inc., Westbrook, ME). Viral titers were

determined by TCID50/ml (Table 3) [29, 30]. All viruses were diluted with minimum

essential medium (MEM; Sigma, St. Louis, MO.) containing 2% fetal bovine serum

(FBS) (Sigma, St. Louis, MO.) in order to deliver a target of 4.79 logs of virus in 2 ml,

intramuscularly, to each animal. The challenge control (group 9) and strict control

(group 10) groups received only dilution medium. For testing purposes, 10 – 15 ml of

blood was collected from each animal on Days 0, 3, 7, 14, 21, 28, 31, and 35. Serum was

separated from the clotted blood and stored for a maximum of 24 hours at 4°C for

testing. Aliquots were then frozen at -70°C.

The challenge model used in this study is consistent with the model used in the

original characterization of the chimeras [1]. This model calls for virulent challenge

three weeks after vaccination (Day 21) and necropsy at five weeks post-vaccination

(Day 35). Challenge timing was chosen since the vaccine component of the chimeras,

Ingelvac® PRRS MLV, has proven to be efficacious three weeks post-vaccination even

though the vaccine virus may still be causing some viremia [31]. Therefore, it was

expected that the chimeras would exhibit similar characteristics. Necropsy at two weeks

post challenge allowed for maximal detection of lung lesions that correlate with in vitro

testing procedures [32]. The animals in groups 1-9 were challenged intranasally with 3.8

logs in 2 ml (1ml per nostril) of virulent JA-142 strain of PRRSV at cell passage 4. At

necropsy all animals were humanely euthanized and assessed for gross lung lesions.

70

2.5. Clinical Evaluation

General observations of each animal in the study were taken from Day 0 through

Day 19 and anything abnormal was noted. From Day 20 through Day 35, clinical

observations were noted and anything considered abnormal was recorded. Individual

observations consisting of behavior, respiration, and cough were also recorded based on

a numerical index from 1 to 4 that reflected the severity of the diseased state for each

category. For instance, a normal animal received a score of 3 (3 x 1 each for behavior,

respiration and cough), an animal exhibiting maximum clinical signs received a 9 (3 x

3), and a deceased animal received a cumulative score of 12 (3 x 4). In addition, animals

were weighed 3 days before vaccination (Day -3), at challenge (Day 21), and at necropsy

(Day 35) for average daily weight gain testing. The lungs of all animals in the study

were evaluated at necropsy for percent consolidation due to PRRSV infection. Lungs

were scored for each individual lobe, as well as an overall level of gross lung pathology

using a standard scoring system [33]. The observation score equaled the sum of all the

individual lobe scores.

2.6. Serology

Serum samples were analyzed for PRRSV antibody using the IDEXX

HerdCheck® PRRS ELISA 2XR. The tests were performed as described by the

manufacturer’s instructions. Samples were considered positive for PRRSV antibodies if

the sample-to-positive (S/P) ratio was at least 0.4.

2.7. Viremia Detection by Virus Isolation and Quantitative RT-PCR

To qualitatively determine viremia, virus isolation was performed on all serum

71

samples from all collection days. Each animal was tested by inoculating 100μl of serum

individually onto 3 day old MA-104 cells in a 48-well tissue culture plate which was

then evaluated 8 days later for signs of cytopathic effect. The percent of positive animals

at each bleed date was then recorded. To attain a relative quantity of viral RNA present,

quantitative RT-PCR (qRT-PCR) was also performed on all serum samples. The

QIAamp® Virus BioRobot

® MDx Kit was used in conjunction with the BioRobot

Universal System from Qiagen (Qiagen Inc., Valencia, CA) to extract the viral RNA

from the serum per manufacturers recommendations. To detect US PRRSV nucleic acid,

the North American Tetracore qRT-PCR kit (Tetracore, Inc., Rockville, MD) was used

as described previously [29].

2.8. Nucleotide Sequence Analysis

Viral RNA was extracted from serum samples from each animal at day 21. To

obtain a consensus nucleotide sequence of the structural genes at this time point, RNA

extracts were pooled for each group and submitted for nucleotide sequence

determination (oligonucleotide primers available on request). Sequences were analyzed

using Geneious Pro Version 4.7.5 (Biomatters Limited). Approximately 4500 bases were

sequenced at the 3'end of the viral genome. In the case of the nsp2 deletion mutant,

rMN184Δ618, a 500 base section spanning the deletion site was examined.

2.9. Statistics/biometrics

All data were imported into SAS version 9.1 for management and preliminary

analysis. Data listings and summary statistics by treatment group including mean,

median, standard deviation, standard error, range, 95 percent confidence limits,

72

coefficient of variation, and frequency distributions were generated for all variables

where appropriate. All parameters were compared among groups 1 – 9 and pair wise

between groups 1 – 9. Group 10 (strict controls) was not included in the analyses other

than summary statistics. In compliance with the methods recommended by the United

States Department of Agriculture Animal Plant Health Inspection Service, only two-

sided results were reported and all comparisons were at α=0.05. All data were

transferred to Prism 4 (Graphpad Software, Inc.) for additional statistical analyses and

optimal formatting prior to publication. Virus isolation data used Fisher’s exact test to

determine the number of animals positive/negative per group ratio. Weights and average

daily weight gain (ADWG) were tested by two-way analysis of variance (ANOVA).

Lung scores for each group were analyzed by one-way ANOVA and Bonferroni’s

Multiple Comparison Test (95% confidence interval).

3. Results

3.1. Recovery of Viruses

Two chimeric viruses, rMLVORF1/MN184 and pMN184ORF1/MLV, were

previously generated [1]. Four other recombinant PRRSV full-length cDNA clones,

pMLV/MN184ORF5-6, pMLV/rMN184ORF7-3’UTR, pMLV/MN184-3’UTR and

pMN184Δ618 were constructed in a similar manner (Fig. 1). To verify whether these

four additional cDNA clones were infectious, linearized pMLV/MN184ORF5-6,

pMLV/rMN184ORF7-3’UTR, pMLV/MN184-3’UTR and rMN184Δ618 were

transcribed in vitro and the synthetic RNAs were subsequently transfected into MA-104

cells. Day 3 post-transfection, all four transfections resulted in the appearance of CPE,

73

indicating that the genetic exchange between the two different strains and the 618 base

deletion in the nsp2 region of MN184 did not have a severe effect on the in vitro growth

properties of the recombinants. Sequence analyses of around 4000 bases at the 3'-end of

the genome confirmed that these four viruses were recovered from the respective

recombinant PRRSV with no or a few scattered changes (data not shown). All chimeras

were passaged 4 times on MA-104 cells in parallel with parental rMLV and rMN184 as

well as Ingelvac® PRRS MLV vaccine and wt MN184. At each passage, onset of CPE in

rMLV/MN184ORF5-6 and rMLV/MN184-3’UTR infected MA-104 cells was similar to

those infected with rMLV, but appeared 1 day later for rMLV/MN184ORF7-3’UTR

infected cells. CPE for rMN184Δ618 infected cells was similar to rMN184 at all four

passages. Passage 4 viruses were titered and used to infect 10 animals/group in the

vaccination study (Table 3).

3.2. HerdChek ELISA

After vaccination, all animals in Groups 1, 2, 3, 5, 7, and 8 tested positive by

IDEXX PRRS ELISA prior to strain JA-142 virulent challenge (Day 21). Group 6

(rMN184Δ618) had 9 positive animals prior to challenge while Group 4

(rMLV/MN184ORF7-3’UTR) had only 4 positive animals and the appearance of the

antibodies in this latter group was delayed (Fig. 2 and data not shown). Antibodies

appeared in Group 1 animals 3 days prior to all other vaccination groups. In addition, the

S/P ratios suggested that all of the animals in groups 1 – 9 seroconverted to either their

respective vaccine or the challenge material by Day 31 of the study. The Strict Control

(group 10) had no positive tests throughout the duration of the study. Figure 2 indicates

74

the day when the individual groups became positive for PRRSV specific antibodies and

the trend for all treatment groups.

3.3. Virus Isolation

Virus isolation analysis confirmed that at least 3 of the 10 animals in each

treatment group were viremic by Day 3 in groups 1, 2, 3, 5, 7, and 8 (Fig. 3). Only

(10%) of the animals in Group 4 were positive on Days 3 and 14, the only positive

results obtained for rMN184ORF7-3’UTR prior to challenge. No viremia was detected

for Group 6 (rMN184Δ618) animals until Days 14 and 21, which then showed positive

results for only 10% and 20% of the animals, respectively. The results suggested that

each engineered recombinant virus was capable of some level of viral replication in the

swine host, although it is evident that rMN184ORF7-3’UTR (Group 4) and

rMN184Δ618 (Group 6) were less successful at replicating inside the animal host as

compared to the other groups, as measured by virus isolation on MARC-145 cells. We

had detected antibodies to Group 6 virus (Fig. 2) with similar kinetics to all other

treatment groups (except Group 4) that might be indicative of replication of this virus in

the absence of overt CPE due to infection of MARC-145 cells. PRRSV vaccine strains

MN184-P102 and Ingelvac® PRRS MLV confirmed viral replication within the host,

although replication of Ingelvac®

PRRS MLV from swine serum samples on cultured

cells was more apparent than replication of MN184-P102 at all-time points. Viremia

continued after virulent heterologous PRRSV challenge in all groups except the strict

control.

75

In order to assess the ability of the immune response to reduce the replication of

the JA-142 challenge virus after vaccination with each of the candidate viruses, we

compared the levels of viremia for all treatment groups to that of the Challenge Control

Group on Day 35, when presumably most virus remaining in the animals would be the

challenge PRRSV strain. Groups 1-3 (chimeric viruses) and Groups 7-8 (traditionally

prepared vaccines) had a statistically significant (p≤0.0001) lower percentage of viremia

as compared to the Challenge Control (Group 9) at this time point (Fig. 3).

3.4. Real Time RT-PCR

PRRSV RNA was detected in all pigs of treatment Groups 1 – 8 prior to

challenge except for Group 4 (rMLV/MN184ORF7-3’UTR), for which only 3 of the 10

animals were positive for viral RNA by the day of challenge (Fig. 4). On Day 10, the

various treatment viruses could be separated into two discrete categories. Those that had

high levels of circulating viral RNA (>107) include Groups 1-3 (chimeric viruses) and

Group 7 (MN184-P102) while those that had less amounts of viral RNA (<106) included

Groups 4-6 and 8. Viral RNA detected in Group 6 animals suggested that this virus

(rMN184Δ618) initially replicated at a lower rate, but eventually achieved RNA levels at

Day 21 approximately equal to the viruses initially showing a higher level of circulating

viral RNA. Group 4 animals revealed only 3 of 10 animals with circulating PRRSV

RNA until after challenge, suggesting the virus does not replicate well in swine with a

nucleocapsid gene and 3’UTR different from the rest of the pMLV genome. The

remaining two viruses, inoculated into animal Groups 5 (rMLV/MN184-3’UTR) and 8

(Ingelvac® PRRS MLV), never reached above 10

7 RNA copies/ml until after challenge.

76

On Day 28, after virus challenge with heterologous strain JA-142, PRRSV RNA

was found in all animals, providing evidence of successful challenge conditions. No

treatment groups were statistically different for viral load as compared to the Challenge

Control, suggesting little or no effect on JA-142 replication in swine by prior

vaccination, when analyzed by qRT-PCR (Fig. 4). These results are considerably

different from those obtained with virus isolation (Fig. 3).

3.5. Nucleotide Sequence Analysis

RT-PCR followed by nucleic acid sequencing of the products was completed on

pooled and extracted serum samples from day 21. Approximately 1000 bases of ORF1b,

the entire structural protein region and most of the 3'UTR were examined to ensure the

animals remained infected with the respective test virus. In all cases, no discrepancy

between the consensus nucleotide sequences with the input viral genome was found

(data not shown). Furthermore, all viruses showed very little nucleotide variation after

21 days in 10 different animals. This indicated that all of the viruses, including the

chimeras, were not undergoing demonstrable nucleotide change in the regions examined

during the course of the experiment.

3.6. Average Daily Weight Gain

To assess the gross clinical effects of PRRSV vaccination and challenge on

swine, all animals were weighed at each time point. From this data, average daily weight

gain (ADWG) was derived for Days -3 to 21 (before challenge) and Days 21 – 35 (after

challenge)(Fig. 5). Prior to virulent challenge, Group 10 (Strict Control) had a

statistically significant (p≤0.01) higher ADWG than only rMN184ORF1/MLV (Group

77

1), signifying that only Group 1 vaccination significantly reduced animal growth during

the period before challenge (identified as A in Fig. 5). After challenge, Groups 1

(rMN184ORF1/MLV), 5 (rMLV/MN184-3’UTR), 6 (rMN184Δ618), and 9 (JA-142

Challenge Control) showed significantly reduced ADWG (p≤0.01) compared to control

animals. This reduced ADWG may be due to insufficient protection of animals by prior

vaccination in Groups 1, 5 and 6. To monitor the ability of the various viruses to protect

against reduced weight gain after JA-142 challenge, ADWG was compared to Group 9

animals (Challenge Control)(identified as B in Fig. 5). In this comparison,

rMLVORF1/MN184 (Group 2), rMLV/MN184ORF5-6 (Group 3), rMN184ORF7-

3’UTR (Group 4), MN184-P102 (Group 7), and Ingelvac® PRRS MLV (Group 8)

showed a statistically significant (p≤0.05) higher ADWG than the JA-142 Challenge

Control group.

3.7. Clinical Observations

Very few animals exhibited clinical signs after primary infection with the test

viruses or with controls, with only one out of ten animals in each of Groups 5-7 showing

mild discomfort (data not shown). This suggests that all treatments, although replicating

variably in the host, did not mimic overt PRRS disease typically seen in the field. Only

one animal in Group 6 experienced sustained mild lethargy and/or an intermittent cough

after challenge (data not shown). In all, the mild clinical signs were to be expected and

were a typical response to PRRSV infection in high health herds. The symptoms were

not severe enough to have an effect on the outcome of the study, as attending

veterinarians determined that no medication was necessary for resolution of clinical

78

signs for all animals enrolled in the study.

3.8. Lung Pathology

Upon completion of the study (Day 35), all animals were necropsied and

assessed for lung pathology (Fig. 6). When compared to the Challenge Control (group

9), five treatment groups exhibited a statistically significant reduction in gross lung

lesions. Those groups were: rMN184ORF1/MLV (Group 1; P < 0.001),

rMLVORF1/MN184 (Group 2; P < 0.01), rMLV/MN184ORF5-6 (Group 3; P < 0.001),

the recently developed vaccine MN184-P102 (Group 7; P < 0.001) and, to a lesser

degree, Ingelvac® PRRS MLV (Group 8; P < 0.05). Three groups, rMN184ORF7-

3’UTR (Group 4), rMLV/MN184-3’UTR (Group 5), and rMN184Δ618 (Group 6), did

not appear to have sufficient protection against the development of pulmonary lesions in

the strain JA-142 respiratory challenge model as the average lung scores of these three

groups were not significantly different (> 0.05) than the average score of the Challenge

Control Group, which had over 50% of the lung displaying lesions. The Strict Control

(group 10) had no lung lesions, thus indicating a valid challenge and successful bio-

containment.

4. Discussion

In this report, a respiratory challenge model was used to examine the vaccine

efficacy of five chimeras and a deletion mutant engineered from PRRSV Type 2 strain

viral clones that differed by 14.3% on a nucleotide basis. Two chimeras,

rMN184ORF1/MLV (Group 1) and rMLVORF1/MN184 (Group 2) had been previously

shown to successfully protect swine against challenge with heterologous PRRSV strain

79

SDSU73 [1]. The percent nucleotide identities between the Group 1 and 2 chimeras and

SDSU73, over the available SDSU73 ORF2-7 sequence (EF442775), were 92.9% and

89.7%, respectively. For this study, the nucleotide identities based on complete genome

comparisons to strain JA-142 were 84.2% for Group 1, 90.2% for Group 2, 90.7% for

Group 3, 90.9% for Group 4, 90.9% for Group 5, 80.4% for Group 6, 83.1% for Group

7, and 91.0% for Group 8. One conclusion to draw from these comparisons is that

percent similarity is not an accurate measure for determining which vaccine formula will

provide the best protection from challenge, as has been shown previously [31]. Rather,

PRRSV protection after vaccination seems to be directed towards specific gene regions

that influence genome replication kinetics and/or viral interaction with the swine host.

Since both ORF1 reciprocal chimeras protected against strain SDSU73 and now strain

JA-142, and both replicated well in swine, we firmly established that genome

components from both viral nonstructural and structural regions can influence the ability

to protect against heterologous challenge [1]. The present work also suggests that simple

exchange of just the ORF5-6 region of strain MN184 can protect against challenge with

strain JA-142, possibly increased over the traditionally prepared Ingelvac®

PRRS MLV

vaccine. This specific data reveals similar findings as those completed using a

reproductive challenge model and infectious clones of two other PRRSV strains,

attenuated vaccine Prime Pac PRRS

and virulent NVSL #97-7895 [10]. The rMN184

nsp2 deletion mutant (Group 6) also provided interesting results. As in previous study

findings, where full-length rMN184 did not protect against challenge with strain

SDSU73 [1], rMN184618 did not protect against challenge with strain JA-142. The

80

challenge viruses were different between those two studies, so additional parallel

experiments must be completed to substantiate this preliminary finding. However, the

data suggested that deletion of much of the nsp2 hypervariable region did not improve

protection from heterologous PRRSV challenge. All of the data confirmed that PRRSV

attenuation is complex, and may involve interactions between individual viral

component and/or host factors.

Novel findings concerning viral fitness in vivo were also presented. Virus

isolation, which requires another round of MARC-145 cell infection and growth,

revealed that rMLV/MN184ORF7-3’UTR and rMN184618 both replicated at a slower

rate than most other viruses before challenge (Fig. 3). rMLV/MN184-3’UTR replicated

quite well in vitro. However, when samples were directly assessed for the level of serum

vRNA by qRT-PCR, rMLV/MN184-3’UTR along with rMLV/MN184ORF7-3’UTR

may have replicated very poorly in swine, suggesting a PRRSV strain does not easily

tolerate a nucleocapsid gene or protein and/or a 3’UTR different from the rest of the

genome. rMN184618 showed evidence of adequate replication in vivo when monitored

by qRT-PCR, different from what was detected by the virus isolation technique. The

implications of this finding are that viral fitness must be directly examined in the host,

that replication of chimeric viruses in the host animal are not predictable and, therefore,

one must assess several parameters when evaluating viruses for biological use. We have

also shown that some chimeric viruses can be readily utilized as vaccines, although

traditionally prepared vaccines can perform as well or better against specific virulent

strains.

81

Acknowledgements

The authors acknowledge critical manuscript review by Marcus E. Kehrli, Jr.,

Kelly M. Lager and Laura C. Miller, and thank Matthew Kappes for completing the

nucleotide sequence analysis. We are appreciative of Boehringer-Ingelheim Vetmedica,

Incorporated's technical and animal-handling support teams for the generation of core

animal data.

82

Table 1. Primers Used in Preparation of Recombinant PRRSV Infectious Clones.

Forward Primers Indicated by a Slash (/) Following the Name and Reverse Primers

by a Slash Before the Name. Primers Were Positioned Based on Genomic

Sequences pMLV (MLV; EF484033) or pMN184 (MN184; EF484031) (Most

Primers Anneal to Both Sequences).

Primer Nucleotide Position Sequence

Synthesis of PRRSV recombinants

MLV-

ORF6-F/

MLV 14192-14217 5′-GCTACGCGTGTACCAGATATACCAAC

/MLV-

ORF7-R

MLV 15249-15277 5′-

CAAGAATGCCAGCTCATCATGCTGAGGGT

184-3′UTR-

F/

MN184 14856-14884 5′-

ACCCTCAGCATGATGAGCTGGCATTCTTG

/184-3′UTR-

R

MN184 15011-15099 5′-GTCTTTAATTAACTAG(T)30AATTTCGGC

184-3122-F/ MN184 2494-

2503/3122-3136

5′-AAGCTCGAGCTGTGGGTTTGTGATG

/184-4083-R MN184 4065-4091 5′-AAAACCGGTCGCACAGGTCGACAAGTG

83

Table 2. Nucleotide and Amino Acid Changes to Recombinant Viral Parent Due to

Clone Construction.

Construct Region NT Changes AA Changes

pMLV/MN184ORF5-6 GP4 11 0

GP5 81 31

M 37 6

pMLV/rMN184ORF7-

3’UTR

M 5 2

N 26 6

3’UTR 9 -

pMLV/MN1843’UTR 3’UTR 9 -

pMN184618 nsp2 618 206

84

Table 3: Treatment List

Group #

Treatment

Treatment Titer

(log 10 TCID50 / ml)

Challenge

1 rMN184ORF1/MLV 5.02 JA-142

2 rMLVORF1/MN184 5.70 JA-142

3 rMLV/MN184ORF5-6 5.63 JA-142

4 rMLV/MN184ORF7-3’UTR 5.50 JA-142

5 rMN184Δ618 5.35 JA-142

6 rMLV/MN184-3’UTR 4.96 JA-142

7 MN184-P102 4.49 JA-142

8 Ingelvac®

PRRS MLV 4.09 JA-142

9 N/A N/A JA-142

10 N/A N/A N/A

85

Figure 1. Genome schematic of PRRSV, the Two Infectious Clones Initially

Derived (pMLV and pMN184 [1]), Chimeras, and Deletion Mutant Prepared for

the Present Study.

86

86

Figure 2. Mean PRRS ELISA 2XR S/P ratios.

87

Figure 3. Viral Load, Determined by Virus Isolation on MARC-145 cells, in Swine

Serum at All Time Points After Intramuscular Inoculation with 4.79 logs of Virus.

1

The challenge control and strict control groups received only dilution medium. On Day

21, all animals except the strict control group were intranasally challenged with 3.8 logs

of strain JA-142. Results for each animal of each group were collated and the percent

positive per group was then determined.

88

Figure 4. Viral Load as Determined by qRT-PCR and Plotted as Viral RNA Copies/ml Serum.

88

89

Figure 5. Growth Effects of Chimeric and Parental Viruses on Swine.

1

All experimental pigs were weighed at Days -3, 21 and end of study. The average daily gain

weight (ADG) from 10 pigs in each group was calculated at period of -3-21 and 21-35 dpi. The

mean was plotted and the standard error of the mean (SEM) represented as error bars.

Statistically significant (≤0.01) lower average daily weight gain than the Strict Control group for

the relevant time period was specified by the letter A. Statistically significant (≤0.01) higher

average daily weight gain than Challenge Control group for Days 21-35 is represented by the

letter B.

90

Figure 6. Average Lung Scores Recorded at 35 Days Post Vaccination and 14 Days Post

Challenge.

1

The results were plotted as mean values of gross lung lesions from 10 pigs in each group, and

SEM values from different pigs designated by error bars. An asterisk indicates the average lung

score of the group is lower than the challenge control group (* p < 0.05).

91

References

[1] Wang Y, Liang Y, Han J, Burkhart KM, Vaughn EM, Roof MB, et al. Attenuation of porcine

reproductive and respiratory syndrome virus strain MN184 using chimeric construction with

vaccine sequence. Virology 2008;371(2):418-29.

[2] Nelsen CJ, Murtaugh MP, Faaberg KS. Porcine reproductive and respiratory syndrome virus

comparison: divergent evolution on two continents. Journal of Virology 1999;73(1):270-80.

[3] Meulenberg JJ, Hulst MM, de Meijer EJ, Moonen PL, den Besten A, de Kluyver EP, et al.

Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome

(PEARS), is related to LDV and EAV. Virology 1993;192(1):62-72.

[4] Mateu E, Diaz I. The challenge of PRRS immunology. Veterinary Journal 2008;177(3):345-

51.

[5] Kimman TG, Cornelissen LA, Moormann RJ, Rebel JM, Stockhofe-Zurwieden N.

Challenges for porcine reproductive and respiratory syndrome virus (PRRSV) vaccinology.

Vaccine 2009;27(28):3704-18.

[6] Dee SA, Joo H. Strategies to control PRRS: a summary of field and research experiences.

Veterinary Microbiology 1997;55(1-4):347-53.

[7] Tian ZJ, An TQ, Zhou YJ, Peng JM, Hu SP, Wei TC, et al. An attenuated live vaccine based

on highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) protects

piglets against HP-PRRS. Veterinary Microbiology 2009;138(1-2):34-40.

[8] Fang Y, Christopher-Hennings J, Brown E, Liu H, Chen Z, Lawson SR, et al. Development

of genetic markers in the non-structural protein 2 region of a US type 1 porcine reproductive and

respiratory syndrome virus: implications for future recombinant marker vaccine development.

Journal of General Virology 2008;89(Pt 12):3086-96.

[9] de Lima M, Kwon B, Ansari IH, Pattnaik AK, Flores EF, Osorio FA. Development of a

porcine reproductive and respiratory syndrome virus differentiable (DIVA) strain through

deletion of specific immunodominant epitopes. Vaccine 2008;26(29-30):3594-600.

[10] Kwon B, Ansari IH, Pattnaik AK, Osorio FA. Identification of virulence determinants of

porcine reproductive and respiratory syndrome virus through construction of chimeric clones.

Virology 2008;380(2):371-8.

[11] Yoo D, Welch SK, Lee C, Calvert JG. Infectious cDNA clones of porcine reproductive and

respiratory syndrome virus and their potential as vaccine vectors. Veterinary Immunology and

Immunopathology 2004;102(3):143-54.

[12] Han J, Liu G, Wang Y, Faaberg KS. Identification of nonessential regions of the nsp2

replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for

92

replication in cell culture. Journal of Virology 2007;81(18):9878-90.

[13] Kim DY, Kaiser TJ, Horlen K, Keith ML, Taylor LP, Jolie R, et al. Insertion and deletion in

a non-essential region of the nonstructural protein 2 (nsp2) of porcine reproductive and

respiratory syndrome (PRRS) virus: effects on virulence and immunogenicity. Virus Genes

2009;38(1):118-28.

[14] Han J, Rutherford MS, Faaberg KS. The porcine reproductive and respiratory syndrome

virus nsp2 cysteine protease domain possesses both trans- and cis-cleavage activities. Journal of

Virology 2009;83(18):9449-63.

[15] Yu D, Lv J, Sun Z, Zheng H, Lu J, Yuan S. Reverse genetic manipulation of the overlapping

coding regions for structural proteins of the type II porcine reproductive and respiratory

syndrome virus. Virology 2009;383(1):22-31.

[16] Zhou L, Zhang J, Zeng J, Yin S, Li Y, Zheng L, et al. The 30-amino-acid deletion in the

Nsp2 of highly pathogenic porcine reproductive and respiratory syndrome virus emerging in

China is not related to its virulence. Journal of Virology 2009;83(10):5156-67.

[17] van Hemert MJ, Snijder EJ. The Arterivirus Replicase. In: Perlman S, Gallaher T, Snjder E,

editors. The Nidoviruses. Washington, DC: ASM Press, 2008: 83-101.

[18] Faaberg KS. Arterivirus Structural Proteins and Assembly. In: Perlman S, Gallaher T,

Snjder E, editors. The Nidoviruses. Washington, DC: ASM Press, 2008: 211-34.

[19] Fang Y, Kim DY, Ropp S, Steen P, Christopher-Hennings J, Nelson EA, et al.

Heterogeneity in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses

isolated in the United States. Virus Research 2004;100(2):229-35.

[20] Han J, Wang Y, Faaberg KS. Complete genome analysis of RFLP 184 isolates of porcine

reproductive and respiratory syndrome virus. Virus Research 2006;122(1-2):175-82.

[21] Fang Y, Schneider P, Zhang WP, Faaberg KS, Nelson EA, Rowland RR. Diversity and

evolution of a newly emerged North American Type 1 porcine arterivirus: analysis of isolates

collected between 1999 and 2004. Archives of Virology 2007;152(5):1009-17.

[22] Johnson CR, Yu W, Murtaugh MP. Cross-reactive antibody responses to nsp1 and nsp2 of

Porcine reproductive and respiratory syndrome virus. Journal of General Virology 2007;88(Pt

4):1184-95.

[23] Li Y, Wang X, Bo K, Tang B, Yang B, Jiang W, et al. Emergence of a highly pathogenic

porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China.

Veterinary Journal 2007;174(3):577-84.

[24] Tian K, Yu X, Zhao T, Feng Y, Cao Z, Wang C, et al. Emergence of fatal PRRSV variants:

unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique

93

hallmark. PLoS ONE 2007;2(6):e526.

[25] Brown E, Lawson S, Welbon C, Gnanandarajah J, Li J, Murtaugh MP, et al. Antibody

response to porcine reproductive and respiratory syndrome virus (PRRSV) nonstructural proteins

and implications for diagnostic detection and differentiation of PRRSV types I and II. Clin

Vaccine Immunol 2009;16(5):628-35.

[26] Yuan S, Mickelson D, Murtaugh MP, Faaberg KS. Complete genome comparison of

porcine reproductive and respiratory syndrome virus parental and attenuated strains. Virus

Research 2001;79(1-2):189-200.

[27] Greiner LL, Stahly TS, Stabel TJ. Quantitative relationship of systemic virus concentration

on growth and immune response in pigs. Journal of Animal Science 2000;78(10):2690-5.

[28] Ropp SL, Wees CE, Fang Y, Nelson EA, Rossow KD, Bien M, et al. Characterization of

emerging European-like porcine reproductive and respiratory syndrome virus isolates in the

United States. Journal of Virology 2004;78(7):3684-703.

[29] Johnson W, Roof M, Vaughn E, Christopher-Hennings J, Johnson CR, Murtaugh MP.

Pathogenic and humoral immune responses to porcine reproductive and respiratory syndrome

virus (PRRSV) are related to viral load in acute infection. Veterinary Immunology and

Immunopathology 2004;102(3):233-47.

[30] Reed LJ, Muench H. A simple method of estimating fifty percent end-points. Amer. J. Hyg.

1938;27:493–7.

[31] Mengeling WL, Lager KM, Vorwald AC, Koehler KJ. Strain specificity of the immune

response of pigs following vaccination with various strains of porcine reproductive and

respiratory syndrome virus. Veterinary Microbiology 2003;93(1):13-24.

[32] Harms PA, Sorden SD, Halbur PG, Bolin SR, Lager KM, Morozov I, et al. Experimental

reproduction of severe disease in CD/CD pigs concurrently infected with type 2 porcine

circovirus and porcine reproductive and respiratory syndrome virus. Veterinary Pathology

2001;38(5):528-39.

[33] Halbur PG, Miller LD, Paul PS, Meng XJ, Huffman EL, Andrews JJ. Immunohistochemical

identification of porcine reproductive and respiratory syndrome virus (PRRSV) antigen in the

heart and lymphoid system of three-week-old colostrum-deprived pigs. Veterinary Pathology

1995;32(2):200-4.

94

CHAPTER 4. DEVELOPMENT OF ATTENUATED PORCINE REPRODUCTIVE AND

RESPIRATORY SYNDROME VIRUS ISOLATES THROUGH CONTINUOUS CELL

PASSAGE BY MULTIPLE WELL LIMITING DILUTIONS

Joshua S. Ellingson, Eric Vaughn, Sarah Layton, and Michael B. Roof

Abstract

In an effort to explore alternative options to develop modified live PRRSV vaccine

candidates, an innovative cell passage processed was utilized. Virulent field isolates, MN184

and MR007, were used as parent viruses to establish in vitro growth of twelve individual cohort

isolates for each strain. Isolates were each initially established on one 96 well plate. Thereafter,

each column was separately passed concurrently by limiting dilution, allowing for natural

mutants to develop twelve potentially unique progeny isolates from each parental strain.

Isolates were passed until significant genomic changes were detected. Nsp2 deletions were

targeted, as recent evidence has indicated nsp2 deletions may be involved with isolate

attenuation. At passage 50 isolates were tested for safety in both a respiratory growing pig safety

study and a gilt reproductive safety study. Numerous parameters of safety were collected from

both studies and revealed significant attenuation of the isolates. These studies suggest the cell

passage process by limiting dilution is a viable and efficient tool for the development of multiple

clones for vaccine candidate assessment.

1. Introduction

Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped single-

stranded positive-sense RNA virus classified under the family Arteriviridae, and genus

Arterivirus [1]. The virus causes a disease known as Porcine Reproductive and Respiratory

Syndrome (PRRS) which is classically seen as reproductive failure in breeding females and

respiratory disease in growing swine. The reproductive failure is associated with mid to late

95

term abortions, increased numbers of mummified fetuses and weak born piglets, and fewer

healthy born piglets [2]. With the aforementioned clinical signs, PRRS can have a significant

negative impact on the productivity of a herd. It has been estimated that PRRS costs the United

States pork producing industry around 664 million dollars a year [3]. Compounding the situation

is the fact that PRRSV is endemic in most swine producing countries and has a similar economic

effect elsewhere. To avoid these economic hardships, it is important for producers to have PRRS

prevention and elimination/management programs in place.

Current control strategies to prevent the spread of the virus within and between herds

includes: the proper management of breeding animals, removal of infected individuals, strict

biosecurity measures, serum inoculation, and the use of vaccines. Both inactivated and modified

live vaccines are commercially available. Inactivated vaccines provide a high level of safety but

are generally considered as ineffective or as conveying a very limited degree of efficacy.

Attenuated live vaccines have been widely used to reduce the transmission and clinical disease

caused by virulent wild-type (wt) viruses. Although modified live vaccine efficacy varies against

heterologous isolates, they remain the best vaccination option available to combat the disease.

The development of a new generation of vaccines capable of providing improved and consistent

protection against heterologous isolates with the ability to detect wt infection in vaccinated

animals would be a tremendous asset to the swine industry and is the focus of this research.

The PRRS genome is approximately 15,400 kilobases in length and is organized into at

least 10 open reading frames, numbered (1a, 1b, 2, 2b, 5a and 3-7) [4, 5]. Nonstructural proteins

(nsps) are encoded by ORF1a and 1b, which occupy three fourths of the entire genome. Due to

the essential nature of the structural proteins for production of viable virus, the nsps are an area

of focus for the generation of deletion marker vaccine candidates [6].

96

The nsp2 protein is the largest PRRSV protein and contains the most variable region in

the genome [7-9]. The nsp2 gene is also highly antigenic, containing numerous B-cell epitopes

[10]. Investigation of potential functions of nsp2 revealed that portions are critical for viral

replication while others were unnecessary [11]. The genetic flexibility of nsp2 allows for foreign

genes to be inserted successfully into the nonessential region to serve as a marker allowing for

users to successfully differentiate infected and vaccinated animals (DIVA) [6, 12]. Interestingly,

many field viruses have been identified with variously sized deletions in the nsp2 gene [8, 13-

20]. However, recent reports indicate the size and location of deletions within nsp2 are not

linked to increases in virulence or pathogenicity [21-24].

Moreover, recent work has reported nsp2 deletion mutants to be attenuated in vivo with

good stability [24-27]. Isolates with nsp2 deletions have been reported to be directly linked to

attenuation while other studies have implicated nsp2 as a potential cause [6, 28]. The cause of

attenuation may be due to the loss of nsp2’s antagonistic effects on the production of interferon

beta (IFN-β), an important part of the innate immune response against early viral replication [29,

30]. Nsp2 has also been found to counteract the antiviral function of interferon-stimulated gene

15 which functions in the regulation of antiviral immune responses [31]. Attenuation may also

be linked to viral replication, as nsp2 deletions have been reported to increase viral growth

kinetics in vitro while limiting replication in vivo [24]. It was determined that nsp2 deletions

may be one method in which isolates naturally attenuate themselves when being passed

continuously in vitro and therefore could provide guidelines to direct isolate testing as potential

vaccine candidates. In addition, deletion mutants could provide additional utility in the

development of DIVA technologies if a successful vaccine candidate could be developed.

97

In an attempt to create new deletion mutants through continuous in vitro passage, two

recently isolated circulating virulent field isolates (MN184 (MN/01/A2) and MR007) were

utilized. Each isolate was used to develop twelve theoretically distinct clones within one culture

plate using a unique cell passage process. After the first passage, progeny isolates were kept

separate from each other and were passed weekly by limiting dilution. This process is believed

to be a more efficient method to obtain and develop multiple independent clones during passage

as compared to traditional methods. Isolates with deletions within nsp2 were specifically

targeted for evaluation as a fact finding mission to determine if a correlation with attenuation

could be identified as reported by others. In vitro adapted progeny isolates were selected and

evaluated for attenuation in an initial 14 day growing pig respiratory trial and a pregnant gilt

reproductive model.

2. Materials and Methods

2.1 Cell Passage

To facilitate viral growth in vitro, 96 well cell culture plates were planted with MA-104

cells (ATCC CRL2621) and incubated with minimum essential medium (EMEM, SAFC

Biosciences M56416) with 10% fetal bovine serum (Invitrogen) and 5% CO2 at 37°C. Once

cells had incubated for 3 days, 100 µL of parent virus, either MN184 (MN/01/A2) or MR007,

were added to each well of an entire row on the culture plate. Each well was then used to make

four 1/10 dilutions down each respective column. After dilution, 100 µL of fresh media was

added over the top of each well. Plates were incubated for 3-8 days prior to being checked for

cytopathic effect. After reading the plates, the highest positive dilution of each column was

passed onto the same column of another plate with 3 day old MA-104 cells.

98

On the new plate four 1/10 dilutions were performed, media was overlaid, and plates

were again incubated. This process was performed continuously through in vitro cell passage 50.

Occasionally, if a column would display no growth the lowest dilution was passed in an attempt

to harbor enough infectious virus to maintain the passing infection. Subsequently, if there were

still no signs of CPE on the next plate another column was used to plant the next plate. Progeny

isolates were strictly kept separate, with the exception of total loss of virus, to encourage the

concurrent development of twelve unique isolates. Total loss of virus occurred twice through

passage 50. At every 10 passages positive samples were frozen at -70ºC as a backup. If a virus

was totally lost the last positive sample was thawed and used for recovery.

2.2 Viral Isolates

MR007, is an isolated virulent field virus from a 2007 PRRS outbreak that exhibits an

ORF5 1-7-4 RFLP pattern and has a JA-142 like nsp2 region. MN184 (MN/01/A2) is a very

pathogenic isolate that appeared in North America in 2002 causing high mortality and severe

reproductive disorders. This isolate has a 131 amino acid deletion in the nsp2 region as

compared to VR-2332, the type 2 prototype strain. Furthermore, MN184 has been found to have

the shortest PRRS genome found to date at 15,019 kb [11, 15]. Deletion mutants created through

the passage process were referred to as 96 well deletion mutants while MR007 #9 contained no

significant deletions in the nsp2 region but was selected to be used as a comparison to the

selected MR007 nsp2 deletion isolate.

2.3 Nucleotide Sequence Analysis

Nucleotide sequence analysis was performed from both in vitro cell cultures and from

study animal serum samples. For the in vitro samples, QIAamp Viral RNA Mini kit (Qiagen Inc,

Valencia, CA) was used for the ribonucleic acid (RNA) extractions while the Total Nucleic Acid

99

MagNA Pure kit (Roche Applied Science) was used to extract from the collected swine serum.

SuperScript® III First-Strand Synthesis (Invitrogen Corp, Carlsbad, CA) was used to create

complementary deoxyribonucleic acid (cDNA) per the manufacturer’s recommendations. The

cDNA product then underwent polymerase chain reaction (PCR) in a GeneAmp® PCR System

9700 (Applied Biosystems) 96 well machine with the following configuration: an initializing

step for 5 minutes (min.) at 95°C, 35 cycles of a denaturation step at 95°C for 30 seconds (sec.)

an annealing step at 53°C for 30 sec. followed by an extension step at 72°C for 150 sec., and

finally a single elongation step at 72°C for 5 min. Samples were held at 4°C until removal from

the thermocycler. Each PCR well was set up accordingly: 25µL of 2X AmpliTaq Gold

Mastermix (Applied Biosystems), 21µL DEPC Water (EMD Chemicals, Gibbstown, NJ), 2 µL

of cDNA template, and 1µL of each respective primer [Table 1].

The PCR products were then purified with the Wizard® DNA Clean-Up System

(Promega, Madison WI) per the manufacturer’s recommendations. Samples were then placed

into a Savant Speedvac DNA 110 (Global Medical Instrumentation, Ramsey, MN) at medium

speed for 10 min. to remove any residual isopropanol. Samples were then mixed with 10 µL of

loading dye and loaded onto a 1.5% agarose gel. Electrophoresis was performed by applying

120 volts for 45 min. Bands of the appropriate size were visualized and underwent purification

with the Wizard® SV Gel and PCR Clean-Up System (Promega).

Samples were then sent to Iowa State University (ISU) DNA Facility for sequence

analysis where the sequencing reactions were set up with the appropriate primers [Table 1]. At

ISU an Applied Biosystems 3730xl DNA Analyzer was used. Sequences were analyzed with

GeneTool Version 2.0 (BioTools Inc.). The ORF5 sequences were classified according to their

100

restriction fragment length polymorphism cut pattern as outlined by the University of Minnesota

Veterinary Diagnostic Laboratory.

2.4 Respiratory Safety Trial

For this study, twenty-five 3 week old commercial crossbred pigs naïve to PRRSV were

randomly split by weight into groups of 5 for a 14 day respiratory safety trial. All animals were

housed at a research facility and blinded to all individuals working with the animals throughout

the study. Animals received 5.0 logs of virus in a 2 ml intramuscular injection in the neck

containing either MN184 pass 51 clone #6, MR007 pass 51 clone #2, MR007 pass 51 clone #9,

wt MR007, or phosphate buffer solution (PBS) for the negative controls. The three isolates were

selected out of the 12 developing clones from each parental virus on the basis of containing nsp2

deletions (MN184 #6 and MR007 #2) or based on replication kinetics in vitro (MR007 #9

consistently replicated to lower levels as compared to cohorts). Animal facility constraints

limited the study to just 5 groups. All viruses were diluted with minimum essential medium

(MEM; Sigma, St. Louis, MO.) containing 2% fetal bovine serum (FBS; Sigma, St. Louis, MO.)

in order to deliver 5.0 logs of virus to each animal. Viral titers were determined by TCID50/ml

[32, 33].

The study concluded at day 14 upon which all animals underwent humane euthanasia and

necropsy by a licensed veterinarian. Assessment of isolate virulence was evaluated by quantity

of gross lung lesions and average daily weight gain. Blood samples were collected prior to

inoculation on study day 0 and on days 7 and 14 to evaluate ability of isolates to induce PRRS

specific antibodies.

The lungs of all animals in the pig safety study were evaluated at necropsy for percent

consolidation consistent with PRRSV infection. Lungs were scored for each individual lobe and

101

total gross lung pathology using a standardized scoring system [34]. The final observation score

equaled the weighted sum of all the individual lobe scores.

2.5 Reproductive Safety Trial

With satisfactory results from the respiratory trial, the same isolates were tested again in

a gestating gilt reproductive model to further ascertain the safety of the isolates.

The reproductive safety trial included sixteen PRRS ELISA negative commercial crossbred gilts

at 90 ± 4 days of gestation housed in a research facility and blinded to all animal caretakers and

investigators. Animals were randomly divided into four treatment groups consisting of the same

cell passaged articles from the respiratory trial and one negative control group. Females were

inoculated intranasally with 2.0 mL per nostril with either inoculum or PBS for the negative

control group. All viruses were prepared as described for the respiratory trial, with the exception

of the gilts received 5.0 logs of virus in 4.0 ml. The study ended for each gilt and her piglets 21

days after their respective day of farrowing (DOF).

Abortions and farrowing data were recorded for each female. The day of farrowing was

defined as the day the first live born pig of the litter was delivered. Gilts were observed

periodically from at least 6:00 AM to 10:00 PM daily. Litter observations included the number

of abortions, stillbirths, mummies, live piglets, and weak born live piglets for each female.

Piglets found dead due to being crushed by the dam were recorded and confirmed with a

necropsy.

All gilts had blood drawn at day 0, 7, 14, 21, day of farrowing (DOF), 7 days after

farrowing (DOF+7), 14 days after farrowing (DOF+14), and 21 days after farrowing (DOF+21).

In addition, live piglets had blood collected on DOF, DOF+7, DOF+14, and DOF+21 while dead

piglets had blood or thoracic fluid collected immediately upon examination regardless of study

102

day. Blood was collected for evaluation of viremia and development of PRRSV specific

antibodies. Additional data was collected to serve as further evidence of safety including:

clinical signs of animals, gilt rectal temperatures, piglet average daily weight gain, and

reproductive performance.

2.6 Serology

Whole blood was collected from each animal via venipuncture. Samples were returned to

the laboratory for separation from the clot by centrifugation. Serum was then decanted into

screw-cap cryogenic vials and stored for a maximum of 24 hours at 4°C or at -70°C until testing

could be performed. Serum samples were analyzed for PRRSV specific antibody using the

IDEXX HerdChek® PRRS ELISA 2XR (IDEXX Laboratories Inc, Westbrook, ME). All tests

were performed as described by the manufacturer’s instructions. Samples were considered

positive for PRRSV antibodies if the sample-to-positive (S/P) ratio was at least 0.4.

2.7 Average Daily Weight Gain

As another parameter to gauge the health status of study animals, average daily weight

gain (ADWG) was recorded. Animal weights were recorded on a scale that was calibrated prior

to each use. For the respiratory safety study, animals were weighed 3 days prior to vaccination

(Day -3) and at necropsy (Day 14). For the reproductive safety study, all piglets delivered were

weighed within 8 hours of farrowing and all remaining live piglets were again weighed 21 days

later for analysis.

2.8 Reproductive Safety Trial Viremia

Both gilt and piglet serum were tested via reverse transcriptase polymerase chain reaction

(RT-PCR) for the presence of PRRSV nucleic acid. Serum was extracted by the Roche MagNA

pure extraction robot with the Total Nucleic Acid MagNA Pure kit (Roche Applied Science).

103

The RT-PCR was performed with the AgPath-ID™ NA and EU PRRSV Multiplex (Applied

Biosystems) per the manufacturer’s instructions. The reactions were run on a Roche Lightcycler

480 96 well machine with the following configuration: an annealing step at 45°C for 10 min.,

denaturation at 95°C for 10 min., and 40 cycles of denaturation at 97°C for 2 sec. followed by an

annealing step at 60°C for 40 sec., and finally a cooling step at 40°C for 40 seconds.

2.9 Reproductive Safety Study Animal Clinical Observations

All study animals were observed daily for overall health and clinical signs associated

with PRRS. Each animal was evaluated for respiration, behavior, and cough with scores

assigned for each category. Possible scores ranged from 0 (normal) to 1 (abnormal). Abnormal

behaviors were defined as abnormal respiration, abnormal behavior such as lethargy, and the

presence of a cough. A total daily score was recorded based on the sum of the 3 individual

scores. Any dead piglets were assigned a score of 3 and then were weighed and subsequently

had a necropsy performed to determine the likely cause of death. In addition to the daily

observations, gilt rectal temperatures were taken periodically beginning with the day prior to

inoculation (day -1) through study termination (DOF+21).

2.10 Statistics/biometrics

All data for the respiratory safety and reproductive safety studies were imported into SAS

version 9.1 for management and analysis. All parameters were compared between groups

(pairwise) 1 – 4 vs. 5 for both the pig and reproductive studies and groups 1 – 3 vs. 4 for the

respiratory study. In compliance with the methods recommended by APHIS, only two-sided

results were reported and all comparisons were at α=0.05. The specific methods used to analyze

data are shown in table 2.

104

3. Results

3.1 Sequence Analysis

The viruses undergoing continuous cell passage had genomic sequence analysis

performed at approximately every 10 passages on the nsp2 region and on the ORF5 region at

passage 50. Genomic changes outside of nsp2 and ORF5 were not monitored. As expected,

several isolates had developed natural deletions in the nsp2 region throughout the process. At

cell passage 50 MN184 #6 had a continuous 6 nucleotide deletion in the nsp2 region, expected to

result in the loss of 2 amino acids. MR007 #2 at cell passage 50 exhibited a continuous 63

nucleotide deletion in the nsp2 region which resulted in the loss of a continuous 21 amino acid

sequence. MR007 #9 at pass 50 remained similar to the parent strain and was selected for testing

for comparison to other isolates.

Samples from the reproductive safety trial also underwent sequence analysis to determine

how stabile the viruses were in vivo. All PCR positive piglet blood samples from the final day of

the study (DOF +21), underwent attempted sequence analysis for nsp2 and ORF5. At least one

sequence was successfully attained from each vaccinate group. All isolates from the gilt safety

trial remained stable in the evaluated regions after in vivo replication. The nsp2 region

sequencing from each individual animal revealed only a few substitutions for each virus.

Substitutions resulting in amino acid changes are summarized in table 3 and are described in

comparison to MN184A and JA142 AY424271. The ORF5 regions were also sequenced and

revealed only a few insignificant changes (data not shown).

3.2 Respiratory Safety Trial Lung Pathology

Upon completion of the study on day 14, all animals were assessed for lung pathology

[Figure 1]. Using ANOVA to compare group mean lung scores, only the wt MR007 group had a

105

significant increase in clinical lung scores as compared to the negative control group. The

MR007 #9 group had significant reductions in lung scores as compared to the wt MR007 group.

The lung scores indicate that the cell passage process significantly reduced the virulence of the

MN184 #6 and MR007 #9 isolates while the MR007 #2 isolate containing the nsp2 deletion may

still be capable of causing some degree of respiratory disease.

3.3 Average Daily Weight Gain

For the respiratory safety study, average daily weight gain analysis revealed no

statistically significant differences for either group mean initial body weight or average daily

gain amongst all treatment groups. The wt MR007 group had a slightly higher mean initial body

weight than the other groups which may account for the lack of statistical differences in ADWG

as compared to the other groups. For the reproductive safety study, piglets in the MR007 #2

group had significantly lower mean body weight at farrowing than the negative control group.

Piglets in all treatment groups had significant reductions in ADWG as compared to the negative

control group.

3.4 HerdChek ELISA

For the respiratory safety study, on day 0 and 7 all animals were negative via the IDEXX

HerdChek® PRRS ELISA 2XR. On day 14 all animals in the MN184 Pass 51 #6 group and

most animals in group 4 (wt MR007) had seroconverted while the MR007 pass 50 treatment

groups displayed poor seroconversion [Figure 2]. The wt MR007 treatment group was only

statistically different from the poor seroconverting MR007 #2 group.

For the reproductive safety study, all animals were again negative on days 0 and 7.

However, by day 21 nearly all gilts that received virus as a treatment were positive, indicating

the pigs in the respiratory trial may have needed additional time to develop detectable levels of

106

antibody. Gilts in the MN184 treatment group all remained positive by ELISA for the duration

of the study. Piglets were found to have a considerable amount of PRRSV specific antibody.

The MR007 #9 and MN184 #6 groups displayed significant increases in positive tests as

compared to the piglets belonging to the negative control group for all sample collection dates.

The MR007 #2 treatment group piglets were found to only be statistically distinct from the

negative control group at DOF+7. ELISA findings for both studies provided evidence that all

isolates are capable of inducing a PRRSV specific antibody response. Interestingly, the onset of

antibody detected in the MN184 treatment group was earlier than the MR007 pass 51 treatment

groups.

3.5 Gilt Reproductive Performance

Females farrowed relatively normal and healthy litters as outlined in (Table 4), with the

exception of 1 gilt in the MR007 #2 group who produced only 3 stillborn piglets. Due to facility

and labor limitations, only 4 gilts were used for each isolate. With such a small sample size it is

difficult to make concrete conclusions over this data. However, there were no dramatic signs of

virulence in any of the tested isolates. No statistical differences were found for any of the

reproductive performance variables measured when compared to the control group. These

findings suggest that the described attenuation process has been successful in reducing the

amount of reproductive failure caused by each isolate.

3.6 Mortality of Piglets, Pigs, and Gilts

For the respiratory safety study no animals were lost during the study. However, for the

reproductive safety study 6 piglets were lost from the DOF to DOF+21. These losses still fall

within the expected range of piglet mortality prior to weaning. One gilt in the MR007 #2

107

treatment group was euthanized due to illness resulting from a retained placenta. The gilt

delivered just 3 stillborn piglets so no piglet performance data was compromised.

3.7 Viremia

Gilt viremia as detected by RT-PCR was relatively short for most groups [Figure 3]. All

treatment groups had a significant increase in animals positive for PRRS RNA at day 14 while

the MN184 #6 group was also statistically distinct at day 7. The negative control group had 1

animal test positive at DOF+7, which was included in the statistical analysis. This was likely the

result of sample contamination sometime along processing as this was the only positive test out

of this group.

For the MR007 treatment groups, the majority of the piglets were negative on the day of

farrowing. However, by DOF+21 most piglets belonging to the MR007 #9 and MN184 #6

treatment groups were positive, presumably due to horizontal transmission of virus. All

treatment groups exhibited a significant increase in the number of piglets testing positive for

PRRS RNA, with the exception of MR007 #2 at DOF+7 which lost significance due to 4 out of

the 26 piglets in the negative control group testing positive on that day. The cause of positive

samples from the negative control group on this study day are unknown, but were likely the

results of contamination somewhere along the line of sample collection, handling, or processing

as no other negative control group samples were PCR positive prior to or after this occurrence

[Figure 4]. While all isolates were capable of replicating in vivo, the MR007 passaged viruses

were less efficient.

3.8 Reproductive Safety Study Clinical Observations

Clinical observations were recorded for the reproductive safety study as supporting data

for remaining isolate virulence. With the exception of the euthanized gilt, only a few isolated

108

events of abnormal scores of 1 were documented. No groups were statistically different from the

negative control group throughout the study. Mean gilt group rectal temperatures were also

collected and compared to the negative control group. Higher mean rectal temperatures were

noted at day 7 (MR007 #9 and MR007 #2) and day 14 (MN184 #6). Body temperatures for gilts

in all treatment groups remained normal throughout the remainder of the study. For the piglet

clinical observation scores, increases in piglet clinical abnormalities in the MR007 #9 and

MR007 #2 treatment groups were noted. All other clinically abnormal animals were not severely

affected and no abnormalities compromised the outcome of the study.

4. Discussion

The aim of this study was to develop attenuated PRRSV isolates from virulent field

strains by continuous in vitro passage for potential use as future modified live vaccines. The

ability to use naturally occurring nsp2 deletions as a determinant of isolate attenuation from in

vitro passage was also a side component of this project. Typically, when viruses replicate in cell

lines derived from a different species the viruses tend to naturally attenuate during the process of

adapting to the cell line used. Early mutations are frequently related to adaptation while later

stage mutations are more likely to be related to isolate attenuation [28, 35]. Currently available

modified live PRRS vaccines were developed by passing pathogenic isolates continuously in cell

culture to reduce virulence. Potential vaccine isolates are then tested for safety, efficacy, and

stability with in vivo models. This process is laborious, costly, and time consuming. The

development of methodologies to improve the efficiency of this process is needed.

In this report, a passage process is described in which single isolates were passed

multiple times by multiple well limiting dilutions to increase the efficiency of developing

naturally attenuated clones. Frequent sequence analysis was used to screen progeny viruses for

109

genomic changes and to guide selection of isolates for potential level of in vivo attenuation. In

the respiratory trial, all cell passage isolates had no statistical differences for lung pathology or

average daily weight gain as compared to the negative controls. The MR007 #9 group had

statistically significant reduced lung scores as compared to the parent group (wt MR007). A wt-

MN184 was not used in this study in an attempt to reduce the number of animals necessary for

this phase of investigation, but has been tested previously [32]. Johnson et al. inoculated ten 2-3

week old pigs with MN184 at cell culture passage 1 and documented the death of 2 pigs in that

group by the first 14 days of the study. Lung pathology scores were not collected for the MN184

group, but the group mortality rate speaks for the general virulence of the parental wt isolate. In

the pig respiratory trial, no animals were lost for any treatment group over the course of the

study.

Results for the reproductive safety trial mimicked those from the respiratory trial. When

compared to the negative control group, all reproductive performance parameters and gilt clinical

observations had no statistical differences for any of the tested isolates. ELISA results for both

trials indicated all isolates are capable of inducing the production of PRRSV specific antibodies

by day 21 in the gilts. Viremia detected by RT-PCR showed that the virus attained detectable

levels within the blood for only short periods of time in the gilts. Transplacental transmission of

virus with subsequent lateral transmission to littermates in all groups was documented. While

congenital transmission of virus did occur, it didn’t negatively affect the performance of all

groups. The MN184 #6 group had no statistical differences in piglet clinical observations when

compared to the negative control group which is a phenomenon that has been previously

described with currently available attenuated vaccines [36]. All passaged isolates were capable

of replication and inducing seroconversion in vivo and were less virulent than the parent viruses.

110

However, the isolates displayed some residual ability to cause disease and potential production

losses, so they will continue to be passaged in cell culture in an attempt to further attenuate the

viruses.

This work also provides evidence that nsp2 deletions may be a component of the

attenuation of in vitro passaged isolates. Naturally occurring nsp2 deletions were purposely

selected to be screened for virulence to determine if nsp2 deletions could be used to gauge levels

of in vitro attenuation. Both nsp2 deletion mutants tested (MN184 #6 and MR007 #2) were

attenuated in vivo. Results from the two safety studies revealed, the MR007 passaged isolate

with the 63 nucleotide deletion (MR007 #2) was less attenuated than the cohort isolate without a

noted nsp2 deletion (MR007 #9) at the same cell passage (passage 50). For the respiratory trial

only the MR007 #9 group was statistically different from the wt parent virus for lung pathology.

However, both isolates were statistically indistinguishable from the negative control group

indicating both were attenuated to some degree. The decreased ability of the nsp2 deletion

mutants to replicate in vivo has been reported previously, and could be the cause of the reduced

levels of viremia and slower development of antibody reported here with MR007 #2 [25, 37].

Without additional data, it is unclear if the nsp2 deletions were directly involved with isolate

attenuation or were a coincidental change.

Nsp2 deletions mutants are considered to be viable potential vaccine candidates worthy

of developing and testing. However, further research is needed to clarify their role in isolate

attenuation. The ability to identify attenuated isolates with molecular techniques would greatly

reduce the cost of developing new vaccines and significantly speed up the process. If nsp2

deletions are not involved with isolate attenuation, they still hold potential for the future

development of successful DIVA technologies.

111

Without a better understanding of viral components important for virulence and host

immunity, the industry will continue to rely on trial and error approaches for the development of

new and improved vaccines. Until then, the passage of virulent isolates in cell culture by

limiting dilution is an efficient and viable technique to concurrently develop multiple potential

vaccine candidate isolates.

112

Table 1. Primers Used in Preparation and Sequencing of PRRSV Isolates.

Primer Target Sequence

PCR Amplification of cDNA

NamNsp2U Nsp2 CTGCGGCCTTRGACAGGAACGG

NamNsp2L Nsp2 TGTCHACCCKATCCCACATGCG

PRRS-Out1 ORF5 GTACGGCGATAGGGACACC

PRRS-Out2 ORF5 CCAGAATGTACTTGCGGCC

Sequence Analysis

NamNsp2U MN#6 Nsp2 CTGCGGCCTTRGACAGGAACGG

NamNsp2L MN#6 Nsp2 TGTCHACCCKATCCCACATGCG

NspMR-U1 MN#6 Nsp2 CTGATCAGGTGTGCTTGGGG

NspMR-L1 MN#6 Nsp2 CCCCAAGCACACCTGATCAG

Nsp-MR-U2 MN#6 Nsp2 GCACCGCCACCTTCTCCAC

Nsp-MR-L2 MN#6 Nsp2 GTGGAGAAGGTGGCGGTGC

NamNsp2U MR#2/9 Nsp2 CTGCGGCCTTRGACAGGAACGG

NamNsp2L MR#2/9 Nsp2 TGTCHACCCKATCCCACATGCG

MN445U MR#2/9 Nsp2 AAGTCTTGAAGAATGCTTGGC

MN445L MR#2/9 Nsp2 GCCAAGCATTCTTCAAGACTT

MN41020U MR#2/9 Nsp2 GCATTGCCGCTGAGTGRGGAT

MN41020L MR#2/9 Nsp2 ATCCYCACTCAGCGGCAATGC

PRRS-Out1 ORF5 GTACGGCGATAGGGACACC

PRRS-Out2 ORF5 CCAGAATGTACTTGCGGCC

Letter Key:

A – Adesosine T - Thymidine K - G or T

G – Guanosine R - A or G Y - C or T

C – Cytidine H - A, C or T

113

Table2. Summary of Statistical Methods of Analysis for Collected Parameters.

Safety

Study

Parameter Specific Evaluation To

Be Conducted

Statistical Method

of Analysis

Respiratory Mean Lung

Scores

Mean lung scores for

each group

ANOVA

Respiratory

and

Reproductive

Serology Number of animals in

each group serologically

positive/total number of

animals in each group

Fisher’s Exact Test

Respiratory

and

Reproductive

Weights and

ADWG

Mean Data ANOVA

Reproductive Gilt

Reproductive

Performance

1. Total Piglets Kurskal-Wallis /

Wilcoxon Two

Sample Test 2. Stillborn

3. Healthy Live Piglets

4. Weak Live Piglets

5. Mummies

6. Live Pigs at DOF 21

Reproductive Gilt and

Piglet

Clinical

Observations

Gilts/Piglets with score

> 0 for at least one day

Fisher’s Exact Test

Reproductive Gilt Rectal

Temperatures

Mean Data ANOVA

Pyrexia Fisher’s Exact Test

Reproductive Gilt/Piglet

Viremia

Animals positive Fisher’s Exact Test

114

Table 3. Nsp2 Mutations Causing Amino Acid Changes from Positive Piglets at Twenty-one

Days of Age.

Isolate MN184A Position Nucleotide

Change

Amino Acid Change

MN184 #6 1468 A G N D

MN184 #6 2072 A G N S

MN184 #6 2087 T C L P

MN184 #6 2245 A G S G

JA142 AY424271 Position Nucleotide

Change

Amino Acid Change

MR007 #2 3034 A G N D

MR007 #2 3097 G A G S

MR007 #9 1738 G A G S

MR007 #9 2684 C T S F

MR007 #9 2941 T G G W

MR007 #9 3022 G A G S

115

Table 4. Mean Gilt Reproductive Performance per Litter.

Total

Farrowed

Stillborn Healthy

Live Piglets

Weak

Live

Piglets

Mummies DOF+21

Live

Pigs

MN184 #6 9.00 1.75 6.25 0.25 0.50 6.50

MR007 #2 8.25 2.50 5.75 0.00 0.00 5.25

MR007 #9 11.25 0.25 9.50 1.00 0.50 9.75

Negative 8.25 1.25 6.50 0.00 0.25 6.50

116

Figure 1. Pig Respiratory Trial: Lung Pathology.

1

The results were plotted as mean values of gross lung lesions from each group. The letter a

indicates the average lung score of the group is significantly higher than the negative control

while the letter b indicates the group was significantly lower than the MR007 wt group (a/b = p <

0.05).

117

Figure 2. Pig Respiratory Trial: Development of PRRSV Specific Antibody as Measured by

IDEXX ELISA.

118

Figure 3: Gilt Reproductive Trial: Gilt Viremia as Detected by RT-PCR.

119

Figure 4. Gilt Reproductive Trial: Piglet Viremia as Detected by RT-PCR.

120

References

[1] Cavanagh D. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch

Virol. 1997;142:629-33.

[2] Chung WB, Lin MW, Chang WF, Hsu M, Yang PC. Persistence of porcine reproductive and

respiratory syndrome virus in intensive farrow-to-finish pig herds. Can J Vet Res. 1997;61:292-

8.

[3] Holtkamp DJ, Kliebenstein JB, Neumann EJ. Assessment of the economic impact of porcine

reproductive and respiratory syndrome virus on United States pork producers. JSHAP.

2013;21:72-84.

[4] Zimmerman JJ KL, Ramirez A, Schwartz KJ, Stevenson GW Diseases of Swine. In:

Zimmermann JJ BD, Dee SA, Murtaugh MP, Stadejek T, Stevenson GW, Torremorell M,,

editor. Porcine Reproductive and Respiratory Syndrome Virus (Porcine Arterivirus). 10 ed:

Wiley-Blackwell; 2012. p. 461-86.

[5] Oh J, Lee C. Proteomic characterization of a novel structural protein ORF5a of porcine

reproductive and respiratory syndrome virus. Virus research. 2012;169:255-63.

[6] Kim DY, Kaiser TJ, Horlen K, Keith ML, Taylor LP, Jolie R, et al. Insertion and deletion in a

non-essential region of the nonstructural protein 2 (nsp2) of porcine reproductive and respiratory

syndrome (PRRS) virus: effects on virulence and immunogenicity. Virus genes. 2009;38:118-28.

[7] Yoshii M, Okinaga T, Miyazaki A, Kato K, Ikeda H, Tsunemitsu H. Genetic polymorphism

of the nsp2 gene in North American type--porcine reproductive and respiratory syndrome virus.

Arch Virol. 2008;153:1323-34.

[8] Fang Y, Kim DY, Ropp S, Steen P, Christopher-Hennings J, Nelson EA, et al. Heterogeneity

in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses isolated in the

United States. Virus research. 2004;100:229-35.

[9] Shen S, Kwang J, Liu W, Liu DX. Determination of the complete nucleotide sequence of a

vaccine strain of porcine reproductive and respiratory syndrome virus and identification of the

Nsp2 gene with a unique insertion. Archives of virology. 2000;145:871-83.

[10] de Lima M, Pattnaik AK, Flores EF, Osorio FA. Serologic marker candidates identified

among B-cell linear epitopes of Nsp2 and structural proteins of a North American strain of

porcine reproductive and respiratory syndrome virus. Virology. 2006;353:410-21.

[11] Han J, Liu G, Wang Y, Faaberg KS. Identification of nonessential regions of the nsp2

replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for

replication in cell culture. Journal of virology. 2007;81:9878-90.

[12] Xu YZ, Zhou YJ, Zhang SR, Jiang YF, Tong W, Yu H, et al. Stable expression of foreign

gene in nonessential region of nonstructural protein 2 (nsp2) of porcine reproductive and

121

respiratory syndrome virus: applications for marker vaccine design. Veterinary microbiology.

2012;159:1-10.

[13] Fang Y, Schneider P, Zhang WP, Faaberg KS, Nelson EA, Rowland RR. Diversity and

evolution of a newly emerged North American Type 1 porcine arterivirus: analysis of isolates

collected between 1999 and 2004. Arch Virol. 2007;152:1009-17.

[14] Gao ZQ, Guo X, Yang HC. Genomic characterization of two Chinese isolates of porcine

respiratory and reproductive syndrome virus. Arch Virol. 2004;149:1341-51.

[15] Han J, Wang Y, Faaberg KS. Complete genome analysis of RFLP 184 isolates of porcine

reproductive and respiratory syndrome virus. Virus research. 2006;122:175-82.

[16] Li Y, Wang X, Bo K, Tang B, Yang B, Jiang W, et al. Emergence of a highly pathogenic

porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China. Vet J.

2007;174:577-84.

[17] Ropp SL, Wees CE, Fang Y, Nelson EA, Rossow KD, Bien M, et al. Characterization of

emerging European-like porcine reproductive and respiratory syndrome virus isolates in the

United States. J Virol. 2004;78:3684-703.

[18] Tian K, Yu X, Zhao T, Feng Y, Cao Z, Wang C, et al. Emergence of fatal PRRSV variants:

unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique

hallmark. PLoS One. 2007;2:e526.

[19] Gauger PC, Faaberg KS, Guo B, Kappes MA, Opriessnig T. Genetic and phenotypic

characterization of a 2006 United States porcine reproductive and respiratory virus isolate

associated with high morbidity and mortality in the field. Virus research. 2012;163:98-107.

[20] Yu X, Chen N, Wang L, Wu J, Zhou Z, Ni J, et al. New genomic characteristics of highly

pathogenic porcine reproductive and respiratory syndrome viruses do not lead to significant

changes in pathogenicity. Veterinary microbiology. 2012;158:291-9.

[21] Metwally S, Mohamed F, Faaberg K, Burrage T, Prarat M, Moran K, et al. Pathogenicity

and molecular characterization of emerging porcine reproductive and respiratory syndrome virus

in Vietnam in 2007. Transboundary and emerging diseases. 2010;57:315-29.

[22] Zhou L, Zhang J, Zeng J, Yin S, Li Y, Zheng L, et al. The 30-amino-acid deletion in the

Nsp2 of highly pathogenic porcine reproductive and respiratory syndrome virus emerging in

China is not related to its virulence. Journal of virology. 2009;83:5156-67.

[23] Han W, Wu JJ, Deng XY, Cao Z, Yu XL, Wang CB, et al. Molecular mutations associated

with the in vitro passage of virulent porcine reproductive and respiratory syndrome virus. Virus

genes. 2009;38:276-84.

122

[24] Ni YY, Huang YW, Cao D, Opriessnig T, Meng XJ. Establishment of a DNA-launched

infectious clone for a highly pneumovirulent strain of type 2 porcine reproductive and respiratory

syndrome virus: identification and in vitro and in vivo characterization of a large spontaneous

deletion in the nsp2 region. Virus research. 2011;160:264-73.

[25] Faaberg KS, Kehrli ME, Jr., Lager KM, Guo B, Han J. In vivo growth of porcine

reproductive and respiratory syndrome virus engineered nsp2 deletion mutants. Virus research.

2010;154:77-85.

[26] Guo B, Vorwald AC, Alt DP, Lager KM, Bayles DO, Faaberg KS. Large scale parallel

pyrosequencing technology: PRRSV strain VR-2332 nsp2 deletion mutant stability in swine.

Virus research. 2011;161:162-9.

[27] Brockmeier SL, Loving CL, Vorwald AC, Kehrli ME, Jr., Baker RB, Nicholson TL, et al.

Genomic sequence and virulence comparison of four Type 2 porcine reproductive and

respiratory syndrome virus strains. Virus research. 2012;169:212-21.

[28] Leng X, Li Z, Xia M, Li X, Wang F, Wang W, et al. Mutations in the genome of the highly

pathogenic porcine reproductive and respiratory syndrome virus potentially related to

attenuation. Veterinary microbiology. 2012;157:50-60.

[29] Sun Z, Chen Z, Lawson SR, Fang Y. The cysteine protease domain of porcine reproductive

and respiratory syndrome virus nonstructural protein 2 possesses deubiquitinating and interferon

antagonism functions. Journal of virology. 2010;84:7832-46.

[30] van Kasteren PB, Beugeling C, Ninaber DK, Frias-Staheli N, van Boheemen S, Garcia-

Sastre A, et al. Arterivirus and nairovirus ovarian tumor domain-containing Deubiquitinases

target activated RIG-I to control innate immune signaling. Journal of virology. 2012;86:773-85.

[31] Sun Z, Li Y, Ransburgh R, Snijder EJ, Fang Y. Nonstructural protein 2 of porcine

reproductive and respiratory syndrome virus inhibits the antiviral function of interferon-

stimulated gene 15. Journal of virology. 2012;86:3839-50.

[32] Johnson W, Roof M, Vaughn E, Christopher-Hennings J, Johnson CR, Murtaugh MP.

Pathogenic and humoral immune responses to porcine reproductive and respiratory syndrome

virus (PRRSV) are related to viral load in acute infection. Veterinary immunology and

immunopathology. 2004;102:233-47.

[33] Reed LJ, Muench H. A simple method of estimating fifty percent end-points. Amer J Hyg.

1938;27:493–7.

[34] Halbur PG, Miller LD, Paul PS, Meng XJ, Huffman EL, Andrews JJ. Immunohistochemical

identification of porcine reproductive and respiratory syndrome virus (PRRSV) antigen in the

heart and lymphoid system of three-week-old colostrum-deprived pigs. Vet Pathol. 1995;32:200-

4.

123

[35] An TQ, Tian ZJ, Zhou YJ, Xiao Y, Peng JM, Chen J, et al. Comparative genomic analysis

of five pairs of virulent parental/attenuated vaccine strains of PRRSV. Veterinary microbiology.

2011;149:104-12.

[36] Mengeling WL, Lager KM, Vorwald AC. Clinical effects of porcine reproductive and

respiratory syndrome virus on pigs during the early postnatal interval. Am J Vet Res.

1998;59:52-5.

[37] Ni YY, Opriessnig T, Zhou L, Cao D, Huang YW, Halbur PG, et al. Attenuation of porcine

reproductive and respiratory syndrome virus by molecular breeding of virus envelope genes from

genetically divergent strains. Journal of virology. 2013;87:304-13.

124

CHAPTER 5. DISCUSSION

General Conclusions

Porcine reproductive and respiratory syndrome virus can be an elusive pathogen to

routinely detect diagnostically and to control in commercial pork production. The ability of the

virus to constantly mutate has led to the development of a huge variety of isolates in the field.

The breadth of isolates makes it difficult to detect all infections diagnostically and to provide

commercial pigs with consistent cross protective immunity. Stakeholders will continue to work

with imperfect tools until significant advances are made in the basic understanding of

determinants of immunity and viral pathogenicity.

The swine industry would undoubtedly benefit from the development of improved

vaccines. However, despite extensive efforts, little progress has been made to improve efficacy

since the first introduction of a live, attenuated vaccine in 1994 [1]. The current lack of

understanding of viral targets for protective immunity prevents guided attempts at developing

vaccines with improved heterologous protection, increased safety, and the ability to differentiate

vaccinated from wild type infected pigs. Without a better understanding of PRRSV immunity

and pathogenesis, the development of novel vaccines will likely rely on the current laborious and

expensive trial and error approach.

The two approaches reported here remain viable options to develop improved modified

live vaccines, but have similar limitations. Construction of protective chimeras will remain a

guessing game until individual viral structures important for immunity are identified and can be

targeted. Likewise, without an understanding of the genomic basis of virulence it is impossible

to determine the degree of virulence of isolates. Potential vaccinates will require continued

testing in live animals to determine attenuation and heterologous efficacy.

125

However, there is reason to remain optimistic for the outlook of improved disease

prevention tools as scientists from around the world are actively seeking solutions. Attempted

strategies to develop improved vaccines have included: development of a vaccine after

continuous passage of a highly virulent variant isolate (HP-PRRSV) in cell culture, genetic

engineering of wild type strains, synthesis of infectious chimeras, creation of recombinant

vectors expressing PRRSV proteins, development of DNA vaccines, and creation of plant made

oral subunit vaccines [2]. Numerous strategies are being attempted by many bright investigators.

Significant advances have already been made in the diagnostics realm allowing for

improved detection of genetically divergent strains, earlier detection of infections, and continued

development of differential assays. In addition, the development of sample collection and

delivery techniques allowing for the reduction of costs and technical training required for sample

collection will be very beneficial to the pork industry.

Development of improved vaccines against PRRSV will likely remain a challenge until

the immunity and pathogenesis is better understood. Additional research in PRRS

immunobiology is urgently needed to hasten the development of better tools to help prevent,

control, and eliminate the virus.

References

[1] Murtaugh MP, Genzow M. Immunological solutions for treatment and prevention of porcine

reproductive and respiratory syndrome (PRRS). Vaccine. 2011;29:8192-204.

[2] Hu J, Zhang C. Porcine reproductive and respiratory syndrome virus vaccines: current status

and strategies to a universal vaccine. Transboundary and emerging diseases. 2013.