poster 5647 / eposter p1754 # lab no. date received id ... · 6. chowdhary a, sharma c, hagen f,...
TRANSCRIPT
Emergence of Echinocandin Resistance in a Patient with Chronic Pulmonary
AspergillosisCristina Jiménez-Ortigosa1, Caroline Moore2, David W. Denning3 and David S. Perlin1
1Public Health Research Institute-New Jersey Medical School, Newark, NJ, USA2Mycology Reference Centre, Manchester, University Hospital of South Manchester, Manchester UK
3University of Manchester, Manchester, UK
POSTER 5647 / ePOSTER P1754
ABSTRACT RESULTS
Background: Echinocandin drugs inhibit the β-(1,3)-glucan synthase (GS), which is responsible for the synthesis of β-(1,3)-glucan, an essential
component of the fungal cell wall. The echinocandin micafungin exhibits high antifungal activity against Aspergillus spp. in vitro and is effective in clinical
studies against aspergillosis. Micafungin is expected to increase the efficacy rate of treatment in patients with severe aspergillosis when used in
combination with another antifungal drugs such as azoles. Mutations in FKS genes encoding GS enzymes have been linked to echinocandin resistance
(ER) in Candida spp. To date, no ER A. fumigatus isolates showing a characteristic fks mutation have been recovered from patients after exposure to an
echinocandin. The aim of this study was to analyse strains isolated from a patient with an aspergilloma and chronic pulmonary aspergillosis who first
failed azole therapy and then was treated with micafungin. We assessed the presence of an fks1 mutation and its affect on inhibition of GS by different
echinocandin drugs.
Material/methods: Susceptibility testing was performed on twelve A. fumigatus isolates according to the recommendations of CLSI document M38-A2
for two echinocandins drugs (micafungin and caspofungin). fks1 gene was amplified and sequenced for the clinical isolates that showed high MECs for
the echinocandins tested. GS was isolated by product entrapment and activity was assessed by glucan polymerization assay. IC50 values for GS
inhibition were determined using a sigmoidal response curve. The 66-year-old female patient has had a right upper lobe aspergilloma for many years
and presented with life-threatening haemoptysis. She initially responded well to a sequence of triazoles, but then developed pan-azole resistance and
further haemoptysis. She then received 2 years of 6x weekly micafungin 150 mg daily, with terbinafine 500 mg. Additional symptoms heralded failure of
micafungin.
Results: Out of the twelve isolates analysed, only one (24053B) showed an epidemiological cut off value (ECV) ≥ 0.5 µg/ml for echinocandins. The
MECs of this isolate for micafungin and caspofungin were 2 µg/ml, between 16.6-66.6-fold higher MEC than the sensitive strain (ATCC13073). The fks1
gene was fully sequenced and a mutation leading to a F675S amino acid substitution was found in the hot spot 1. β-(1,3)-glucan synthase (GS)
complexes were isolated from the isolate 24053B and the inhibition kinetic value (50% inhibitory concentration [IC50]) was obtained to confirm the ER
phenotype. GS complexes isolated from the isolate 24053B yielded higher IC50 (>10000-fold) for all echinocandins tested relative to wild-type GS
complexes.
Conclusions: The Fks1 point mutation F675S of the A. fumigatus isolate 24053B yielded a β-(1,3)-glucan synthase enzyme with highly reduced
sensitivity to echinocandin drugs resulting in elevated MECs. To date, this is the first reported case of echinocandin resistance due to a point mutation in
the fks1 gene in an A. fumigatus clinical isolate.
INTRODUCTION
Invasive aspergillosis (IA) is a life-threatening mycosis mainly caused by the pathogenic fungus Aspergillus fumigatus. Triazole antifungal drugs
represent first-line therapy for all forms of aspergillosis. Voriconazole is used as the primary azole for treatment of IA, while itraconazole is the choice to
treat chronic pulmonary aspergillosis and posaconazole is more often used for prophylaxis (1, 2). Even though acquired resistance during therapy is
rare, epidemiological studies have shown that the number of clinical isolates showing an azole-resistant phenotype have increased over the past decade
in patients with prolonged exposure to azoles (3). Alterations in the cyp51A gene leading to amino acid substitutions in the target enzyme 14-α lanosterol
demethylase are the primary cause for azole resistance (1, 4, 5) although non-cyp51A-mediated resistance has been recently reported (6).
Micafungin (MCF) is a member of the echinocandin class of antifungal agents (alongside with caspofungin and anidulafungin) that targets the fungal cell
wall by the inhibition of the β-(1,3)-glucan synthase, an enzyme unique to fungi and responsible for the synthesis of β-(1,3)-glucan. MCF has
demonstrated in vitro and in vivo activity against A. fumigatus and shown synergistic activity when used in combination therapy with azoles
(isavuconazole, itraconazole, voriconazole) or with amphotericin B (7, 8). Echinocandin resistance has been linked to mutations in the FKS genes –
which encode the β-(1,3)-glucan synthase enzymes- in Candida spp (9-11). In A. fumigatus an in vitro engineeried point mutation in the fks1 gene
showed to be sufficient to confer resistance to echinocandin drugs (12).
To date, no echinocandin resistant A. fumigatus isolates showing a characteristic fks mutation have been recovered from patients after exposure to an
echinocandin. In this study, we describe the first documented case of echinocandin resistance in A. fumigatus due to a point mutation in the hot spot 1 of
the fks1 gene in a female 66-year-old patient with an aspergilloma and chronic pulmonary aspergillosis that failed azole therapy.
Antifungal susceptibility testing was performed in triplicate in accordance with the guidelines described in CLSI document M38-A2 (13). The drugs
used were isavuconazole (ISA) (Astellas Pharma USA, Inc., Northbrook, IL), itraconazole (ITR) (Sigma-Aldrich, St. Louis, MO), voriconazole (VRC)
(Pfizer Inc., New York, NY), posaconazole (POS) (Merck Sharp & Dohme Corp., Rahway, NJ), amphotericin B (AMB) (Sigma-Aldrich, St. Louis, MO),
caspofungin (CSF) (Merck Sharp & Dohme Corp., Rahway, NJ), micafungin (MCF) (Astellas Pharma USA, Inc., Northbrook, IL) and terbinafine (TERB)
(Novartis Pharmaceuticals, East Hanover, NJ) and were obtained as standard powders from their manufacturers. All drugs were dissolved in 100%
dimethyl sulfoxide (DMSO) with the exception of CSF and MCF that were dissolved in water. Stock solutions of the drugs were kept at −86°C. Microtiter
plates were read visually and the MIC was determined using 100% inhibition of growth at 48h for azoles, AMB and TERB. In the case of the
echinocandins (CSF and MCF) plates were read under the microscope after 24h of growth to determine the MEC [C. krusei ATCC 6258 and C.
parapsilosis ATCC 22019 were used as quality control strains through all experiments].
fks1 and cyp51A sequencing. DNA from spores was extracted following the protocol published by Hervás-Aguilar et al, 2007 (14). PCR and
sequencing primers were designed based on the sequences of the genes Affks1 (GenBank accession no. U79728.1), Afcyp51A (GenBank accession
no. JX283445.1) and Aflvcyp51A (Gene ID: 7913518) and are listed in Table 1. PCR amplifications were carried out in a BIORAD iCycler (Biorad) in a
50 μl reaction volume containing 50 ng of genomic DNA, 0.2 μM of each primer and 25 μl of EmeraldAmp Master MIX (Takara Bio Inc). PCR products
were purified by QIAquick PCR Purification Kit (Qiagen). Automated fluorescent sequencing was performed in both 5’ and 3’ by Genewiz NJ lab (South
Plainfield, NJ). Sequences were assembled and edited using SeqMan II and EditSeq software packages (Lasergene 13.0; DNAStar, Inc., Madison, WI).
Table 1. Oligonucleotides used for fks1 and cyp51A PCR and sequencing.
GS isolation and assay. 1,3-β-D-glucan synthase (GS) complexes were isolated from the ATCC13073 and MD24053B strains. Cell growth and
disruption, membrane protein extraction, partial GS purification by product entrapment, and polymerization assays were performed as described
previously (10, 11). Inhibition curves and 50% inhibitory concentrations (IC50s) were determined using a sigmoidal response (variable-slope) curve and a
two-site competition fitting algorithm with GraphPad Prism software, version 4.0 (10).
1. Verweij PE, Howard SJ, Melchers WJ, Denning DW. 2009. Azole-resistance in Aspergillus: proposed nomenclature and breakpoints. Drug Resist Updat. 12(6):141-7.
2. Dekkers BG, Bakker M, van der Elst KC, Sturkenboom MG, Veringa A, Span LF, Alffenaar JC. 2016. TherapeuticDrug Monitoring of Posaconazole: an Update. Curr Fungal
Infect Rep. 10:51-61.
3. van der Linden JW, Arendrup MC, Warris A, Lagrou K, Pelloux H, Hauser PM, Chryssanthou E, Mellado E, Kidd SE, Tortorano AM, Dannaoui E, Gaustad P, Baddley JW,
Uekötter A, Lass-Flörl C, Klimko N, Moore CB, Denning DW, Pasqualotto AC, Kibbler C, Arikan-Akdagli S, Andes D, Meletiadis J, Naumiuk L, Nucci M, Melchers WJ,
Verweij PE. 2015. Prospective multicenter international surveillance of azole resistance in Aspergillus fumigatus. Emerg Infect Dis. 21(6):1041-4.
4. van Ingen J, van der Lee HA, Rijs AJ, Snelders E, Melchers WJ, Verweij PE. 2015. High-Level Pan-Azole-Resistant Aspergillosis. J Clin Microbiol. 53(7):2343-5.
5. Pfaller MA. 2012. Antifungal drug resistance: mechanism, epidemiology and consequences for treatment. 125(1 Suppl):S3-13.
6. Chowdhary A, Sharma C, Hagen F, Meis JF. 2014. Exploring azole antifungal drug resistance in Aspergillus fumigatus with special reference to resistance mechanisms. Future
Microbiol. 9(5):697-711.
7. Enoch DA, Idris SF, Aliyu SH, Micallef C, Sule O, Karas JA. 2014. Micafungin for the treatment of invasive aspergillosis. Journal of Infection. 68, 507-526.
8. Karagkou A, McCarthy M, Meletiadis J, Petraitis V, Moradi Pw, Strauss GE, Fouant MM, Kovanda LL, Petraitiene R, Roilides E, Walsh TJ. 2014. In vitro combination
of isavuconazole with micafungin or amphotericin B deoxycholate against medically important molds. Antimicrob. Agents Chemother. 58(11):6934-7.
METHODS
CASE REPORT
A 66-year-old life-long non-smoker female patient with an aspergilloma and chronic pulmonary
aspergillosis, diagnosed after coughing up blood who later developed azole resistance on
voriconazole. The patient (MD) complained of weight loss, fatigue and severe breathlessness. She
had suffered recurrent chest infections for many years. MD had severe kyphoscoliosis as a child
with insertion of spinal rods in early adulthood. She first presented in 2001 with an irritating cough
and several treatments with antibiotics that failed to alleviate it. After 2 years, the cough worsened
and the patient developed a fever. MD then coughed up large amounts of blood (haemoptysis)
and had a very severe bleed which was treated with embolization and oral tranexamic acid. MD
continued to cough and produced green sputum and lose weight. Aspergillus precipitin titre was
high and the CT scan demonstrated chronic cavitary pulmonary aspergillosis with fungal ball
(aspergilloma). She was started on itraconazole in 2005 but failed to respond despite satisfactory
blood drug levels, and was switched to voriconazole in 2006. Considerable improvement was seen
initially and the patient gained some weight. Voriconazole therapy continued for 2 years. However,
the Aspergillus titre remained high and the cough continued. Further tests showed the trough
plasma levels of voriconazole to be more than 0.5 mg/L, however Aspergillus fumigatus isolates
recovered were resistant to itraconazole, voriconazole and posaconazole. Thus, a portocath was
inserted for IV amphotericin B but it was felt that her Aspergillus was probably amphotericin B-
resistant as she continued to deteriorate, which was supported by in vitro data. In 2010, the patient
started micafungin IV 150mg 6x weekly with oral terbinafine daily. She improved substantially and
continued to take micafungin, with terbinafine to minimise the risk of resistance. She remained on
this combination, until she developed more haemoptysis and a micafungin resistant A. fumigatus
was grown and therapy was discontinued in 2013. She remained off therapy for over 2 years.
Haemoptysis recurred and she was trialed on isavuconazole (2015/6).
Effect of Fks1 F675S substitution on 1,3-
β-D-glucan synthase inhibition. Product-
entrapped 1,3-β-D-glucan synthase (GS)
complexes were extracted from a prototype
wild type strain (ATCC13073) and the
MD24053B clinical isolate (Fig 3A), and the
echinocandin inhibition parameter IC50 (half
maximal inhibitory concentration) was
determined. The fks1 mutant enzyme
showed significantly higher IC50 values than
corresponding enzyme isolated from the
wild-type (>106-fold change for both CSF
and MCF) (Fig. 3B).
REFERENCES
DNA sequencing of the drug target gene fks1 was performed on the isolate MD24053B. A
point mutation in the hot-spot 1 (HS1) at nucleotide position 2072 (T to C), leading to an
F675S amino acid substitution, was found. The HS1 region of fks1 gene correspond to
nt2071-3003 (aa675-684) of the published A. fumigatus Af293 fks1 gene (Afu6g12400).
The equivalent mutation in the highly conserved HS1 region of Fksp is well known to
confer echinocandin resistance in Candida albicans (F641S) and other Candida spp. and
has been linked with echinocandin clinical failure (9-11) (Fig. 2 and Table 3).
Fig. 2. Sequencing of the A. fumigatus Hot Spot 1 (HS1) region of the fks1 gene. The HS1 sequence
is shown in black and the mutation found in the clinical isolate MD24053B is shown in a purple box
(TTC x TCC in the first codon of the HS1 sequence). The wild-type strain ATCC13073 is also shown.Fig. 3. A. Strains used in the assay grown for 2 days at 37º C on PDA plates. B. Echinocandin inhibition profiles for
product-entrapped 1,3-β-D-glucan synthase enzyme complexes assessed by the incorporation of [3H]-glucose into
radiolabeled product and using a sigmoidal-response (variable-slope) curve. Echinocandin inhibition kinetics yielding 50%
inhibitory concentrations (IC50s) were obtained and are expressed in nanograms per milliliter. Titration curves for CSF and
MCF for wild-type (ATCC13073) and clinical isolate MD24053B of A. fumigatus are shown.
9. Garcia-Effron G, Katiyar SK, Park S, Edlind TD, Perlin DS. 2008. A naturally occurring proline-to-alanine amino acid change in Fks1p in Candida parapsilosis, Candida orthopsilosis,
and Candida metapsilosis accounts for reduced echinocandin susceptibility. Antimicrob. Agents Chemother. 52:2305–2312.
10. Garcia-Effron G, Lee S, Park S, Cleary JD, Perlin DS. 2009. Effect of Candida glabrata FKS1 and FKS2 mutations on echinocandin sensitivity and kinetics of 1,3-beta-d-glucan
synthase: implication for the existing susceptibility breakpoint. Antimicrob. Agents Chemother. 53:3690–3699.
11. Garcia-Effron G, Park S, Perlin DS. 2009. Correlating echinocandin MIC and kinetic inhibition of fks1 mutant glucan synthases for Candida albicans: implications for interpretive
breakpoints. Antimicrob. Agents Chemother. 53:112–122
12. Rocha EM, Garcia-Effron G, Park S, Perlin DS. 2007. A Ser678Pro substitution in Fks1p confers resistance to echinocandin drugs in Aspergillus fumigatus. Antimicrob. Agents
Chemother 51(11):4174-6.
13. National Committee for Clinical Laboratory Standards. 2008. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi; approved standard.
Document M38-A2, Vol 28, No 16. National Committee for Clinical Laboratory Standards, Wayne, Pa.
14. Hervás-Aguilar A, Rodríguez JM, Tilburn J, Arst HN Jr, Peñalva MA. 2007 Evidence for the direct involvement of the proteasome in the proteolytic processing of the Aspergillus
nidulans zinc finger transcription factor PacC. J Biol Chem. 282:34735-47.15. Alanio A, Cabaret O, Sitterle E, Costa JM, Brisse S, Cordonnier C, Bretagne S. 2012. Azole preexposure affects the Aspergillus fumigatus population in patients. Antimicrob
Agents Chemother. 56:4948-50.
Twelve consecutive Aspergillus spp. isolates (11 A. fumigatus and 1 A. flavus) were recovered from sputum cultures and were submitted for susceptibility
testing against several antifungal compounds. According to the epidemiological cut-off values (ECVs), all isolates except one (MD24053B) were classified as
wild-type population for all antifungal drugs tested. Moreover, cyp51A sequencing revealed five mutations not linked to azole resistance in all A. fumigatus
isolates (15). Isolate MD24053B showed an increase in MEC values of 16.6 to 66.6-fold higher for CSF and MCF respectively, compared to the control strain
(ATCC13073, data not shown) and the other 11 isolates collected from the patient (Table 2). Isolate MD24053B showed a diminished growth rate in PDA
plates compared to the other ten A. fumigatus isolates recovered from the patient and lacked the typical dark green color of the colonies formed by A.
fumigatus (Fig. 1B.).
Table 2. MIC/MEC distributions of the antifungal drugs tested in the study for the Aspergillus spp. clinical isolates.
# Oligo Name Sequence 5'→3' Purpose # Oligo Name Sequence 5'→3' Purpose
1 AfFKS1 -751F CCTGAGTTGGTGGTCAAT 13 AfCyp51A F -991 CGTCGATCTGTGTGACAC
2 AfFKS1 R6378 GACTGGCGAAACACGTTG 14 AfCyp51A R 1993 CTAGAAGGAGCAGGACTG
3 AfFKS1F -211 CTGCGACTCGAGATTCAG 15 AfCyp51A F -819 CATGCTGGGAGGAATCTC
4 AfFKS1F +697 GCATGCGCAACATGTATG 16 AfCyp51A F -147 GCTGGTCTCTCATTCGTC
5 AfFKS1F +1562 CGCACAATCGCTTTACAC 17 AfCyp51A F 502 AGAGTCTCATGTGCCACT
6 AfFKS1 1947F CGTCAGTATGTGGCTAGC 18 AfCyp51A F 1151 CACTCCTCTATTCACTCTATC
7 AfFKS1F +2405 GATTTCTCAAGTTTGGAATGC 19 AflvCyp51A_F-511 CAGACTTCGAGGCTTTGG
8 AfFKS1 3043F CGATCAAGCTCCTGTACC 20 AflvCyp51A_R1985 TGGTATTGACGCAGGTAC
9 AfFKS1F +3401 GTCTGACAACCAGAATCAC 21 AflvCyp51A_F-286 CGATGCCAAGTACTCCAA
10 AfFKS1F +4269 GTCCAGGAACTGACAGAG 22 AflvCyp51A_F240 CCACAATGTTGTACGGAG
11 AfFKS1F +5117 CGAAGTCATGTTCTTCCTTG 23 AflvCyp51A_F886 CTACAAGAATGGACAGCC
12 AfFKS1R +5931 CTTCGAGGCGCTGGATAC 24 AflvCyp51A_R1811 GGTCATCATACTGTGGAC
Affks1 PCR
amplification
Affks1
sequencing
Afcyp51A PCR
amplification
Afcyp51A
sequencing
A. flavus cyp51A
PCR amplification
A. flavus cyp51A
sequencing
Table 3. fks1 sequencing of the A. fumigatus MD24053B isolate.
CONCLUSION
The Fks1 point mutation F675S of the A. fumigatus isolate 24053B yielded a β-(1,3)-glucan synthase enzyme with highly reduced sensitivity to echinocandin drugs
resulting in elevated MECs, and echinocandin clinical failure. To date, this is the first reported case of echinocandin resistance due to a point mutation in the fks1 gene in
an A. fumigatus clinical isolate.
# Lab no. Date received ID Specimen site ISA ITR POS VOR CSF MCF AMB TERB Cyp51A* Fks1*
1 62194 12/24/2015 Aspergillus fumigatus complex sputum 0.25 0.5 0.25 0.12 0.12 0.03 2 0.5 Y46F, V172M, T248N, E255D, K427E ND$
2 53619 1/28/2015 Aspergillus fumigatus complex sputum 0.25 0.5 0.25 0.25 0.12 0.03 2 0.5 Y46F, V172M, T248N, E255D, K427E ND
3 45755 12/30/2013 Aspergillus fumigatus complex sputum 2 1 1 0.5 0.12 0.03 2 1 Y46F, V172M, T248N, E255D, K427E ND
4 33460 4/10/2012 Aspergillus fumigatus complex sputum 0.25 0.5 0.25 0.12 0.12 0.03 2 1 Y46F, V172M, T248N, E255D, K427E ND
5 30906 10/25/2011 Aspergillus fumigatus complex sputum 0.25 0.5 0.25 0.12 0.12 0.03 2 1 Y46F, V172M, T248N, E255D, K427E ND
6 29576A 7/27/2011 Aspergillus flavus sputum 0.25 0.5 0.25 0.25 0.12 0.03 2 0.06 WT# ND
7 29576B 7/27/2011 Aspergillus fumigatus complex sputum 0.25 0.25 0.25 0.25 0.12 0.03 2 0.5 Y46F, V172M, T248N, E255D, K427E ND
8 24555 7/28/2010 Aspergillus fumigatus complex sputum 0.25 0.25 0.25 0.25 0.12 0.03 2 0.5 Y46F, V172M, T248N, E255D, K427E ND
9 24053A 6/15/2010 Aspergillus fumigatus complex sputum 0.25 0.25 0.25 0.25 0.12 0.03 2 1 Y46F, V172M, T248N, E255D, K427E ND
10 24053B 6/15/2010 Aspergillus fumigatus complex sputum 0.5 0.25 0.25 1 2 2 2 1 Y46F, V172M, T248N, E255D, K427E F675S
11 23525 5/4/2010 Aspergillus fumigatus complex sputum 0.25 0.25 0.12 0.12 0.12 0.03 2 0.5 Y46F, V172M, T248N, E255D, K427E ND
12 22432 2/9/2010 Aspergillus fumigatus complex sputum 0.25 0.25 0.12 0.25 0.12 0.03 2 1 Y46F, V172M, T248N, E255D, K427E ND
*Ref strain used Af293$ND = not determined #Ref strain used A. flavus NRRL3357
MIC/MEC (mg/L)
A.
A. B.
Contact information: Cristina Jimenez-Ortigosa Ph.D. E-mail: [email protected]
Strain nt aa
Af293 (Ref) TTCCTGACCCTGTCTTTCAAGGATCCGATCCG FLTLSFKDPI
ATCC13073 TTCCTGACCCTGTCTTTCAAGGATCCGATCCG FLTLSFKDPI
MD24053B TCCCTGACCCTGTCTTTCAAGGATCCGATCCG SLTLSFKDPI
fks1 HS1
Fig. 1. A. Antifungal therapy of the patient. Collection of the Aspergillus spp. isolates for the current microbiological
study is shown (triangles). B. Isolates recovered from the patient grown for 2 days at 37º C on a PDA plate.
B.