possible role of garlic oil in ameliorating renal … · ischemia/reperfusion injury (i/r) is...
TRANSCRIPT
INTRODUCTION
Ischemia/reperfusion injury (I/R) is defined as cellulardamage secondary to oxygen deprivation which is aggravated bythe sudden restoration of blood perfusion (1). Due to the highincidence of non-alcoholic fatty liver diseases in female obesesubjects, long-term complications of liver failure becomes morecommon despite presence of hepatoprotective activity offibroblast growth factor-21 and omentin-1 (2). Thus, I/R is acommon clinical condition such as organ transplantation,hepatectomy for cancer complications and shock (3).
In addition to acute liver injury, liver I/R causes remote organdamage such as kidney, heart, lung (4). Thus, acute kidney injury(AKI) was frequently found in patients with acute liver failure,considered as a serious clinical problem during the perioperativeperiod increasing patients’ morbidity and mortality (5).
AKI was evident within 24 hours after liver I/R in mice andwas attributed to intra-renal vasoconstriction resulted fromsplanchnic vasodilatation following portal hypertension (6).Also, systemic inflammatory response after I/R may be anothercausal factor of such remote organ damage (7).
Previously, Arduini et al. (8) reported that ischemia couldimpair mitochondrial antioxidant defences, thereby, enhancing thepossibility of oxidative stress, and altering many enzymes such asheme oxygenase 1 (HO1). HO1 may prevent early injury in thereperfused organ, and could inhibit immune reactive cellsactivation, thereby ameliorating an antigen-independent I/R injury(9). Further, HO1 could be involved in mitochondrial qualitycontrol in term of mitochondrial biogenesis and autophagy (10).
In addition to cell necrosis after I/R injury, autophagy wasfound to play an important role in distant organ damagefollowing warm or cold I/R (11).
JOURNAL OF PHYSIOLOGY AND PHARMACOLOGY 2019, 70, 5, 765-778www.jpp.krakow.pl | DOI: 10.26402/jpp.2019.5.12
N.N. LASHEEN1, W.M. ELAYAT2, M.F.M. ELREFAI3,4, W.S. ZAKI2, E.H. AHMED3, R.M.N. EL SHEIKH5, D.S.A. ABO RAYA5, F.R.S. GAD5
POSSIBLE ROLE OF GARLIC OIL IN AMELIORATING RENAL INJURY AFTER LIVER ISCHEMIA/REPERFUSION IN RATS
1Department of Physiology, Faculty of Medicine, Ain Shams University, Cairo, Egypt; 2Department of Biochemistry and Molecular Biology, Faculty of Medicine, Ain Shams University, Cairo, Egypt;
3Department of Anatomy and Embryology, Faculty of Medicine, Ain Shams University, Cairo, Egypt; 4Department of Anatomy and Embryology, Faculty of Medicine, Hashemite University, Zarqa, Jordan;
5Undergraduate Medical Students, Faculty of Medicine, Ain Shams University, Cairo, Egypt
Acute liver failure induces renal injury by triggering inflammation and oxidative stress. The heme oxygenase systemhas a preventive role against reperfusion injury, while garlic oil has antioxidants and anti-inflammatory effects. Thisstudy investigated the protective effects of garlic oil pretreatment on remote renal functions after liverischemia/reperfusion (I/R), and clarifying gene expressions of heme oxygenase 1 (HO1), autophagy-related 7 (Atg7)and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1a) in renal tissues. Thirty six adultfemale Wistar rats were randomly divided into control, garlic oil-supplemented, liver I/R, and garlic oil-pretreated liverI/R groups. Liver ischemia was performed in anesthetized rats for 45 min, followed by reperfusion for 24 hours inmetabolic cages. Serum samples were used for determination of liver enzymes and creatinine levels and totalantioxidant capacity (TAC). Urine samples were assayed for albumin, volume and creatinine concentration. Right liverlobe and right kidney specimens were used for determination of oxidative stress markers (colorimeterically). Also,gene expressions of HO1, Atg7 and PGC1a were investigated in right kidney specimens using real time PCR. Leftkidney specimens were used for histopathological studies. Liver I/R group exhibited higher liver enzymes andcreatinine levels in serum, prominent oxidative stress in both liver and renal tissues, albuminuria, lowered GFRderanged renal structure, and upregulated HO1, Atg7 and PGC1a gene expressions in renal tissues. Garlic oil-pretreated I/R group restricted such detrimental changes in renal functions and structure, though it caused furtherupregulation of the studied gene expression in renal tissue to alleviate the oxidative stress. It is concluded that garlicoil exerted reno-protective effected against remote organ damage induced by liver I/R injury, through enhancing HO1,Atg7 and PGC1a gene expressions.
K e y w o r d s : garlic oil, heme oxygenase 1, ischemia/reperfusion, kidney, liver, mitochondrial autophagy, oxidative stress,peroxisome proliferator-activated receptor gamma coactivator 1-alpha
Mitochondrial biogenesis, which is a crucial and dynamicprocess for reactive oxygen species (ROS) production in manyconditions, is regulated by peroxisomal proliferator activatorreceptor gamma coactivator-1alpha (PGC1a) (12). In oxidativestress, there are lowered mitochondrial biogenesis and inhibitedautophagy accumulating small dysfunctional mitochondriatogether with higher ROS production and deficient adenozyno-5’-trifosforan (ATP) production.
However, controversial studies on the status of autophagy inliver I/R are present (11, 13). So, it is important to investigatesome autophagy markers in remote renal injury following liverI/R insult, and to shed more light on the associated changes inHO1 and PGC1a.
As natural antioxidant compounds are preferred to controldiseases rather than synthetic ones (14), garlic (Allium sativum)has been known for its antioxidant properties (15). The four mostimportant organosulfur compounds, suggested to be the majorbiological agents, are diallyl sulfide (DAS), diallyl disulfide(DADS), diallyl trisulfide (DATS) and allylmethyl trisulfide(16). Shaik et al. (17) demonstrated that diallyl sulfide couldprotect the liver from I/R by reducing oxidative stress through,at least in part, induction of HO1 (9).
Up to the authors’ knowledge, the reno-protective effects ofgarlic oil pre-treatment prior to liver I/R injury through alteredHO system and mitochondrial-regulating genes in terms ofbiogenesis and mitophagy has not been studied before.
The aim of this study is to investigate the effects of garlicoil pretreatment prior to liver I/R on the remote renal changesin rats. Also, it investigated the possible role of garlic oil inaltering some mitochondrial related gene expression in suchstate.
MATERIALS AND METHODS
Animals
This study was performed on 36 adult female Wistar rats,initially weighing 180 – 250 g, purchased from animal farm,Giza. The care of the experimental animals adopted the NationalInstitutes of Health guidelines for the human use of laboratoryanimals. Rats were housed in animal cages (4/cage) with suitableventilation, temperature of 22 – 25°C, normal light dark cycleand free access to food and water ad libitum in the Animal Houseof Medical Ain Shams Research Center, Faculty of Medicine,Ain-Shams University (MASRI) in Cairo.
After one week of acclimation, surgical procedure wasrun under anesthesia to avoid induction of pain in animals.Rats were not exposed to unnecessary pain or stress, andanimal manipulation was performed with maximal care andhygiene.
All animal experiments were performed according to theNational Institutes of Health guide for the care and use ofLaboratory animals (NIH Publications No. 8023, revised 1978).
At the end of experiment, rats were killed by overdose ofanesthesia and animal remains disposal occurred by incineration.
Rats were randomly divided into four groups (9 rats in eachgroup):
1) Control (sham-operated group): rats were supplementedby distilled water by gavage for 2 weeks, then they wereexposed to I/R procedure without clamping of bloodvessels (they were served as negative control group).
2) Garlic oil-supplemented group: they received garlic oil(Sigma-Aldrich) in a dose of 5 ml/kg/day by gavage (18)for 2 weeks, thereafter; they were exposed to I/Rprocedure without clamping of blood vessels (served aspositive controls).
3) Liver ischemia/reperfusion group: rats were exposed toliver I/R procedure.
4) Garlic oil-pretreated liver ischemia/reperfusion group:rats were pretreated with garlic oil in a similar dose to thatof garlic oil supplemented group. Thereafter, they wereexposed to liver I/R procedure.
Garlic oil preparation
Garlic oil is mostly prepared by steam-distillation processfor medical purposes. Steam-distilled garlic oil consists of thediallyl, allylmethyl, and dimethyl mono to hexa sulfides (19).
Experimental procedures
Liver ischemia/reperfusion procedure: the overnight fastedrats were weighed and anesthetized by i.p. injection of xylazine(EPICO) (10 mg/kg) and ketamine hydrochloride (EPICO) (100mg/kg) (20). A midline laparotomy was made using minimaldissection. Total hepatic ischemia was induced for 45 min byclamping the hepatic artery, the portal vein and the bile ductusing a microvascular clamp (21). During the period of hepaticischemia, the abdominal cavity was closed with clamps. Then,the microvascular clamp was removed allowing reperfusion ofhepatic tissue for 24 hours to study the late phase of liver I/R(22). Following reperfusion, the animals received 5 ml ofwarmed (body temperature) normal saline intraperitoneally andthe incision was closed in two layers. The ani mals subsequentlyrecovered at room temperature (23). Thereafter, all rats werekept in metabolic cages (Courtesy of Pharmacology Department,Faculty of Medicine, Ain Shams University) during thereperfusion period to collect the urine samples for subsequentassays.
During the last hour of reperfusion period, overnight fastedrats were weighed and anaesthetized with i.p. injection ofpentobarbitone (40 mg/kg b.w.). When the stage of surgicalanaesthesia has been reached, judged by loss of withdrawalreflexes, an abdominal midline incision was performed.Abdominal aorta was cannulated using polyethylene catheter,blood samples were collected into serum clot activator tubeswith gel. These tubes were left for 30 minutes in roomtemperature, then, centrifuged at 3000 rpm for 15 minutes. Theseparated serum samples were used for subsequentdetermination of renal and liver functions and total antioxidantscapacity (TAC).
Right lobe of liver and right kidney specimens, also, weredissected and were preserved at –80°C for subsequentdetermination of oxidative stress markers, namely MDA andmitochondrial NAD+, in addition to assay of gene expressionlevels of HO1, PGC1a and autophagy-related gene 7 (Atg7) inright kidney specimens.
Also, left kidney specimens from all studied groups wereused for histopathological examination.
Serum samples were used for assessment of the levels ofalanine transaminase (ALT), and aspartate transaminase (AST)using kinetic kits supplied by ELI TECH (France), andcreatinine level was colorimeterically assayed in sera and urinesamples using kits supplied by Biosystem S.A (Costa Brava,Spain). Assessment of urinary albumin was performed usingcolorimetric kits supplied by ELI TECH (France). TAC wasperformed using colorimetric kits, supplied by Biodiganostic(Egypt). All assays were performed according to themanufacturer’s instructions.
GFR was calculated by creatinine clearance over 24 hours as(U creatinine X V)/P creatinine, where U creatinine and Pcreatinine are urinary and sera creatinine levels, respectively,and V is urinary flow rate (24).
766
Evaluation of mitochondrial nicotinamide adeninedinucleotide+ in hepatic and renal tissues
Mitochondria isolation was carried out from stored frozen at–80°C hepatic and renal tissues, according to Saleh and Saleh(25). The nicotinamide adenine dinucleotide+ (NAD+) wasmeasured after perchloric acid extraction. In the case of isolatedmitochondria, 0.1 ml of 21% (v/v) perchloric acid was added to1 mg of protein/ml suspensions. The NAD+ concentrations in theperchloric acid were measured using an alcohol dehydrogenasereaction. The reaction mixture contained 1000 µL of buffersubstance (0.1 M Tris acetate, pH 8.8, and 0.5 M ethanol), 100µL of the tissue extract neutralized, and 20 µL of alcoholdehydrogenase. The change of absorbance at 340 nm wasrecorded by a spectrophotometer.
Determination of liver and renal tissue malondialdehyde levels
Determination of liver and renal tissue malondialdehydelevels was performed using colorimetric kit supplied fromBiodiagnostic (Egypt). Prior to dissection, both tissues wereperfused with a phosphate buffered saline (PBS) solution, pH7.4, containing 0.16 mg /ml heparin to remove any red bloodcells and clots. The tissues were homogenized in 5 ml coldbuffer (50 mM potassium phosphate, pH 7.5.) per gram tissue.Then, the samples were centrifuged at 4000 r.p.m for 15 minutesusing cold centrifuge. The supernatant was removed and storedat –80°C till the day of assay. Thiobarbituric acid (TBA) reactswith malondialdehyde (MDA) in acidic medium at temperatureof 95°C for 30 min to form thiobarbituric acid reactive product.The absorbance of the resultant pink product in each sample wasmeasured at 534 nm against its sample blank.
RNA isolation from renal tissue and quantitative real-time PCR(qRT-PCR)
Equally weighed frozen renal tissues were homogenized inPBS, pH 7. The total RNA was extracted using TRIzol reagent(Invitrogen) (Fischer Scientific cat no 15596026), then theconcentration and purity of RNA were determined by NanoDrop1000 spectrophotometer. One µg of RNA was reversetranscribed for cDNA synthesis with QuantiTect® ReverseTranscription kit (QIAGEN, Germany, Cat no 205311). qRT-PCR was performed for HO1, PGC1a and Atg7 genes using Fast
SYBR Green master mix (Qiagen Germany, Cat no. 204141),and 5 plex rotor gene ™ system (Qiagen) according tomanufacturer’s instructions.
The primers for HO1 and PGC1a were designed andpurchased from Macrogen, (Seoul, Korea). The primerssequence of the HO1 and PGC1a genes are displayed in Table 1.Meanwhile Atg7 was purchased from Qiagen, Germany (SGquantiTect primer; cat no. 249900; assay ID:QT0008974), also,b-actin gene, the reference gene was purchased from Qiagen,Germany (HS_ACTB_1 quantiTect primer; cat no. 249900;assay ID:QT000954 31). The cyclic conditions of QuantiTectSYBR Green PCR are shown in Table 2.
The expression of the target genes was defined based on thecycle threshold (Ct), their expression levels were calculated as 2–DD
Ct after normalization to relative expression of b-actin gene (26).
Histopathological studies
The left kidney specimens (1 × 3 mm) were takenimmediately after sacrifice, and were immediately dipped in 4%glutaraldehyde for two hours. Then, they were washed inphosphate buffer at pH 7.3, and were kept in the refrigerator at4°C for 24 hours. The kidney specimens were post-fixed in 1%osmium tetraoxide for 2 hours, and then they were dehydrated inascending grades of ethyl alcohol. Thereafter, they were clearedin propylene oxide and were finally embedded in spur premix at60°C for 48 hours (27). Ultrathin sections were cut and mountedon grids. Contrast was enhanced in ultrathin sections by using asaturated solution of uranyl acetate in 50% alcohol followed bylead citrate. Examination by electron microscope was performedusing multiple fields of interest and multiple animals in eachgroup. The sections were examined using Philips 200 electronmicroscope in the Anatomy Department, Faculty of Medicine,Ain Shams University in Cairo.
Statistical analysis
The results are expressed as mean ± SE of the mean.Statistical Package for the Social Sciences (SPSS, Inc., Chicago,IL, USA) program, version 20.0 was used to comparesignificance between each two groups. One-way ANOVA fordifference between means of different groups was performed onthe obtained results, using post-hoc test. Differences wereconsidered significant when P £ 0.05. Also, two-way ANOVA
767
Gene Sequence Accession number
HO1 F: ‘CACCAGCCACACAGCACTAC R: CACCCACCCCTCAAAAGACA NM_012580
PGC1α F:GCGCTCTCGTTCGAGATCCTTTTC R:GCGGTGTCTGTAGTGGCTTGATTC NM_031347
Table 1. Gene sequences for the assayed gene expressions in this study.
Step Time Temperature PCR initial activation step 15 min 95ºC Step Cycling: Denaturation Annealing Extension
15 s 30 s 15 s
94ºC
50 – 60ºC 72ºC
Number of cycles 35 – 45 cycles
Table 2. Cycling conditions of QuantiTect SYBR green PCR.
768
0
20
40
60
80
100
120
140
160
180
Serum ALT level Serum AST level
Liver Function Changes
Control group Garlic oil-supplemented group
Liver I/R group Garlic oil-Pretreated Liver I/R group
a
b
a
b
(U/ L)
Fig. 1. Changes in liver functions inthe different studied groups. (a):Significance by LSD at P < 0.05 fromthe control group; (b): Significance byLSD at P < 0.05 from liver I/R group.
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
0,9
(mg/ dL) Serum Creatinine Level
a
b
0
2
4
6
8
10
12
14
16
Control groupGarlic oil-supplemented groupLiver I/R groupGarlic oil-Pretreated Liver I/R group
a
a
(ml/ min) Changes in Creatinine Clearance
0
1
2
3
4
5
6
7
8
9
10
(g/L) Urinary Albumin Level
a
b
Fig. 2. Changes in renal functions in the different studied groups. (a): significance by LSD at P < 0.05 from the control group; (b):significance by LSD at P < 0.05 from liver I/R group.
for difference between means of different groups was used todemonstrate the effects of liver I/R and garlic oilsupplementation on some parameters.
RESULTS
Changes in liver enzymes
As shown in Fig. 1, compared to the control rats, liver I/Rgroup exhibited a significant rise in serum levels of ALT andAST (P < 0.001 for each). On the other hand, garlic oil-pretreated I/R group had significantly reduced serum ALT andAST levels, compared to untreated liver I/R group (P < 0.001 foreach). When comparing garlic oil-pretreated liver I/R group andthe controls, non-significant changes of serum ALT and ASTlevels were observed. Similarly, garlic oil-supplemented groupand control ones had insignificant changes in liver enzymes.
Assessment of distant effects of liver ischemia/reperfusion onthe kidney
Liver I/R group exhibited significantly higher serumcreatinine level compared to the control rats (P < 0.001),however, garlic oil-pretreated liver I/R had significantly loweredserum creatinine level compared to the untreated liver I/R group(P < 0.001), as shown in Fig. 2. Urinary albumin level wassignificantly elevated in untreated liver I/R group compared tothe controls (P < 0.001). However, it was significantly reducedin garlic oil-pretreated liver I/R group compared to liver I/Rgroup (P < 0.001). Non-significant changes in serum creatinineand urinary albumin levels were observed when comparingeither garlic oil-supplemented or garlic oil-pretreated liver I/Rgroup to the control rats, as shown in Fig. 2.
In addition, a significant reduction in creatinine clearance, asa test of glomerular filtration rate (GFR), was observed inuntreated and treated liver I/R groups when each one wascompared to control rats (P < 0.001 for each). However, creatinineclearance was insignificantly changed in garlic oil-pretreated liverI/R group compared to liver I/R group, as shown in Fig. 2.
Changes in oxidative stress markers
Hepatic tissue MDA and mitochondrial NAD+ levels weresignificantly elevated in liver I/R group compared to the controlones (P < 0.002, P < 0.001 respectively), while they weresignificantly lowered in garlic oil-pretreated liver I/R groupcompared to liver I/R group (P < 0.005, P < 0.01 respectively),despite a significantly higher hepatic tissue mitochondrial NAD+
compared to the control rats (P < 0.02). Similarly, liver I/R ratsexhibited significantly higher renal tissue MDA and mitochondrialNAD+ levels compared to the control rats (P < 0.001, P < 0.01respectively). Meanwhile, garlic oil-pretreated liver I/R group hadsignificantly lowered renal tissue MDA and NAD+ levelscompared to the untreated liver I/R group (P < 0.002 for each), inspite of a significantly higher renal tissue mitochondrial NAD+ (P< 0.02), as shown in Table 3 and Fig. 3. On the other hand, totalantioxidant capacity (TAC) was significantly lower in liver I/Rgroup than the controls (P < 0.02). Meanwhile, it was significantlyelevated in garlic oil-pretreated liver I/R group compared to theuntreated liver I/R rats (P < 0.05), as shown in Table 3.
Changes in mitochondrial related- gene expression in renaltissues
Liver I/R group had up-regulated HO1 gene expression inrenal tissues compared to the control group (P < 0.05). Similarly,garlic oil pre-treated liver I/R group exhibited a significantly
769
Control group Garlic oil-supplemented
group
Liver I/R group Garlic oil-treated liver I/R
group Hepatic tissue MDA (nmol/gm) P P*
650 ± 15.09 706 ± 19.25
NS
1790 ± 105.49
< 0.002
874 ± 81.05
NS < 0.005
Renal tissue MDA (nmol/gm) P P*
880 ± 10.17 906 ± 17.17
NS
2190 ± 85.36
< 0.001
948 ± 21.3
NS < 0.002
TAC in serum (mM/L) P P*
2.67 ± 0.18 2.81 ± 0.12
NS
2.06 ± 0.09
< 0.02
2.55 ± 0.21
NS < 0.05
Renal tissue HO1 (RQ) P P*
0.339 ± 0.063
0.614 ± 0.061
NS
1.094 ± 0.118
< 0.05
5.053 ± 0.587 < 0.001 < 0.001
Renal tissue PGC1α (RQ) P P*
2.093 ± 0.472
3.643 ± 0.37 NS
19.983 ± 3.564 < 0.01
62.614 ± 7.783 < 0.001 < 0.001
Renal Tissue Atg7 (RQ) P P*
0.589 ± 0.128
1.925 ± 0.192 NS
3.222 ± 0.465 < 0.05
15.848 ± 1.841 < 0.001 < 0.001
Table 3. Changes in hepatic and renal tissues MDA (nmol/gm), total antioxidants capacity (TAC) in serum (mM/L) and renal tissuegene expression of HO1, PGC1and Atg7 (RQ) in the different studied groups.
P, significance by LSD at P < 0.05 from the control group; P*, significance by LSD at P < 0.05 from liver I/R group.
higher HO1 gene expression in the renal tissues compared toeither untreated liver I/R group or control group (P < 0.001 foreach), as shown in Table 3 and Fig. 3.
PGC1a, being an important factor for induction ofmitochondrial biogenesis, was significantly upregulated in renaltissues in liver I/R group compared to the controls (P < 0.01).Similarly, garlic oil-pretreated liver I/R group showedsignificantly enhanced expression of PGC1a in renal tissuescompared to either the controls or the untreated liver I/R group(P < 0.001 for each), as shown in Table 3.
On the other hand, Atg7 expression in renal tissues, being anindicator of mitophagy, was significantly elevated in the liverI/R group compared to the controls (P < 0.05). Also, it wassignificantly enhanced in the garlic oil-pretreated liver I/R groupcompared to the liver I/R group (P < 0.001), as shown in Table 3and Fig. 3.
It was noted that garlic oil-supplemented rats hadupregulated renal tissue HO1, PGC1a and Atg7 compared to thecontrols, though they did not reach the statistical level ofsignificance, as shown in Table 3 and Fig. 3.
By using two-way ANOVA, it was found that garlic oilpretreatment caused significant lowering of serum creatinine andurinary albumin levels when compared to I/R operation. Also,garlic oil pretreatment significantly elevated GFR compared toI/R operation, as shown in Fig. 4. Similarly, all studied
mitochondria-related gene expressions in renal tissue (HO1,Atg7 and PGC1a) were significantly enhanced by garlic oilpretreatment compared to I/R operation, as shown in Fig. 5.
Histological results
Electron microscopic examination of renal sections of thecontrol group showed appearance of normal ultrastructure of therenal tubular epithelium with thin basal lamina, nuclei appearedeuchromatic with marginally arranged chromatin and prominentnucleolus, mitochondria appeared elongated and spherical inshape, and brush border with apical microvilli were obvious(Fig. 6A). By further magnification, the normal ultrastructure ofthe renal tubular epithelium had numerous mitochondria whichappeared spherical and elongated with prominent cristae. Thebrush border with microvilli was prominent (Fig. 6B). Theultrastructure of glomerulus in the control rats showed capillarytufts containing red blood cells, and the podocytes appearedclearly with intact foot processes (Fig. 7). Further magnificationshowed the normal structure of the filtration membrane;capillary fenestrations, thin glomerular basement membrane andpodocyte foot processes were clearly evident (Fig. 8).
Garlic supplemented group (positive control group) had thesame arrangements of renal tubules and glomeruli as negativecontrol group.
770
0
5
10
15
20
25
30
35
40
45
Liver tissue Mitochondrial NAD+ Renal Tissue Mitochondrial NAD+
Oxidative Stress Markers
Control group Garlic oil-supplemented group
Liver I/R group Garlic oil-Pretreated Liver I/R group
a
a, b
a
a, b
(nmol/mg tissue protein)
0
2
4
6
8
10
12
Renal tissue HO1 gene expression Renal Tissue Atg7 gene expression
Mitochondrial-related Gene Expression in Renal Tissues
Control group Garlic oil-supplemented group
Liver I/R group Garlic oil-Pretreated Liver I/R group
a
a, ba
a, b(RQ)
aFig. 3. Changes in mitochondrialNAD+ in hepatic and renal tissuesand renal tissue HO1 and Atg7gene expressions in the differentstudied groups. (a): Significanceby LSD at P < 0.05 from thecontrol group; (b): Significanceby LSD at P < 0.05 from liver I/Rgroup.
Electron microscopic examination of renal sections of liverI/R group revealed thickening of basal lamina of the renaltubular epithelium heterochromatic nuclei with peripheralclumped chromatin and indented nuclear membrane, in additionto small numerous mitochondria and cytoplasmicautophagosomes (Fig. 9A and 9B). With further magnification,degenerative changes in mitochondria appeared, somemitochondria with indistinct cristae were noticed (Fig. 10).Electron microscopic examination of the glomeruli of liver I/Rgroup showed abnormal glomerular ultrastructure, effacement ofpodocyte foot processes with occluded filtration slits andcongested blood capillaries (Fig. 11).
Electron microscopic examination of kidney sections ofgarlic oil-pretreated liver I/R group showed restoration ofnormal ultrastructure of the renal tubular epithelium. The nucleiappeared euchromatic with marginally arranged chromatin, andnormal nuclear membrane were noticed. Numerousmitochondria appeared, which were spherical and elongated inshape, in addition the brush border with apical microvilli was
present, with congested blood capillaries (Fig. 12). By furthermagnification, numerous mitochondria appeared elongated andspherical shape enclosed within the basal infoldings with normalappearance of mitochondrial cristae (Figs. 13 and 14) andcytoplasmic autophagosomes were seen. The normal glomerularultrastructure in this group was observed, with appearance of thecapillary tufts containing red blood cells and clearly presentpodocytes with normal foot processes (Fig. 15).
DISCUSSION
This study demonstrated that liver I/R induced remote acuterenal failure, renal tubular and glomerular damage andprominent oxidative stress. Pretreatment with garlic oil prior toliver I/R exhibited reno-protective and antioxidant effects.
The higher liver enzymes in liver I/R group, herein, aresimilar to Atef et al. (28), and could be attributed to the effect ofreperfusion injury in early and late phases. During the early
771
Fig. 4. Changes in parameters of renal function in the differentstudied groups using two way ANOVA to demonstrate theinteraction between I/R operation and garlic oil supplementation.
Fig. 5. Changes in mitochondrial gene expression in renal tissuesin the different studied groups using two way ANOVA todemonstrate the interaction between I/R operation and garlic oilsupplementation.
phase, the first 2 hours after reperfusion, Kuppfer cells areactivated (29), in addition to enhancement of the production ofROS and cytokines, namely tumor necrosis factor-a andinterleukin-1 (30). While in the late phase of reperfusion, theactivated neutrophils release more ROS and more proteasescausing extensive oxidative stress (31). Thus, the use of 24 hours
period as reperfusion period, herein, was to demonstrate distanteffects of I/R injury by the intense oxidative stress of the latestage of reperfusion. Fully unexpected, the elevatedmitochondrial NAD+ in liver tissues in liver I/R group, in thisstudy, could be explained according to Jaeschke (32) to theexistent oxidative stress. It was suggested that oxidative stress
772
A
B
Fig. 6. An electromicrograph of a section of rat kidney of thecontrol group showing:(A): the normal ultrastructure of the renal tubular epithelium.Note the normal basal lamina (L), euchromatic nuclei (N) withmarginally arranged chromatin and prominent nucleolus (n),numerous mitochondria (M) elongated and spherical in shapeand the brush border with apical microvilli (B). (Uranyl acetateand lead citrate ×1500);(B): Further magnification of electromicrograph A showing thenormal ultrastructure of the renal tubular epithelium. Note theeuchromatic nucleus (N) with marginally arranged chromatin,numerous mitochondria (M) with prominent cristea and thebrush border (B) (Uranyl acetate and lead citrate × 6000).
Fig. 7. An electromicrograph of a section of rat kidney of thecontrol group showing normal glomerular ultrastructure. Noticecapillary tuft (C) containing red blood cells (c), podocytes (P)with foot processes (arrow head). (Uranyl acetate and leadcitrate × 1000).
C
P
c
*
Fig. 8. Further magnification of the previouselectromicrograph showing normal glomerular ultrastructure.Notice capillary tuft (C) containing red blood cells (c),podocytes (P) with foot processes (arrow head). Note thenormal structure of the filtration membrane; capillaryfenestrations (arrow), thin glomerular basement membrane (*)and podocyte foot processes (arrow head). (Uranyl acetate andlead citrate × 2000).
might induce the formation of membrane permeability transitionpores and the breakdown of the mitochondrial membranepotential causing cellular death (33).
The normalized liver enzymes in sera of garlic oil-pretreatedliver I/R rats, herein, are in accordance to Sener et al. (34). This
protection could be due to the garlic extract’s ability to preserveI/R-induced liver damage, through anti-inflammatory and immunemodulatory effects (35). Also, the observed hepatoprotectiveeffects of garlic oil were manifested, herein, as lowering of MDAand mitochondrial NAD+ levels in the liver tissues.
773
A
B Fig. 9. An electromicrograph of a rat kidney section of liver I/Rgroup showing:(A): the renal tubular epithelium with thickened basal lamina(L), heterochromatic nuclei (N) with peripheral clumpedchromatin and indented nuclear membrane (arrow), numerousmitochondria (M) and vacuolization (V). (Uranyl acetate andlead citrate × 1000).(B): the renal tubular epithelium with basal lamina (L), nucleuswith irregular nuclear membrane (arrow). Some mitochondria(M) show degenerative changes and indistinct cristae (arrowhead). (Uranyl acetate and lead citrate × 3000).
Fig. 10. Further magnification of the previous electromicrographshowing the renal tubular epithelium with thick basal lamina (L),nucleus with irregular nuclear membrane (arrow). Somemitochondria show degenerative changes (M) and indistinctcristae (arrow head) degenerative changes (arrow head) andindistinct cristae (*); (Uranyl acetate and lead citrate × 6000).
Fig. 11. An electromicrograph of a rat kidney section of liver I/Rgroup showing abnormal glomerular ultrastructure. Notice thethickened basement membrane (*) and effacement of podocytefoot processes with occluded filtration slits (arrow head).Congested capillaries (C) are noticed. (Uranyl acetate and leadcitrate × 1000).
Additionally, liver I/R group, herein, exhibited renalimpairment manifested as higher serum creatinine level,albuminuria, and reduced GFR compared to the controls. Thesefindings are in accordance to Jochmans et al. (36). This remoteacute kidney injury could be due to the systemic inflammationprovoked by liver I/R (37). In support, cytokines and growthpromoting factors were elevated in impaired lymph flow fromthe liver in rats (38). The released inflammatory mediators couldaffect endothelial cell adhesion molecules as P selectin andICAM-1 in the kidney (39). Also, this renal damage in theuntreated liver I/R, herein, could be due to the oxidative stress,which was evident by higher renal tissue MDA andmitochondrial NAD+, and lowered TAC.
Meanwhile, HO1 gene expression in renal tissues wasupregulated in liver I/R group, similar to Tanaka et al. (37). Thiseffect could be explained by ROS-induced enhanced stress geneexpression, as an attempt to control the coexistent oxidativestress (40). This finding could be, also, attributed to the ability ofinducible isoform of HO (HO1) to regulate inflammation. Thus,overexpressed HO1 in oxidative stress could scavenge peroxyradicals, and might inhibit lipid peroxidation (41). Also, HO1hasanti-inflammatory effects through release of carbon monoxide(CO), by its catabolic action, thereby mediating anti-apoptoticeffects (42). Therefore, these known cytoprotective effects ofHO1 limited the severity of renal impairment, herein (43).
Further, the histopathological renal changes present in liverI/R group, herein, could explain the present renal impairment.The lowered GFR could be attributed to the observed thickeningof the glomerular basement membrane, and to effacement ofpodocyte foot processes occluding filtration slits, whilealbuminuria could be due to the observed tubular damage inthese rats in the form of damaged microvilli of the brush borderof the renal tubular epithelium, in agreement with Han et al.(44). In line, Lee et al. (45) demonstrated that liver I/R in micedeveloped renal morphological changes in the form of focal
proximal tubular cell necrosis, cytoplasmic autophagosomes,dilated lumina and granular cast formation. On the contrary,Polat et al. (46) found no overt renal injury under light andelectron microscopy after liver I/R. However, Behrends et al.(22) demonstrated that severe hepatic ischemia resulted in amoderate impairment of renal function in rats without renalinflammatory response and morphological renal damage. This
774
Fig. 12. An electromicrograph of a section of rat kidney of garlicoil-pretreated liver I/R group showing normal ultrastructure ofthe renal tubular epithelium, and normal basal lamina (L),euchromatic nuclei (N) and marginally arranged chromatin,normal nuclear membrane integrity (arrow), numerousmitochondria (M) spherical in shape, and the brush border withapical microvilli (B). (Uranyl acetate and lead citrate × 1500).
A
A
B Fig. 13. An electromicrograph of a section of rat kidney of garlicoil-pretreated liver I/R group with further magnificationshowing:(A): normal ultrastructure of the renal tubular epithelium withnormal of basal lamina (L), euchromatic nuclei (N) withprominent nucleolus (n) and marginally arranged chromatin,restoration of nuclear membrane (arrow), numerousmitochondria (M) which are elongated and spherical in shapeenclosed within the basal infolding, and the brush border withapical microvilli (B). Note blood vessels still congested (C).(Uranyl acetate and lead citrate × 3000);(B): with further magnification, there is normal ultrastructure ofthe renal tubular epithelium with euchromatic nuclei (N) withmarginally arranged chromatin, numerous mitochondria (M) andnormal appearance of mitochondrial cristea (arrow). (uranylacetate and lead citrate × 4000).
discrepancy could be due to the age of the used animals, theduration of ischemia and/or the reperfusion period.
Another possible explanation of deranged renal morphologyand impaired renal function in liver I/R group, herein, ismitochondrial dysfunction according to Kubli and Gustafsson(47). These rats had mitochondrial degenerative changes andminimal mitochondrial cristal damage in renal tissues, similar toAtes et al. (48). These mitochondrial changes could be mediatedby oxidative injury and apoptosis (49). In support,microelements such as zinc protected against gentamicin-induced acute renal failure (50).
Another mitochondrial biogenesis-related gene, PGC1a,was higher in renal tissues of liver I/R group, herein. Itincreases mitochondrial DNA synthesis, and a key regulator ofmitochondrial functions, oxygen consumption and ATPproduction, in addition to stimulating mitochondrialbiogenesis (51).
Interestingly, examination of renal tissues by electro-microscope, herein, revealed presence of autophagosomes,formation of a double-membrane vesicle by autophagy. Theseautophagosomes could engulf cytoplasmic components, anddeliver them to lysosomes for degradation (52). Also, theupregulated Atg7 gene expression in renal tissue in liver I/Rgroup, herein, could result from higher ROS production by I/Rinjury (53). Atg7 was found to induce autophagy which may beselective to mitochondria, known as mitophagy (54). Thus, liverI/R induced mitophagy in renal tissues as a protectionmechanism by removing and recycling of damagedmitochondria (55).
On the other hand, garlic oil pretreatment, herein, exertedreno-protective effects in accordance to Elkhoely and Kamel(56). This protection could be mediated by enhancingantioxidant defense and reducing the inflammatory cytokinestissue levels, as well as, inhibition of apoptosis by diallyl sulfide,a natural organosulfur compound in garlic. The anti-inflammatory properties of garlic extracts occur through
reducing the actions of proinflammtory cytokines and nitricoxide overproduction, and cyclooxygenase-2 expression (57).Also, garlic oil pretreatment, herein, caused a near normal renaltubular and glomerular ultrastructure, which could explain thedecline in albuminuria and serum creatinine levels in addition tothe non-significant rise of GFR in garlic oil-pretreated liver I/Rgroup. Similarly, Bagheri et al. (58) demonstrated that garlicpretreatment 24 hour and 15 minutes before renal I/R in ratsprevented renal functional and histological injuries mediated bythe antioxidant potentials of garlic.
The higher expression of HO1 in renal tissues of garlic oil-pretreated liver I/R rats, herein, is in accordance to Seetharamanet al. (57). The HO system was suggested to exert three majorfunctions in I/R injury: antioxidant effects; maintenance ofmicrocirculation; and modulatory effects upon the cell cycle.The antioxidant functions depend on heme degradation, oxygenconsumption and the production of biliverdin/ferritin via ironaccumulation, while tissue microcirculation is preserved by thevasodilator CO production. Thus, the higher HO1 geneexpression in renal tissues prevented the early injury duringreperfusion period, and inhibited the function of activatedimmune cells according to Katori et al. (9).
In line, Seetharaman et al. (57) reported that garlic oil-induced up-regulation of HO1gene expression in activatedmacrophages proved the anti-inflammatory effects of garlicextract. Thus, it could be suggested that upregulated HO1 inrenal tissues, herein, had many cytoprotective effects, herein,through its anti-inflammatory, anti-apoptotic and anti-proliferative actions (59).
Similar to Hull et al. (60), upregulated HO1 gene expressionin garlic oil-pretreated rats, herein, was, also, combined withhigher expression of PGC1a, to enhance mitochondrialbiogenesis in renal tissues denoted by the numerous and near-normal mitochondrial structure in these rats. Higher HO1expression enhances mitochondrial biogenesis by increasing theexpression of nuclear respiratory factor 1 (NRF1) and its co-
775
Fig. 14. Further magnification of the previous electromicrographof a section of rat kidney of garlic oil-pretreated liver I/R groupshowing mitochondria (M) which are either elongated orspherical in shape with intact mitochondrial cristae (c). Note thenucleus (N). (Uranyl acetate and lead citrate × 4000).
Fig. 15. An electromicrograph of a rat kidney section of garlicoil-pretreated liver I/R group showing gain of normal glomerularultrastructure. Notice capillary tuft (C) containing red bloodcells (c), podocytes (P) with normal foot processes (arrow head).(Uranyl acetate and lead citrate × 1500).
activator PGC1a, thereby, upregulating the mitochondrialtranscription factor A expression, allowing the replication of themitochondrial DNA.
Furthermore, the association of enhanced expressions ofAtg7 and HO1 expression agree with Wang et al. (61), thus HO1exerted such renal cytoprotection by stimulating autophagy.Therefore, it could be suggested that garlic oil affectsmitochondrial quality by positively activating the expression ofautophagy protein, Atg7, in renal tissues. In support, Allavena etal. (62) demonstrated a significant transcriptional induction ofAtg7 genes and the related genes coding for proteins involved inthe autophagic pathway, in ovarian endometriosis. Also, theysuggested that these proteins, being recruited in an increasedautophagic flux, could undergo a more rapid turnover, affordedby the autophagic process itself or by different proteolyticmechanisms.
Meanwhile, the oxidative stress was limited in garlic oil-pretreated liver I/R group, herein, evidenced by higher TAC,lowered oxidative stress markers in renal tissues, andpreserved renal mitochondrial structure. These antioxidanteffects could be, also, explained by the upregulated PGC1a inrenal tissues. In support, biogenesis of mitochondria couldmodulate the elevated ROS production by electron transportchain under ischemic conditions (63). Also, Sanchez-Ramos etal. (64) reported that PGC1a has a regulatory role onexpression of antioxidant genes and ROS production in theliver, explaining the hepatocyte tolerance to I/R. In line, Funkand Schnellmann (65) found that PGC1a exerted protectiverole against ischemic injury of cardiac, renal and centralnervous system.
This study is a novel study in demonstrating the ability ofgarlic oil to alter the mitochondrial morphological changes inrenal tissues induced by liver I/R, and normalized renal tissuemitochondrial NAD+ level. Garlic oil attenuated liver I/R-induced renal impairment through enhancing the expression ofHO1, improvement of mitochondrial quality by enhancing somegenes responsible for mitochondrial biogenesis and autophagy inrenal tissue, namely Atg7 and PGC1a.
It is worth noting that the animals used in the current studywere female rats, as female patients survived better than malesafter liver transplantation or hepatocellular carcinoma resection(45). Another possible cause of the choice of female gender,herein, is the more protection of female rats against the injuriouseffects of liver I/R than male rats (66). This gender-specificresponse is due to effective cytokine/chemokine regulation as aninflammatory response to hepatic I/R (67).
From the aforementioned results, it could be concluded thatgarlic oil exerted cyto-protective effects on liver I/R-inducedrenal injury, and this protection could be mediated by HO1enzyme, as well as, modulating mitochondrial related genes,namely Atg7 and PGCa1.
Funding: This study was funded by the authors themselvesonly.
Conflict of interests: None declared.
REFERENCES
1. Hammond JS, Guha IN, Beckingham IJ, Lobo DN.Prediction, prevention and management of postresectionliver failure. Br J Surg 2011; 98: 1188-1200.
2. Waluga M, Kukla M, Zorniak M, et al. Fibroblast growthfactor-21 and omentin-1 hepatic mRNA expression andserum levels in morbidly obese women with non-alcoholicfatty liver disease. J Physiol Pharmacol 2017; 68: 363-374.
3. Land WG. The role of postischemic reperfusion injury andother nonantigen-dependent inflammatory pathways intransplantation. Transplantation 2005; 79: 505-514.
4. Sun H, Zou S, Candiotti KA, et al. Octreotide attenuatesacute kidney injury after hepatic ischemia and reperfusionby enhancing autophagy. Sci Rep 2017; 7: 42701. doi:10.1038/srep42701
5. Arroyo V, Fernandez J, Gines P. Pathogenesis and treatmentof hepatorenal syndrome. Semin Liver Dis 2008; 28: 81-95.
6. Lee HT, Park SW, Kim M and D’Agati VD. Acute kidneyinjury after hepatic ischemia and reperfusion injury in mice.Lab Invest 2009; 89: 196-208.
7. Schepke M. Hepatorenal syndrome: current diagnostic andtherapeutic concept. Nephrol Dial Transplant 2007; 22(Suppl. 8): viii2-viii4. doi: 10.1093/ndt.gfm656
8. Arduini A, Mezzetti A, Porreca E, et al. Effect of ischemiaand reperfusion on antioxidant enzymes and mitochondrialinner membrane proteins in perfused rat heart. BiochimBiophys Acta 1988; 970: 113-121.
9. Katori M, Anselmo DM, Busuttil RW, Kupiec-WeglinskiJW. A novel strategy against ischemia and reperfusioninjury: cytoprotection with heme oxygenase system. TransplImmunol 2002; 9: 227-233.
10. Turkseven S, Drummond G, Rezzani R, et al. Impact ofsilencing HO 2 on EC SOD and the mitochondrial signallingpathway. J Cell Biochem 2007; 100: 815-823.
11. Evankovich J, Zhang R, Cardinal JS, et al.Calcium/calmodulin-dependent protein kinase IV limitsorgan damage in hepatic ischemia-reperfusion injurythrough induction of autophagy. Am J Physiol GastrointestLiver Physiol 2012; 303: G189-G198.
12. Nisoli E, Clementi E, Paolucci C, et al. Mitochondrialbiogenesis in mammals: the role of endogenous nitric oxide.Science 2003; 299: 896-899.
13. Kang JW, Cho HI, Lee SM. Melatonin inhibits mTOR-dependent autophagy during liver ischemia/reperfusion. CellPhysiol Biochem 2014; 33: 23-36.
14. Craig W, Beck L. Phytochemicals: health protective effects.Can J Diet Pract Res 1999; 60: 78-84.
15. Morihara N, Sumioka I, Ide N, Moriguchi T, Uda N, Kyo E.Aged garlic extract maintains cardiovascular homeostasis inmice and rats. J Nutr 2006; 136: 777S-781S.
16. Nicastro HL, Ross SA, Milner JA. Garlic and onions: theircancer prevention properties. Cancer Prev Res 2015; 8:181-189.
17. Shaik IH, George JM, Thekkumkara TJ, Mehvar R.Protective effects of diallyl sulfide, a garlic constituent, onthe warm hepatic ischemia-reperfusion injury in a rat model.Pharm Res 2008; 25: 2231.
18. Hassan HA, El-Agmy SM, Gaur RL, Fernando A, Raj MH,Ouhtit A. In vivo evidence of hepato-and reno-protectiveeffect of garlic oil against sodium nitrite-induced oxidativestress. Int J Biol Sci 2009; 5: 249-255.
19. Lawson LD, Bauer R. Garlic: a review of its medicinaleffects and indicated active compounds. In: Phytomedicinesof Europe. Chemistry and Biological Activity, 1998. Series69 1. Washington DC: American Chemical Society; pp.176-209.
20. Yeboah MM, Xue X, Duan B, et al. Cholinergic agonistsattenuate renal ischemia- reperfusion injury in rats. KidneyInt 2008; 74: 62-69.
21. Sehirli O, Ozel Y, Dulundu E, Topaloglu U, Ercan F, Sener G.Grape seed extract treatment reduces hepatic ischemia-reperfusion injury in rats. Phytother Res 2008; 22: 43-48.
22. Behrends M, Hirose R, Park YH, et al. Remote renal injuryfollowing partial hepatic ischemia/reperfusion injury in rats.J Gastrointest Surg 2008; 12: 490-495.
776
23. Behrends M, Hirose R, Serkova NJ, et al. Mild hypothermiareduces the inflammatory response and hepaticischemia/reperfusion injury in rats. Liver Int 2006; 26: 734-741.
24. Basile DP, Donohoe D, Roethe K, Osborn JL. Renalischemic injury results in permanent damage to peritubularcapillaries and influences long-term function. Am J PhysiolRenal Physiol 2001; 281: F887-F899.
25. Saleh NK, Saleh HA. Protective effects of vitamin E againstmyocardial ischemia/reperfusion injury in rats. Saudi Med J2010; 31: 142-147.
26. Livak KJ, Schmittgen TD. Analysis of relative geneexpression data using real- time quantitative PCR and the 2–DD
CT method. Methods 2001; 25: 402-408.27. Hayat M. Principle and Techniques of Electron Microscopy.
Vol. 1. Van Nostrano Reinhold ltd. 1989, pp. 24-74.28. Atef Y, El-Fayoumi HM, Abdel-Mottaleb Y, Mahmoud MF.
Quercetin and tin protoporphyrin attenuate hepatic ischemiareperfusion injury, role of HO-1. Naunyn-Schmiedeberg’sArch Pharmacol 2017; 390: 871-881.
29. Jaeschke H, Farhood A. Neutrophil and Kupffer cell-inducedoxidant stress and ischemia-reperfusion injury in rat liver.Am J Physiol 1991; 260: G355-G362.
30. Liu TZ, Lee KT, Chern CL, Cheng JT, Stern A, Tsai LY. Freeradical-triggered hepatic injury of experimental obstructivejaundice of rats involves overproduction of pro-inflammatory cytokines and enhanced activation of nuclearfactor kappa B. Ann Clin Lab Sci 2001; 31: 383-390.
31. Jaeschke H. Reactive oxygen and mechanisms ofinflammatory liver injury. J Gastroenterol Hepatol 2000; 15:718-724.
32. Jaeschke H. Xanthine oxidase-induced oxidant stress duringhepatic ischemia-reperfusion: are we coming full circle after20 years? Hepatology 2002; 36: 761-763.
33. Nieminen AL, Byrne AM, Herman B, Lemasters JJ.Mitochondrial permeability transition in hepatocytesinduced by t-BuOOH: NAD(P)H and reactive oxygenspecies. Am J Physiol 1997; 272: C1286-C1294.
34. Sener G, Sehirli O, Ipci Y and Ercan F. Aqueous garlic extractalleviates ischaemia-reperfusion-induced oxidative hepaticinjury in rats. J Pharm Pharmacol 2005; 57: 145-150.
35. Durak I, Kavutcu M, Aytac B, et al. Effects of garlic extractconsumption on blood lipid and oxidant/antioxidantparameters in humans with high blood cholesterol. J NutrBiochem 2004; 15: 373-377.
36. Jochmans I, Meurisse N, Neyrinck A, Verhaegen M,Monbaliu D, Pirenne J. Hepatic ischemia/reperfusioninjury associates with acute kidney injury in livertransplantation: prospective cohort study. Liver Transplant2017; 23: 634-644.
37. Tanaka Y, Maher JM, Chen C and Klaassen CD. Hepaticischemia-reperfusion induces renal heme oxygenase-1 viaNF-E2-related factor 2 in rats and mice. Mol Pharmacol2007; 71: 817-825.
38. Beck B. Transforming growth factor-b1 and tumor necrosisfactor-a concentration in serum during disturbed lymph flowfrom a liver in rats. J Physiol Pharmacol 2017; 68: 91-98.
39. Molitoris BA, Sandoval R, Sutton TA. Endothelial injuryand dysfunction in ischemic acute renal failure. Crit CareMed 2002; 30: S235-S240.
40. Bauer M, Bauer I. Heme oxygenase-1: redox regulation androle in the hepatic response to oxidative stress. AntioxidRedox Signal 2002; 4: 749-758.
41. Stocker R. Antioxidant activities of bile pigments. AntioxidRedox Signal 2004; 6: 841-849.
42. Berberat PO, A-Rahim YI, Yamashita K, et al. Hemeoxygenase- 1-generated biliverdin ameliorates experimentalmurine colitis. Inflamm Bowel Dis 2005; 11: 350-359.
43. Seifi B, Kadkhodaee M, Delavari F, Mikaeili S, Shams S,Ostad SN. Pretreatment with pentoxifylline and N-acetylcysteine in liver ischemia reperfusion-induced renalinjury. Ren Fail 2012; 34: 610-615.
44. Han SJ, Jang H, Seu SY, et al. Hepatic ischemia/reperfusioninjury disrupts the homeostasis of kidney primary cilia viaoxidative stress. Biochim Biophys Acta Mol Basis Dis 2017;1863: 1817-1828.
45. Lee CC, Chau GY, Lui WY, et al. Better post-resectionalsurvival in female cirrhotic patients with hepatocellularcarcinoma. Hepatogastroenterology 2000; 47: 446-449.
46. Polat C, Tokyol C, Kahraman A, Sabuncuoglu B, Yilmaz S.The effects of desferrioxamine and quercetin on hepaticischemia-reperfusion induced renal disturbance.Prostaglandins Leukot Essent Fatty Acids 2006; 74: 379-383.
47. Kubli DA, Gustafsson AB. Mitochondria and mitophagy: theyin and yang of cell death control. Circ Res 2012; 111: 1208-1221.
48. Ates E, Genc E, Erkasap N, et al. Renal protection by briefliver ischemia in rats1. Transplantation 2002; 74: 1247-1251.
49. Jassem W, Heaton ND. The role of mitochondria inischemia/reperfusion injury in organ transplantation. KidneyInt 2004; 66: 514-517.
50. Teslariu O, Pasca AS, Mititelu-Tartau L, et al. The protectiveeffects of zinc in experimental gentamicin induced acuterenal failure in rats. J Physiol Pharmacol 2016; 67: 751-757.
51. Andersson U, Scarpulla RC. PGC-1-related coactivator, anovel, serum-inducible coactivator of nuclear respiratoryfactor 1-dependent transcription in mammalian cells. MolCell Biol 2001; 21: 3738-3749.
52. Nakatogawa H, Suzuki K, Kamada Y, Ohsumi Y. Dynamicsand diversity in autophagy mechanisms: lessons from yeast.Nat Rev Mol Cell Biol 2009; 10: 458-467.
53. Ding W, Yin X. Mitophagy: mechanisms,pathophysiological roles, and analysis. Biol Chem 2012;393: 547-564.
54. Rodriguez-Enriquez S, Kim I, Currin RT, Lemasters JJ.Tracker dyes to probe mitochondrial autophagy (mitophagy)in rat hepatocytes. Autophagy 2006; 2: 39-46.
55. Sciarretta S, Hariharan N, Monden Y, Zablocki D,Sadoshima J. Is autophagy in response to ischemia andreperfusion protective or detrimental for the heart? PediatrCardiol 2011; 32: 275-281.
56. Elkhoely A, Kamel R. Diallyl sulfide alleviates cisplatin-induced nephrotoxicity in rats via suppressing NF-kBdownstream inflammatory proteins and p53/Puma signallingpathway. Clin Exp Pharmacol Physiol 2017; 45: 591-601.
57. Seetharaman R, Park SY, Yoon MK, et al. Heme oxygenase-1-mediated anti-inflammatory effect of a novel garliccompound in RAW264. 7 murine macrophages. HorticEnviron and Biotechnol 2014; 55: 148-157.
58. Bagheri F, Gol A, Dabiri S and Javadi A. Preventive effect ofgarlic juice on renal reperfusion injury. Iran J Kidney Dis2011; 5: 194-200.
59. McDaid J, Yamashita K, Chora A, et al. Heme oxygenase-1modulates the allo-immune response by promotingactivation-induced cell death of T cells. FASEB J 2005; 19:458-460.
60. Hull TD, Boddu R, Guo L, et al. Heme oxygenase-1regulates mitochondrial quality control in the heart. JCIInsight 2016; 1: e85817.
61. Wang Y, Shen J, Xiong X, et al. Remote ischemicpreconditioning protects against liver ischemia-reperfusioninjury via heme oxygenase-1-induced autophagy. PLoS One2014; 9: e98834. doi: 10.1371/journal.pone.0098834
777
62. Allavena G, Carrarelli P, Del Bello B, Luisi S, Petraglia F,Maellaro E. Autophagy is upregulated in ovarianendometriosis: a possible interplay with p53 and hemeoxygenase-1. Fertil Steril 2015; 103: 1244-1251.
63. Fernandez-Marcos PJ, Auwerx J. Regulation of PGC-1alpha, a nodal regulator of mitochondrial biogenesis. Am JClin Nutr 2011; 93: 884S-8890.
64. Sanchez-Ramos C, Tierrez A, Fabregat-Andres O, et al.PGC-1alpha regulates translocated in liposarcoma activity:role in oxidative stress gene expression. Antioxid RedoxSignal 2011; 15: 325-337.
65. Funk JA, Schnellmann RG. Accelerated recovery of renalmitochondrial and tubule homeostasis with SIRT1/PGC-1alpha activation following ischemia-reperfusion injury.Toxicol Appl Pharmacol 2013; 273: 345-354.
66. Lu P, Liu F, Wang CY, et al. Gender differences in hepaticischemic reperfusion injury in rats are associated withendothelial cell nitric oxide synthase-derived nitric oxide.World J Gastroenterol 2005; 11: 3441-3445.
67. Crockett ET, Spielman W, Dowlatshahi S, He J. Sexdifferences in inflammatory cytokine production in hepaticischemia-reperfusion. J Inflamm 2006; 3: 16. doi:10.1186/1476-9255-3-16
R e c e i v e d : September 20, 2019A c c e p t e d : October 30, 2019
Author’s address: Assoc. Prof. Noha N. Lasheen, Departmentof Physiology, Faculty of Medicine, Ain Shams University,Abbassyia, 11566 Cairo, Egypt.E-mail: [email protected]
778