preface - udn.vntapchikhcn.udn.vn/ortherfile/2016_7_14_10_31_795so6... · nguyen thi khanh hong, le...

115
PREFACE In pursuance of the press restructuring approved by the Prime Minister and the proposal made by the Ministry of Education and Training, the Ministry of Culture and Information issued the Decision No 519/GP-BVHTT dated November 25th, 2002, licensing the publication of the University of Danang journal entitled “Science and Technology”. The Press Bureau under the Ministry of Culture and Information issued the official dispatch No 816/BC dated August 10th, 2006, permitting the University of Danang to publish the “Science and Technology” every two months instead of every three months. The National Scientific and Technological Information Centre under the Ministry of Science and Technology issued the official dispatch No 44/TTKHCN-ISSN dated February 6th, 2007, agreeing to grant an international standardized code, namely ISSN 1859-1531 to the UD journal “Science and Technology”. The Press Bureau under the Ministry of Information and Communications issued the official dispatch No 210/CBC of March 5th, 2008, allowing the UD journal Science and Technology” to be published in English and French in addition to the Vietnamese publication. On September 15th, 2011, the Ministry of Information and Communications issued the Decision No 1487 /GP-BVHTT, granting an additional licence which permits the UD journal “Science and Technology” to increase the publication period frequency from every 2 months to every month and to raise the number of pages from 80 to 150 pages. On January 7th, 2016, the Ministry of Information and Communications issued Decision No 07 /GP-BVHTT, granting a print licence which permits the UD journal “Science and Technology” to operate with a publication frequency of 15 issues per year (of which 3 issues are published in English). The UD journal “Science and Technology” has been established in view of announcing and introducing scientific researches in the fields of teaching and training, offering information on the domestic and foreign scientific research results that serve the education in colleges and universities and propagating the State and Party’s guidelines and policies in education and training as well as in scientific and technological researches. Over the past 40 years, the UD journal “Science and Technology” has been published as the continuity and development of the scientific information journals and conference proceedings published at the University of Danang and its member universities. The journal’s editorial staff wishes to receive many-sided contributions of the scientists and educators from within the university and from other colleges and universities inside and outside the country so that the journal’s quality will be more and more improved in the future. Journal’s Editorial Staff

Upload: others

Post on 03-Jul-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

PREFACE

In pursuance of the press restructuring approved by the Prime Minister and the

proposal made by the Ministry of Education and Training, the Ministry of Culture and

Information issued the Decision No 519/GP-BVHTT dated November 25th, 2002,

licensing the publication of the University of Danang journal entitled “Science and

Technology”.

The Press Bureau under the Ministry of Culture and Information issued the official

dispatch No 816/BC dated August 10th, 2006, permitting the University of Danang to

publish the “Science and Technology” every two months instead of every three months.

The National Scientific and Technological Information Centre under the Ministry

of Science and Technology issued the official dispatch No 44/TTKHCN-ISSN dated

February 6th, 2007, agreeing to grant an international standardized code, namely ISSN

1859-1531 to the UD journal “Science and Technology”.

The Press Bureau under the Ministry of Information and Communications issued

the official dispatch No 210/CBC of March 5th, 2008, allowing the UD journal “Science

and Technology” to be published in English and French in addition to the Vietnamese

publication.

On September 15th, 2011, the Ministry of Information and Communications issued

the Decision No 1487 /GP-BVHTT, granting an additional licence which permits the UD

journal “Science and Technology” to increase the publication period frequency from

every 2 months to every month and to raise the number of pages from 80 to 150 pages.

On January 7th, 2016, the Ministry of Information and Communications issued

Decision No 07 /GP-BVHTT, granting a print licence which permits the UD journal

“Science and Technology” to operate with a publication frequency of 15 issues per year

(of which 3 issues are published in English).

The UD journal “Science and Technology” has been established in view of

announcing and introducing scientific researches in the fields of teaching and training,

offering information on the domestic and foreign scientific research results that serve the

education in colleges and universities and propagating the State and Party’s guidelines

and policies in education and training as well as in scientific and technological researches.

Over the past 40 years, the UD journal “Science and Technology” has been

published as the continuity and development of the scientific information journals and

conference proceedings published at the University of Danang and its member

universities.

The journal’s editorial staff wishes to receive many-sided contributions of the

scientists and educators from within the university and from other colleges and

universities inside and outside the country so that the journal’s quality will be more and

more improved in the future.

Journal’s Editorial Staff

Page 2: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

CONTENTS ISSN 1859-1531 – THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016

ENGINEERING AND TECHNOLOGY

Pointing error effects on performance of Amplify-and-Forward relaying fso systems using SC-QAM signals over Gamma-Gamma atmospheric turbulence channels

Duong Huu Ai, Do Trong Tuan, Ha Duyen Trung 1

Boosting frame rate performance of fall detection system on heterogeneous platform

Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6

Applying automation in remote health care

Truong Thi Bich Thanh 11

Researching on and designing temperature controller for heaters

Vu Van Thanh, Thai Van Tien 16

The effects of variable thermophysical properties on droplet evaporation in high temperature convective flow environment

Nguyen Thi Bang Tuyen, Subhasish Mitra, Duong Viet Dung, Nguyen Vo Dao, G.M. Evans 21

A tool for unit commitment schedule in day-ahead in pool based electricity markets

Pham Nang Van, Nguyen Duc Huy, Nguyen Van Duong, Nguyen The Huu 25

Using dual formulations for correction of thin shell magnetic models by a finite element subproblem method

Dang Quoc Vuong, Bui Duc Hung, Khuong Van Hai 30

NATURAL SCIENCES

A survey on consensus protocols in multi-agent systems

Tran Thi Minh Dung 35

Organization of a knowledge base to reuse workflow templates: an ontological approach

Nguyen Thi Hoa Hue, Le Thanh Nhan 40

A new proposed method for automatic number plate recognition

Bui Huu Phu, Trinh Hoang Hon 45

SOCIAL SCIENCES

Research on application of servperf model in assessing Viettel’s mobile internet service quality in Danang city

Dam Nguyen Anh Khoa, Nguyen Hoang Thao Nguyen 50

Student plagiarism – causes and suggested solutions

Vu Thi Chau Sa, Nguyen Pham Thanh Uyen 55

The impact of focus on form in language teaching

Nguyen Pham Thanh Uyen 59

Page 3: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

HUMAN SCIENCES

Strategies and functions of other-repair in English and Vietnamese conversations

Nguyen Thi Minh Hanh, Nguyen Thi Quynh Hoa 63

Linguistic features of advertisements on road safety equipment in English

Nguyen Thi Quynh Hoa, Nguyen Thi Hong Minh, Nguyen Ngoc Nhat Minh 67

Functional analysis of behavioral clauses denoting smiling in English and Vietnamese

Phan Van Hoa, Tran Huu Phuc, Nguyen Thi Tu Trinh 71

A critical discourse analysis of discursive strategies used in economic news in economist.com and tuoitre.vn

Luu Quy Khuong, Vo Thi Hoang Ngan, Nguyen Ngoc Nhat Minh 76

Enhancing intercultural sensitivity and problem-solving skills of language learners via critical incidents in cross-cultural communication: a constructivist approach

Ho Si Thang Kiet 83

Humor strategies in English and Vietnamese sitcoms from pragmatic perspectives

Pham Thi Thanh Ly 88

Nonverbal strategies used in closing a conversation at offices by English and Vietnamese staff and managers

Hoang Tra My 93

Rules of switching meanings to form new words with two methods of metaphor and metonymy in the system of modern Vietnamese

Bui Trong Ngoan, Ho Thi Duyen 98

A study of syntactic and lexical features of the introduction of English M.A. theses in linguistics in Vietnam and Australia

Tran Thi Ngoc Phuong 101

Movement terms in English and Vietnamese conceptually metaphorical expressions of love

Ho Trinh Quynh Thu 106

MEDICAL PHARMACEUTICAL SCIENCES

Identification of the frequency of drug resistance mutations of helicobacter pylori in gastric patients in Hai Duong provincial general hospital

Le Thi Phuong 110

Page 4: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 1

POINTING ERROR EFFECTS ON PERFORMANCE OF AMPLIFY-AND-FORWARD RELAYING FSO SYSTEMS USING SC-QAM SIGNALS OVER

GAMMA-GAMMA ATMOSPHERIC TURBULENCE CHANNELS

Duong Huu Ai1, Do Trong Tuan2, Ha Duyen Trung2 1VietNam Korea Friendship Information Technology College; [email protected]

2Hanoi University of Science and Technology; [email protected]

 Abstract - This paper presents the theoretical analysis of the average symbol error rate (ASER) of free space optical (FSO) communication system combined with multiple-input multiple-output (MIMO) relay based on Amplify-and-Forward (AF) technique employing subcarrier quadrature amplitude modulation (SC-QAM) signal over strong atmospheric turbulence, which is modeled by Gamma-Gamma distributions and pointing error. The pointing error effect is studied by taking into account the influence of beamwidth, aperture size and jitter variance on the ASER. The influence of the number of relay stations, link distance and different MIMO/FSO configurations on the system’s ASER are also discussed in this paper. The numerical results present the impact of pointing error on the performance of systems and how we use proper values of beamwidth and aperture to improve the performance of such systems.

Key words - AF; atmospheric turbulence; ASER; FSO; QAM; pointing error.

1. Introduction

Free-space  optical  (FSO)  communications  have  gained significant  research attention  due  to  their ability  to cater  to high  bandwidth  demand.  However,  the  optical  links  are vulnerable  to  adverse  channel  conditions  caused  by atmospheric  turbulence  and  pointing  error  [1].  The turbulence  induced  scintillation  and  misalignment-fading is  modeled  using  the  Gamma-Gamma  distribution,  which is  suitable  for  moderate  to  strong  turbulence  regimes  [2]. To  mitigate  the  impact  of  turbulence,  multi-hop  relaying FSO  systems  have  been  proposed  as  a  promising  measure to extend the transmission links and the turbulence-induced fading.  Recently,  performance  of  multi-hop  relaying  FSO systems  over  atmospheric  turbulence  channels  has  been studied  in  [3-10]. 

In  this  work,  the  ASER  expressions  of  systems  in  the Gamma-Gamma  atmospheric  turbulence  channel  are analytically  obtained  by  taking  into  account  the  influence of pointing errors represented by beam-width, aperture size and jitter variance. The SC-QAM scheme is adopted for the performance  analysis.  Moreover,  the  number  of  relaying stations is included in the statistical model of the combined channel  together  with  atmospheric  loss,  atmospheric turbulence  and  pointing  error. 

The rest of the paper is organized as follows: Section 2 introduces  the  system  description.  Section  3  discusses  the atmospheric  turbulence  model  of  AF  MIMO/FSO/SC-QAM  systems  with pointing error. Section 4  is  devoted  to ASER  derivation  of  AF  MIMO/FSO  links.  Section  5 presents  the  numerical  results  and  discussion.  The conclusion  is  reported  in  Section 6. 

2. System description

2.1. AF relaying SISO/FSO system using SC-QAM signals

1R 2Rc-1R cR

Figure 1. A serial relaying SISO/FSO system

e(t)  s(t) 

er (t) r(t) 

1s (t) 1e (t) 

Figure 2. The source node, relaying node and destination node of SISO/FSO systems

We  consider  an  AF  relaying  FSO  system  using SC-QAM  signals  depicted  in  Figure  1,  with  single transmitter  and  single  receiver,  in  which  signal  from  the source  node  S  is  transmitted  to  the  destination  node  D serially  through  c  relay  stations  1 2 c-1 cR , R ,..., R , R .  The 

schemes  are  illustrated  in  Figure  2,  QAM  symbol  is  first up-converted  to  an  intermediate  frequency  .cf   The 

electrical SC-QAM signal at the output of QAM modulator can be written as 

I Q( )    ( )cos(2 )    ( )sin(2 )c ce t s t f t s t f t   (1) 

where  I  ( ) ( ) ( )ii i ss t a t g t iT   and 

  ( ) ( ) ( )jjQ j ss t b t g t jT   are  the  in-phase  and  the 

quadrature  signals,  respectively. ( )ia t ,  ( )jb t are  the 

in-phase  and  the  quadrature  information  amplitudes  of  the transmitted  data  symbol,  respectively,  ( )g t is  the  shaping 

pulse  and  sT  denotes  the  symbol  interval.  The  QAM  signal 

is  used  to  modulate  the  intensity  of  a  laser  of  the transmitter,  the  transmitted  signal can be  written as 

1 [ ( )cos(2 ) ( )sin(2 )]   s I c Q cs t P s t f t s t f t   (2) 

where  sP  denotes  the average  transmitted optical power per 

symbol at each hop and   is  the modulation  index. Due  to the  effects  of  both  atmospheric  loss,  atmospheric turbulence  and  the  pointing  error,  the  received  optical signal at the first relay node can be expressed as 

1 1 [ ( ) cos(2 ) ( )sin(2 )]   s I c Q cs t X P s t f t s t f t (3) 

where  X   presents  the  signal  scintillation  caused  by atmospheric  loss,  atmospheric  turbulence  and  the  pointing error.  At  each  relay  node,  AF  module  is  used  for  signal 

a)  Source  node 

b)  Relaying  node 

c)  Destination  node 

Page 5: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

2 Duong Huu Ai, Do Trong Tuan, Ha Duyen Trung

amplification  as  shown  in  Figure  2b.  Due  to  slow 

turbulence  changes,  the  DC  term sX P can  be  filtered  out 

by  a  bandpass  filter.  The  electrical  signal  output  of  AF module at the first relay node therefore can be expressed as 

1 1 1( ) ( )se t XP P e t t   (4) 

where  is the PD’s responsivity and  1P is the amplification 

power  of  the  first  relaying  node.  The  receiver  noise  1( )tcan  be  modeled  as  an  additive  white  Gaussian  noise (AWGN)  process. 

Repeating  such  manipulations  above,  the  electrical signal  output  of  the  PD  at  the  destination  node  can  be derived  as  follows 

2 11 00

( ) ( )c ci

e s i i iiir t P e t X P t

  (5) 

2.2. AF relaying MIMO/FSO system using SC-QAM signals

a) Source node    b) Relay node      c) Destination node 

Figure 3. The source node, relay node and destination node of MIMO/FSO systems

In  this  section,  we  consider  a  general  AF  relaying M N   MIMO/FSO  system  using  SC-QAM  signals  with M-lasers  pointing  toward  an  N-aperture  receiver  as depicted.  The  schemes  are  illustrated  in  Figure  3.  The MIMO/FSO  channel  can  be  modeled  by M N  matrix  of 

the  turbulence  channel,  denoted  as  ,

, 1

M N

mn m nX X

.  The 

electrical  signal  at  the  input  of  QAM  demodulator  of  the destination node can be  expressed as 

2 11

1 1 0

0 1 1

( )

( )

cM Ni

e s i imnm n i

c M N

mni m n i

r t P e t X P

tv

  (6) 

where  mnX  denotes  the  stationary  random  process  for  the 

turbulence channel  from  the mth laser  to  the nth PD. In  this system  model,  the  instantaneous  electrical  SNR  can  be expressed as a finite sum of  sub-channels as 

2

1 1 0

cM N

imnm n i

  (7) 

where  imn   is  the  random  variable  defined  as  the 

instantaneous electrical SNR component of the sub-channel from the mth laser to the nth PD, it can be expressed as 

2

2 121

11

0 0

1 ci

s i i ci

i

i

P X PMN

XN

  (8) 

where   is defined as  the average electrical SNR. 

3. Atmospheric turbulelce models with pointing error

In Eqs. (7) and (8), X  is the channel state. X  models  the optical  intensity  fluctuations  resulting  from  atmospheric loss  ,lX   atmospheric  turbulence  fading  aX   and  pointing 

error .pX  They can be described as 

l a pX X X X   (9) 

3.1. Atmospheric loss

Atmospheric  loss lX   is  a  deterministic  component  and 

no randomness, thus acting as a fixed scaling factor over a long time period. It is modeled in [4] as 

LlX e   (10) 

where    denotes  a  wavelength  and  weather  dependent attenuation  coefficient,  and L  is  the link distance. 

3.2. Gamma-gamma atmospheric turbulence

For  moderate  to  strong  turbulence,  the  most  widely accepted  model  is  the  gamma-gamma  distribution,  which has  been  validated  through  studies  [4,  5].  The  pdf  of  the irradiance intensity of gamma-gamma channel is given as 

12

22

2   Γ Γ

X a a aaf X X K X

 (11)

 where  ( ), ( )   is  the  Gamma  function  and  (.)K  

denotes the modified Bessel function of the second kind. The positive  parameter    represents  the  effective  number  of large-scale  cells  of  the  scattering  process,  and  the  positive parameter   represents  the effective number of small-scale 

cells of the scattering process in the atmospheric. 

1

2

2

7 / 62 12 / 5

2

0.49exp 1

1 0.18 0.56

  d

  (12) 

1

5 / 62 12 / 5

2 2

2 12 / 5

2

0.51 1 0.69exp 1

1 0.9 0.62 

d

  (13) 

In  Eqs.  (12)  and  (13), 2/4d kD L  where  2 /k  is 

the  wave  number,    is  the  wavelength,  L   is  the  link distance,  and D  is  the  receiver aperture diameter, and  2

 is 

the Rytov variance, it expressed by [4] 2 2 7 /6 11/ 6

2 0.492 nC k L   (14) 

where  2

nC  is  the  refractive-index  structure  parameter. 

Through  c  relay  stations,  there  are  ( 1)c   turbulence 

channels, The pdf of  1cX  is as follows: 

221 2

2

c 1 Γ Γ

2

cc

X mn mnmn

mn

f X X

K X

  (15) 

3.3. Pointing error model

A statistical pointing error model is developed in [7, 8], the pdf of  pX  is given as [7] 

22

2

0

1( ) , 0 0f X X X ApX pp

A

  (16) 

where  20 erf ( )A v  is  the  fraction  of  the  collected  power 

at radial distance 0, v is given by  / ( 2 )v r z  with r and 

z   respectively  denote  the  aperture  radius  and  the  beam 

Page 6: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 3

waist  at  the  distance  z  and  ,/ 2zeq s   where  the 

equivalent beam radius can be calculated by  [7] 2 1/ 2

( erf( ) / 2 exp( ))zeq z v v v   (17) 

where, 1/22 2

0 01 ( / )z L   with  0   is  the 

transmitter beam waist radius at  0z ,  2 20 0(1 2 )/  and 

2 2 3/ 50 (0.55 )nC k L  is  the coherence  length. 

3.4. Combined channel model

We  derive  a  complete  statistical  model  of  the  channel considering the combined effect of atmospheric turbulence, atmospheric  loss and pointing error. The unconditional pdf of the channel state is obtained [8, eq. (17)]. 

X X X a Xa a a af X f X X f X dX   (18) 

where aaX Xf X X  denotes  the  conditional  probability 

given a turbulence state, and it can be expressed by [8]. 

1

. .a pa

XX Xa l a l

Xf X X f

X X X X

  (19) 

As  a  result,  we  can  derive  the  unconditional  pdf.  The pdf can be expressed by 

2

2

2

1

0

2

0

( )/2

( )1

2

/

2( )

( 1)( )

( )

( ) ( )

(2 )

X

l

a

l

c

a a

X X A

f X X

c A X

dXX K X

  (20) 

The  modified  Bessel  function  of  the  second  kind 

.K   can  be  expressed  as  a  special  case  of  the  Meijer 

G-function, given by  the  following relationship  [11] 

2

0

11 2

0

2

3,01,3

20

( )( 1)( )

( )

( ) ( )

12

, ,2 2 2

X

l

cc

l

l

f Xc A X

X

A X

cX

GA X c

  (21) 

Eq.  (21)  can  be  further  simplified  using  [12,  eq. (9.31.5)]  as 

2

0

1

23,01,3 2

0

( )( 1)( )

( )

( ) ( )

1, 1 , 1

X

l

c

l

f Xc A X

XG

A X c c

 (22) 

4. Aser calculation

We  can  derive  the  average  symbol  error  rate  of  AF relaying  MIMO/FSO/SC-QAM,  which  can  be  generally expressed  as 

0( ) ( )se eP P f d

  (23) 

where  ( )e

P   is  the  conditional  error  probability  (CEP), 

, 1,..., , 1,...,n N m Mnm   is  the  matrix  of  the  MIMO/FSO 

channels.  For  using  SC-QAM  modulation,  the  conditional error  probability  presented  as 

( ) 1 1 2 ( ) ( ) 1 2 ( ) ( )e I I Q QP q M Q A q M Q A

 (24) 

where  1( ) 1q x x ,  ( )Q x   is  the  Gaussian  Q-function, 

( ) 0.5erfc( / 2),Q x x   1/2

2 2 26/ ( 1) ( 1) ,I I QA M r M  

1/2

2 2 2 26 / ( 1) ( 1) ,Q I QA r M r M   in  which  /Q I

r d d   as  the 

quadrature  to  in-phase  decision  distance  ratio,  IM  and  QM  

are  in-phase  and  quadrature  signal  amplitudes, respectively. Eq.  (24) can further be  written as  follows 

( ) 2 ( ) ( ) 2 ( ) ( )

4 ( ) ( ) ( ) ( )e I I Q Q

I Q I Q

P q M Q A q M Q A

q M q M Q A Q A

  (25) 

Assuming  that  MIMO  sub-channels’  turbulence processes  are  uncorrelated,  independent  and  identically distributed,  according  to  Eq.  (8),  Eq.  (22)  and  formula contact between probability density function, we obtain the pdfs  of  AF  relaying  MIMO/FSO  systems  over  gamma-gamma channel as 

2

0

1 12

20.53,01,3 2

0

( )( 1)( )

( ) 1

( ) ( ) 2

( / )

1, 1 , 1

mn

l

c c

mn

l

fc A X

GA X c c

(26) 

Substituting  Eq.  (25)  and  Eq.  (26)  into  Eq.  (23),  the ASER of  the systems can be obtained as 

0 0

0

( ) 2 ( ) ( ) ( ) 2 ( ) ( ) ( )

4 ( ) ( ) ( ) ( ) ( )

se I I Q Q

I Q I Q

P q M Q A f d q M Q A f d

q M q M Q A Q A f d

(27) 

5. Numerical results and discussion

Using  previous  derived  expressions,  Eq.  (26)  and  Eq. (27), we present numerical results for ASER analysis of the AF  relaying  MIMO/FSO  systems.  The  systems’s  ASER can  be  estimated  via  multi-dimensional  numerical integration  with  the  help  of  the  MatlabTM  software. Relevant  parameters  considered  in  our  analysis  are provided  in Table 1. 

In  Figure  4,  the  system’s  ASER  is  presented  as  a function  of  transmitter  beam  waist  radius  under  several  of number relay stations. In these figures it is clearly depicted that  for  a  given  condition  including  specific  values  of number  relay  stations,  aperture  radius  and  average  SNR, the  minimum of  ASER  can be  reached  to  a  specific  value of  0 .   This  value  is  called  the  optimal  transmitter  beam 

waist  radius. Apparently,  the  more the  value of  transmitter beam  waist  radius  comes  close  to  the  optimal  one,  the lower the value of system’s ASER is. 

Table 1. Sysem parametters and constants

Parameter Symbol Value

Laser Wavelength  λ  1550 nm 

Photodetector  responsivity  ℜ  1 A/W 

Modulation  Index    1 

Total noise variance  N0 10-7A/Hz 

Page 7: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

4 Duong Huu Ai, Do Trong Tuan, Ha Duyen Trung

In-phase/Quadrature  signal amplitudes 

/I QM M 8/4 

Index of refraction structure  2nC  

14 2/33 10 m  

Figure 4. ASER performance versus transmitter beam waist radius 0 for various values of s with the aperture radius

0.065m,r the average SNR = 23 dB and 1000m.L

Figure 5. ASER performance against s for various values of

aperture radius with transmitter beam waist radius

0 0.022 m, the average SNR = 23 dB and 1000m.L

Figure  5  illustrates  the  ASER  performance  against  the pointing  error  displacement  standard  deviation  of  the  AF relaying  MIMO/FSO  systems  with  different  MIMO configuration  of 2 2  and 4 4  MIMO/FSO  systems.  As  it is  clearly  shown,  the  system’s  ASER  is  improved significantly  with  the  increase  of  number  of  lasers, receivers  and  relay  stations.  In  addition,  the  pointing  error effects  impact  more severely on  the  system’s performance since higher values of ASER are gained. The impact of the aperture radius and the transmitter beam waist radius on the system’s performance is more significant in low  s  regions 

than in high  s  regions. 

Figure  6  illustrates  the  ASER  performance  against  the aperture  radius  under  various  relay  stations  of  the  AF relaying  MIMO/FSO  systems.  As  a  result,  the  system’s ASER  significantly  decreases  when  the  values  of  aperture radius  and  number  relay  stations  increase.  It  is  found  that, in  low-value  region  when  aperture  radius  increases, system’s  ASER  does  not  change  much.  However,  when aperture  radius  exceeds  the  threshold  value,  ASER plummets  when  aperture  radius  increases. 

Figure 6. ASER performance against the aperture radius r for various values of s with the beam waist radius 0 0.022 m, the

average SNR = 23 dB and 1000m.L

Figure 7. ASER performance versus link distance with of SISO, 2 2 and 4 4 MIMO/FSO systems. 0.08 m,s beam waist

radius 0 0.022 m, 0.055 mr and 1000m.L

Figure 8. ASER performance versus average SNR of SISO, 2 2 and 4 4 MIMO/FSO system. 0.08 m,s beam waist radius

0 0.022 m, 0.055 mr and 1000m.L

Figure 7 depicts  the  ASER  performance  as  function  of the transmission link distance L for various number of relay stations  with  different  MIMO/FSO  configurations.  It  can be seen  from  the  figure  that  the ASER  increases when  the transmission  link  distance  is  longer.  In  addition,  when using  relay  stations  combined with MIMO/FSO systems, ASER  will  get  better  performance.  Figure  8  illustrates  the ASER  as  a  function  of  the  average  electrical  SNR  for different  number  relay  stations  and  different  MIMO 

0.01 0.015 0.02 0.025 0.03 0.03510

-4

10-3

10-2

10-1

100

Tranmitter beam waist radius, 0(m)

Av

erag

e sy

mb

ol e

rro

r ra

te, A

SE

R

s = 0.09m

s = 0.08m

s = 0.07m

c = 0

c = 1 (PAF = 3.5dB)

c = 2 (PAF

 = 3.5dB)

0.05 0.06 0.07 0.08 0.09 0.1 0.11 0.12 0.13 0.1410

-5

10-4

10-3

10-2

10-1

100

The pointing displacement standard deaviation, s(m)

Av

erag

e sy

mb

ol e

rro

r ra

te, A

SE

R

r = 0.055m, c = 0

r = 0.060m, c = 0

r = 0.055m, c = 1 (PAF

 = 3.5dB)

r = 0.060m, c = 1 (PAF

 = 3.5dB)

SISO/FSO

4x4MIMO/FSO

2x2MIMO/FSO

0.04 0.045 0.05 0.055 0.06 0.065 0.0710

-5

10-4

10-3

10-2

10-1

100

Aperture radius, r(m)

Av

erag

e sy

mb

ol 

erro

r ra

te, A

SE

R

s = 0.10m, c = 0

s = 0.08m, c = 0

s = 0.10m, c = 1 (P

AF = 3.5dB)

s = 0.08m, c = 1 (PAF = 3.5dB)

4x4MIMO/FSO

2x2MIMO/FSO

SISO/FSO

1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 200010

-5

10-4

10-3

10-2

10-1

100

Link distance, L(m)

Av

erag

e sy

mb

ol 

erro

r ra

te, A

SE

R

Relay stations, c = 0

Relay stations, c = 1, PAF = 3.5dB

Relay stations, c = 2, PAF = 3.5dB

SISO/FSO

4x4  MIMO/FSO

2x2 MIMO/FSO

0 5 10 15 20 25 3010

-5

10-4

10-3

10-2

10-1

100

Signal-to-Noise Ratio, SNR(dB)

Av

erag

e sy

mb

ol 

erro

r ra

te, A

SE

R

Relay stations, c = 0

Relay stations, c = 1, PAF

= 3.5dB

Relay stations, c = 2, PAF

= 3.5dB

SISO/FSO

2x2 MIMO/FSO

4x4 MIMO/FSO

Page 8: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 5

configurations.  The  ASER  decreases  with  the  increase  of the SNR,  number of  relay  stations  and MIMO/FSO.  It  can be  found  that  simulation  results  show  a  closed  agreement with  analytical  results. 

6. Conclusion

In this paper, we have theoretically analyzed the ASER of  AF  relaying  MIMO/FSO  communication  systems employing  SC-QAM  signals  over  Gamma-Gamma atmospheric  turbulence  and  pointing  error.The  results present  the  theoretical  expressions  for  ASER  performance of  SISO  and  MIMO  systems  by  taking  into  account  the number of AF relay stations, MIMO configurations and the pointing  error  effect.  The  numerical  results  show  the impact  of  pointing  error  on  the  system’s  performance.  By analyzing  ASER performance,  we can conclude  that using proper  values  of  aperture  radius,  transmitter  beam  waist radius,  partially  surmounted  pointing  error  and  number  of relay  stations  combined  with  MIMO/FSO  configurations could greatly benefit the performance of  such systems. 

REFERENCES

[1] X. Zhu and J. M. Kahn, “Free-space optical communication through atmospheric  turbulence  channels”, IEEE Trans. Commun., vol. 55, no. 8, pp. 1293–1300, Aug. 2002. 

[2] M. A. Al-Habash, L. C. Andrews, and R. L. Philips, “Mathemati-cal model for the irradiance probability density function of a laser beam 

propagating through turbulent media”, Opt. Eng., vol. 40, no. 8, pp. 1554–1562, 2001. 

[3] Mona Aggarwal, ParulGarg and Parul Puri, “Exact Capacity of Amplify and-Forward Relayed Optical Wireless Communication Systems”, IEEE Phôtnics Technology Letters, Vol. 27, No. 8, April 15, 2015. 

[4] Majumdar, A. K., Ricklin, J. C., Free-space laser communications: principles and advances, New York Springer (2008) 

[5] Andrews, L., Phillips, R., Hopen, C., Laser Beam Scintillation with Applications, Bellingham, WA: SPIE Press (2001). 

[6] Safari,  M.,  Uysal,  M,  “Relay-Assisted  Free-Space  Optical  Commu-nication”, IEEE Trans. Wireless Communication. (2008) 5441-5449. 

[7] Arnon,  S.,  “Effects  of  atmospheric  turbulence  and  building  sway  on optical wireless communication systems”, Opt. Lett. 28 (2003) 129–131 

[8] Trung,  H.  D.,  Tuan,  D.  T.,  Anh,  T.  P.,  “Pointing  error  effects  on performance  of  free-space  optical  communication  systems  using SC-QAM signals over atmospheric turbulence channels”, AEU-Int. J. of Elec. and Commun. 68 (2014) 869-876 

[9] Kostas  P.  Peppas,  “A  New  Formula  for  the  Average  Bit  Error Probability  of  Dual-Hop  Amplify-and-Forward  Relaying  Systems over  Generalized  Shadowed  Fading  Channels”,  IEEE Wireless Ccommunications Letters, Vol. 1, No. 2, april 2012. 

[10] Kostas P. Peppas, Argyris N. Stassinakis, Hector E. Nistazakis, and George  S.  Tombras,  “Capacity  Analysis  of  Dual  Amplify-and-Forward Relayed Free-Space Optical Communication Systems Over Turbulence  Channels  With  Pointing  Errors”,  J. Opt. Commun. Netw./Vol. 5, No. 9/september 2013. 

[11] Harilaos G. Sandalidis, Theodoros A. Tsiftsis, Member, and George K. Karagiannidis, Senior, “Optical Wireless Communications With Hetero-dyne  Detection  Over  Turbulence  Channels  With  Pointing  Errors”, journal of lightwave technology, Vol. 27, No. 20, october 15, 2009. 

[12] I.  S.  Gradshteyn  and  I.  M. Ryzhik,  Table  of  Integrals,  Series,  and Prod-ucts, 7th ed. New York: Academic, 2008. 

(The Board of Editors received the paper on 05/03/2016, its review was completed on 25/03/2016)

Page 9: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

6 Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy

BOOSTING FRAME RATE PERFORMANCE OF FALL DETECTION SYSTEM ON HETEROGENEOUS PLATFORM

Nguyen Thi Khanh Hong1, Le Huu Duy1, Pham Van Tuan2, Cecile Belleudy3 1College of Technology, The University of Danang, Vietnam; [email protected]; [email protected]

2University of Science and Technology,The University of Danang, Vietnam; [email protected] 3University of Nice Sophia Antipolis, Nice, France; [email protected]

 Abstract - Heterogeneous computing platform, Zynq- 7000 all programmable system-on-chip, not only accomplishes high efficiency solutions in accelerating the power consumption, execution time for implementing the Fall Detection application but also takes the advantage of Open source Computer Vision (OpenCV) libraries. The main goal of this work is to design and implement the Fall Detection System on Zynq platform. In addition, the execution time and calculated energy are extracted from the platform implementation. Besides, the Accuracy, Recall and Precision factors of Fall Detection System which are executed on the computer and platform implementation are compared. Finally, NEON optimization is used to boost the frame rate performance of Fall Detection System on Zynq Platform.

Key words - Fall Detection; energy consumption; execution time; boosting frame rate.

1. Introduction and Related works

It is necessary to have systems which can automatically monitor human activities in order to reduce the pressure on training  and  expanding  force  for  health  solutions.  As  a result,  it  is  important  to  develop  an  automated  Fall Detection  application  to  prevent  fall  risk  of  elderly  and rehabilitants  and  provide  immediate  help  to  them. 

1.1. Fall Detection Approaches

Automatic  fall  detection  in  general  can  be  performed by  many  different  techniques:  Indoor  sensors  [1],  [2],  [3]; Wearable  sensors  [4]; Video systems  [5],  [6],  [7]. 

Among  them,  the  wearable  sensors  help  to  capture  the high  velocities,  which  occur  during  the  critical  phase  and the  horizontal  orientation  during  the  post  fall  phase. However,  in  these  methods  the  users  have  to  wear  the device  all  the  time,  and  therefore,  if  it  is  inconvenient,  it could  bother  them.  Additionally,  such  systems  require recharging the battery frequently, which could be a serious limitation  for  practical  application. 

On the other hand, video systems enable an operator to rapidly check  if an alarm  is  linked  to an actual  fall or not. A  block  diagram  of  Fall  Detection  based  on  video processing  is  described  in  Figure 1. 

Figure 1. Block diagram of Fall Detection application

A moving object will be extracted  from background of a  video  clip.  The  moving  area  will  be  detected  by  using background  subtraction  techniques  which  define  the different  of  pixels  in  consecutive  frames.  After  blobbing and smoothing the object,  this result will be  tracked by 2D modeling such as point tracking, kernel tracking (rectangle, 

ellipse,  skeleton…),  silhouette  tracking.  Then,  calculating the  feature  extractions  í  done  to  understand  what  kind behaviors  of  object  based  on  one  of  these  modeling.  The problems  are  that  these  features  must  encapsulate  unique characteristics  for  the  same  action  made  by  different people.  In order  to avoid misdetection and  false alarms  for this  system  not  only  depends  on  the  techniques  but  also confronts  some  challenges  such  as  dynamic  background, brightness,  occlusion,  static  object. 

After  tracking  and  extracting  the  object  features,  the problem of the system has to understand the meaning of the object actions  through its  features  in  the  recognition block. 

1.2. Implementation of Fall Detection Application

We  now  review  some  implementations  for  Fall Detection  System  which  uses  various  methods.  Besides, Michal Kepski and Bogdan Kwolek deploy the Kinect and accelerate-meter  in  fall  detection  system  [8].  They implement this system on PandaBoard ES, which is a low-power  and  low-cost  single  board  computer  development platform  based  on  Texas  Instruments  OMAP4  line  of processors.  In  addition,  a  method  for  detecting  falls  at homes of elderly using a two-stage  fall detection system is presented by Erik E. Stone et al.  [9]. The  first stage of  the detection  system  characterizes  a  person’s  vertical  state  in individual  depth  image  frames.  The  segmentation  on ground  events  from  the  vertical  state  time  series  is  then obtained  by  tracking  the  person  according  time.  The second stage uses an ensemble of decision trees to compute a  confidence  that  a  fall  precede  on  a  ground  event.  Their database  consists  of  454  falls  where  445  falls  are performed  by  trained  stunt  actors  and  9  are  resident  falls. The database  is collected in nine years at  the actual homes of older adults living in 13 apartments. This means that the data  collection  allows  for  characterization  of  system performance  under  real-world  condition,  which  is  not shown  in  other  studies.  Cross  validation  results  are included  for  standing,  sitting  and  lying  down  positions, within 4 m versus far fall locations and occluded versus not occluded  fallers. 

Martin  Humenberger  et  al.  in  [10]  present  a  bio-inspired  and  embedded  fall  detection  system  by  the combination  of  FPGA  and  DSP.  Bio-inspired  means  that the  use  of  two  optical  detector  chips  with  event-driven pixels  is  sensitive  to  relative  light  intensity  changes  only. The chips are used as stereo configuration which facilitates a  3D  representation  of  the  observed  area  with  a  stereo matching  technique.  Moreover,  the  stationary  installed  fall detection  system  has  a  better  acceptance  for  independent living  compared  to  permanently  worn  devices.  The  fall 

Page 10: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 7

detection is performed by a  trained neural network. First, a meaningful  feature  vector  is  calculated  from  the  point clouds. Then the neural network classifies  the actual event as  fall  or non-fall. All processing  is done on an embedded device  consisting  of  an  FPGA  for  stereo  matching  and  a DSP  for  neural  network  calculation  achieving  several  fall evaluations  per  second.  The  results  of  evaluation  indicate that  a  fall  detection  rate  of  more  than  96%  with  false positives  below  5%  for  the  pre-recorded  database consisting of 679  fall  scenarios. 

In the next section, the research objective is mentioned. Fall  Detection  application  will  be  described  with  four steps:  object  segmentation,  filter,  feature  extractions  and recognition  in  Section  3.  In  Section  4  an  insightful experiment of  implementation  and  evaluation  is  described. Finally, Section 5 contains  the conclusions of  this paper. 

2. Research objective

In  this  study,  the Fall Detection System in High Level Languages  specified  in  C/C++  integrated  OpenCV,  cross-compiled  along  with  libraries  which  implement  the communication  Application  Programming  Interfaces (APIs)  and  runtime  layer  using  gcc/g++  toolchains  are designed.  The  toolchains  generate  an.elf  file  downloaded to  the  processor  ARM  Cortex  A9  on  Zynq  platform supported  by  SDK  tools.  Our  system  is  executed  by  the configuration  of  image  resolutions,  frequencies  of processor cores. The recognition  rate is  then evaluated and compared  with  other  system.  For  designing  and implementing  our  Fall  Detection  System  on  Zynq platform,  the case study  is presented as  follows: 

Input  video  is  recorded  by  the  Camera  Web  Cam-Philips SPC 900NC 1 that is mounted on the wall at the distance of 3m from the floor. 

Resolution of input video: 320x240 pixels, 680x480 pixels. 

Core  frequency:  222  MHz,  333MHz  and  667  MHz. 

Output:  warning  signal  (FALL  or  NONFALL), execution  time,  energy  consumption. 

Moreover,  the  recognition  parameters  such  as Accuracy,  Recall  and  Precision  are  compared  based  on computer  and  Zynq  platform.  The  configuration  of computer  is  described as  follows: 

CPU:  Intel Core  i3 2.6Ghz 

Ram:  2GByte 

Operating System: Windows 7 

And  the  characters  of  Zynq  platform  are:  The  Zynq®-

7000 XC7Z020 CLG484  -1 AP SoC  is a product based on the  Xilinx  All  Programmable  SoC  architecture.  It integrates  a  feature-rich  dual-core  ARM®  Cortex™-A9 based  processing  system  (PS)  and  28  nm  Xilinx programmable  logic  (PL)  in  a  single  device.  The  ARM Cortex-A9  CPUs  are  the  heart  of  the  PS  and  also  include on-chip memory, external memory interfaces, and a rich set of  peripheral  connectivity  interfaces  [11]. 

Finally,  from  the  observed  results  which  are  extracted by  implementation  of  Zynq  platform,  the  NEON 

 1http://www.p4c.philips.com/cgi-bin/dcbint/cpindex.pl?ctn=SPC900NC/00&scy=gb&slg=en 

Optimized  Libraries  is  applied.  As  Cortex-A9  on  Zynq platform  prevails  in  embedded  designs,  many  software libraries  are  optimized  for  NEON  and  have  performance improvements  and  cache  efficiency.  In  our  study,  we extract  the  execution  time,  power  consumption  of  whole Fall  Detection  System  which  is  deployed  on  ARM processor  of  Zynq  -7000  AP  SoC  platform.  After  that, NEON  is  used  for  boosting  the  frame  rate  performance  of Fall  Detection  System. 

3. Fall Detection Application

3.1. Object segmentation

Background subtraction is method used to detect moving object.  This  method  detects  and  distinguishes  object  or foreground with the rest of the frame called background [12] by subtracting current frame to estimated background [13]. The estimated background is update as follows: 

1 (1 )i i iB aI a B   (1) 

Where  Bi  is  current  background,  Bi+1  is  a  updated background, and a is update coefficient and is kept small to prevent  artificial  tails  forming  behind  moving  objects.  In the  study,  an  average  of  3  consecutive  frames  is  used instead of the current frame Ii 

1

2

1(1 )

3

i

i i j

j j

B a B a I

  (2) 

Where α is chosen 0.05 as in [12]. Figure 2a and Figure 2b  show  the  input  frame and  the  the  result  of background after  estimating. 

Moving  object  is  estimated  by  subtracting  the  current frame  from  background  and  comparing  with  threshold value  τ. Pixels are considered if 

| |i iI B   (3) 

Where  is  τ is  predefined  threshold.  The  result  after being compared  to τ  is described  in Figure 2c 

(a) (b)

(c) (d)

Figure 2. (a) Estimate Background; (b) Input Frame; (c) Background Subtraction method; (d) GMM method.

However,  the  result  of  background  subtraction  process is  greatly  affected  by  shadow  of  the  object.  In  order  to distinguish  object  from  background,  another  method  of estimating  background/foreground  is  applied.  An  adaptive Gaussians  mixture  model  (GMM)  that  was  proposed  by 

Page 11: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

8 Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy

Stauffer and Grimson at  [16]  is  applied here.  In  this work, the values of a particular pixel over time is considered as a “pixel process”, and each pixel is modeled by a mixture of K  Gaussian  distributions,  which  is  used  to  estimate  that pixel  belongs  to  foreground  or  background.  Thanks  to probability  distribution,  GMM  method  could  produces  a better  result  than Background subtraction, even  in  the case of shadow caused by object (Figure 2d). 

3.2. Morphology Filter

Morphology  Mathematic  (MM)  methods  are  used  to improve the quality of image from the object binary image. Some of MMs are dilation, erosion, opening, closing or the combination of  these. 

3.3. Body modelling and features extraction

3.3.1. Ellipse model

Ellipse  model  is  a  simple  model  describing  the  motion or  other  factors  of  object  like  velocity,  location,  or  the shape of  the human body.  In  this  model,  a  single object  is surrounded  by  an  ellipse  that  represents  human  body. Three main  and  important  parameters  are  considered  in  an ellipse  model as  follows  [5]: 

a. Centroid of ellipse

It  is  the  location O(Ox, Oy) or  the  centroid  coordinates of  ellipse  each  frame,  and  it  is  calculated  as  an average  of all  x  coordinates  and  all  y  coordinates  of  white  pixels  in binary  image. 

b. Vertical angle of the object

It presents the angle of object. It is also the angle between the major axis of ellipse and horizontal line. Figure 3. 

Figure 3. Current angle of an object

c. Major and minor axis of the object:

Major and minor axis are twice as much as the distance from  centroid  of  ellipse  O  to  O1  and  O2  respectively,  in which: 

O1  is  the  average  of  all  x  coordinates  and  the  all  y coordinates  of  white  pixels  which  have  a  limited  angle  so 

that  0| | 60W O h

  and  O2  is  the  average  of  all  x 

coordinates and  the all y coordinates of white pixels which 

have a limited angle so that  0| ( / 2) | 60W O h

3.3.2. Feature extraction

5  major  features  are  extracted  from  ellipse  model  of moving object and binary image: 

a. Current angle

Current  angle  is  vertical  angle  of  the  ellipse  which presents  the  object  [5]. 

b. Coefficient of motion

This  is  also known as  an  image of  motion history  and 

is  considered  as  the  velocity  of  the  moving  object.  The equation of Cmotion is described as follows. And Figure 4 shows Motion History Image in case of moving and falling. 

Figure 4. Motion History Image

c. Deviation of the angle (Ctheta)

Ctheta is standard deviation of vertical angle calculated from  15  successive  frames.  Ctheta  is  usually  higher  when a  fall occurs  [5]. 

d. Eccentricity

Eccentricity e at current  frame is computed: 

2

21

be

a   (9) 

Where a, b is semi-major and semi-minor axis of ellipse perspective. e is smaller when direct  fall happens 

e. Deviation of the centroid.

Ccentroid  is  standard  deviation  of  centroid  coordinates calculated  from  15  continuously  frames.  Ccentroid  falls rapidly  when a  fall occurs. 

3.3.3. Recognition based on Template Matching

 Figure 5. Feature evolution for walking, fall-down in two direct

0 5 10 15 20 25 30 35 400

50

100

150

a)

Thet

a

0 5 10 15 20 25 30 35 400

0.2

0.4

0.6

0.8

1

b)

CM

otio

n

0 5 10 15 20 25 30 35 400

10

20

30

c)

CThe

ta

0 5 10 15 20 25 30 35 400

0.2

0.4

0.6

0.8

1

d)

Ecce

ntric

ity

0 5 10 15 20 25 30 35 400

5

10

15

Time - framee)

CC

entr

oid.

walking  Cross fall  Direct fall 

88.9022 78.590

Page 12: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 9

Five  extracted  features  from  extraction  block  will  be reasonably  combined  to  recognize  fall  action.  First, suitable thresholds are indicated through training process. A  decision  is  estimated  based  on  combination  of  some features with appropriate rules. This will be applied in test process to recognize action. From training, some rule are applied as follows: Theta and Cmotion are necessary in all case of data because there is a major change in two features when  fall-behaviors  occurs.  So  the  combination  of  two features  could  effectively  distinguish  fall  from  non-fall behavious of old people such as walking, bending, sitting or lying in the bed; Eccentricity plays a key role in direct fall  detection  because  other  features  are  difficult  to recognize  in  this case. More specific  information of each case is shown in Figure 5. 

4. Implementation & Evaluation

4.1. Platform implementation

4.1.1. Classification Performance

The DUT-HBU database [5]  is used  in this  system. All video data are compressed  in.avi  format  and captured by  a single camera in a small room with the changeable conditions such as brightness, objects, direction of camera, etc. Database: the  fall  direction  is  subdivided  into  three  basic  directions: Direct fall: object falls face to the camera; Cross fall: occurs when the object falls cross to the camera; Side fall: the object perpendicularly falls to the both sides of the camera. In terms of  non-fall  videos,  usual  activities  which  can  be misrecognized with fall action such as lying, sitting, creeping, bending are also classified into three directions above. 

4.1.2. Classifying Evaluation

ROC (Receiver Operating Characteristics) is one of the methods to evaluate the efficient and accuracy of a system by  calculating  the  Precision  (PR),  Recall  (RC)  and Accuracy (Acc). See in the Equation 10. 

; ;TP TP

PR RCTP FP TP FN

TP TNAcc

TP TN FP FN

  (10) 

Where TP, TN, FN, FP are defined as follows: 

True positives (TP): amount of fall actions which are correctly classified as fall. 

False positives (FP): amount of non-fall actions which are wrongly considered to be fall. 

False negatives (FN): amount of fall actions which are wrongly rejected and classified as non-fall actions. 

True negative (TN): amount of non-fall actions which are correctly classified as non-fall. 

4.1.3. Recognition performance

In this study, Template Matching algorithm is used in 

recognition  block.  We  combine  five  features:  ,  Ctheta, Cmotion, Ccentroid, e and four models of the fall to detect a  fall  event.  In  some case,  the  models  are not  enough  to describe all cases when falls may occur. 

The  recognition  parameters  such  as  Recall,  Precision and Accuracy are calculated by using the clear data set in 

DUT-HBU database [5]. Figure 6 presents the comparison of  these parameters which are executed on computer and implemented on Zynq platform. The result of computer is higher about 8% than Zynq platform. However, the Recall, Precision and Accuracy are achieved by 90.5%, 86.2% and 87.1%.  These  parameters  are  considerably  improved compared with the same of study in [14]. 

4.1.4. Experiment results for the Fall Detection System on platform

In our study, the measurement of power is taken by the Fusion Digital Power Designer GUI. The TI USB Adapter includes Power Management Bus (PMBus). PMBus is an open  standard  power-management  protocol. This  flexible and  highly  versatile  standard  allows  for  communication between Zynq platform and PC based on both analog and digital  technologies  and  provides  true  interoperability, which will  reduce design complexity and shorten  time  to market for power system designers. The Table 1 shows the power  and  energy  consumption  at  various  image resolutions and frequencies. 

Figure 6. The results of Template Matching Algorithm.

Table 1. The Power/Energy of Fall Detection System on platform

 

4.1.5. NEON for boosting performance

Xilinx Zynq®-7000 AP SoC platform is an architecture that  integrates a  dual-core  ARM®Cortex™-A9 processor, which  is  widely  used  in  embedded  products.  Both  ARM Cortex-A9  cores  have  an  advanced  single  instruction, multiple data  (SIMD) engine,  also known as  NEON.  It  is specialized for parallel data computation on large data sets. Parallel computation is the next strategy typically employed to  improve  CPU  data  processing  capability.  The  SIMD technique allows multiple data to be processed in one or just a few CPU cycles. NEON is the SIMD implementation in ARM v7A processors. Effective use of NEON can produce significant software performance improvements [15]. 

SIMD is particularly useful for digital signal processing or  multimedia  algorithms,  such  as:  Block-based  data 

Image Frequency Power Energy

resolution (MHz) mW mJ

667 420 45.11

333 304.55 65.26

222 254.55 79.83

667 437.27 188.73

333 323.64 268.68

222 269.09 335.39

320x240

640x480

Page 13: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

10 Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy

processing;  Audio,  video,  and  image  processing  codecs; 2D  graphics  based  on  rectangular  blocks  of  pixels;  3D graphics;  Color-space  conversion;  Physics  simulations; Error  correction. 

The  NEON  to  optimize  Open  Source Libraries  such  as ffmpeg  and  OpenCV  is  applied  in  this  study. The  Table 2 describes  the  improvement  of  average  execution  time  and frame rate of two implementation stages on Zynq Platform. 

5. Conclusion and Future works

In  this  paper,  a  Fall  Detection  Application  is implemented  on  Zynq-7000  AP  Soc  platform  with  two video  input  resolutions  and  various  frequencies.  Its recognition performance  has been evaluated  and  compared with  the  other  system  in  terms  of  recall,  precision  and accuracy.  The  platform  implementation  of  the  application shows  an  average  accuracy  of  almost  over  85%.  We  also measure on-line power consumption and execution time of this  system.  Besides,  the  NEON  optimizes  Open  source libraries  to  improve  the  frame  rate  performance  with maximum  number  of  3fps  In  this  system,  we  can  use  the other  method  such  as  accelerating  on  hardware, hardware/software  co-design. 

Table 2. Frame rate improvement by using NEON

 

REFERENCES

[1] A. Sixsmith, N. Johnson, and R. Whatmore, “Pyroelectric IR sensor arrays for fall detection in the older population”, Journal of Physics IV (Proceeding), vol. 128, pp. 153–160, Sep. 2005. 

[2] T. Pallejà, M. Teixidó, M. Tresanchez, and J. Palacín, “Measuring gait using a ground laser range sensor”, Journal of Sensors (Basel), vol. 9, no. 11, pp. 9133–9146, Jan. 2009. 

[3] Y.  Zigel,  D.  Litvak,  and  I.  Gannot,  “A  method  for  automatic  fall detection  of  elderly  people using  floor  vibrations  and  sound-proof of  concept  on human  mimicking doll  falls”, IEEE Transaction on Biomedical Engineering, vol. 56, no. 12, pp. 2858–2867, Dec. 2009. 

[4] M. Tolkiehn, L. Atallah, B. Lo, and G.-Z. Yang, “Direction sensitive fall  detection  using  a  triaxial  accelerometer  and  a  barometric pressure  sensor”, Conference Proceeding of IEEE Engineering in Medicine Biology Society, vol. 2011, pp. 369–372, Jan. 2011. 

[5] Y. T. Ngo, H. V. Nguyen, and T. V. Pham, “Study on fall detection based  on  intelligent  video  analysis”,  International Conference on Advanced Technologies Communication, pp. 114–117, Oct. 2012. 

[1] E. Auvinet, F. Multon, A. Saint-arnaud, J. Rousseau, and J. Meunier, “Fall  Detection  with  Multiple  Cameras :  An  Occlusion-Resistant Method  Based  on  3-D  Silhouette  Vertical  Distribution”,  IEEE Transaction on Information Technology in Biomedicine, vol. 15, no. 2, pp. 290–300, 2011. 

[6] S.  Gasparrini,  E.  Cippitelli,  S.  Spinsante,  E.  Gambi,  and  U. Politecnica,  “A  Depth-Based  Fall  Detection  System  Using  a Kinect® Sensor”, Journal of Sensors, vol. 14, pp. 2756–2775, 2014. 

[7] M.  Kepski  and  B.  Kwolek,  “Human  Fall  Detection  Using  Kinect Sensor”,  in  Proceedings  of  the  8th  International  Conference  on Computer Recognition Systems CORES, 2013, pp. 743–752. 

[8] E. E. Stone and M. Skubic, “Fall detection in homes of older adults using  the  Microsoft  Kinect”,  IEEE J. Biomed. Heal. informatics, vol. 19, no. 1, pp. 290–301, Jan. 2015. 

[2] M. Humenberger, S. Schraml, C. Sulzbachner, A. N. Belbachir, A. Srp, and F. Vajda, “Embedded fall detection with a neural network and  bio-inspired  stereo  vision”,  in IEEE Computer Society Conference on Computer Vision and Pattern Recognition Workshops (CVPRW), 2012, pp. 60–67. 

[9] M. Kepski and B. Kwolek, “Fall Detection on Embedded Platform Using Kinect and Wireless Accelerometer”, Proceedings of the 13th International Conference on Computers Helping People with Special Needs, vol.2, pp. 407–414, 2012. 

[10] A.M.  McIvor,  “Background  subtraction  techniques.  In  Proc.  Of Image and Vision Computing:, Auckland, New Zealand,2000. 

[3] A.  Derek,  James  M.Keller,  Marjorie  Skubic,  Xi Chen,  and  Zhihai He,  “Recognizing  Falls  from  Silhouettes”  Proceedings  of  the  28th IEEE EMBS Annual International Conference New York City, USA, Aug 30-Sept, 2006. 

[11] Hong Thi Khanh Nguyen,, Cecile Belleudy, Pham Van Tuan, “Fall Detection  Application  on  an  ARM  and  FPGA  Heterogeneous Computing Platform”, International Journal of Advanced Research in Electrical, Electronics and Instrumentation Engineering, Volume 3, pp 11349-11357, 20 August 2014. 

[12] Haoliang Qin, “Boost Software Performance on Zynq-7000 AP SoC with NEON”, Xilinx XAPP1206, 2014. 

[13] C.Stauffer,  W.E.L.  Grimson,  “Adaptive  background  mixture models  for  real-time  tracking”,  IEEE Conf. Computer Vision and Pattern Recognition vol. 2 pp. 246-252, June 23-24 1999. 

(The Board of Editors received the paper on 13/04/2016, its review was completed on 22/05/2016)

 

Frequency

(MHz) Standard NEON Standard NEON

667 96.5 75.5 10.4 13.2

333 182 163.2 5.5 6.1

222 277.4 255.1 3.6 3.9

667 395.7 358.6 2.5 2.8

333 761.5 690.3 1.3 1.4

222 983.5 923.8 1 1.1

Frame rate (fps)

320x240

640x480

Average execution time(ms)

Image resolution

Page 14: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 11

APPLYING AUTOMATION IN REMOTE HEALTH CARE

Truong Thi Bich Thanh

The University of Danang, University of Science and Technology; [email protected]

 Abstract - The increasing cost of aging population and dependants has now become a growing concern. However, the advancement of science and technology, especially of information technology, has created opportunities to improve health care services. This is also a motivation for new researches designed to supplement the capabilities of the elderly as well as the disabled to ensure that they can maintain a healthy and independent lifestyle in their own homes as long as possible. In the present context, the research in this paper presents an idea for health care services at home via an analysis of users’ habits. Existing home entertainment tasks and other activities are regarded as built-in sensors. Based on the modeling of the tasks, a reinforcement algorithm is applied to the analysis of users’ habits. Then frequently used scenarios supplementing user capabilities are discovered.

Key words - analysis of users’ habits; scenario; event quality; grouping; modeling.

1. Introduction

According  to  the  chapter  ‘Population  Division’  in  [2], in 2000, 11% of the world’s elderly people aged 60 or older are  80  or  more.  By  2050,  this  rate  could  increase  to approximately  20%.  With  this  rapid  growth  rate  of  the elderly  population,  the  need  for  services  for  aged  and disabled  people  is  increasing,  including  the  need  for assisted-living  facilities.  We  also  observe  a  trend  toward maintaining  people  in  their  private  homes  as  long  as possible.  This  is  motivated  first  by  people’s  own  wishes, and  second  by  cost  reduction  objectives.  In  this  context, more and more research is being done on the monitoring of dependant people  (i.e.  elderly  and disabled people)  in  their own  environment,  with  more  or  less  intrusive  approaches such  as  telemonitoring  or  sensor  techniques.  These techniques will allow the residents to remain safely in their home  far  longer  than  could  otherwise  be  expected.  Our work  takes  place  in  this  context,  and  includes  two  steps: i) providing the user with new services based on an analysis of  his  habits,  namely  the  way  he  is  using  the  home automation  and  multimedia  services;  ii)  providing  a low-level  and  non-intrusive  personal  supervision  based  on the above  analysis. 

This  paper  is  organized  as  follows:  after  reviewing  in Section  1  the  general  background  and  our  own  approach, we will introduce the modeling used in our work in section 2. In section 3, we will present the analysis of our approach. Section 4 presents  the  test  platform used  for  the validation of  our  work,  and  Section  5  describes  the  obtained simulation  results.  Finally,  in  Section  6,  we  will  draw  up some  conclusions  and  perspectives. 

1.1. Background

To  determine  what  the  elderly  require,  to  enable  them to remain in  their homes as  long as possible, Bargers et al. described  in  [3]  a  mixed-model  framework,  to  develop  a new  probability  model  of  behavior  patterns.  In  the  same field  of  research  (tracking  a  user’s  behavior),  other contributions  are  presented  in  [4,  5].  In  terms  of  Smart 

Home,  many  studies  target  technical  support  for  disabled and  elderly  people,  with  the  design  of  an  intelligent environment adapted  to  the users’ needs  [6, 7]. 

Most of  these approaches  integrate various sensors and cameras  to  most  of  the  environment’s  devices.  However, input  from users  and professionals,  including occupational therapists  (OT),  indicate  that  such  intrusive  methods  are uncomfortable and  therefore not easily accepted. This  is an important  issue  since  the  primary  objective  is  the  user’s safety and well-being. Furthermore, the use of sensors also requires an investment  in costly equipment. 

1.2. Our Approach

With  the  aim  of  contributing  something  new  to  the support and assistance of dependant people, we attempted to find a non-intrusive solution, without sensors, and based on existing  services. We  also  used  our  analysis  to propose  an online composition of services, i.e. a proactive meta-service. In  our  approach,  using  returned  services,  we  built  up  an ontology model of daily services and relevant scenarios,  to model  the  existing  home  automation  and  multimedia system.  Instead  of  sensors,  we  calculated  the  quality  of service  (QoS)  and  probability  models,  both  for  anomaly detection and for the day by day monitoring of the user. The QoS  specification of our  approach  is  directly based on  the users’  needs  and  habits.  With  a  modified  reinforcement algorithm [9] presented in this paper (in Section 3), we can detect  the  user’s  habits  and  offer  him  new  automatic scenarios. Figure 1 shows the principle of our method. 

Occupational therapists (OTs) have an important role to play in the search for techniques to assist dependent persons. This point is often forgotten in existing approaches. Hence, in  our  approach,  as  real-life  experience  proves  that cooperation  with  these  professionals  is  essential,  we integrate dependent persons and OTs into the loop. 

Figure 1. Scheme of service scenario adaptation

Our  approach  is  based  on  two  steps.  The  first  is performed online.  In  the  Initialization phase,  with  the  help of  an  OT,  we  draw  up  a  Service  model  from  the  existing home  automation  and  multimedia  system.  In  this  online phase, the system’s design is optimized to improve the QoS, and the QoS values adapt proposed services with the help of the  OT.  The  second  phase  is  run  online.  Following  the optimization  of  the  QoS  criteria,  our  analysis  features  a 

Page 15: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

12 Truong Thi Bich Thanh

modified  reinforcement  algorithm,  in  order  to  offer  new scenarios. The “Proposition” phase is  then validated by  the OT and  the user’s opinion, and the service model updated. Adding probability models to the analysis allows us to detect an anomaly, a departure from the usual user profile, and to warn the family members, doctor and OT via internet. 

2. Modeling

In the context of our subject - existing home automation and  multimedia  services  -  our  approach  is  based  on  the ontology  of  returned  services.  Therefore,  our  first important  design  phase  is  the  service  and  scenario modeling  described  in  this  section. 

2.1. Service modeling

In  order  to  provide  semantics  for  the  various  elements of the service architecture, we will give some definitions in the context of home automation and multimedia systems. 

-  Operation:  an operation  is  a  function performed  by  a resource  (e.g.  ‘switch  on  light’  with  a PDA,  ‘turn on TV’ with  a  remote control). 

-  Service  is  a  function  or  a  set  of  mutually  dependent functions carried out by  the user. 

We  set  for  each  service  a  Quality  of  Service  value (QoS). We  recognize  two  types of  service: 

-  An  elementary  service  is  a  function  (e.g.  ‘turn  off light’), or a set of mutually dependent functions (e.g. ‘open door’  consists  of  two  mutually  dependent  functions ‘command  open  door’  and  ‘door  open’).  An  elementary service cannot  be broken  down  into  sub-services. 

-  A  scenario  is  made  up  of  at  least  two  elementary services  (e.g. a  ‘go out’  scenario  is achieved  through a set of services:  ‘open door’,  ‘turn off  light’ and ‘close door’.) 

Within  a  scenario,  according  to  the  importance  of function  failure,  we classify  functions  into  two categories: 

-  Critical  function:  a  function  is  critical  if  its  failure causes  the  failure of  the whole scenario. 

- Normal  function: a non-critical function. 

To  define  the  status  of  the  services,  we  have  three service  modes: 

-  Out  of  order  mode:  the  mode  which  causes  the scenario’s  failure. 

- Deteriorated  mode:  the  mode  indicating a decrease  in the scenario’s QoS without bringing the scenario to an end. 

-  Normal  mode:  the  mode  in  which  all  functions  run normally. 

Each of the means by which a function can be activated is  considered  as  a  distinct  operation.  We  therefore  assume the  existence  of  different  types  of  resources,  allowing  the user  to  activate a  service  through different  means. 

-  Direct:  the  user  accesses  the  resource  directly,  we have a  type of resource or device. 

-  Electronic:  through  electronic  control  buttons. 

- Domotic: through a user interface such as PDA, PC or touch  screen. 

From  these  definitions,  we  can  build  up  a  hierarchical 

architecture  of  services,  from  which  we  can  acquire  the configuration  of  a  scenario  brought  about  by  a  sum  of services. 

2.2. Scenario graph

A  set  of  at  least  two  services  make  up  a  scenario;  a service  may  contain  several  functions.  Thus,  the performance  of  a  scenario  corresponds  to  an  ordered performance  of  all  the  functions  which  make  up  the scenario.  In order to present  this  form of scenario, we will show the construction of a scenario graph. 

Beside  simple  services  which  involve  only  one operation  such  as  ‘Switch  on  light’,  ‘Turn  on  television’, there are complex services made up of several functions, in which  the  occurrence  of  the  next  function  depends  on  the result of  the previous one. For example,  in order to open a door,  the  function  ‘Unlock  door’  must  already  be accomplished.  In  order  to  draw  up  a  scenario  graph,  we need  to  discriminate,  in  the  scenario,  between  functional dependency  and  ordering  dependency. 

- Functional dependency: the term is used to express the connection  between  a  sequence  of  functions  performed  in a  predefined  order.  The  occurrence  of  the  next  function depends  on  the  result  of  the  previous  function  in  the sequence. Therefore, in order to complete this sequence, all the  functions  must  have  been  executed.  For  example, achieving  the  service  ‘Listen  to  Web  radio’  depends  on three  functions  with  functional  dependencies: 

+ Go on the Internet 

+ Connect  to a selected site 

+ Play  the radio 

The  service  ‘Listen  to  Web  radio’  implies  that  these three  functions  run  correctly. 

-  Ordered  dependency:  the  term  is  used  to  express  the connection  in  a  sequence  of  normal  functions  in  temporal order. The performance of a function does not depend on the result  of  a  previous  function.  For  example,  we  have  a sequence of three functions: ‘switch on light’, ‘open shutter’, and  ‘turn  on  television’,  which  is  performed  in  temporal order one after the other, but the function ‘open shutter’ does not depend on the result of the function ‘switch on light’. 

With these definitions, a scenario can be presented as a functions graph as shown in Figure 2. 

Figure 2. Illustration of a scenario as a function graph

In  this  graph,  the  nodes  perform  the  functions  in  the scenario.  The  dotted  edges  represent  the  ordered dependency  of  two  consecutive  functions,  whereas  the 

Page 16: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 13

plain edges denote the  functional dependency between two functions.  Node  ‘End’  and  node  ‘Start’  are  the  graph’s terminal  nodes,  indicating  the  beginning  and  end  of  the scenario.  If  a  critical  function  fails,  the  scenario  stops immediately; a point-edge to  the  ‘End’ node  is  realized. 

This  construction  makes  it  possible  to  visualize  all  the data contained  in a scenario, such as  the way a  scenario  is performed, critical functions within the scenario, as well as the  relationship  between  the  functions.  This  graph therefore enables us to describe the new scenarios provided by the analysis presented  in  the following section. 

3. Analysis

As shown in Figure 1, with the acquired service models, our analysis consists in offering new possible scenarios and detecting anomalies. To be able to offer new scenarios with a better QoS, we need to learn the user’s habits. This is one of the main purposes of our analysis. The guiding principle of our work is shown in Figure 3. 

Figure 3. Our method’s guiding principle

From  the  chaos  of  services  in  the  user’s  environment, we  learn  the  user’s  habits  through  a  modified reinforcement  algorithm,  and  then  detect  the  sets  of  usual services  to be offered  in new  scenarios. 

3.1. Modified reinforcement algorithm analysis

Every  day,  the  user  performs  various  activities,  among which  can  usually  be  detected  habits,  based  on  sets  of services requested in a coherent way. It  is well known that for  disabled  and  elderly  people  with  a  limited  movement capacity, it takes a long time to achieve a scenario consisting of several services, if they are performed separately. In order to reduce effort and to improve access to services, we collect the  sets  of  services  often  performed  together,  through  a reinforcement algorithm, and make them accessible within a scenario  launched  by  a  single  command.  Our  algorithm  is based on the graph construction. 

- Vertex i: the service i. 

- Edge: expresses the continuity of two services i and j, each  edge  being  characterized  by  a  weight  value  (i,  j) which is reinforced with each  repetition of the ‘i,  j’ set. 

In  order  to  detect  whether  a  pair  of  two  services  (i,  j) occur,  we  use  a  time  window  T.  Basically,  we  limit  the search  space  to  compact  scenarios,  namely  scenarios providing a number of services in a short period of time. For example,  we  limit  the  T  value  to  a  predefined  value 

corresponding to the user’s needs - or according to the OT’s opinion - (e.g. T = 30 minutes). Because the time activation between  services  is  an  important  parameter  in  a  context dealing  with  dependent  people,  the  smaller  the  interval  of time activation  between  services,  the  greater  the  weight  of the  edge.  We  therefore  consider  time  intervals  within  the window T,  in order  to  take  into account  the  importance of time  activation  between  services.  The  principle  of  this algorithm  is  therefore  based  on  the  computation  of  the weight (i, j) through the following formula: 

�� = �1 �� ���� �������� �����������

1 +(� ��)

� ����ℎ������

 (1) 

Where  N  is  the  number  of  time  intervals  in  the  time window T, and n is the nth interval (1 ≤ n ≤ N). 

Then, the value of weight(i,j) updated is given by 

���� ℎ�(�,�) = ���� ℎ�(�,�) + ��   (2) 

Observing  the  above  formula,  it  can  be  noted  that  the computed  value  of  weight  (i,  j)  presents  an  occurrence percentage for a pair of services (i, j). As a result, we obtain a graph of services in which the weight (i, j) of each pair of services  (i,  j),  is  sufficient,  according  to  the  OT’s  opinion (e.g. weight (i, j) >Pthreshold). 

On  the basis of  this graph,  we can offer new  scenarios by assembling possible sets out of services already existing in the graph. With these new scenarios, the user can access a set of services with a single command. If the user changes his  habits,  the  reinforcement  algorithm  can  learn  the  new behavior, and adapt the services to this change. Finally, the scenario graph can be used to present the obtained scenario in  a  time  order  corresponding  to  the  performance  time  of the  services  in  the  scenario. 

To  evaluate  the proposed  automatic  scenarios, we need to  measure  how  satisfactory  they  are  in  relation  to  the user’s  needs  and  capabilities.  It  is  moreover  essential  to quantify  the advantages of  the proposed scenarios. 

3.2. QoS validation

In  order  to  validate  the  performance  of  proposed scenarios,  we  use  the  QoS  criterion  to  assess  user satisfaction  as  to  the  performance  of  a  service.  QoS  is  the quality of service as perceived by the user. 

In  the  context  of  home  automation  and  multimedia systems,  we  take  into  account  the  user’s  needs  as  well  as the user’s ability  to perceive  the QoS. We  therefore extract the models of QoS calculation according to user needs and user abilities as well as user habits. Since our calculation is directly related to the user’s needs, an improved QoS value should produce an improved quality of life. In this sense, a service  performed  automatically,  through  an  automatic resource,  must achieve a  maximum QoS  value. 

According  to  this  definition  of  service  modeling,  the QoS  of  an  operation,  generated  by  the  performance  of  a function j on a physical resource I, is given by: 

����� = �� × ��  (3) 

Where:  0 ≤ Ri ≤ 1:  specific QoS  resource  i 

0 ≤ Rj ≤ 1: specific QoS function j 

Page 17: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

14 Truong Thi Bich Thanh

For  a  service  consisting  of  a  sequence  of  several functions  in  ordered  dependency,  the  QoS  is  computed with the following formula: 

��� =�

�∑ �����

���� = ��� �(�����)  (4) 

At  the  scenario  level,  if  a  critical  function  fails,  the scenario  is  interrupted  and  we obtain  a  zero  value of QoS. Since  the  performance  of  a  scenario  depends  on  the operation  of  the  critical  function  it  contains,  we  calculate the QoS of a scenario with the following formula: 

��� = ���������������,������������  (5) 

Where 

QoScritical:  QoS  value  of  all  the  contained  critical functions  in  the  scenario. 

If  this  principle  is  applied  to  new  scenarios,  once  the user  accepts  our  scenario  proposal,  all  the  services  within the  scenario  are  performed  by  automatic  resources, offering  a  maximum  QoS.  Otherwise,  the  user  must activate each service within the scenario manually, and  the resulting QoS  is  lower  than that of  the automatic scenario. This difference in QoS is  illustrated in Figure 4. 

Figure 4. The QoS difference

The  above  figure  shows  how  the  better  QoS  of  the automatic scenario generates both a gain of time and a gain of effort  for  the user. Therefore,  the QoS validation proves the relevance of  new scenarios. 

In  short,  on  the  basis  of  returned  services  for  the  user, we can perform the analysis which enables us to create new scenarios  with  better  QoS.  Then,  by  observing  the performance  of  the  accepted  scenarios  over  time,  and  in relation  to  the  user’s  habits,  we  can  detect  possible anomalies. Without  using sensors, our method  shows how user  habits  can  be  monitored  in  a  non-intrusive  way,  and warning  signs  detected.  At  this  point,  before  going  on  to actual experimentation with  the users,  the  relevance of our models  must  be  assessed. 

4. Test plateform

4.1. Introduction

In  order  to  test  both  our  model  and  our  approach  of dynamically  adapting  the  services  to  the  user  through solutions  of  non-intrusive  monitoring,  we  developed  a simulator  using  the  Scilabsoftware  [8].  This  is  an  open-source  equivalent  of  Matlab,  used  to  simulate  the  user’s everyday  activities.  Moreover,  this  software  enables  us  to create a reinforcement algorithm, and to draw up a scenario proposal  graph  automatically,  in  conjunction  with  the Graphvizsoftware. For  these reasons, we chose a simulator for our  test platform. 

4.2. Simulation design

This  subsection  describes  the  principles  of  our 

simulator’s  design.  Basically,  the  simulator  is  used  to generate  typical  events,  derived  from  the  user’s  activities, and  to  show  the  QoS  of  the  services  requested.  Since  our method  is  built  into  existing  home  automation  and multimedia  systems,  the  simulator’s  input  is  the  list  of services  including probability, dependencies, resource  type and  criticality  of  the  services.  These  profiles,  based  on interviews conducted by  the OT at Kerpape center  [1], are imported  into  the  user’s profile data  in  the  simulator. This simulator  also  has  the  capacity  of  integrating  the  type  of dynamic  analysis  introduced  in  the  previous  section,  to draw  up  better  service  proposals  and  new  scenarios.  This information  is  transmitted  by  internet  to  both  the  OT  and the  users  for  validation.  As  a  result,  our  method  can  be applied  to  a  close  approximation  of  the  user’s  real  daily life. The principle of the simulator is shown in Figure 5. 

Figure 5. Scheme of simulator design

As can be seen in this figure, on the basis of the profile data  obtained  from  information  on  the  user’s  daily activities,  a  set  of  everyday  services  is  generated, simulating  a  real-life  period  of  N  days.  From  this  output, we obtain a  test database enabling us  to analyze  the use of services  and  perform  the  QoS  calculation.  We  then  apply the  reinforcement  algorithm  to  the  generated  events  to draw up our proposal for a new scenario. By observing the use of the accepted scenarios in the defined time period, we can  detect  warning  signs  in  discrepancies  with  the  user’s usual  habits.  Finally,  the  user  profile  data  is  updated  with the accepted scenarios. Due to  the attributes of profile data based on real-life observation,  the generator can build up a relevant  test  database.  Our  analysis  thus  provides  reliable results,  adapted  to  the user’s  needs. 

5. Simulation results

This  section  describes  the  results  of  the  experimental simulation. According to  the simulator design diagram,  the engineering of a simulation consists in the following steps: 

- Step 1: Specify the table of services based on real-life observation  and  OT  advice.  For  example,  Figure  6 illustrates  this  type of  table: 

Figure 6. Table of the user’s everyday activities

-  Step  2:  Simulation  of  N  days  based  on  probability. Basically, from the probability of the need for each service, we  draw  up  the  list  of  the  daily  services  required  by  the 

Page 18: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 15

user as shown in Figure 7. 

Figure 7. Table of user profile

-  Step  3:  Analysis  of  user  habits  through  the reinforcement  algorithm  and  the  QoS  calculation. 

- Step 4: Offer of new services. Based on the results of Step  3,  new  scenarios  made  up  of  relevant  services  are automatically  drawn  up. 

- Step 5: User agreement. When the user accepts a new scenario,  this  means  that  the  habits  detected  are  reliable. Instead of  having  to  activate  all  the  services  manually,  the user can press one button to access the entire scenario. This reduces  the user’s effort while improving his or her access to  services. 

Figure 8. Graph of “Sleep” scenario proposal

For  instance,  by  applying  the  five  steps  listed  above with a threshold value of 50%, a ‘Sleep’ scenario has been obtained,  consisting  of  a  set  of  services  rendered  in  a predefined order. This new scenario has been automatically drawn up, as shown in the scenario graph (Figure 8). 

Our  test  is  based  on  observation,  and  elaborated  in collaboration  with  OTs  from  Kerpape  Center,  a  large treatment  center  for  the  disabled.  This  figure  shows  a critical  “Switch  off  light”  function.  The  activation  of  the whole  scenario  depends  on  the  activation  of  this  specific function:  if  it  operates  normally,  this  automatic  scenario gains  maximum  QoS.  While  in  manual  way,  obtained QoSvalue  is  smaller  due  to  difficulty  of  user  in activationaction  for  each  service.  Figure  9  shows  the  QoS of a proposed scenario  with better value. 

From  the  simulation  results,  we  can  derive  a  non-intrusive observation of  the user through his activities with existing  home  automation  and  multimedia  systems.  If  the user’s  behavior  changes,  the  reinforcement  algorithm makes  it  possible  to  detect  these  new  habits,  and  to  put 

forward new  scenarios adapted  to  the change. 

This paper has described a non-intrusive method with a test platform in SCILAB to detect automatically  the user’s habits and  to offer new scenarios. The  result enables us  to observe  the user’s daily  life without  recourse  to  the use of sensors,  and  to  improve  the  user’s  quality  of  life  while facilitating his or her use of daily  services. 

Figure 9. QoS value of proposed scenario

In  the  next  step,  our  simulator  is  used  to  test  our strategies  of  anomaly  detection,  so  as  to  offer  a  complete non-intrusive  monitoring of  the users’  daily  life. To detect anomalies,  a probability  model  for  computing  the duration or  delay  in  the  use  of  a  service  is  given.  For  real-life experiments, we plan to use an open-source Linux MCE to present  the  user  interface  –  a  well-adapted  solution  to create  a  genuine  test  environment  in  a  user’s  home  or  in one of the rooms. 

TÀI LIỆU THAM KHẢO

[1] Kerpape  mutualistic  functional  reeducation  and  rehabilitation center. 

[2] World population ageing 1950-2050. 

[3] http://www.un.org/esa/population/publications/worldageing19502050/, 2002 

[4] T.S.Barger,  D.E.Brown,  and  M.Alwan.  Health-status  monitoring through  analysis  of  behavioral  patterns.  IEEE Transactions on Systems, Man, and Cybernetics, Part A, 35(1):22–27, 2005. 

[5] N.Kushwaha, M.Kim, D-Y.Kim, and W-D.Cho. An intelligent agent for ubiquitous computing environments: Smart home UT-AGENT. In WSTFEUS, pages 157–159. IEEE Computer Society, 2004.

[6] Dobkin,  Bruce  H.,  and Andrew  Dorsch. The  Promise of  mHealth: Daily Activity Monitoring and Outcome Assessments by Wearable Sensors. Neurorehabilitation and neural repair 25.9 (2011): 788–798. PMC. Web. 2 May 2016. 

[7] Ali Hussein and all. Smart Home Design for Disabled People based on Neural Networks.Procedia Computer Science, Volume 37, 2014, Pages 117-126.

[8] Basma  M.  Mohammad  El-Basioniand  all.  Independent  Living  for Persons  with  Disabilities  and  Elderly  People  Using  Smart  Home Technology. International Journal of Application or Innovation in Engineering & Management (IJAIEM), Volume 3, Issue 4, April 2014. 

[9] S.Campell,  J-P.Chancelier,  and  R.Nikoukhah.  Modelingand Simulation in Scilab/Scicos. Hardcover, 2006. 

[10] R.S.  Sutton  and  A.G.Barto.  Reinforcement  Learning:  An Introduction  (Adaptive  Computation  and  MachineLearning). Hardcover edition, 1999. 

(The Board of Editors received the paper on 12/04/2016, its review was completed on 15/05/2016)

Time Daily activities Resource E14 15:00:00 Turn on computer PC

E1 08:00:00 Switch on light PC E15 17:00:00 Turn off computer PC

E2 08:05:00 Open shutter PC E16 19:00:00 Switch on light PDA

E3 08:10:00 Turn on TV PC E17 20:00:00 Turn on TV PDA

E4 08:15:00 Turn on hot water PC E18 20:30:00 Watch DVD PDA

E5 08:30:00 Unlock door PC E19 21:00:00 Turn on light ext PDA

E6 08:45:00 Turn off TV PDA E20 21:15:00 Hang on telephone PDA

E7 08:55:00 Open door PDA E21 21:30:00 Hang up telephone PDA

E8 09:00:00 Switch off light PDA E22 21:50:00 Close shutter PDA

E9 09:05:00 Close door PDA E23 22:00:00 Turn off DVD PDA

E10 13:00:00 Open door PDA E24 22:00:00 Locate beb Touch screen

E11 13:10:00 Close door PDA E25 22:15:00 Turn off TV PC

E12 13:25:00 Install beb PC E26 22:30:00 Switch off light ext PC

E13 14:30:00 Uninstall bed PC E27 22:40:00 Switch off light int PC

Page 19: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

16 Vu Van Thanh, Thai Van Tien

RESEARCHING ON AND DESIGNING TEMPERATURE CONTROLLER FOR HEATERS

Vu Van Thanh, Thai Van Tien

The University of Danang, University of Science and Technology [email protected]; [email protected]

 Abstract - This paper presents design solutions of control circuit and temperature stability in a closed environment, in order to increase stability and the fast response of heaters to save energy efficiently. A PIC micro-controller is used to perform P.I.D and ON/OFF algorithms in temperature control and stabilization.This is the new point compared to traditional temperature stability systems. The temperature of the heater is updated through the PT100 temperature sensor. The output of the control system includes the cooling fan and thermal wire to create temperature. The output control signal is a stimulus angle control signal of the Triac. This signal is calculated by P.I.D algorithm. The control program of system contains the P.I.D and ON/OFF program. The results of the paper are to evaluate the fast response, stability, reliability and accurate control of the circuit.

Key words - PIC16F877A; PID control; ON/OFF control; Zero Crossing; Temperature Control.

1. Introduction

Temperature  control  application  areas  are  very  broad, which could be as  large as  industrial production, aerospace or  as  small  as  our  daily  life.  Currently,  most  temperature control  systems  use  computer  control  technology  with  a microprocessor  core,  both  improving  the  degree  of automation of the device and  the accuracy of the control. 

PID control is by far the most common control method. Because  of  its  high  reliability,  simplicity  and  algorithm robustness, it is widely used in process control, especially for establishment  of  deterministic  system  of  a  precise mathematical model. PID control effect depends entirely on the four parameters [1], [2], namely the sampling period Ts, the  proportional  coefficient Kp,  integral  coefficient Ki  and differential  coefficient Kd. Thus,  the PID parameter  setting and optimization are two important topics of research in the field of automatic control. PID in industrial process control applications  nearly  has  a  hundred  years  of  history,  and during  this  period,  despite  the  advent  of  many  control algorithms, thanks to the long-term use of the PID algorithm and  its  own  characteristics,  coupled  with  people accumulating  a  wealth  of  experience  it  is  widely  used  in industrial control. In PID algorithm, the key issues lie in the setting and optimization of the three parameters of the P.I.D [3],  [4].  With  the  continuous  development  of  science  and technology,  people  have  increasingly  high  requirement  for temperature  control  system,  so  temperature  control  system that is highly precise, intelligent and humane is the inevitable trend of development at home and abroad. The introduction, application, development  and  production of programmable controller begin along with the reform and opening up. 

The  PID  controller  output  is  converted  into  high  and low  signal  input  control,  controlling  the  zero  trigger  plate according  to  certain  duty  cycle  conduction.  It  controls energization  time  of  both  ends  of  thermal  resistance  wire or  cool  fan,  achieving  closed-loop  temperature  control. 

2. Temperature Stable and Control System

The  control  system  includes  an  heater  containing  a 500W  thermal  wire  to  generate  heat,  one  PT100 temperature  sensor,  a  sensor  amplifier  circuit  located outside, Zero crossing detector, one Triac controller and an AC  cooling  fan.  MCU  circuit  using  PIC16F877A microcontroller  perform  PID  algorithm  for  control  of stimulus corner and ON/OFF of  the Triac. 

Figure 1. Block diagram of the control system

Input of control system has a PT100 sensor, one sensor amplifier  and  zero  crossing  detector. 

Figure 2. Heat sensor and Measurement amplifier

PT100  sensor  and  R18,  R19,  R20  make  up  a  resistor bridge;  the  output  of  this  resistor  bridge  is  put  into  the differential  amplifier  using  Opamp,  then  further  passed through the non-inverting amplifier with amplification factor adjusted by VR2. To calibrate the circuit, by replacing PT100 with 195.9Ω resistor and adjust VR2 so that the voltage will be 5V at AN0 pins. R17 and zener D5 controlling the output voltage  of  the  amplifier  is  5.1V,  the  load  which  is  not connected to the sensor. When the temperature changes from 0 - 255°C, corresponding to the output voltage changes from 0 - 5V. Thus, if using an 8-bit ADC converter respectively to one,the change level of the ADC is 1°C. 

AN0

U8

lm358

U9

lm358

R12

220k

R13

220k

R14

220k

R15

1k

R16

47k

R17

1k

R184.7k

R194.7k

R20220k

R21100

C3

0.1uF

PT100

VR2

50k

D5zener 5.1V

Page 20: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 17

Figure 3. Zero Crossing detector circuit

Zero-crossing  detector  is  located  between  02  semi period  of  the  AC  source,  helping  the  microcontroller determine  the  accurate  positioning  to  find  the  stimulus angle, δ = 00 of  Triac. 

Figure 4. Zero Crossing detector signal

Experimental results from Zero Crossing detector circuit is given by Figure 5, performed on oscilloscope meter. 

Figure 5. Zero Crossing detector real signals

Because  PIC  microcontroller  uses  external  interrupt  0 and  impacts  along  the  side  down  to  find  the  location  zero crossing,  the  signal  out  of  detector  should  need  reverse-phase versus  the signals  in Figure 4. 

Trigger  and  Triac  control  circuit  include  an  opto-triac MOC3021  used  to  isolate  stimulus  signal  of microcontroller  with  the  grid  power 220V/  50Hz. 

� � = (� �� − � � )/��� .  Where:  VF  is  the  forward voltage  of  infrared  light  -  emitting  diode  and  it  can  take values  from  1.2V  to  1.4V;  IFT  is  the  trigger  current  of infrared  emitting  diode.  If  the  working  temperature  is below  25OC,  the  value  of  IFT  should  be  appropriately increased.  R10  is  the  triac  gate  resistor.  In  the  case  of relative  high  SCR  sensitivity,  the  gate  resistance  is  also 

high.  The  paralleling  of R10 can  improve  the  interference resistance.

Figure 6. Isolation circuit and Triac controller

3. Control Method

The  controller  allows  the  temperature  in  the  heater  to stabilize  at  one  pre-determined  value  by  controlling  speed of the cooling fan and the heating level of the thermal wire. 

3.1. ON/OFF control

An on-off controller is the simplest form of temperature control device. The output from the device is either on or off, with  no  middle  state.  An  on-off  controller  will  switch  the output only  when  the  temperature  crosses  the  setpoint. For heating  control,  the  output  is  on  when  the  temperature  is below  the  setpoint,  and  off  above  setpoint.  Since  the temperature crosses  the setpoint  to change  the output state, the  process  temperature  will  be  cycling  continually,  going from  below  setpoint  to  above,  and  back  below.  In  cases where this cycling occurs rapidly, and to prevent damage to contractors and valves, an on/off differential, or “hysteresis,“ is added to the controller operations. This differential requires that  the  temperature  exceed  setpoint  by  a  certain  amount before  the  output  turns  off or on  again.  On-off  differential prevents  the  output  from  “chattering”  (that  is,  engaging  in fast, continual  switching if  the temperature’s cycling above and below the setpoint occurs very rapidly). On-off control is usually  used  where  a  precise  control  is  not  necessary,  in systems  which  cannot handle  the  energy’s being  turned on and off frequently, where the mass of the system is so great that  temperatures  change  extremely  slowly,  or  for  a temperature alarm. One special  type of on-off control used for alarm is a limit controller. This controller uses a latching relay, which must be manually reset, and is used to shut down a process when a certain temperature is reached. 

Figure 7. ON/OFF control signal

INT0

R4

220k

R5220k

BR1

BRIDGE

R622k

C110u

D4DIODE

6

5

4

1

2

U1

OPTOCOUPLER-NPN

R1

10k

Q12N2222

R1110k

V1220VACC2

1nF

VDK

1

2

6

4

U6

MOC3021

U7TRIAC

R9100

D3LED-GREEN

R10

2.2K

V3220VAC

QUAT/NHIET TRO

Page 21: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

18 Vu Van Thanh, Thai Van Tien

3.2. PID control

A  PID  (Proportional-Integral-Derivative)  controller  is  a control  loop  feedback  mechanism  commonly  used  in industrial  control  systems.  A  PID  controller  continuously calculates  an  "error  value"  as  the  difference  between  a measured  process  variable  and  a  desired  setpoint.  The controller  attempts  to  minimize  the  error  over  time  by adjusting  a  control  variable,  such  as  the  position  of  a control valve, a damper, or  the power supplied to a heating element, to a new value determined by a weighted sum: 

�(�) = �� �(�) + �� ∫ �(�)�� + ����

��

�  (1) 

Control  signal  of  the  PID  controller  for  each  sampling interval  (T)  is determined  as; 

�� = �� + (�� − ��)�� + (���2�� + ��)��

�+ (��+��)

���

�  (2) 

Where, Kp, Kd and Ki are  coefficients  of  proportional, integral  and  derivative  elements,  respectively.  P0  is  the control  signal  of  the  previous  sampling,  e1  is  the  current error, e2 is error of previous sampling and e3 is  the error of the  sampling before previous  sampling  [5]. 

Application of PID to control temperature stability is to calculate  stimulus  angle  for  Triac  by  the  phase  angle control  method. 

Figure 8. Phase controller - resistive load

The operation of a phase controller with a resistive load is  the  simplest  situation  to  analyse.Waveforms  for  a  full wave  controlled  resistive  load  are  shown  in  Figure  8.  The triac is triggered at angle δ, and applies the supply voltage to the  load.  The  triac  then  conducts  for  the  remainder  of  the positive half-cycle, turning off when the anode current drops below  the  holding  current,  as  the  voltage  becomes  zero  at θ = 180˚. The triac is then re-triggered at angle (180 + δ)˚, and  conducts  for  the  remainder  of  the  negative  half-cycle, turning off when its anode voltage becomes zero at 360˚. 

The  sequence  is  repeated  giving  current  pulses  of alternating polarity which are fed to the load. The duration of each pulse is  the conduction angle α,  that  is (180  - δ)˚. The output power is therefore controlled by variation of the trigger angle δ. For all values of α other than α = 180˚ the load current is  non-sinusoidal.  Thus,  because  of  the  generation  of 

harmonics, the power factor presented to the a.c. supply will be less than unity except when δ = 0. For a sinusoidal current the rectified mean current, IT(AV) and the rms current, IT(RMS), are related to the peak current, IT(MAX), by equation 4. 

�� (��) =2. �� (���)

�= 0.637. �� (���) 

�� (���) =��(���)

√�= 0.707. �� (���)  (3) 

Where, 

�� (���) =��(���)

��=

√�.�(���)

��  (4) 

4. Experimental Results

The  control  program  is  written  in  C  codes  and converted  to  hexadecimal  codes  by  the  PIC.C  software. Hex codes are transferred  to  the PIC by a programmer that we have  formed according to the scheme below [6]. 

Flowchart of the program is shown in Figure 9: 

Figure 9. The control program flow chart

Figure 10. Temperature result in the heater

Page 22: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 19

While  the  temperature  of  the  outer  environment  is 290C,  the  heater  is  heated  during  6  minutes  and  then  heat of inner environment is measured at 400C. Graph of heating versus time for the heater is  shown in Figure 10. 

Ziegler-Nichols  method  is  used  to  adjust  PID  for temperature control  system of  the heater. Model open-loop system  of  the  heater  is  implemented  in  the  laboratory  as follows:  K=200,  L=40,T=1200,  then  transfer  function  of 

the  object:  �(�) =���

(�����)(������ �).  This  function  is 

performed on  simulink such as Figure 11. 

 

 

 

Figure 11. Model open-loop system of the heater

Figure 12. The response of the open-loop system

In Figure 12, we draw a  tangent  at  the  inflection point to  figure  out  the  parameters  T1 =  5, T2 = 80  then  find out the  parameters  of  the  PID  controller  follow  Ziegler-Nichols  method: 

Table 1. Adjust the PID parameters follow Ziegler-Nichols

Controller KP Ti Td

PID 1.2

��

���= 0.1 

2T1=10  0.5T1=2.5 

Find  G(PID)s: 

G(PID)=Kp(1+�

���+ �� �)=0.1+0.01s+0.25s 

Figure 13. PID controller by simulink

Through  the survey of  the parameters affecting Kp, Kd, Ki,  PID  controller  can  find  a  transfer  function  of  the controller  to  respond  to  the  best  of  the  object:  Kp  =  0.5, Kd = 0.2, Ki = 0.01. 

Control  system  with  PID  algorithm  determines  the stimulus  angle,  δ  to  enable  Triac  controlling  the  rotation speed  of  the  cooling  fan,  helping  the  heater  temperature reduce  to  the  setpoint  value  of  360C.  The  figure  below shows  the  changes  of  δ  corresponding  to  the  changes  of temperature  in  the  heater. 

(a) Temperature >=400C  (b) Temperature = 390C 

 

(c) Temperatue = 380C  (d) Temperature = 370C 

Figure 14. (a), (b), (c), (d) are the different temperature

When  the  temperature  into  the  heater  is  larger  and greater  than  setpoint  value,  the  error  (current  temperature value  –  setpoint)  increases.  The  stimulus  angle, δ  =  00 means  Triac  for  active  load  with  100%  capacity.  As  the temperature  decreases  to  the  setpoint,  δ  will  gradually increase  to  1800  meaning  the  value  of  the  heater temperature reaches the setpoint and the Triac will turn off, corresponding  to  the  load  of  the  cooling  fan  or  in  the opposite,  the  thermal  wire  will  stop operations. 

Figure 15. PID control results on the circuit

Using  ON/OFF  controller  is  started  with  setpoint  is 360C, as shown in Figure 16. 

34

35

36

37

38

39

40

41

42

Temperature (oC)

1                              5                                10t(min)

200

40� + 1 

1

1200� + 1 

step                         Tranfer 1                 Tranfer 2                    Scope1 

Page 23: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

20 Vu Van Thanh, Thai Van Tien

Figure 16. ON/OFF control results on the circuit.

From the results of the two of control methods, we can see that: settling time of the PID controller is faster than the ON/OFF  controller.  Overshoots  and  undershoots  are relatively small. Thus, compared with the control method of the  traditional  heater,  the  control  circuit  and  temperature stabilization by PID and ON/OFF enables the heater to have more  flexible  control  and  temperature  stability,  energy saving  through reducing  the  losses due  to  the phenomenon of temperature control inefficiency of ON/OFF methods. 

5. Conclusion

In  the  temperature  control  system,  the  heater  is  aimed to  be  cooled  by  PID  and  ON/OFF  control  methods.  In  the both  methods,  system  is  cooled  linearly  until  a  certain degree  which  is  above  the  heat  of  outer  environment. Oscillations after  this  temperature  is sourced by rolling-off the  PAN  speed.  Cooling  rate  is  reduced  relative  to  the reduction  in  the  error  and  can  not  remove  the  heated  air 

away sufficiently. 

That  is  why  temperature  occasionally  increases  and decreases.  In order  to set  the  temperature under  the heat of the  outer  environment,  a  cooler,  such  as  Peltier  cooling elements can be used instead of the fan. These elements can reduce  the  temperature  under  negative  degrees.  This  will also  reduce  the settling  time. 

The results have proved that the PID control system has fast  response, high  accuracy  and  stability. 

Acknowledgment

Many  thanks  to  the  reviewers  for  their  detailed  and constructive  comments,  which  meaningfully  helps  to improve  this  paper. 

REFERENCES

[1] Yun Niu, Lurong Cao, Xuguang Wu, ShouJun Song, "Optimal Co-design of Control and Scheduling for Distributed Industrial", AISS, Vol.4, No. 13, pp. 135 ~ 143, 2012. 

[2] Jung-Sook  Kim,  "Development  of  Intelligent  Machinery  and  IT Convergence  Using  Case-Based  Reasoning", JCIT, Vol. 6,  No. 5, pp. 61 ~ 68, 2011. 

[3] Chen Chao-Da Lv Zhi-Sheng, "Temperature Control In Agricultural Preservation  Application  Research", IJACT, Vol. 4, No. 1, pp. 470 ~ 476, 2012. 

[4] Jun  Bi,  Dongfusheng  Liu,  Kexin  Zhan,  "PID  Parameters Optimization  for  Liquid  Level  Control  System  Based  on  Genetic Algorithm", JDCTA, Vol. 6, No. 1, pp. 361 ~ 368, 2012. 

[5] N.  Kuo,  C.  Benjamin,  Digital  Control  Systems,Saunders  College Publishing, 1992. 

[6] Flash PIC Programmer, www.rotgradpsi.de/mc/index.html. 

(The Board of Editors received the paper on 10/11/2015, its review was completed on 21/01/2016)

Page 24: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 21

THE EFFECTS OF VARIABLE THERMOPHYSICAL PROPERTIES ON DROPLET EVAPORATION IN HIGH TEMPERATURE CONVECTIVE

FLOW ENVIRONMENT

Nguyen Thi Bang Tuyen1,2, Subhasish Mitra1, Duong Viet Dung2, Nguyen Vo Dao2, G.M. Evans1 1Discipline of Chemical Engineering, School of Engineering, University of Newcastle, NSW 2308, Australia

2University of Science and Technology, The University of Danang, [email protected]

 Abstract - Evaporation of fuel droplets in a convective environment has significant applications in several energy systems, for example in internal combustion engines. Appropriate estimation of evaporation rate is critical in predicting performance of the system, which involves computation of the relevant heat and mass transfer terms. All of these terms are sensitive to the physical properties of the phases and affected by the transient variation of the corresponding phase temperature. In the present study, effects of temperature dependent thermo-physical properties of both liquid and gas phases on the evaporation behaviour of the droplet are investigated using a previously reported vaporization model (Nguyen et al., 2015) and compared with the available experimental data. Analysis shows that in a high temperature ambiance, use of temperature dependent thermo-physical properties for the gas phase and constant properties at an average temperature for the liquid phase produce the best agreement with experimental data.

Key words - evaporation, heat transfer, mass transfer, thermos-physical properties; average temperature.

1. Introduction

Droplet  evaporation  has  many  significant  applications in  several  energy  systems  such  as  in  internal  combustion engines,  gas  turbines,  liquid  rocket  engines,  liquid  fuel fired  industrial  furnace  etc. 

The  fuel  droplet  evaporation  models  have  been categorized  into  the  following  six  groups  with  increasing level  of  complexity  in  computation  (Sirignano,  2010):  (1) constant  droplet  temperature  models  (2)  infinite  liquid thermal  conductivity  models;  (3)  finite  liquid  thermal conductivity  models;  (4)  effective  liquid  thermal conductivity  models  where  both  the  finite  liquid  thermal conductivity  and  the  recirculation  inside  droplets  are accounted;  (5) vortex  model where  the  recirculation  inside droplets  in  terms  of  vortex  dynamics  is  described;  and  (6) Navier-Stokes solution models where the complete solution of  the  flow  field can be obtained. The 1st group of  models assumes isothermal condition and neglects any temperature gradient  inside droplet  which  enables  related computations to be faster.Nonetheless,  such assumption  in  the context of real application is over-simplified and may be inappropriate for droplets evaporating in a high temperature environment. In  contrast,  the  fifth  and  sixth  group  models  are computationally  expensive  even  for  single  droplet calculations and often limited by the available computational resources for use in spray calculation (multi-droplet system). Models belonging to group (2), (3) and (4) have been used in  droplet  evaporation  studies  over  several  decades. Although  simple,  the  infinite  thermal  conductivity  (ITC) modelfrom  2nd  group  has  been  applied  successfully  in application like spray combustion (Chen and Periera, 1996) for  its sufficient accuracy. Also,  this model was previously revised  and  validated  by  Miller  et  al.  (1998)  and  later  by 

Nguyen et  al.  (2015) using experimental data of  Ranz  and Marshall (1952) and Downing (1966). 

A major concern in the vapour-liquid equilibrium based evaporation  models  is  the  flow  of droplet’s  vapour around interface,  which  significantly  reduces  the  evaporation  rate by  preventing  contact  between  fresh  hot  gas  and  the droplet. Since  the  introduction of  the  Frossling’s  empirical correlations  in  1938,  there  have  been  several  modified evaporation  models  to  account  for  this  vapour  blowing effect  (Stefan  flow)  in  the  modelsusing  appropriate correction  factors  (Ranz  and  Marshall,  1952;  Yuen  and Chen,  1976;  Renksizbulutand  Yuen.,  1983;  Miller  et  al., 1998; Sazhin et  al.,  2006). 

Figure 1. A subcooled liquid droplet evaporating in hot gasstream

Briefly,  the  evaporation  process  of  a  single  subcooled droplet  in  a  hot  convective  environment  involves simultaneous  heat  transfer  from  gas  to  liquid  phase  and mass transfer from the liquid phase to gas phase (Figure 1). In  a  high  temperature  environment,  gas  phase  temperature may  be  assumed  to  remain  unchanged;  however; temperature  of  both  liquid  and  vapour  mixture  near interface will  substantially  increase during  the evaporation process. Conversely,  for  a  low  temperature case,  change  in droplet and vapour mixture temperature is insignificant and therefore can be ignored. However, for a significant change in  the  liquid  temperature  due  to  a  high  gas  temperature, dependence  of  the  physical  properties  on  temperature needs to be taken into account to determine the evaporation rate. The present study paper aims to investigate the effects of  variable  thermo-physical  properties  on  the  droplet evaporation  in  high  temprature  of  the  gas  stream. Calculations in  the present study are obtained by using the revised  ITC  model  in  which  the  modified  Nu  and  Sh numbers  suggested  by  Abramzon  and  Sirignano  (1989) based  on  film  theory  are  used  to  account  for  the  Stefan flow.Details of  the model can be found in  the earlier  study of  the  authors  (Nguyen  et  al.,  2015).  The  model  is evaluated  against  the  experimental  data  of  Wong  and  Lin (1992)  for  a  single  decane  droplet  evaporating  in  high temperature of  the ambient gas. 

Page 25: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

22 Nguyen Thi Bang Tuyen,, Subhasish Mitra, Duong Viet Dung, Nguyen Vo Dao, G.M. Evans

2. Model descriptions

Assuming  spherical  shape  and  uniform  temperature  in the entire  liquid droplet,  the  transient  temperature (Td) and mass (md) of the droplet can be written as: 

/dd pL G G d v d

dTm C dNu k T T L m

dt   (1) 

ln 1d G v Mm d D Sh B   (2) 

The droplet diameter could be calculated either from the droplet evaporation ratemdor from the total droplet mass md 

simply  as 1/3

6 /d Ld m   which  is  used  in  the  present 

study.  Thermodynamic  liquid-vapour  equilibrium  state  at the droplet  surface  is  assumed and  the  Clausius-Clapeyron correlation is utilized to estimate the vapour pressure; mole and  mass  fraction  of  the  vapour  at  the  droplet  interface. Substituting  vaporization  term  from  Eq.  (2)  into  Eq.  (1), Eq.  (1)  is  integrated  by  a  4th  order  Rung-Kutta  method  in MATLAB  (ver:  2013)  to  determine  the  transient temperature and diameter variation of the droplet. The time step  size  is  selected  based  on  the  characteristic  heating-up time,  which  is  found  to  be  smallest  compared  to  other characteristic  times.  Temperature  dependent  liquid  phase 

properties  such  as  density  (L),  viscosity  (L),  thermal conductivity (kL) and heat capacity (CpL) are computed using Peng-Robinson equation of state model in Aspen Properties package (V8.4).Binary diffusion coefficient (Dv) is obtained from the Chapman-Enskog formulation (ref). Vapour phase properties specifically heat capacity (Cpv) and latent heat of evaporation (Lv) and all physical properties of carrier gas are calculated at the wet bulb temperature correlation proposed by Miller et al. (1998) as follows: 

0.68

10137 / 373.15 log ( ) - 45WB B GT T T   (3) 

3. Results and Discussions

The  numerical  results  obtained  from  the  model  are evaluated  against  the  experimental  data  of  Wong  and  Lin (1992).  This  particular  experimental  research  reports  both the  temporal  squared  diameter  and  temperature of  a  single decane  droplet  (d0=2.0mm)  evaporating  in  a  very  high temperature  low  Reynolds  number  ambiance  (TG=1000K, Red0=17  or UG=1.0m/s).  Unlike  many  other  experimental studies  where  only  the  temporal  reduction  of  droplet diameter  is  reported,  data  of  Wong  and  Lin  (1992)  also comprises  transient  temperature  measurement  of  the droplet, which allows a thorough evaluation of the models. 

As  the  temperature  of  the  liquid  droplet  varies  during the  vaporization  process,  the  relevant  physical  properties such  as  density,  heat  capacity,  thermal  conductivity, viscosity,  latent  heat  of  vaporization  and  binary  diffusion coefficient  need  to  be  computed  at  the  corresponding temperature.  The  impacts  of  these  variable  physical properties  on  the  evaporation  time  are  investigated  in  the present  study.  First,  the  effects  of  the  binary  diffusion coefficient  on  the  evaporation  behavior  are  examined. Equation (2)  indicates  that binary diffusivity (Dv)  is  related to the vaporization rate of droplet which in turn affects  the droplet temperature as can be found in Eq. (1). One can see that  a  higher  value  of  diffusion  coefficient  results  in  a 

higher  vaporization  rate,  which  in  turn  predicts  a  lower droplet  temperature.  In  this  study Dv is estimated using the Chapman-Enskog  theory  based  on  the  Lennard-Jones parameters  obtained  from  four  different  sources  (see Appendix).  Temperature  term  in  the  expression  of  Dv  is computed  using  the  wet  bulb  temperature  TWBgiven  in Eq.  (3).  Four  different  sources  of  Lennard-Jones parameters  provide  a  wide  range  of Dv from 0.55 x 10-5 to 1.11  x  10-5  m2/s.  Figure  2  and  Figure  3  compare  droplet size  and  temperature  using  these  four  different  diffusivity parameters.  The  largest  deviation  in  the  model  prediction is  ~  2.5%  for  droplet  lifetime  (Figure  2)  and  ~  3.6%  for droplet  temperature  (Figure  3)  which  results  in  11o difference.  Results  obtained  by  the  largest  Dv  at 1.11 x 10-5 are found  to agree with experimental data. 

Figure 2. Effects of the diffusion coefficient on the droplet size. Conditions are: Td0=315K. TG=1000K. TB=447.1K. d0=2mm. Red0=17

Figure 3. Effects of the diffusion coefficient on the droplet temperature. Conditions of Figure 2

Figure 4. Effects of the temperature dependent diffusion coefficient on droplet size. Conditions of Figure 2

Page 26: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 23

Figure 5. Effects of the temperature dependent diffusion coefficient on droplet temperature. Conditions of Figure 2

Figure  4  and  Figure  5  present  the  droplet  size  and temperature  profiles  with  the  two  different  diffusion coefficient  evaluation  methods,  i.e.  Dv=f(TWB)  and Dv=1.11  x  10-5  (constant).  Better  agreement  with experimental  data  is  obtained  when  the  temperature dependent  Dv is  used  which  results  in  NRMSD=0.10  for droplet  size  and  NRMSD=0.06  for  droplet  temperature compared  with  constant Dv which  yields  an  NRMSD=0.14 and  0.12  for  droplet  size  and  temperature  respectively. 

Figure 6. Effects of the liquid properties on the droplet evaporation time. Conditions of Figure 2

The  effects  of  the  liquid  physical  properties  on  the droplet  lifetime  are  presented  in  Figure  6.  Relevant thermos-physical  properties  of  liquid  phase  such  as density,  viscosity,  thermal  conductivity  and  heat  capacity are  estimated  by  three  different  methodologies:  (1)  at droplet  temperature, Td (base  case);  (2)  at  constant  droplet temperature,Td0;  and  (3)  at  constant  average  droplet temperature, Tavg. The average temperature Tavg is obtained as  Tavg=0.5(Td0+TB)=381K (Abramzon&Sirignano,  1989) based  on  the  assumption  that  droplet  temperature  will increase  to  boiling  point  from  its  initial  temperature  while evaporating  in  a  high  temperature  environment.  The evaporation  time  is  found  to  be  ~  12%  larger  when  the liquid  properties  are  evaluated  at Td0 compared  to  the  base case  at Td. Deviation in model prediction reduced to only ~ 2% when thermos-physical properties are estimated at Tavg. This  insignificant  difference  suggests  use  of  average temperature  to  estimate  properties  in  the  model  for droplet evaporation  in  high  temperature  carrier  gas.  However,  a 

caution  is  worth  noting  when  carrier  gas  temperature  is lower  than  the  boiling  point  of  droplet.  Use  of  average temperature  expression  mentioned  before  in  this  case  may lead  to  a  lower  value  compared  with  the  real  average droplet  temperature. 

4. Conclusion

The  effects  of  the  thermo-physical  properties  of  the gas  and  liquid  phase  are  evaluated  by  using  the  revised infinite  thermal  conductivity  model  and  published experimental  data.  For  the  gas  phase  (vapour  mixture), calculations  using  temperature  dependent  binary diffusion  coefficient  provides  a  better  agreement compared to constant diffusion coefficient. For the liquid phase,  a  deviation  ~  12%  in  the  evaporation  time  are found as  the physical  liquid properties evaluated once at the droplet’s initial condition whereas a negligible change in  the  evaporation  time  (~2%)  as  these  properties  are evaluated  once  at  the  temperature  average  temperature (compared  to  the base case of  instantaneous  temperature dependent properties). This study therefor concludes that temperature  dependent  properties  for  the  gas  phase  and constant  properties  at  the  average  temperature  for  the liquid  phase  should  be  used  for  the  droplet  evaporation calculations  in  high  temperature  environment  to  obtain better agreement with experimental data. 

Notation

T temperature, K 

U velocity of gas  respecting  to droplet, m/s

M molecular  weight, kg/kmol

m mass, kg 

d droplet, m 

Cp heat  capacity, J/kgK 

dm evaporation  rate, kg/s 

LV latent  heat  of  evaporation, J/kg 

k thermal  conductivity, W/mK 

Dv diffusion coefficient of  vapour  into air, m2/s

Sh=Kdd/Dv, (K is  mass  transfer coefficient) 

Nu=hdd/kG, (h is  heat  transfer  coefficient)

Pr /G pG GC k Prandtl  number  of 

Re /d G d GU d  Reynolds number of  gas phase 

Greek letters

viscosity, Ns/m2 

density,kg/m3 

Subscripts

d Droplet 

G gas 

L liquid 

V vapour 

NRMSD: Normalized  Root  Mean  Squared  Deviation, itwas defined by ratio between the RMSD and the range of the  measured  data  (maximum  value  minus  minimum value). 

Page 27: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

24 Nguyen Thi Bang Tuyen,, Subhasish Mitra, Duong Viet Dung, Nguyen Vo Dao, G.M. Evans

APPENDIX

Physical properties of liquid Decane

Vapour  (Abramzon&Sirignano,  1989) 

/1000 0.8 :W B

T  2106.6 5765 /1000 1675 ( /1000)pV W B W BC T T

3473.1 ( / 1000)

/ 1000 0.8 :

W B

W B

T

T

2

3

411.1 5460 /1000 2483 ( /1000)

422.9 ( /1000)

pV W B W B

W B

C T T

T

Liquid  (Aspen  Properties  V8.4) 4 2 1 2 3

4 2 2

5.916 10 3.974 10 8.982 10 , /

9.428 10 3.977 8.088 10 , /

L d d

p L d d

T T kg m

C T T J kgK

7 2 4 1

10 3 7 2

5 2 2

1.678 10 1.208 10 1.832 10 , /

1.809 10 2.292 10

9.877 10 1.470958 10 , /

L d d

L d d

d

k T T W mK

T T

T Ns m

Physical properties of (Aspen Properties V8.4) 9 3 6 2

3 3

4.195 10 9.608 10

7.941 10 2.79525, /

WB WB

W

G

B

T T

T kg m

 

8 2 4 22.632 10 1.764 10 9.368 10 , /WB BpG WC T T J kgK  

8 2 5

3

1.196 10 7.089 10

4.812 10 , /

WB WBGk T T

W mK

 

17 4 13 3

10 2 7 6 2

5.982 10 1.608 10

1.542 10 1.029 10 1.913 10 , /

WB WB

WB WB

G T T

T T Ns m

 

Binary diffusion coefficient of vapour in air

The  binary  diffusion  coefficient  of  decane  into  air  is estimated using  the Chapman-Enskog  theory as: 

37

2

(1/ 1 / )1.8583 10

V Cv

C VV CC

T M MD

p

where  the  pressure  term pc is equal to 1 atm. 

The  integral  collision VC   is  calculated  using  the 

following  correlation 

*0.1561 * *

*

* 23

1.06036 0.193 1.03587

(0.47635 ) (1.52996 )

1.76474

(3.89411

/ , 0.5( ), 1.3

)

8065 10 ,

VC

B B

V C

VC V C

T exp T exp T

exp T

T T k k

 

The Lennard Jones potential model constants  and /kB

ofair  are  3.711  and  78.6  respectively  (Bird  et  al,  2007). 

and /kB of  the  vapour  (V)  of  four  different  sources  are shown in Table 1. 

Table 1. Lennard Jones potential model constants of different sources for decane

Sources  v v/kB  Dv[m2/s] 

Tavares (1997)   4.604   238.80  1.11E-05 

Yu and Gao (2000)  5.233  226.46  9.64E-06 

Parades et al (2000)-M1  6.563   456.74  6.44E-06 

Parades et al (2000)-M2  7.164   572.56  5.49E-06 

REFERENCE

[1] Abramzon, B., & Sirignano, W. (1989). Droplet vaporization model for  spray  combustion  calculations.  International Journal of Heat and Mass Transfer, 32(9), 1605-1618. 

[2] Bird,  R.  B.,  Stewart,  W.  E.,  &  Lightfoot,  E.  N.  (2007). Transport phenomena (pp. 866): John Wiley & Sons. 

[3] Chen,  X.-Q.,  &  Pereira,  J.  (1996).  Computation  of  turbulent evaporating  sprays  with  well-specified  measurements:  a  sensitivity study on droplet properties. International Journal of Heat and Mass Transfer, 39(3), 441-454. 

[4] Miller,  R.,  Harstad,  K.,  &  Bellan,  J.  (1998).  Evaluation  of equilibrium  and  non-equilibrium  evaporation  models  for  many-droplet  gas-liquid  flow  simulations.  International Journal of Multiphase Flow, 24(6), 1025-1055. 

[5] Nguyen, T. T., Mitra, S., Pareek, V., Joshi, J., & Evans, G. (2015). Comparison of vaporization models for feed droplet in fluid catalytic cracking risers. Chemical Engineering Research and Design. 

[6] Paredes, M. L., Nobrega, R., & Tavares, F. W. (2001). An analytic equation-of-state for mixture of square-well chain fluids of variable well width. Fluid phase equilibria, 179(1), 231-243. 

[7] Ranz, W., & Marshall, W.  (1952). Evaporation from drops. Chem. Eng. Prog, 48(3), 141-146. 

[8] Renksizbulut, M., & Yuen, M. (1983). Numerical  study of droplet evaporation in a high-temperature stream. Journal of Heat Transfer, 105(2), 389-397. 

[9] Sazhin,  S.,  Kristyadi,  T.,  Abdelghaffar,  W.,  &  Heikal,  M.  (2006). Models  for  fuel  droplet  heating  and  evaporation:  comparative analysis. Fuel, 85(12), 1613-1630. 

[10] Sirignano, W. A. (2010). Fluid dynamics and transport of droplets and sprays: Cambridge University Press. 

[11] Tavares,  F.  W.,  Chang,  J.,  &  Sandler,  S.  I.  (1997).  A  completely analytic equation of state for the square-well chain fluid of variable well width. Fluid phase equilibria, 140(1), 129-143. 

[12] Wong, S.-C., & Lin, A. (1992). Internal temperature distributions of droplets  vaporizing  in  high-temperature  convective  flows. Journal of Fluid Mechanics, Cambridge University Press, 237. 

[13] Yu,  Y.-X.,  &  Gao,  G.-H.  (2000).  Lennard–Jones  chain  model  for self-diffusion of  n-alkanes. International journal of thermophysics, 21(1), 57-70. 

[14] Yuen, M., & Chen, L. (1976). On drag of evaporating liquid droplets. 

(The Board of Editors received the paper on 04/11/2015, its review was completed on 24/04/2016)

Page 28: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 25

A TOOL FOR UNIT COMMITMENT SCHEDULE IN DAY-AHEAD IN POOL BASED ELECTRICITY MARKETS

Pham Nang Van1, Nguyen Duc Huy1, Nguyen Van Duong2, Nguyen The Huu2 1Hanoi university of Science and technology; [email protected]; [email protected]

2Ministry of Industry and Trade; [email protected]; [email protected]

 Abstract - Operating the power system in a deregulated framework is now becoming a common trend in many countries in the world, including Vietnam. In order to ensure effective operation of the power market, there is a need for a good infrastructure for information exchange, and especially high performance computing tools which allows determining the optimal unit commitment schedule, based on price signal. These computing tools also serve to derive optimal bidding strategies for generating companies. Thi paper presents a computational tool for day ahead market clearing, based on price signals. The program has been tested with large size data, which proves its capability to handle the computational task of the Vietnam power market.

Key words - Power system operation; electricity market; day ahead unit commitment; marginal pricing; mixed integer linear programming.

1. Introduction

Nowadays,  several  countries  in  the  world  have  moved towards the deregulation of the power market. This change in  the power system operation provides  more  incentive  for investors, as well as for power companies to optimize their operation.  One  early  model  for  the  deregulated  power market  is  the  "Single  Buyer"  model.  In  this  deregulated framework,  the  single  buyer  receives  bidding  from generation  companies  (GENCO),  and  combines  with forecast  load  demand  to  determine  the  optimal  generation schedule  (unit  commitment  -  UC)  for  the  next  day.  The objective function of  this calculation is to minimize energy cost  purchased  from  generating  companies. 

Currently  in  Vietnam,  the  National  Load  Dispatch Center  (NLDC)  has  used  some  professional  programs  to determine  the  optimal  generation  scheduling.  However, there is still a need to develop a domestic tool for calculating unit  commitment.  On  one  hand,  this  tool  can  be  modified more easily, and with more flexibility to accommodate new rules in the power market operation. On the other hand, this kind of  software  serves  as  a  fundamental  tool  for deriving GENCOs' optimal bidding strategies. 

Conventional  unit  commitment  program  are  based  on dynamic  programming  and  Lagrange  relaxation  algorithm. The  Lagrange  relaxation  algorithm  has  been  tested  with large  network  model.  However,  there  is  an  essential drawback associated with this algorithm [1] due to the fact that there can be several solutions which are similar in terms of  objective  function,  but  with  different  scheduling variables.  In  recent  years,  the  programs  based  on  Mixed Integer  Linear  Programming  have  been  more  and  more commonly used [2-8]. One of the main advantages of MILP formulation  is  that  there has been  considerable progress  in the performance of MILP solvers in recent years. 

In  this  paper,  a  MILP  formulation  for  the  day-ahead market clearing problem is presented. The program developed 

in  this work not only provides with solutions  for day-ahead dispatching  schedule  but  also  determines  the  Locational Marginal  Pricing.  The  program  is  tested  with  a  large  size problem which is based on actual data from the Vietnam pool based market. The computational performance of the program is shown to be very good. The paper is organized as follows: section 2 presents  the mathematical  formulation of  the day-ahead  price  based  unit  commitment  problem.  Section  3 discusses the calculation of LMP based on the solution of the UC program. Section 5 presents numerical results for a 111 bus system, which is based on actual data of the Vietnam pool based electricity market. 

2. Mathematical formulation

2.1. Objective function

The objective function of the unit commitment problem is  to  minimize  total  cost  paid  to  the  GENCOs,  in  order  to satisfy  the  forecasted  load  demand.  Figure  1  describes  the market  equilibrium. 

The  objective  function  can  be  described  explicitly  as follows: 

1 1 1

.G GitN NT

ibt Gibt

t i b

F c P

  (1) 

In Eq. (1), cibt is the bidding price of the generation unit i,  corresponding  to  block b at  time t, Pibt is  the  generating power of  the same unit at  the same  time; T is  the  duration considered  in  the  unit  commitment  problem  (T = 24); NG is  the number of generating units  in  the system, NGit is the number of bidding blocks  at  time t (NGit = 3). 

Price

Energy

Market clearing price

GENCO s surplus

Figure 1. Market equilibrium

Figure 2. Handling of 3 blocks of generation bidding

1

2

3

1

2

3

4

5

6

7

8

9

Page 29: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

26 Pham Nang Van, Nguyen Duc Huy, Nguyen Van Duong, Nguyen The Huu

In  this paper,  to  account  for GENCOSs'  3-step bid,  we propose  using  3  pseudo  units  to  replace  one  real  unit,  as depicted in Figure 2. At one time, only one pseudo-unit can operate. 

2.2. Constraints for power plants

2.2.1. Minimum and maximum active power

At all times, the active power of each generating unit is subject to its minimum and maximum limit. This constraint is  expressed as  follows: 

min i,t max i,t. . 1, 24, 1, NGi Git Gi GP u P P u t i   (2) 

1

GitN

Git Gibt

b

P P

  (3) 

max0 , ,Gibt GibtP P i b t   (4) 

where: PGit is the active power of unit i at  time t, Pibt is  the 

active  power  of  the  unit  i,  block  b  at  time  t,  maxibtP   is  the 

upper  limit  of  block b; ui,t  is  a  binary  variable,  indicating whether  the  unit  is  operating  (if  the  unit  is  active, ui,t =  1 and ui,t = 0 otherwise). 

Since  one  generating  unit  now  consists  of  3  pseudo units  as  in  Figure  2,  a  maximum  of  only  one  pseudo  unit can be active at one time. Therefore we have the following constraint: 

1 2 3, , , 1i t i t i tu u u   (5) 

2.2.2. Constraint on ramp-up/ramp-down rate

The  limit  on  the  ramp-up  and  ramp  down  rate  of generating units  are  expressed as  follows: 

ow, 1 ,d n

Gi t Git iP P R i t   (6) 

, 1 ,upGit Gi t iP P R i t   (7) 

In expressions (5) and (6),  ow ,d n upi iR R  are respectively the 

limits on maximum ramp-up and ramp-down rate of unit i. 

2.2.3. Minimum up-time

Thermal  generating  units  normally  has  a  constraint  on minimum  up-time.  These  constraints  are  expressed  as follows  [2]: 

1

, , , 1.

1, ; 2, 1

it Minup

i n i i t i t

n t

G i

u UT u u

i N t T UT

  (8) 

In  (7), UTi is  the  minimum  up-time of  unit,  and ui,n is the state of unit i at  time n. 

At  hour  t =  1  and  t =  24,  the  constraints  on  minimum up-time are expressed as Eq.  (8) and (9). 

, ,1 ,0

1

.iMinup

i n i i i

n

u UT u u

  (9) 

, , , 1 0

1, ; 2 ,T

T

i n i t i t

n t

G i

u u u

i N t T UT

(10)

2.2.4. Minimum down-time constraint

Thermal generating  units  also have  a  limit  with  regard 

to the minimum down-time after shutting down, before the unit  can  be  started  up  again.  The  minimum  down-time constraints  are  expressed  as  follows  [2]: 

1

, , 1 ,1 .

1, ; 2, 1

it DT

i n i i t i t

n t

G i

u DT u u

i N t T DT

  (11) 

, ,0 ,1

1

1iDT

i n i i i

n

u DT u u

  (12) 

, , 1 ,1 0

1, ; 2,

T

i n i t i t

n t

G i

u u u

i N t T DT T

  (13) 

In  Eq.  (10-12),  DTi  is  the  minimum  down-time requirement  of  unit i. 

2.2.5. Operating state of generating units

The  state  of  one  generating  unit  being  started  up  and being  shut-down  are  mutually  exclusive.  Hence,  we  need to add  the  following constraints  [11]: 

, , , , 1

1, , 1,

i t i t i t i t

G

y z u u

i N t T

  (14) 

, , 1

1, , 1,

i t i t

G

y z

i N t T

  (15) 

where yi,t is a binary variable reflecting the start-up state of generating  unit  i  at  time  t  (1  if  the  unit  starts  at  the beginning  of  time t); zi,t is  a  binary  variable  reflecting  the shut  down  state  of  unit  i  (1  if  unit  i  shuts  down  at  the beginning of time t). 

2.3. System constraints

2.3.1. Active power balance

Branch currents  and bus  voltages  in  the power  system obey  the Kirkhop equations, which are non-linear. In order to  solve  the  power  flow  equations,  an  iterative  algorithm needs to be used. However,  in unit commitment programs, a DC formulation is often used for its simplicity. In the DC power flow formulation, the reactive power loss and active power  loss  are  ignored.  Besides,  the  branch  flows  are assumed to be proportional to  the angle difference between the sending end bus and  the  receiving end bus. With  these assumptions,  active  power  flowing  into  a  bus  i  can  be expressed by  the  following equation: 

ij

1

LN

i i j

j

P B

  (16) 

1

0N

Gi Di i

i

P P P

  (17) 

where  NL  is  the  number  of  branches  in  the  power system, Pi is active power injected at bus i into the network, N  is  the  total  number  of  buses,  PGi  is  active  power 

generated  at  bus i, PDi is  active power demand  at bus i; i is voltage angle at bus i. 

2.3.2. Power flow limit on system branches

In  the  DC  power  flow  method,  the  branch  flow  is 

Page 30: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 27

determined by  the  following equation: 

ij ij i jP B   (18) 

The branch flow limit is thus expressed as follows: min max

ij ij ijP P P   (19) 

2.3.3. Spinning reserve requirement

In  order  to  regulate  the  system  frequency,  the  system should  maintain  at  all  time  a  certain  amount  of  active power  reserve,  which  is  the  active  power  that  can  be dispatched  from  online  generating  units.  The  amount  of required  reserve  depends  on  the  reliability  criteria  for  each power  system.  In  a  general  form,  the  spinning  reserve constraint can be written as follows: 

max,

1

GN

i t Gi Dt Rt

i

u P P P t

  (20) 

3. Locational Marginal Pricing

3.1. Theoretical overview

One  of  the  technical  problems  in  power  system operation  is  managing  the  branch  flows  so  that  they  can remain  below  acceptable  limits,  which  depend  on stability/thermal  constraints.  The  most  common  approach to deal with branch flow limit (or congestion management) in the power market is Locational Marginal Pricing (LMP). Due  to  space  limit,  we  do  not  go  into  details  the  theory behind  LMP.  In  essence,  LMP  is  the  sensitivity  of  the objective  function  F  with  regard  to  the  demand  power  at each bus  [13]: 

iDi

FLMP

P

  (21) 

In  the optimal  solution of  the unit commitment, LMPs is  in  fact  the  Lagrange  multipliers  corresponding  to  the power balance constraints at system buses. In theory, LMP based method  is  really  effective  to handle  congestions due to  branch  flow  limit  [9].  However,  its  implementation  in practice  requires  exact  knowledge  of  the  branch  flow limits. It is not always easy to determine branch flow limits, because  there  are  several  underlying  technical considerations:  thermal,  voltage  stability,  angle  stability, etc. Currently,  in Vietnam,  a more  simple version of LMP is adopted.  In  this model,  the branch  flow  limits of only 2 branches  are  used:  between  the  Northern  grid  and  the Central grid, and between the Central grid and the Southern grid.  This  model  is  refered  to  as  ZMP  (Zonal  Marginal Price). In ZMP model, it is assumed that there is no branch flow  limit within one area  (North, Central, South). 

3.2. Post UC calculation of Locational Marginal Prices

The  LMPs  are  obtained  after  solving  the  DCOPF problem at each hour. The LMP at each bus is in fact equal to  the  sensitivities  of  constraint  (17)  at  the  same  bus.  In order  to  obtain  sensitivity  measures,  the  optimization problem  should  be  a  Linear  Programming  problem,  with only continuous variables. The Unit Commitment problem, however,  is  a  MILP  which  contains  binary  variables. Therefore,  in  most  market  clearing  programs,  the  UC  and LMP  are  calculated  using  two-step  procedures  [13]: 

1. In  step  1,  the  UC  problem  (1)  is  solved,  which  gives the  optimal  values  for  binary  as  well  as  continuous variables. 

2. In step 2, the binary variables obtained from step 1 are fixed.  The  optimization  problem  is  solved  again  with the  continuous  variables.  At  this  step,  the  LMP  for system buses can be obtained. 

The  results  in  this  study  show  that  the  optimal  values for the continous variables obtained in step 1 and step 2 are the same. Step 2 is carried out only to determine LMP. 

4. Problem size

The  optimization  problem  presented  in  section  2  is  a Mixed  Integer  Linear  Programming  problem,  with  large number  of  variables.  In  our  program,  the  optimization variables are organized as  in Figure 3. 

Figure 3. Structure of optimization variables

If  the  system  has  N  buses,  NG  generating  units  and  a total  of T time  periods,  the  size  of  each  variable  blocks  in Figure 3 are given by: 

. 1

. 1

. 1

. 1

.( 1) 1 (3. 2. 1).T 1

G

G

G

T N

T N

T N

T N

T N N N

u

P

x y

z

  (22) 

In summary,  the vector of optimization variable [x] has 

(3N+2NG-1)T  variables,  of  which  (N+2NG)T  are binaries. In this paper, the optimization model is applied to a  power  system  model  that  is  based  on  actual  data  of  the Vietnam power system in 2014. The total number of buses is 111,  in which 108 are generation buses. 

It  should  be  noted  that  in  the  ZMP  formulation  (see section  3),  there  is  no  branch  flow  constraint  within  one region. Therefore all load of each region can be aggregated into  a  single  load bus. Hence,  there are only 3  load buses, representing load demands of the North, Central and South areas.  With  the  above  parameters,  the  proposed optimization  problem  has  46848  variables,  of  which  7848 are  binaries.  The  total  number  of  constraints  is  80112,  of which  58980  constraints  are  nonlinear. 

5. Application results

5.1. System description

The  optimization  problem  presented  in  sections  2  to  4 is applied for a real large system, which is based on actual data  of  Vietnam  power  system  in  2014  [12].  The  bidding 

Page 31: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

28 Pham Nang Van, Nguyen Duc Huy, Nguyen Van Duong, Nguyen The Huu

prices  of generating  units  consist of  3  blocks,  as  shown  in Table  1. 

Table 1. Example of generation bidding data

Block 

1  2  3 

Pmin  Pmax  Pmin  Pmax  Pmin  Pmax 

Power  160  260  260  320  320  400 

Price (VND/kWh) 

1220  1280  1360 

Besides  the  bidding  data  in  Table  1,  GENCOs  should also  provide  technical  constraints  for  the  generating  units, such  as  ramp  rates,  maximum  and  minimum  up-time/downtime.  The  optimization  problem  is  programmed in  MATLAB  language  [11].  In  order  to  solve  the  MILP problem,  CPLEX  software  [13],  version  12.6  is  used. The  program  is  run  on  a  personal  computer  with  4GB  of RAM,  and  Intel  Core  i3  processor.  With  this  computing platform,  it  takes  approximately  30s  to  solve  the  market clearing  problem. 

The  market  clearing  is  calculated  for  two  operating scenarios:  normal  operating  scenario  and  a  contingency scenario,  in  which  one  500kV  circuit  between  the  North and  the Central areas  is  lost. 

5.2. Optimization results

5.2.1. Normal operating scenario

The  optimal  daily  schedule  for  of  generating  units  for the normal operating condition  is  shown  in Figure 4. Each color  represents  one  generating  unit.  The  ZMP  for Northern, Central and Southern grid are shown in Figure 5, and the branch flows between areas are shown in Figure 6. 

Figure 4. Solution for normal operating scenario

Figure 5. Zonal marginal prices, normal operating scenario

Figure 6. Branch flows between areas, normal scenario

From Figure 6, it can be seen that the interface between the Central and the South area is almost always utilized up to its maximum capacity. This is due to the fact that there are many hydro power plants in the Northern areas, with cheaper bidding  prices  than  the  thermal  units  in  the  South  system. Since the connection between the Central area and the South area is almost always at maximum active power transfer, the ZMP of  the South system is higher than  that of  the Central and  the  North  system.  On  the  other  hand,  the  ZMP  of  the North system and the Central system are always equal. 

5.2.2. Contingency scenario

In  the  contingency  scenario,  it  is  assumed  that  one 500kV  circuit  between  the  North  and  the  Central  area  is lost. Hence maximum power transfer capacity of  the North -  Central  interface  is  reduced  to  900MW.  The  power transfer between regions in this case is shown in Figure 7. 

Figure 7. Branch flows for contingency operating scenario

It can be seen from Figure 7  that  the  interface between the  North  and  the  Central  areas  is  almost  always  fully utilized.  In  fact,  due  to  reduced  limit  on  the  North-Central interface,  electricity  from  cheap  hydro  power  plants  from the  Northern  area  can  not  be  transferred  to  the  Southern area.  The  power  transfer  between  the  Central  area  and Southern  area  even  decreases  near  peak  load  hours  (19h), because  most  power  generation  from  the  Central  area  at peak load hours  is used to serve its own load. 

The  ZMP  for  this  scenario  are  shown  in  Figure  8.  At times  when  the  interface between  Central  and South  areas is  not  fully  utilized,  their  ZMP  are  equal.  Another  remark can  be  drawn  from  this  result  is:  As  the  transmission capacity  is  limited,  the  receiving  system  (Southern  area) has  to pay higher price  for  electricity. 

Page 32: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 29

Figure 8. ZMP for contingency operating scenario

6. Conclusion

In  this  paper,  a  program  for  determining  the  optimal unit commitment, based on price signal of generating units has  been  developed  in  MATLAB  environment.  The program  takes  into  account 3 bidding blocks  for each unit, as  well  as  several  practical  constraints  of  the  unit commitment problem, such as  active power balance,  ramp rate,  minimum  up-time  and  down-time,  etc.  The optimization  problem  is  solved  successfully  and  quickly for large scale power system model of Vietnam. 

The  program  developed  in  this  work  can  be  easily modified  to  determine  dispatching  schedule  for  actual Vietnam  power  system,  which  consists  of  both  day-ahead market  and  long-term  contracts.  Based  on  the  developed optimization  tool,  the  various  aspects  of  power  market operation can  be  studied.  Moreover,  the  program  will  help generation  companies  study  the  market  behavior,  which 

allows  them to determine  suitable bidding strategies. 

REFERENCES

[1] Jose Manuel Arroyo and Antonio J. Conejo,  “Multi period auction for a pool-based electricity market”, IEEE Trans. Power Syst., vol. 17, pp. 1225-1231, Aug. 2002. 

[2] Miguel  Carrion  and  Jose  M.  Arroyo,  “A  computationally  efficient mixed-integer  linear  formulation  for  the  thermal  unit  commitment problem”, IEEE Trans. Power Syst., vol. 21, pp. 1371-1378, Aug. 2006. 

[3] C.  Wang  and  S.  M.  Shahidehpour,  “Ramp-rate  limits  in  unit commitment  and  economic  dispatch  incorporating  rotor  fatigue effect”, IEEE Trans. Power Syst., vol. 9, pp. 1539-1545, 1994. 

[4] H. Pandzic,  Ting Qui,  D.S Kirschen,  “Comparison of  state-of-the-art transmission constrained unit commitment formulations”, IEEE Power and Energy Society General Meeting, July. 2013. 

[5] E. Litvinov, “Design and opertion of the locational marginal prices-based  electricity  markets”,  IET Generation, Transmission & Distribution, vol. 4, pp. 315-323, Feb. 2010. 

[6] G. Morales-Espana,  J. M. Latorre,  A. Ramos, “Tight  and compact MILP  formulation  for  the  Thermal  Unit  Commitment  Problem”, IEEE Trans. Power Syst., vol. 28, pp. 4897-4908, Nov. 2013. 

[7] J. Ostrowski, M. F. Anjos, A. Vannelli, “Tight Mixed Integer Linear Programming Formulations for Unit Commitment Problem”, IEEE Trans. Power Syst., vol. 27, pp. 39-46, Feb.2012. 

[8] M.  Shahidehpour,  H.  Yamin  and  Z.Y.  Li,  Market operations in electric power system, John Wiley &Sons, Inc., New York, 2002. 

[9] Z. Li and H. Daneshi, “Some observations on market clearing price and  locational  marginal  price”,  IEEE Power Engineering Society General Meeting, pp. 2702-2709, Jun. 2005. 

[10] Matlab R2014b, http://www.mathworks.com/products/matlab/ 

[11] Cao Xuân Hoàng, “Optimal unit commitment in the power system.”, Master thesis, Hanoi Uni. of Science and Technology, 2014. 

[12] IBM, “IBM ILOG CPLEX Optimization Studio Community Edition”. 

[13] Allen  J.  Wood,  Bruce  F.  Wollenberg,  Gerald  B.  Sheble,  Power generation, operation and control, Wiley & Sons, Inc, New Jersey, 2014”. 

(The Board of Editors received the paper on 14/12/2015, its review was completed on 12/03/2016)

 

Page 33: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

30 Dang Quoc Vuong, Bui Duc Hung, Khuong Van Hai

USING DUAL FORMULATIONS FOR CORRECTION OF THIN SHELL MAGNETIC MODELS BY A FINITE ELEMENt SUBPROBLEM METHOD

Dang Quoc Vuong1, Bui Duc Hung1, Khuong Van Hai2 1Hanoi University of Science and Technology; [email protected]

2Water Resources University

 Abstract - Dual formulations for finite element magnetostatic and magnetodynamic subproblems are developed to correct the inaccuracies near edges and corners of thin shell magnetic models. Such models replace volume thin regions by surfaces but neglect border effects in the vicinity of their edges and corners, which can cause inaccuracy in solving thin sheel problems. The developed surface-to-volume correction problem is defined as a step of the multiple subproblems applied to a complete problem (inductors and conductor regions), considering successive additions of inductors and magnetic or conducting regions, some of which are thin regions. Each subproblem is independently solved on its own domain and mesh, which facilitates meshing and increases computational efficiency.

Key words - Eddy current, finite element method (FEM), magnetodynamics, subproblem method (SPM), thin shell (TS)

1. Introduction

As proposed in [1], [2], thin shell (TS) finite element (FE) models  are  used  to  avoid  meshing  thin  regions,  which  are replaced  by  surfaces  with  interface  conditions  (ICs). Nevertheless,  these  ICs  lead  to  inaccuracies  on  the computation  of  local  electromagnetic  quantities  (current density,  magnetic  flux  density  and  magnetic  field)  in  the vicinity  of  geometrical  discontinuities  (edges  and  corners). Such  inaccuracies  increase  with  the  thickness,  and  are exhacerbated  for  quadratic  quanti-ties  like  forces  and  Joule losses, which are often the primary quantities of interest. To cope with these disadvantages, a subproblem method (SPM) based  on  magnetic  flux  density  formulations,  proposing  a surface-to-volume local correction, has been proposed in [3]. The SPM for TS correction is explicitly developed for dual finite element (FE) b- and h- formulations, with generalized mesh projections of solutions between the subproblems (SPs). Also, the SPM naturally allows parameterized analyses of the thin  region  characteristics:  permeability,  conductivity  and thickness. In the proposed SP strategy, a reduced problem (SP u)  with  only  inductors  is  first  solved  on  a  simplified  mesh without  thin  and  volume  regions.  Its  solution  gives  surface sources (SSs) as ICs for added TS regions (SP p), and volume sources (VSs) for possible added volume regions (SP k). The TS solution is then corrected by a volume correction via SSs and  VSs  that  suppress  the  TS  representation  and  add  the volume  model.  The  method  allows  coupling  SPs  in  two procedures:  one-way  coupling  and  two-way  coupling.  The one-way  coupling  is  a  SP  sequence,  where  no  iteration between the SPs is necessary. On the other hand, with two-way coupling, each SP solution is influenced by all the others, which thus must be included in an iterative process. 

2. Thin Shell Correction in a SPM

2.1. Canonical magnetodynamic or static problem

A  canonical  magnetodynamic  problem  i,  to  be  solved 

at  step i of  the SPM (i u, p or k),  is  defined  in  a domain 

i,  with  boundary  , ,i i h i b i .  The  eddy  current 

conducting  part  of  p  is  denoted  c,p  and  the  non-

conducting  one  ,C

c i ,  with  , ,C

i c i c i .  Stranded 

inductors  belong  to  ,C

c i ,  whereas  massive  inductors 

belong  to  c,i.  The  equations,  material  relations  and 

boundary  conditions  (BCs)  of  SP i are 

curl div 0 curl (1a - b - c)

(2a - b)

  (3a - b)

  (3c)h ,i b ,i

e ,i b ,i

i i i i t i

f ,i f ,i

f ,i

, ,

μ σ

-1

i i i s,i i i i s,i

i i

i

h j b e b

h = b + h , j = e + j

n h = j , n b = f

n e = k

 

where hi is the magnetic field, bi is the magnetic flux density, 

ei is the electric field, ji is the electric current density, i is the 

magnetic permeability, i is the electric conductivity and n is 

the unit normal exterior  to i. The  field hs,i and  js,i and  in 

(2a) and (2b) are VSs that can be used for expressing changes of a material property in a volume region [3]. The fields jf,i and kf,i in (3a) and (3b) are SSs and generally equal zero for 

classical  homogeneous  BCs.  ICs  can  define  their 

discontinuities  through  any  interface  i  (i+  and  i

–)  in i, 

with the notation [  ]i =  i+ –  i

–. If nonzero, they define 

possible SSs that account for particular phenomena occurring 

in the idealized thin region between i+ and i

– [3]. This is the 

case  when  some  field  traces  in  SP  p  are  forced  to  be discontinuous  (e.g.  in  TS  model),  whereas  their  continuity must  be  recovered  via  a  SP  k;  with  the  SSs  fixed  as  the opposite of the trace discontinuity solution of SP p. 

2.2. Subproblem: “Adding a thin shell”

 

 

 

 

 

 

 

Figure 1. Interface condition between SP u and SP p

The  solution  of  an  SP u is  first  known  for  a  particular configuration,  e.g.  for  an  inductor  alone  (Figure  1,  a),  or more  generally  resulting  from  the  superposition  of  several SP solutions. The next SP p consists in adding a TS to this configuration (Figure 1, b). From SP u to SP p, the solution 

u gives  SSs  for  the  added TS p,  through TS  ICs  [2]. The 

b-formulation uses a magnetic vector potential ai (such that 

Page 34: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 31

curl ai = bi),  split  as a = ac,i + ad,i [2].  The h-formulation 

uses  a  similar  splitting  for  the  magnetic  field, h = hc,i + hd,i.  The  fields  a

c,i, hc,i, and a

d,i, hd,i, are  continuous  and 

discontinuous  respectively  through  the  TS.  The  traces 

discontinuities  in  SP  p  [n  hp]p  and  [n  ep]p  (with 

nt = -n) in both formulations can be expressed as paper [2] 

pγ γ[ × ( × )] = [ × ] = (2 + )p p tμ β u p p c, p d, pn h h n h a a   (4) 

pγ γ[ ×( )] = [ × ] = (2 + )p p tβ u p p c, p d, pn e × e n e h h   (5) 

1tanh 2 1p p p p p p( .d / ), ( j ) /   (6) 

because there are no discontinuities  in SP u (before adding 

p), where dp is the local TS thickness,  2 / ( )p p p

is the skin depth in the TS,  = 2f, f is the frequency and j is  the  imaginary  unit.  Also,  the  traces of ep and hp on  the 

positive side p+ are expressed as [2] 

1 1× = [ (2 + ) ] × (7)

2

1 1× = [ (2 + ) ] × (8)

2

pp

pp

p p p t u

p p

p p t u

p p

ββ

ββ

c, p d, p d, p

p c, p d, p d, p

n h a a a -n h

n e h h a -n e

 

2.3. Subproblem: “Correcting a thin shell”

A  TS  solution  obtained  in  an  SP  p  can  be  further improved  by  a  volume  correction  SP  k  via  SSs  and  VSs that overcome the TS assumptions. SP k has to suppress the TS representation via SSs opposed to TS discontinuities,  in parallel  with  VSs  in  the  added  actual  volume  that  account for  changes  of  material  properties  in  the  added  volume 

region  from p and p in  SP p to  from k and k in SP k 

(with p = 0, k = volume, k = 0 and k = volume). 

This  defines  a  surface-to-volume  correction.  Such  a correction  generally  leads  to  local  modifications  of  the solution,  which  thus  allows  reducing  the  calculation domain  and  its  mesh  in  the  surroundings  of  the  thin regions. The VSs  for SP k are paper [3] 

1 1

= , = ( (9a -b)

= ( , = -( (10a -b)k p p p

k p

(μ - μ ) (σ -σ )

μ - μ )

s,k u p s,k c, p d, p

s,k u p s,k c, p d,

b (h + h ) j e +e )

h (b +b ) e e +e ) 

3. Finite Element Weak Formulations

3.1. Magnetic Vector Potential Formulation

The  weak bi -formulation  (in  terms of ai) of SP i (i u, p or k)  is  obtained  from  the  weak  form  of  the  Ampère equation  (1a),  i.e.  [3],  [4] 

1, ,( curl , curl ') ( , curl ') ( , ')

i i ii i i s i i s i i

a a h a j a

, , , ,( , ') , ' [ ] , '

i h i t i t i t ii t i i i i i i a a n h a n h a  

1,( , ') , ' ( )

is i i i i iF j a a   (11) 

where Fi1(i) is a curl-conform function space defined in i, 

gauged  in c,iC, and containing the basis functions for a as 

well as for the test function ai' (at the discrete level, this space is defined by edge FEs; the gauge is based on the tree-co-tree technique); (·, ·) and < ·, · > respectively denote a volume 

integral in  and a surface integral on  of the product of their 

vector  field  arguments.  The  surface  integral  term  on  h,i 

accounts  for  natural  BCs  of  type  (3a),  usually  zero.  At  the discrete level, the required meshes for each SP i differ. 

3.1.1. Inductor alone - SP u

The  weak  form  of  an  SP  u  with  the  inductor  alone  is first  solved  via  the  first  and  last  volume  integrals  in  (11) 

(i u) where ji is the fixed current density in on s. 

3.1.2. Thin shell FE model- SP p

The  TS  model  is  defined  via  the  term 

,[ ] , 'p pp d p n h a in  (11)  (i p).  The  test  function  ai'  is 

split  into  continuous  and  discontinuous  parts a'c,p and a'd,p

(with a'd,p zero  on p) [2]. One thus has 

,[ ] , ' [ ] , 'p p p pp p p c p n h a n h a  

,| , 'p p

p d p n h a   (12) 

The  terms  of  the  RHS  of  (12)  are developed  using  (4) and  (7)  respectively,  i.e. 

, ,[ ] , ' [ ] , 'p p p pp c p c p n h a n h a  

, , ,(2 ), 'pp p t c p d p c p a a a (13) 

, ,[ ] , ' | , 'pp p p

p d p u d p n h a n h a  

, , ,1 1

(2 ) , '2 pp p t c p d p d p

p p

a a a   (14) 

The  last  surface  integral  term  in  (14)  is  related  to a SS that can be naturally expressed via the weak formulation of SP u (11),  i.e. 

1, ,| , ' ( curl , curl ')

p p pu d p u u d p

n h a a a  

At  the  discrete  level,  the  volume  integral  in  (15)  is  thus 

limited  to  a  single  layer  of  FEs  on  the  side p  touching 

p+,  because  it  involves  only  the  associated  trace 

n  ad,p'|p. Also, the source au, initially in the mesh of SP 

u,  has  to  be  projected  on  the  mesh  of  SP  p,  using  a projection  method  [5]. 

3.1.3. Volume correction replacing the TS representation - SP k

The TS SP p solution is  then corrected by SP k via  the 

volume  integrals  ,( , curl ')ps p h a and  ,( , ')

ps p j a in  (11). 

The VSs js,k and hs,k are given  in (9) and  (10),  respectively. 

Simultaneously to the VSs in (11), SSs have to suppress the TS discontinuities, with ICs to be defined as 

[ ] [ ]k kk p n h n h  and [ ] [ ]

k kpa a n n . The 

trace  discontinuity [ ]kk n h occurs  in (11) via 

[ ] , ' [ ] , 'k p k kk k p k n h a n h a   (16) 

and can be  weakly evaluated  from a volume  integral  from SP p similarly  to  (15). However, directly using  the explicit form  (4)  for [ ]

kp n h gives  the  same  contribution,  which 

is  thus  preferred. 

3.2. Magnetic Field Formulation

3.2.1. h-Formulation with source and reaction magnetic fields

The  i i h  formulation of SP i (i u; p or k)  is obtained 

Page 35: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

32 Dang Quoc Vuong, Bui Duc Hung, Khuong Van Hai

from the weak form of Faraday’s law (1 c) [6]. The field hi is  split  into  two  parts, hi = hs,i + hr,i where hs,i is  a  source field defined by curl hs,i = js,i and hr,i is unknown. One has 

1, ,( ( ), ') ( curl ,curl ')

i it i r i s i i i i i

h h h h h

,, ,( , , ') ( , curl ') , 'i i e it s i i s i i i ib e e h h n h

1[ ] , ' 0, ' ( )i ii i i i ie F n h h  

where Fi1(i)  is a curl-conform function space defined  in 

i and contains  the basis  functions for hi as well as for the 

test function hi'. The surface integral term on e,i accounts 

for natural BCs of type (3 b),  is usually zero. 

3.2.2. Inductor model SP u

The  model  SP  u  with  only  the  inductor  is  first  solved 

with  (17)  (i p).  The  source  field  hs,u  is  defined  via  a projection  method  of  a  known distribution js,u [5],  i.e 

, , , ,(curl ,curl ') ( ,curl ') ,u us u s u s u s uj h h h  

1, ' ( )s u u uF h   (18) 

3.2.3. Thin shell FE model - SP p

The  TS  model  is  defined  via  the  term 

,[ ] , 'p pp d pe n h in  (11)  (i p).  The  test  function  hi'  is 

split  into  continuous  and  discontinuous  parts h'c,p and h'd,p

(with h'd,p zero  on p) [2]. One thus has 

,[ ] , ' [ ] , 'p p p pp p p c pe e n h n h  

,| , ' .p p

p d pe n h   (19) 

The  terms of  the  right-hand  side  of  (19)  are developed using  (5)  and  (8)  respectively,  i.e. 

, ,[ ] , ' [ ] , 'p p p pp c p c pe e n h n h  

, , ,(2 ), ' ,pp p t c p d p c p h h h (20) 

, ,[ ] , ' | , 'pp p p

p d p u d pe e n h n h  

, , ,1 1

(2 ) , '2 pp p t c p d p d p

p p

h h h   (21) 

The  last  surface  integral  term  in  (21)  is  related  to a SS that can be naturally expressed via the weak formulation of SP u (17),  i.e. 

, , , ,| , ' ( ( ), ')p p p

u d p u t s u s u d pe n h h h h  (22) 

The  sources hs,i and hr,i,  initially  in  the  mesh  of  SP u, have  to  be  projected  on  the  mesh  of  SP p using a  using a projection  method  [5]. 

3.2.4. Volume correction replacing the TS representation SP k

Once obtained,  the TS  solution  in SP p is  corrected  by 

SP  k  via  the  volume  integrals  ,( , ')pt s pb h and 

,( , curl ')ks p ke h . The VSs bs,k and es,k are also given  in (9) 

and  (10),  respectively. The VS es,k in (10) is to be obtained from  the  still  unknown  electric  fields  eu and ep and  their determination needs to solve an electric problem [6]. 

In parallel with the VSs in (17), ICs compensate the TS discontinuities  to  suppress  the  TS  representation  via  SSs opposed  to  previous  TS  ICs,  i.e., hd,k = -hd,k to  be  strongly 

defined,  and  [ ] [ ]k kp pe e n n .  The  trace 

discontinuity [ ]kpe n occurs  in  (17) via 

[ ] , ' [ ] , 'k p k kk k p ke e n h n h   (23) 

and can be  weakly evaluated  from a volume  integral  from SP p similarly  to (22). 

4. Application Examples

A  3-D  test  problem  is  based  on  TEAM  problem  21 (model B, coil  and plate, Figure 2). 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 2. Geometry of TEAM (Testing Electro-magnetic Analysis Methods) problem 21 – Model B [8]

 

 

  

 

 

Figure 3. TEAM problem 21 (1/4th of the geometry): magnetic flux density bu (in a cut plane) generated by a stranded inductor

(left), eddy current density jp on TS model (middle) and its volume correction jk (right) (thickness d = 10 mm)

An  SP  scheme  considering  three  SPs  is  developed.  A first FE SP u with the stranded inductors alone is solved on a  simplified  mesh  without  any  thin  region  (Figure 3, left). Then an SP p is solved with the added thin region via a TS FE  model  (Figure  3, middle).  At  last,  a  SP  k  replaces  the TS  FEs  with  the  actual  volume  FEs  (Figure  3, right). The inaccuracies  on  the  Joule  power  loss  densities  of  TS  SP p are  pointed  out  by  the  importance  of  the  correction  SP k (Figure  4).  Significant  error  on  TS  SP  p  along  the  z-direction reaches 73% near the plate ends (Figure 4, top) or 

85%  along  the y-direction  (Figure  4, bottom)  with  =  2.1 mm  and  thickness  d  =  7.5mm  for  both  cases.  For  d  = 1.5mm,  it  is  reduced  to below 10%.  In particular, accurate local corrections with volume correction SP k are checked to be close to the reference solution computed from the FEM. 

Page 36: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 33

Figure 6. Norm of the eddy current density j (A/m) along the plate 1 at different iterations

Table  I  shows  the  Joule  losses  in  the  plate  with  an approximate BC for SP k. The exterior boundary of SP k is first chosen at a distance Dbound = 200d from the thin region, with  thickness d = 10 mm. The inaccuracies on Joule losses for TS SP p reach 58.9%, or 1.2% for volume correction SP 

k, with f = 50 Hz,  = 100 and = 6.484 MS/m in both cases. The  proposed  SP  strategy  allows  locally  focusing  on  the mesh of volume correction SP k and its neighborhood. It is shown that even if Dbound is reduced to 2d, the error on SP k is  1.53%,  which  is  still  very  accurate.  For  d  =  1mm,  the errors  on  Joule  losses  for  SP  p  are  reduced  to  1.17%,  or 0.05% for SP k. or 0.05% for SP k. 

Figure 4. Power loss density with TS and volume solutions along the z-direction (top) and along the y-direction (bottom),

with effects of d (f = 50 Hz, r = 200, = 6.484 MS/m) The  second  test  problem  is  a  convergence  test  of  two-

way coupling (f = 50 Hz, r = 1,  = 59 MS/m)  (Figure 5). The test at hand  is considered in  five SPs. It  is  first  solved via an SP u with the stranded inductor alone, then adding a TS FE SP p1 that does not include the stranded inductor via SP u with  a  stranded  inductor  alone,  then  adding  a  TS  FE SP p1 that does not  include  the  stranded  inductor  anymore. An SP k1 then replaces the TS SP p1 with an actual volume covering  the plate 1. Next, another TS SP p2 is  added. 

Table 1. Joule losses in the plate with approximate BCs (f = 50 Hz, = 100, = 6.484 MS/m), with with b- formulation

Dbound 

d = 10 mm  Errors % 

TS Pthin 

(W) 

Vol Pvol 

(W) Ref Pref 

(W) Between Pthin 

and Pref Between 

Pvol and Pref 

200d  0.0196  0.0477  0.0483  58.9  1.2 

20d  0.0196  0.0476  0.0483  58.9  1.35 

2d  0.0196  0.0475  0.0483  58.9  1.53 

  d = 1 mm   

200d  0.0113  0.0115  0.0115  1.74  0.0001 

2d  0.0113  0.0115  0.0115  1.77  0.05 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

  

 

 

 

 

 

 

 

 Figure 7. Exact local errors (top) on the norm of eddy current j between the total solution and the reference solution at right end

of plate 1, with the number of iterations

An SP k2 eventually replaces the TS SP p2 with  another actual  volume  covering  the  plate  2.  In  the  correction process  of  SP p1,  the  fields  generated  by  SP p2 and  SP k2

are  reaction  fields  that  influence  the  source  solutions calculated  from  previous  SP  p1.  This  means  that  some iterations  between  the  SPs  are  required  to  determine  an accurate  solution considered as a  series of corrections. The problem  is  first  tested  on  the  same  mesh  to  avoid  an additional error due  to mesh-to-mesh projections.  It  is  then solved  with  different  meshes  taking  the  projection  errors into account. Figure 6 represents the convergence of the TS solution SP p1 and volume solution SP k1 along the plate 1, for different  iterations. The  accurate  local  volume  solution is  checked  to  be  close  to  the  reference  solution  during  8 iterations. Relative local errors on the norm of eddy current j between the total solution and the reference solution at the 

Figure 5. 2-D geometry of an inductor and two plates (d = 5mm, H1 = 120mm, H2 = H3 = 45mm, H4 = 80mm,

H5 = 67.5mm, dx = dy = 12mm)

Page 37: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

34 Dang Quoc Vuong, Bui Duc Hung, Khuong Van Hai

right end of plate 1 are shown in Figure 7. The error is less than 1% (0.78%) with no projection, and  increases  slightly up  to  1.17%  with  projection  error,  during  9  iterations  for both  cases. 

5. Conclusions

The  SPM  allows  correcting  the  inaccuracies  proper  to the  TS  model.  Accurate  eddy  current  and  power  loss densities  are  obtained,  especially  along  the  edges  and corners of the thin regions, also for significant thicknesses. The  refined mesh  for volume correction can be  reduced  to a close neighborhood of  the  thin  region. 

ACKNOWLEDGMENT

This  work  was  supported  by  the  fund  of  Hanoi University of  Science and  Technology  (HUST). 

REFERENCES

[1] L. Krähenbühl and D. Muller, “Thin layers in electrical engineering. Examples  of  shell  models  in  analyzing  eddy-currents by  boundary and finite element methods”, IEEE Trans. Magn., Vol. 29, No. 2, pp. 1450-1455, 1993. 

[2] C. Geuzaine, P. Dular,  and W. Legros,  “Dual  formulations  for  the modeling of thin electromagnetic shells using edge elements”, IEEE Trans. Magn., vol. 36, no. 4, pp. 799–802, 2000. 

[3] C. Geuzaine, P. Dular,  and W. Legros,  “Dual  formulations  for  the modeling of thin electromagnetic shells using edge elements”, IEEE Trans. Magn., vol. 36, no. 4, pp. 799–802, 2000. 

[4] P. Dular, Vuong Q. Dang, R. V. Sabariego, L. Krähenbühl and C. Geuzaine, “Correction of thin shell finite element magnetic models via a subproblem method”, IEEE Trans. Magn., Vol. 47, no. 5, pp. 158 –1161, 2011. 

[5] P. Dular, R. V. Sabariego, M. V. Ferreira da Luz, P. Kuo-Peng and L.  Krähenbühl,  “Perturbation Finite Element Method  for Magnetic Model Refinement of Air Gaps and Leakage Fluxes”, IEEE Trans. Magn., vol.45, no. 3, pp. 1400-1403, 2009. 

[6] C.  Geuzaine,  B.  Meys,  F.  Henrotte,  P.  Dular  and  W.  Legros,  “A Galerkin projection method for mixed finite elements”, IEEE Trans. Magn., Vol. 35, No. 3, pp. 1438-1441, 1999. 

[7] P. Dular and R. V. Sabariego, “A perturbation method for computing field  distortions  due  to  conductive  regions  with  h-conform magnetodynamic finite element formulations”, IEEE Trans. Magn., vol. 43, no. 4, pp. 1293-1296, 2007. 

[8] Zhiguang  CHENG  and  Norio  TAKAHASHI  and  Behzad FORGHANI  “TEAM  Problem  21  Family".  Approved  by  the International  Compumag  Society  Board  at  Compumag-2009, Florianópolis, Brazil. 

(The Board of Editors received the paper on 25/02/2016, its review was completed on 26/04/2016)

Page 38: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 35

A SURVEY ON CONSENSUS PROTOCOLS IN MULTI-AGENT SYSTEMS

Tran Thi Minh Dung

The University of Danang, University of Science and Technology; [email protected]

 Abstract - In the past few year, the research community has paid much attention to consensus problems in multi-agent systems, especially, for wireless sensor networks, i.e. control systems that are physically distributed and cooperate by exchanging information through a communication network. This paper gives a brief survey on consensus problems for multi-agent systems based on the current literature. In particular, the general view of the consensus protocols as well as its applications in various fields are presented. Furthermore, we also summarize the studies on designing the consensus matrix according to its convergence analysis. Finally, we give some open problems that can be investigated in the future.

Key words - Consensus Protocols; Multi-agent systems; Graph Theory; Formation control; Coordination control.

1. Introduction

Multi-agent  systems  (MASs)  have  received  a  growing interest  in  the  last  decades.  They  are  developed  for  the demand  of  flexibility,  robustness,  and  re-configuration features  that  appear  in  various  application  domains including  manufacturing,  logistics,  smart  power  grid, building  automation,  disaster  relief  operation,  intelligent transportation  systems,  surveillance,  environmental monitoring  and  exploration,  infrastructure  security  and protection,  etc.  A  MAS  is  a  system  composed  of  multiple interacting  intelligent  agents  (sensors,  plants,  vehicles, robots,  etc.) and  their  environment  in Figure 1. 

 

 

Agents 

 Environment 

 

To  summarize,  a  MAS  is  a  group  of  nodes  (agents) representing  vehicles,  sensors,  plants,  etc.,  which  are  able to exchange  information in order to  reach a common goal. Schematically,  MAS  can  be  represented  by  a  network  of nodes  interconnected  via  a  communication  topology. Interconnections  between  agents  in  a  MAS  are  usually modeled  by  directed  or  undirected  graphs. 

One thing to note here is that a MAS can deal with tasks that are difficult or even impossible to be accomplished by an individual  agent.  During  recent  decades,  MASs  gain  a widespread interest in many disciplines such as mathematics, physics,  biology,  computer  science  and  social  science.  An increasing  range  of  research  topics  in  MASs  includes cooperation  and  coordination,  distributed  computation, automatic control, wireless communication networks, etc. 

In  automatic  control,  the  interests  of  MASs  is particularly  relevant  when  one  has  to  face  with  systems 

consisting of multiple vehicles (which are considered to be the  agents)  with  several  sensors  and  actuators  that  are intended  to  perform  a  coordinated  task.  In  recent  years, these  cooperative  control  capabilities  including  formation control,  rendez-vous,  attitude  alignment,  flocking, congestion  control  in  communication  networks,  task  and role  assignment,  air  traffic  control  have been  analysed. 

(a) (b)

Figure 2. Examples with cooperative control and formation control: (a) cooperative localization of robots, (b) a simple

formation control. Pictures from the website: (http://www.cis.upenn.edu/~cjtaylor/RESEARCH/projects/Multi

bots/Multibots.html).

In  cooperative  control  strategies  to  be  successful, numerous issues must be addressed, including the definition and  management  of  shared  information  among  a  group  of agents  to  facilitate  the  coordination  of  these  agents. Furthermore,  the  shared  information  may  take  the  form  of common  objectives,  common  control  algorithms,  relative position information, or a world map. Information necessary for  cooperation  may  be  shared  in  a  variety  of  ways.  For instance,  relative  position  sensors  may  enable  vehicles  to construct state information for other vehicles, knowledge may be communicated between vehicles using a wireless network, or joint knowledge might be preprogrammed into the vehicles before a mission begins. Therefore, cooperation requires that the group of agents reach consensus on the coordination data. 

In  a  typical  centralized  structure,  a  fusion  center  (FC) collects all measurements from the agents and then makes the final  computations.  However,  due  to  the  high  information flow  to  FC,  congestion  can  occur.  Such  a  structure  is vulnerable to FC failure. Also, the hardware requirements to build wireless communications can be one of reasons for an increase in the cost of the devices and thus, a higher overall cost of the network. For these reasons, a centralized structure can  be  inefficient.  Hence,  the  research  trend  of  MASs  has shifted  to decentralize MASs where  the interaction between agents  is  implemented  locally without global knowledge. A good  example  is  wireless  sensor  networks  (WSNs),  which find broad application domains such as military applications (battlefield  surveillance,  monitoring  friendly  forces, equipment  and  ammunition,  etc.),  environment  applications (forest fire detection, food detection, etc.), health applications (tele-monitoring  of  human  physiological  data,  etc.),  home 

Figure 1. A Multi-agent system with their agents and the environment.

Page 39: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

36 Tran Thi Minh Dung

Nodes (vertices) 

Edge (link) 

automation, formation control, etc.. Figure 3 depicts a WSN that  collects  data  for  the  air  quality,  light  intensity,  sound volume, heat, precipitation and wind. 

Figure 3. A network of wireless sensors on the light poles all over the city

Therefore,  based  on  local  information  and  interactions between  agents,  how  can  all  agents  reach  an  agreement (consensus)?  This  problem  is  called  consensus  problem, which  is  to  design  a  network  protocol  based  on  the  local information obtained by each agent so that all agents finally will reach an agreement on certain quantities of interest. 

Consensus  problems  of  MASs  have  received tremendous  attention  from  various  research  communities due to its broad applications in many areas including multi-sensors data  fusion  [1],  flocking behavior of  swarms  [2], [3],  multi-vehicle  formation  control  [4],  distributed computation [5], rendez-vous problem [6] and so on. More specifically,  average  consensus  protocols  (i.e.  the agreement corresponds to the average of the initial values) are  commonly  used  as  building  block  for  several distributed control, estimation or inference algorithms. 

In  the  recent  literature,  one  can  find average  consensus protocols  embedded  in  the  distributed  Kalman  filter  [7], distributed  Least  Squares  algorithm  [8],  distributed Alternating  Least  Square  for  tensors  factorization  [9], distributed Principal Component Analysis [10], or distributed joint input and state estimation [11] to cite few. However, the asymptotic  convergence  of  the  consensus  protocols  is  not suitable  for  these  kinds  of  sophisticated  distributed algorithms. A low asymptotic convergence cannot ensure the efficiency and the accuracy of the algorithms, which can lead to  other  unexpected  effects.  For  example,  regarding  to  the WSNs,  a  reduction  in  the  total  number  of  iterations  until convergence can  lead  to  a  reduction  in  the  total  amount of energy  consumption  of  the  network,  which  is  essential  to guarantee a longer lifetime for the entire network. On the other hand, the protocols that guarantee a minimal execution time are  much  more  appealing  than  those  ensuring  asymptotic convergence.  For  this  purpose,  several  contributions dedicated  to  finite-time  consensus  have  been  recently published in the literature [12]. In other words, the consensus is obtained in a finite number of steps. 

There  are  several  approaches  used  by  a  number  of researchers  to  reach  the  finite-time  consensus  in  recent years: linear iteration, leader-follower type architecture, and so on. In literature, most authors use a linear iteration, where 

each node repeatedly updates its value as a weighted linear consensus scheme so that, at each time-step, each node will have only to transmit a single value of its neighbors. 

In  this  paper,  we  make  a  brief  survey  on  consensus problem in multi-agent systems in Section 1 and cite a few of its  applications  in  this  Section.  After  introducing  the mathematic  background  on  graph  theory  in  Section  2,  we present  the  consensus  problem  and  the  consensus  matrix design in Section 3. Finally, we conclude this paper and point out some open problems for future research in Section 4. 

2. Graph Theory

As  we  state  in  the  Section  I,  the  interconnection between agents in a network can be modeled by a graph as shown in Figure 4 with graphG (V, E). 

Where  V = {1, 2, … , N} is  the  set  of  vertices  (nodes  or 

agents), and E  V  V is the set of edges (links between agents). 

 Figure 4. Graph � (�, �)

According  to  the  communication  policy,  the  graph G (V, E)  can  be  distinguished  as  undirected  graph  and directed  graph.  If  there  is  no  direction  assigned  to  the edges, then both edges (�, �) and (�, �) are included in the set of the edges E. The graph is called undirected graph. It is said that if agent � and � are connected, then link between 

i and j is included in E, (�, �) E. And then, i and j are both called neighbors. The set of neighbors of agent i is denoted by Ni and its degree is presented by di = |N|, where |.| stands for the cardinality. Conversely, if a direction is assigned to the  edges,  the  relations  are  asymmetric  and  the  graph  is called a directed graph. For a directed edge(�, �), i is called the head and j is called the tail. A vertex i is connected to j 

by a directed edge, or that j is a neighbor of i if (�, �) E. 

In  an  undirected  graph  G,  two  vertices  i  and  j  are connected if  there is a path from  i to j. And an undirected graph G is connected if for any two vertices in G there is a path between them. Conversely, two vertices i and j in G are disconnected if there is no path from i to j. A directed graph is  strongly  connected  if  between  every  pair  of  distinct vertices (i, j) in G, there is a directed path that begins at i and ends at j. It is called weakly connected if replacing all of its directed edges with undirected edges produces a connected undirected graph. A graph is said to be complete if every pair of vertices has an edge connecting them, which means that the number of neighbors for each vertex is equal to N-1. 

We denote by A the adjacency matrix of the graph with 

the entries  ��,� given by ��,�= �1, �� (�, �) ∈ �

0, ��ℎ������ . The graph 

Laplacian matrix L is defined as the matrix with entries ��,� 

Page 40: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 37

given by ��,� = �∑ ��,� �� � = ��

� �� ,���

− ��,� �� �≠ �.  Degree  matrix D of 

the  graph  has  vertex  degree  di,  i  V  on  its  diagonal  and zeros  elsewhere. 

3. Consensus problem

Consensus issue in networks of autonomous agents has been  widely  investigated  in  various  fields,  including computer  science  and  engineering.  In  such  networks, according to an a-priori specified  rule, also called protocol, each  agent  updates  its  rate  based  on  the  information received  from  its  neighbors  with  the  aim  of  reaching  an agreement  to  a  common  value.  When  the  common  value corresponds  to  the  average  of  the  initial  states  average consensus  is  to be achieved. 

Example 1:  Consider  an  arbitrary  network  of  5  agents communicating  with  each  other  as  described  in  Figure  5. Each agent has an initial value. A consensus protocol is an interaction  rule  that  specifies  the  information  exchange between an agent and all of its neighbors on the network to reach an agreement  regarding  a  certain quantity of  interest that  depends  on  the  state  of  all  agents.  Informally,  despite the  initial  values  of  all  agents,  the  output  of  the  given network is converged to the common value (in the case, the average of  initial values). 

Figure 5. Average Consensus in a network: initial condition (left) and steady state (right)

In  the  literature,  consensus  protocols  can  be  classified as  follows  [13]: 

Figure 6. Classification of Consensus protocols

3.1. Definition

In  this  part,  the  definition of  the  consensus  problem  is given  according  to  discrete-time  systems  and  continuous-time systems. 

Given  a  graph G (V, E),  each  node  has  an  associated value  xi  defined  as  the  state  of  node  i.  Let 

�(0) = [��(0) ��(0) … �� (0)]�  be the vector of initial states  of  the  given  network.  In  general,  given  the  initial states at each node ��(0),� ∈ �, the main task is to compute the  final  consensus  value  using  distributed linear iterations.Each  iteration  involves  local  communication between nodes.  In particular, each node  repeatedly updates its value as a linear combination of its own value and those of  its  neighbors.  The  main  benefit  of  using  a  linear iterations scheme is that, at each time-step, each node only has to transmit a single value to each of its neighbors. 

3.1.1. Discrete-time systems

The linear iteration-based consensus update equation is: 

��(� + 1) = � ��(�)��(�) + ∑ � ��(�)��(�),�∈��  (1) 

� = 1,2, … ,� 

Or equivalently in matrix form: 

�(� + 1) = �(�)�(�),           (2) 

Where  W(k)  is  the  matrix  with  entries 

� ��(�) = 0 �� (�,�) ∉ �and ∑ � ��(�) = 1�∈��∪{�} . 

The system is said to achieve the distributed consensus 

asymptotically  if  lim�→�

�(�) = ��,  meaning  that  all  nodes 

agreed  on  the  value . When  is  equal  to  the  average  of 

the  initial  values,  i.e. � =�

�∑ ��(0)�

��� ,  the system  is  said 

to achieve  the average consensus,  meaning that: 

lim�→�

�� =�

����.            (3) 

The  convergence  conditions  are  described  as  follows: 

Theorem 1[15]: Consider  linear  iteration  protocol  (2), the  distributed  consensus  is  achieved  if  and  only  if  the weighted  consensus  matrix  W  satisfies  the  following conditions: 

a. �� = �

b. �(� − ���) < �

Where �(� − ���) is  the  spectral  radius  of � − ���  

and c is chosen so that ��� = 1. 

Then, the weighted matrix has row-sum equal  to 1 and 1 is a simple eigenvalue of W and that all other eigenvalues are  strictly  less  than  one  in  magnitude.  It  is  said  that  the weighted  matrix  is a  row-stochastic  matrix. 

Theorem 2 [15] : Equation (3) holds if and only if: 

c. ��� = �

d. �� = �

e. � �� −�

����� < �

Meaning  that W is a doubly stochastic  matrix. 

3.1.2. Continuous-time systems

We still consider a system modeled as a graph �(�,�) with N agents,  in which each agent has a value �� ∈ � .  In 

5 4 

7 6 

Initial values

At the beginning 

4.8 

4.8 

4.8 

 

4.8 4.8 

 

final values

Finish 

Page 41: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

38 Tran Thi Minh Dung

[13]  a  continuous-time  consensus  protocol  can  be expressed  as  follows: 

��(�) = − ∑ ���(�) ���(�) − ��(�)��∈��(�) ,  (4) 

Where  ��(�)  represents  the  set  of  agents  whose information  is  available  to  agent  i  at  time  t  and  ���(�) 

denotes  a  positive  time-varying  weighting  factor.  In  other words,  the  process  of  calculation  is  implemented  by  the fact  that  the  node  just  integrates  its  values  or,  the information  state  of  each  agent  is  driven  toward  the  states of  its  neighbors at each time. 

The  protocol  (4)  can  be  expressed  in  matrix  form  as � = − ��, where  L is  the  graph  Laplacian  and � = [�� �� … �� ]� . 

3.1.3. Finite-time consensus problems [14]

In  actual  complicated  systems,  the  execution  time  is getting more and more impact. Therefore, the purpose is now to design a finite-time average consensus algorithm allowing all  nodes  to  reach  the  average  consensus  value  in  a  finite number of steps D for self-configuration protocols, i.e. 

�(�) =�

�����(0)  (5) 

Meaning  that,  we  are  about  to  design  a  set  of  consensus 

matrices ��,��, … ,��  such that ∏ ���� �� =

���� . 

3.2. Consensus Matrix Design

In  the  literature,  there  are  some  works  devoted  to  the design  of  the  weighted  matrix  W  that  satisfies  the convergence  conditions  of  the  consensus  protocols.  For instance,  in  [15]: 

A. Maximum-degree  weights: 

An approach to design the weighted matrix W in a graph with  fixed  topology consists of assigning a weight on each edge equal to the maximum-degree of the network, i.e. 

� �� =

⎩⎪⎨

⎪⎧

1

���� + 1 �� �∈ ��

1 −��

���� + 1 �� � = �

0 ��ℎ������

 

Where ���� = max �� ≤ � . 

B. Metropolis  weights: 

The  metropolis  weights  matrix  W  for  a  graph  with  a time-invariant  topology  is proposed with  the entries: 

� �� =

⎩⎪⎨

⎪⎧

1

max {��,��} + 1 �� � ∈ ��

1 − � � ��

���

�� � = �

0 ��ℎ������

 

C. Constant  edge  weights: 

This is widely model for the weight matrix in both time-varying and  time-invariant  topologies. The W is defined as follows: 

� �� = �� �� �∈ ��

1 − �|��| �� � = �

0 ��ℎ������

 

The  weighted  matrix  can  be  expressed  in  matrix  form as � = �� − �� with �� being  identity  matrix. 

D. In  analysis  of  consensus  problem,  convergence  rate is an important index that evaluates the performance of the proposed  consensus  protocol.  Therefore,  there  are  some works dealing  with  accelerating  the  rate of  convergence of the  consensus  protocol  by  solving  some  optimization problems  in  centralized  way. 

In  [15],  the  authors  have  proposed  an  optimization method  to  obtain  the  optimum  weighted  matrix  W achieving  the  average  consensus  in  linear  time  invariant topologies  as  the  solution  of  a  semi-definite  convex programming. 

min�

� �� −1

�����

������� �� � ∈ ��,��� = ��,�� = �

 

Where  � ∈ �� expresses  the  constraint  on  the  sparsely pattern of  the matrix W with the set �� defined as  follows: 

�� = �� ∈ � �× �|� �� = 0 �� (�,�) ∉ � ��� � ≠ ��.

4. Conclusion

In this paper, we have reviewed the consensus protocols in the context of Multi-agent systems (MAS), in particular for Wireless Sensor Network (WSN).  In addition, we have cited  out  some  application  domains  of  the  consensus protocols  that can be embedded  in various  important  fields such  as  military,  environment,  health,  automation  control, and formation control, etc. Since the research on consensus is  ongoing,  this  survey  is  waiting  for  future  contributions to  the  literature. 

Moreover,  we  have  pointed  out  the  general  picture  of consensus  protocols  and  some  designs  of  the  consensus matrix.  In  fact,  most  applications  of  consensus  are asymptotic convergence  that  is  not  suitable  for  these  kinds of  sophisticated  distributed  algorithms.  A  low  asymptotic convergence cannot  ensure  the  efficiency  and  the accuracy of the algorithm, which can lead to other unexpected effects. Therefore,  the orientation of  research now  is  shifted  to  the protocols that guarantee a minimal execution time. For this purpose,  some  works  are  dedicated  to  accelerate  the convergence rate of the algorithms or finite-time consensus. 

REFERENCES

[1] R.  Olfati-Saber  and  J.S.  Shamma.  Consensus  filters  for  sensor networks  and  distributed  sensor  fusion.  In  Proc. of the 44th IEEE Conference on Decision and Control and European Control Conference. CDC-ECC ’05, pages 6698–6703, Dec 2005. 

[2] R.  Olfati-Saber.  Flocking  for  multi-agent  dynamic  systems: algorithms  and  theory.  The IEEE Transactions on Automatic Control, 51(3): 401–420, March 2006. 

[3] V. D. Blondel, J. M. Hendrickx, A. Olshevsky, and J. N. Tsitsiklis. Convergence  in multi-agent coordination,  consensus,  and  flocking. In Proc. of the 44th IEEE Conference on Decision and Control, 2005 and  2005  European  Control  Conference.  CDC-ECC  ’05,  pages 2996–3000, December 2005. 

[4] D.V. Dimarogonas and K.J. Kyriakopoulos. Formation control and collision  avoidance  for  multi-agent  systems  and  a  connection between  formation  infeasibility  and  flocking  behavior. In Proc. of the 44th IEEE Conference on Decision and Control and European Control Conference. CDC-ECC ’05, pages 84–89, Dec 2005. 

Page 42: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 39

[5] V.  Borkar  and  P.P.  Varaiya.  Asymptotic  agreement  in  distributed estimation. IEEE Transactions on Automatic Control,  27(3):  650–655, Jun 1982. 

[6] J.  Cortes,  S.  Martinez,  and  F.  Bullo.  Robust  rendezvous  for  mobile autonomous agents via proximity graphs in arbitrary dimensions. IEEE Transactions on Automatic Control, 51(8): 1289–1298, Aug 2006. 

[7] R. Olfati-Saber. Distributed Kalman filtering for sensor networks. In Proc. of the 46th IEEE Conf. on Decision and Control, pages 5492–5498, New Orleans, LA, USA, December 12–14 2007. 

[8] S.  Bolognani,  S.  Del  Favero,  L.  Schenato,  and  D.  Varagnolo. Distributed  sensor  calibration  and  least-squares  parameter identification in WSNs using consensus algorithms. In Proc. of 46th annual Allerton Conference, pages 1191–1198, Allerton  House, UIUC, Illinois, USA, 2008. 

[9] A.Y.  Kibangou  and  A.L.F.  de  Almeida.  Distributed  PARAFAC based  DS-CDMA  blind  receiver  for  wireless  sensor  networks.  In Proc. of the IEEE Workshop SPAWC,  Marrakech,  Morocco,  June 20-23 2010. 

[10] S.  V.  Macua,  P.  Belanovic,  and  S.  Zazo.  Consensus-based distributed  principal  component  analysis  in  wireless  sensor 

networks.  In Proc. of the IEEE Workshop SPAWC,  Marrakech, Morocco, June 20-23 2010. 

[11] A. Esna-Ashari, A.Y. Kibangou, and F. Garin. Distributed input and state estimation for linear discrete-time systems. In Proc. 51st IEEE Conf. on Decision and Control (CDC),  Maui,  Hawaii,  USA, December 2012. 

[12] S. Sundaram and C. Hadjcotis. Finite-time distributed consensus in graphs  with  time-invariant  topologies.  In Proc. of the American Conference on Control (ACC),  pages  711–716,  New  York,  USA, July 2007. 

[13] R. Olfati-Saber and R. M. Murray. Consensus problems in networks of  agents  with  switching  topology  and  time-delays.  i  vol.  49,  pp. 1520-1533, Sep. 2004. 

[14] A. Y.  Kibangou. Step-size sequence design  for  finite-time average consensus in secure wireless sensor networks. Systems and Control Letters, 67:19–23, March 2014. 

[15] L. Xiao, S. Boyd, and S. Kim. Distributed average consensus with least-mean-square  deviation.  Journal on Parallel Distributed Computation, 67(1): 33–46, January 2007. 

(The Board of Editors received the paper on 14/04/2016, its review was completed on 25/04/2016)

Page 43: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

40 Nguyen Thi Hoa Hue, Le Thanh Nhan

ORGANIZATION OF A KNOWLEDGE BASE TO REUSE WORKFLOW TEMPLATES: AN ONTOLOGICAL APPROACH

Nguyen Thi Hoa Hue1, Le Thanh Nhan2 1Information Technology Faculty Vietnam - Korea Friendship Information Technology College

Da Nang, Vietnam; [email protected] 2Nice Sophia Antipolis University, Sophia Antipolis, France; [email protected]

 Abstract - Nowadays, business process models have been used in a wide range of enterprise applications. As a result, it is necessary to take interest in how to create business processes correctly in terms of semantics and syntax. Moreover, attention needs to be paid to the acceleration of the efficiency of reusing the existing models. In this paper, we introduce a knowledge base established to assist the choice of appropriate workflow templates for the development of a new business workflow template. We describe a repository that contains business workflow templates whose syntactic and semantic correctness has been checked. The repository provides an organizational mechanism for control flow-based business workflow templates to guarantee an effective search for necessary workflow templates. In addition, we also propose a process for developing workflow templates in the paper.

Key words - business process; knowledge base; ontology; SPARQL; reuse; workflow template.

1. Introduction

The  design  of  business  workflow  management  systems (WfMSs)  is  generally  independent  from  the  concrete business  area  of  employing  enterprises.  Consequently,  this workflow technology follows a generic approach. Therefore, IT experts play an important role in implementing business processes  of  the  enterprise  and  establishing  its  software infrastructure. It is important to note that business workflows are  aimed  at  automating  and  optimizing  an  organization's processes in an administrative context to reduce costs (e.g., human  resources)  and  increase  revenue.  Up  to  now,  there have  been  more  than  a  hundred  business  WfMSs,  such  as FileNet,  SAP,  JBPM  and  Spiff  Workflow.  Insurance, banking  and  health  industries,  for  example,  are  domains using business workflows. 

However,  the  specification  of  a  real-world  business process  is  generally  manual  and  is  thus  vulnerable  to human errors. An  incorrectly designed workflow may  lead to  failed  workflow  processes,  execution  errors  or  not  meet the  requirements  of  customers,  etc.  There  is  an  inherent problem  regarding  the  problem  of  modelling  semantically rich  business  workflow  templates1,  workflow  templates sharing and subsequently their reuse need to be considered. 

Continuing our previous  work  [9, 10, 11], which  focus on  how  to  model  semantically  rich  business  workflow templates  and  check  their  correctness  at  the  syntactic  and semantic  level,  in  this paper we introduce a solution  to  the reuse of  workflow  templates. 

Let  us  consider  the  following  scenario.  A  person  plans to  create  an  ordering  process  for  his  own  purpose.  He  has either some experience in working on it or none at all. The question is how he can create his process model in the most 

 1  In  our  work,  we define  a  definition  for  business  workflow  template: A business workflow template  is  a generic business workflow that  can  be customized according to the application. 

effective way without developing it  from scratch. 

In  fact,  the  different  existing  workflow  templates extracted  from  a  set  of  process  models  can  support modellers  to  create  new  workflows  or  process  models  by providing  the  knowledge  about  potential  and  suitable workflow  activities.  We  are  interested  in  the  organization of  a  knowledge  base  which  guides  the  search  for  suitable workflow templates in order to reuse them. Users can adapt the resulting workflow templates for each specific use case. This is the knowledge on how to model a business process reusing  control  flow-based  business  workflow  templates (CBWTs).  Hence,  the  annotation  and  storage  of  workflow templates  play  a  very  important  role  in  the  success  of reusable  CBWTs,  which  guarantee  an  effective  search  for modelling  a  business  process. 

The  rest  of  this  paper  is  structured  as  follows:  In Section  2  we  present  related  works.  We  then  propose  an organization  of  the  knowledge  base  of  CBWTs  in  Section 3. We also  indicate that  the SPARQL [13] query  language is  used  to  retrieve  a  list  of  workflow  templates  from  the CBWT  repository  we  have  proposed.  In  Section  4,  we introduce  a  process  for  developing  workflow  templates. Finally,  Section  5  concludes  the  paper  with  an  outlook  on future  research. 

2. Related Works

Up  to  now,  the  problem  of  reusing  process  models  or workflows  is  mentioned  in  some  existing  approaches.  In general,  workflows  can  be  reused  manually  or  semi-automatically  [4,  6,  7].  Moreover,  modellers  can  partly  or fully reuse a workflow [1, 3, 4, 8]. 

The authors in [8] specify a method for business process design via view  integration which  takes  two process views as input. At first, semantic relationships between elements of different  process  models  are  formalized.  On  this basis,  the integrated  process  model  applying  the  merge  operator  is calculated.  [1]  also  presents  a  formal  approach  for constructing customized process views on structured process models  to  improve  effective  cross-organizational collaborations.  Each  customized  process  is  constructed  by hiding and/or omitting activities not requested by the process consumer.  However,  neither  of  them  considers  content-based reuse. In order to overcome that issue, the authors in [4]  introduce a set of Domain Process Patterns (DPPs)  that capture process model parts. 

A  DPP  represents  a  specific  business  function  of  a 

Page 44: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 41

process  model part  in  a modelling domain.  DPPs  facilitate reuse  from  a  content  perspective  by  focusing  on  domain-centered  reuse  of  process  model  content.  Nevertheless, DPPs  do  not  provide  any  syntactic  needs  for  modelling business  processes.  However,  by  capturing  process  model parts  with  a  particular  structure,  DPPs  do  not  support syntactic  checks  which  are  supported  in  our  approach.  In our  approach,  a  workflow  template  is  stored  in  the repository  if  and  only  if  it  is  checked  at  the  syntactic  and semantic  level, and no errors exist. 

In  [2],  the  authors  propose  a  framework  to  enable ontology-driven  process  modelling.  By  utilizing  the framework, users can define, analyze and re-engineer their process  models  in  complex  and  dynamic  contexts  with semantically  enriched  processes.  But  they  are  mainly interested  in  structuring  and  exploiting  design  knowledge. They do  not  focus on  the  meaning of  all  the  concepts  and relationships in the knowledge base, this is in contrast with our  approach. 

3. Organization of the Knowledge Base of Control Flow-based Workflow Templates

In  literature,  the  main  goals  of  workflow  reuse  are  to improve  workflow  template  quality  and  to  increase  its development  productivity  [5].  In  other  words,  the  more workflow templates are available, the more difficult they are to be suitable in a specific reuse case. It is worth noting that the reuse of workflow templates is only beneficial if the cost to  find and adapt an  existing workflow  template  is  smaller than the cost needed to develop a new one from scratch. 

After  finding  suitable  workflow  templates,  it  is important  for  users  to  understand  what  the  workflow templates actually do. Thus,  there is a strong need that  the knowledge  base  of  workflow  templates  could  provide enough  information  for  modellers  to  be  able  to  determine which template is suitable for  the reuse case at hand. 

In  [9,  10],  we  introduce  an  approach  to  develop  a workflow  template relying on a set of semantic constraints and  the  structure  of  CPNs.  The  workflow  template  is formalized  via  an  RDF  [13]  graph  in  which  the dependencies  between  its  activities  are  expressed. 

In  this  paper,  we  propose  a  method  to  semantically annotate workflow templates. Their retrieval through meta-workflow  templates  will  model  expert  knowledge  and guide  the  use of existing  workflow  templates. The  idea of using  content  which  characterizes  workflow  templates  is not  original.  Indeed,  it  seems  reasonable  to  use  explicit information  to  find  suitable  templates  to  build  a  business workflow.  This  is  particularly  important  for  workflow modellers  to  be  able  to  deal  with  the  great  number  of workflow  templates. 

Based on the analysis of  the state-of-the-art concerning the  organization  and  reuse  of  workflow  templates,  we annotate  workflow  templates  by  the  following  properties as  follows:  2 SPARQL is a query language,  inspired by SQL for querying RDF data. It  is adapted to  the specific structure of RDF and relies on  the triplets that constitute  them. SPARQL allows adding,  removing,  searching and/or modifying data  in RDF format. SPARQL can also be used to query RDFS or OWL vocabularies (written in RDF). 3 PREFIX  anno:<http://ontWFTemplateAnnotationsURI.owl#> 

templateName:  Description  of  the  main  task  being enacted by  the  template. 

description: Description of  the  template. 

keywords:  List  of  words  that  characterizes  the template.  It  also  includes  the  words  that  name  the template. 

listOfActivityLabels:  The  labels  are  extracted  from activity  labels  in  the  template. 

creationDate:  The  date  when  the  template  is created. 

modificationDate:  The  date  the  template  is  last modified. 

relatedTemplates: List of related  templates (if any). The  related  templates  can  be  predecessors  and successors of  the  template. 

bpOnt:  Indicating  the  business  process  ontology used  to develop  the  template. 

The properties templateName, description, keywords and relatedTemplates are determined by using expert knowledge. In  contrast,  the  values  of  the  properties  creationDate  and modificationData are automatically captured at the moment of storing the template. Depending on all the activity labels in the template,  the  value  of  the  property  listOfActivityLabels  is automatically retrieved. For example, to get all activity labels of the template http://WFTemplate#Payment_Processing, the following  SPARQL2 query is first executed to get all IDs of its transitions: 

SELECT distinct ?trans WHERE

{k:Payment_Processing h:hasTrans ?trans}

Then  the  labels  of  these  transitions  are  cut  from  their  IDs and added  to  the list of activity  labels. 

The  property bpOnt captures  the  names  (or  URLs)  of the  business  process  ontology  file.  This  property  leads  us to  the  representation  of  additional  knowledge  that facilitates modellers to search for suitable templates, which can be used to design a new one. 

An  ontology  is  thus  developed  to  annotate  workflow templates.  The  ontology  describes  the  main  classes  and properties  for RDF annotations of workflow  templates  (see Figure  2). 

In fact,  the semantic annotations of workflow templates have  been  inspired  by  this  idea:  the  knowledge  added  to these annotations will be helpful for the (re-)use of workflow templates. Those meta-workflow  templates allow retrieving a  list  of  workflow  templates  that  correspond  to  different criteria.  For  example,  to  acquire  all  existing  workflow templates relating to payment by credit card, two criteria are used:  (i)  one  keyword  of  such  template  is credit card;  (ii) description  of  such  template  contains  payment procecss. This can be performed by the SPARQL3 query as follows: 

 

Page 45: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

42 Nguyen Thi Hoa Hue, Le Thanh Nhan

Figure 1. Example of the semantic annotation of Payment workflow template  

SELECT * WHERE

{ ?workflow anno:keywords ?keyword

FILTER (?keyword ~ "credit card"^^xsd:string)

?workflow anno:description ?descr

FILTER (?descr ~ "payment process"^^xsd:string)

?workflow anno:templateName ?name;

anno:listOfActivityLabels ?actLabel;

anno:relatedTemplates ?relatedTemp;

anno:creationDate ?crtDate;

anno:modificationDate ?modDate }

As  a  result,  a  semantic  annotation  of  workflow templates  which  expresses  knowledge  relative  to  their properties  is  proposed  here.  The  expert  knowledge  is captured  as  RDF  annotations  to  conduct  users  to  model new  business  processes.  Figure  1  illustrates  a  simplified example of such semantic annotation. 

Figure 2. Extract of the annotation ontology used to annotate workflow templates

It is important to emphasize that those meta-workflow 

templates allow retrieving workflow templates, which are annotated  with  additional  expert  knowledge  formalized with the help of the CPN ontology (for more details please see [10]) and the BP ontology (for more details please see [9]). In the following we introduce an excerpt of the RDF annotation  related  to  the  workflow  template http://WFTemplate#Payment depicted in Figure 1. 

<rdf:RDF

xmlns ="http://ontWFTemplateAnnotationsURI.owl#"

xmlns:wf="http://WFTemplate#"

xmlns:rule="http://ECARule#"

... >

<TemplateAnnotation rdf:ID="wf0012">

<templateName rdf:resource="http://WFTemplate#Payment"/>

<keywords>Cash;Credit card; Payment; Payment processing </keywords>

<listOfActivityLables>Request payment; Provide payment methods; Get payment data; Process check or cash; Process credit card; Accept payment; Reject payment </listOfActivityLables>

<description>Template payment processing is used to handle the payment process...</description>

<relatedTemplates rdf:resource="http://WFTemplate#Invoicing"/>

<relatedTemplates rdf:resource= "http://WFTemplate#OrderProcessing"/>

...

<bpOnt rdf:resource="http://BPOntology#

Payment"/>

...

</TemplateAnnotation>

</rdf:RDF>

Page 46: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 43

4. Process for Developing Workflow Template

In  this  section,  we  introduce  a  process  for  developing workflow templates, which is  regarded as part of a process for  developing  an  encompassing  workflow  application. The  process  consists  of  the  main  following  phases  (see Figure  3): 

Search for reusable workflow templates:  An analysis  of  the  process(es)  is  performed  before implementing  it.  This  results  in  a  set  of  requirement descriptions  as  well  as  a  business  process  model.  The information is  then used to start  the process for developing workflow  templates  which  may  involve  the  search  for reusable  workflow  templates. 

Understand and select potential, suitable templates:  In  this  phase,  modellers  have  to  carefully consider  the  found  workflow  templates.  They  try  to understand  them to decide which ones are (partly or  fully) reused  for  their  application. 

Modify selected templates:  If  the  selected templates  do  not  comply  with  all  the  requirements,  they have  to  be  modified  accordingly.  For  example,  some  new activities  can be  added  into  a  selected  template. 

Create new sub-workflow templates:  Besides reusing  part  or  all  of  the  existing  templates,  modellers might  have  to  create new sub-workflow  templates  to  meet all  the  requirements. However,  the  creation  of  a  new  sub-workflow  template  is  only  necessary  if  no  existing templates can be reused  instead for  the same purpose. 

Complete workflow templates: The last phase is to  complete  a  new  workflow  template.  The  existing unmodified,  modified  and  new  sub-workflow  templates are integrated into a new workflow template for a specific use case. Each of these workflow templates is considered as  a  sub-workflow  of  the  new  workflow  template.  It  is then verified at  the  syntactic and  semantic  level.  In  case of errors, the errors have to be solved. The new workflow template is stored in the CBWT repository if and only if there exist neither syntactic errors nor semantic errors. 

Figure 3. Development of reuse-based workflow template

To  find  suitable  workflow  templates,  users  can  define their  criteria  via  keyword,  description  or  activity  labels.  If the  search  process  returns  only  one  template,  users  can 

easily  make  their  decision  that  the  template  is  selected  or not  selected.  Otherwise,  the  value  of  the  property RelatedTemplates can be used to provide more information for users  to make their decision. 

To  sum  up,  the  semantic  annotations  of  workflow templates integrating expert domain knowledge formalized via  an  RDF  graph  are  used  to  organize  and  retrieve workflow  templates  and  their  business  process  ontologies. The  resulting  templates  and  their  rules  can  be  used  in  a process  for  implementing  software  components  or  in  a process  for  developing  workflow  templates. 

5. Conclusion

In  this  paper,  we  have  presented  a  process  for developing  workflow  templates,  which  specially emphasizes  the  different  phases  of  workflow  template reuse comprising the tasks of searching, understanding and modifying  workflow  templates.  Each  phase  provides useful support to facilitate the reuse of workflow templates. 

Moreover,  in  order  to  better  support  the  search  for suitable  workflow  templates,  the  annotation  ontology  has been  developed  to  annotate  workflow  templates.  The ontology  provides  adequate  information  about  the workflow  templates  for  workflow  modellers  to  determine whether a workflow  template is able  to be reused. 

At  the  moment,  only  build-time  is  supported  and  we know  that  verifying  workflow  templates  at  the  build-time is  not  sufficient  to  guarantee  that  workflows  can  be executed correctly. The correctness of workflow execution must  also  be  checked.  Therefore,  in  future  work,  we  plan to  develop  a  run-time  environment  for  validating  concrete workflows. 

REFERENCES

[1] Rik Eshuis and Paul W. P. J. Grefen. Constructing customized process views. Data Knowl. Eng., vol. 64, no. 2, 2008, pages 419-438 

[2] G.  Greco,  A.  Guzzo,  L.  Pontieri,  L.  and  D.  Saccà  (2004).  An ontology-driven process modeling framework. In 15th International Conference  on  Database  and  Expert  Systems  Applications,  IEEE Computer Society, Zaragoza, Spain, pp. 13–23. 

[3] Agnes  Koschmider,  Thomas  Hornung  and  Andreas  Oberweis. Recommendation-based editor for business process modeling. Data Knowl. Eng., vol. 70, no. 6, 2011, pages 483-503 

[4] Agnes  Koschmider and Hajo A. Reijers.  Improving  the process of process modelling by the use of domain process patterns. Enterprise IS, vol. 9, no. 1, 2015, pages 29-57. 

[5] Markus  Kradolfer.  A  workflow  metamodel  supporting  dynamic, reuse-based model evolution. PhD thesis, 2000 

[6] Ruopeng  Lu,  Shazia  Sadiq  and  Guido  Governatori.  On  Managing Business Processes Variants. Data Knowl. Eng., vol. 68, no. 7, July 2009, pages 642-664. 

[7] Ivan  Markovic  and  Alessandro  Costa  Pereira.  Towards  a  Formal Framework for Reuse in Business Process Modeling. In Proceedings of  the  2007  International  Conference  on  Business  Process Management,  BPM'07,  Berlin,  Heidelberg,  2008.  Springer-Verlag, pages 484-495. 

[8] Jan Mendling and Carlo Simon. Business Process Design by View Integration.  In  Business  Process  Management  Workshops,  BPM 2006  International  Workshops,  BPD,  BPI,  ENEI,  GPWW,  DPM, semantics4ws, Vienna, Austria, September 4-7, 2006, Proceedings, 2006, pages 55-64. 

[9] Thi-Hoa-Hue Nguyen and Nhan Le-Thanh. Ensuring  the Semantic Correctness  of  Workflow  Processes: An  Ontological Approach.  In 

Page 47: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

44 Nguyen Thi Hoa Hue, Le Thanh Nhan

Proceedings  of  10th  Workshop  on  Knowledge  Engineering  and Software  Engineering  (KESE10)  co-located  with  21st  European Conference  on  Artificial  Intelligence  (ECAI  2014),  volume  1289. CEUR  Workshop  Proceedings,  Prague,  Czech  Republic,  August 2014, pages 30-41. 

[10] Thi-Hoa-Hue  Nguyen  and  Nhan  Le-Thanh.  An  Ontology-Enabled Approach for Modelling Business Processes. In Beyond Databases, Architectures,  and  Structures,  volume  424  of  Communications  in Computer  and  Information  Science.  Springer  international 

Publishing, 2014, pages 139-147. 

[11] Thi-Hoa-Hue  Nguyen  and  Nhan  Le-Thanh.  Ensuring  the Correctness  of  Business  Workflows  at  the  Syntactic  Level:  An Ontological Approach. In Proceedings of  ACIIDS 2016, Da Nang, Vietnam, 2016, pages 533-543. 

[12] https://www.w3.org/RDF/, accessed in April 2016 

[13] https://www.w3.org/TR/rdf-sparql-query/, accessed in April 2016

 

(The Board of Editors received the paper on 12/04/2016, its review was completed on 20/04/2016)

 

Page 48: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 45

A NEW PROPOSED METHOD FOR AUTOMATIC NUMBER PLATE RECOGNITION

Bui Huu Phu1, Trinh Hoang Hon2 1Institute of Applied Mechanics and Informatics; [email protected]

2Hochiminh City University of Technology; [email protected]

 Abstract - This paper describes our new proposed method for automatically identifying the text of vehicle number plate. From a new image, the method automatically extracts plate, classifies and recognizes characters (digits). Firstly, Laplace operator is used to calculate the magnitude of gradient which then is binarized based on a threshold. In the second phase, a sub-window slides all images to search the candidate of plate.The best candidate is chosen by aspect ratio conditions. The extracted plate is then enhanced and classified by colour segment conditions to find candidates of characters as foreground. The horizontal and vertical histograms are used to classify and extract each character separately. Finally, Support Vector Machine algorithm is used to identify the characters. The experimental results have shown that our proposed method obtains high accuracy and is available for real applications.

Key words - Automatic number plate recognition (ANPR); Laplace operator; plate extraction; plate classification; plate identification.

1. Introduction

Automatic  number  plate  recognition  (ANPR),  also called  other  names  as  Automatic  license-plate  recognition (ALPR),  Automatic  license-plate  reader  (ALPR), Automatic  vehicle  identification  (AVI),  Car  plate recognition  (CPR),  License-plate  recognition  (LPR), Lecture  automatique  de  plaques  d'immatriculation  (LAPI), Mobile  license-plate  reader  (MLPR),  or  Vehicle  license-plate  recognition (VLPR),  is a  technology  that uses optical character recognition on images to read vehicle registration plates.  It  can  use  existing  closed-circuit  television,  road-rule  enforcement  cameras,  or  cameras  specifically designed  for  the  task.  ANPR  is  used  by  police  forces around  the  world  for  law  enforcement  purposes.  It  is  also used  for electronic  toll collection on pay-per-use roads and as  a  method  of  cataloging  the  movements  of  traffic  for example by highway agencies. 

Automatic  number  plate  recognition  can  be  used  to store the images captured by the cameras as well as the text from  the  license  plate,  with  some  configurable  to  store  a photograph  of  the  driver.  Systems  commonly  use  infrared lighting to allow the camera to take the picture at any time of  the  day  [1-3].  ANPR  technology  tends  to  be  region-specific, owing  to plate variation  from place  to place. 

ANPR  was  invented  in  1976  at  the  Police  Scientific Development  Branch  in  the  UK.  Prototype  systems  were working  by  1979,  and  contracts  were  let  to  produce industrial  systems,  first  at  EMI  Electronics,  and  then  at Computer  Recognition  Systems  (CRS)  in  Wokingham, UK. Early trial systems were deployed on the A1 road and at  the Dartford Tunnel. However  it  did not become widely used  until  new  developments  in  cheaper  and  easier  to  use software  was  pioneered  during  the  1990s.  The  first  arrest through detection of a stolen car was made in 1981 and the first  documented case  of  ANPR  in  helping  solve a  murder 

occurred  in  November  2005  after  the  murder  of  Sharon Beshenivsky,  in  which  City  of  Bradford  based  ANPR played a vital  role  in  locating and  subsequently  convicting her killers  [4]. 

The  software  aspect  of  the  system  runs  on  standard home  computer  hardware  and  can  be  linked  to  other applications  or  databases.  It  first  uses  a  series  of  image manipulation  techniques  to  detect,  normalize  and  enhance the  image  of  the  number  plate,  and  then  optical  character recognition  (OCR)  to  extract  the  alpha-numeric  of  the license plate. ANPR systems are generally deployed in one of  two  basic  approaches:  one  allows  for  the  entire  process to  be  performed  at  the  lane  location  in  real-time,  and  the other transmits all the images from many lanes to a remote computer  location  and  performs  the  OCR  process  there  at some  later  point  in  time.  When  done  at  the  lane  site,  the information  captured  of  the  plate  alphanumeric,  date-time, lane  identification,  and  any  other  information  required  is completed  in  approximately  250  milliseconds.  This information can easily be transmitted to a remote computer for further processing if necessary, or stored at  the lane for later  retrieval.  In  the other arrangement,  there  are  typically large numbers of PCs used in a server farm to handle high workloads,  such  as  those  found  in  the  London  congestion charge  project.  Often  in  such  systems,  there  is  a requirement  to  forward  images  to  the  remote  server,  and this can  require  larger bandwidth  transmission  media. 

ANPR  uses  optical  character  recognition  (OCR)  on images  taken by  cameras. When  Dutch  vehicle  registration plates  switched  to  a  different  style  in  2002,  one  of  the changes  made  was  to  the  font,  introducing  small  gaps  in some  letters (such as P and R) to make  them more distinct and  therefore  more  legible  to  such  systems.  Some  license plate  arrangements  use  variations  in  font  sizes  and positioning—ANPR systems must be able to cope with such differences in order to be truly effective. More complicated systems  can cope  with  international  variants,  though  many programs are individually tailored to each country. 

There  are  seven  primary  algorithms  that  the  software requires  for  identifying  a  license  plate: 

-  Plate  localization  –  responsible  for  finding  and isolating  the plate on  the picture. 

- Plate orientation and sizing – compensates for the skew of the plate and adjusts the dimensions to the required size. 

- Normalization – adjusts the brightness and contrast of the  image. 

-  Character  segmentation  –  finds  the  individual characters  on  the  plates. 

-  Optical  character  recognition. 

Page 49: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

46 Bui Huu Phu, Trinh Hoang Hon

-  Syntactical/Geometrical  analysis  –  check  characters and  positions  against  country-specific  rules. 

-  The  averaging  of  the  recognized  value  over  multiple fields/images  to  produce  a  more  reliable  or  confident result. Any single image may contain a reflected light flare whether  it  is  partially obscured or other  temporary effect. 

The  complexity  of  each  of  these  subsections  of  the program determines the accuracy of the system. During the third  phase  (normalization),  some  systems  use  edge detection  techniques  to  increase  the  picture  difference between  the  letters  and  the  plate  backing.  A  median  filter may also be used to reduce the visual noise on the image. 

ANPR has been widely studied in  the world. In [6], the author has  described a  fast  algorithm  for automatic  license plate  detection  system  for  the  Egyptian  license  plates  that achieves  a  high  detection  rate  without  the  need  for  a  high quality  images  from  expensive  hardware.  The  system captures  images  of  the  vehicles  with  a  digital  camera.  An algorithm  for  the  extraction  of  the  license  plate  has  been explained  and  designed  using  Matlab.  The  result  can  be achieved  at  about  96%  detection  rate  for  small  dataset.  In [7],  as  few  constraints  as  possible  on  the  working environment  are  considered.  The  proposed  LPR  technique consists  of  two  main  modules:  a  license  plate  locating module  and  a  license  number  identification  module.  The former  characterized  by  fuzzy  disciplines  attempts  to extract  license plates  from  an  input  image,  while  the  latter conceptualized  in  terms  of  neural  subjects  aims  to  identify the  number  present  in  a  license  plate.  Experiments  have been  conducted  for  the  respective  modules.  In  the experiment  on  locating  license  plates,  1088  images  taken from  various  scenes  and  under  different  conditions  were employed.  Among  them,  23  images  have  been  failed  to locate  the  license  plates  present  in  the  images;  the  license plate location rate of success is 97.9%. In the experiment on identifying  license  number,  1065  images,  from  which license  plates  have  been  successfully  located,  were  used. Among them, 47 images have failed to identify the numbers of the license plates located in the images; the identification rate  of  success  is  95.6%.  Combining  the  above  two  rates, the overall rate of success for our LPR algorithm is 93.7%. In [8], the proposed method applied on yellow color license plate.  It  has  two  main  stages.  Firstly,  exact  location  of  the license plate is detected from an input image by using image acquisition  and  optical  character  recognition  and  Sobel edge is used for character segmentation. Secondly, template matching  is  used  to  test  the  recognized  characters  with templates.  This  paper  also  proposes  vehicle  authorization by  checking  the  license  plate  number  from  database  and electronic mail is send to administrator if authorization fails. In  [9],  the  Edge  Detection  methods  are  used  to  locate  the rectangles  from  an  image.  This  is  very  simple  and  fast technique.  Morphology  [10]  is  used  to  extract  the  license plate from the original  image. It helps  to remove unwanted small parts from license plate. 

In  Vietnam,  the  demand  for  the  software  of  ANPR  is very high in many applications. Until now,  in the Vietnam market,  only  the  imported  software  licenses  with  the  high price  have  been  used.  Therefore,  the  authors  want  to 

develop a domestic ANPR with the same quality but much cheaper  than  imported  ones. 

In  the  paper,  the  authors  present  our  own  proposal  of ANPR. We have developed a new algorithm, then build the software,  and  test  it  in  the  realistic  environment.  The results  have  shown  that  our  ANPR  software  has  worked very well  and given  high precision nearly 100% under  the industrial  test.  The  authors  believe  the  software  can  be packed  to be commercialized  in  the  near  future. 

The remaining of the paper has the structure as follows. In section 2 the model of ANPR is presented. In sections 3 and  4,  our  proposed  algorithm  and  processing  steps  of ANPR  are  described.  The  experimental  results  are  shown in  section  5.  Finally,  the  conclusions  are  discussed  in section  6. 

2. Model of Automatic Number Plate Recognition

In general,  the processing steps of ANPR are shown  in Figure  1.  The  input  images  got  from  digital  cameras  will detect  and  extract  the  plate  region,  and  then  the  software will  classify  and  identify  characters  and  digits.  Finally  it gives  the  result  of  recognizing  the  number  plate  of  the vehicle. 

Figure 1. Proposed scheme for identifying plate vehicles

In ANPR, the  steps of plate extraction, character (digit) classification,  and  character  (digit)  identification  are  the most  important,  and  decide  the  quality  and  correction  of the  software. 

a. One row of characters/digits b. Two rows of characters/digits

Figure 2. Several types of vehicle plates in Vietnam

Because  the  number  plates  of  vehicles  are  different  in countries,  the  processing  algorithms  will  be  different.  In Vietnam,  basically,  there  are  2  common  kinds  of  vehicle plates shown  in Figure 2. The number plate  recognition of vehicles in Vietnam is quite difficult because many number plates  are  not  clear,  bended,  and  mounted  with  strange things.  In  the  following  sections, our proposed methods  in the  important  steps of  ANPR are presented. 

3. Plate Extraction

The vehicle plate structure in Vietnam is determined by the Vietnamese government. The dimension and font size of vehicle plates are standardized commonly. There are usually 

Page 50: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 47

two kinds of plates as one row or two rows characters, shown in  Figure  2.  The  dimension  of  one  row  character  plates  is 470mmx110mm,  the  height  of  characters  is  approximately 75% but not higher than 80% of the plates, and the width of characters equals a half of the height. For the plates with two row  characters,  the  dimension  is  280mmx200mm,  but  the size of characters is similar to the first kind. 

In  the  realistic  environments,  the  plates  are  affected  by the  distortion  such  as  scale,  skew,  rotation,  and  cameras. So  in  the  process,  the  relative  dimensions  are  used  with tolerance  ratio  between  plate's  dimensions  built  by  the experience. 

(a) (b)

Figure 3. (a) Original image, (b) Magnitude of gradient with Laplace operation

(a) (b)

(c) (d)

Figure 4. Plate extraction; (a) Binary image, (b) survived image, (c) aspect ratio verification, (d) example of results of

plate extraction.

Firstly, the input image (Figure3 (a)) is performed to get edge enhancement by Gaussian operator [11] as Eq.1 whose 

 is chosen √2; and Gaussian Kernel size is 3 × 3  pixels. 

�(�,�) = �

������ exp(−��� ��

��� ),      (1) 

The  results  (an  example  in  Figure3  (b))  are  binarized with  the  threshold  of  � = 0.07,  then  a  subwindow  with 16 × 8   size  is  slided  to  search  candidates  of  plates,  the candidates which satisfy condition in (2) will survive. 

∑ ∑ ��(�,�) ≥ 15,����

�� ��   (2) 

where, BW is considered as binary  image, w and h are the width  and  height  of  sub-window.  Threshold  value  is chosen  as  15  by  our  experience.  A  demonstration  of  this step can be seen in Figure 4 (b). 

A  bounding  box  of  each  plate  candidate  is  calculated, 

the candidate is chosen from candidates if its aspect ratio is passed the condition in the non-equation (3), whereas non-equations  3(a)  and  3(b)  are  applied  for  one  row  and  two row  character  plates  respectively.  Figure  4  (d)  shows  a result  of  plate  detection. 

�0.15 ≤

� ≤ 0.3 ��� ��� ��� �ℎ������� ������ (3�)

0.5 ≤ �

� ≤ 0.95 ��� ��� ��� �ℎ������� ������ (3�)

 

4. Character (Digit) Identification

The extracted plates are binarized to get foreground shown in Figure 5a, the intensity of pixel is inverted to get the white foreground as shown in Figure 5b. Four line segments nearby bounding box are used to retrieve the rectangular shape. To do so,  the  2D-2D  projection  is  used.  Then  the  plates  are 

normalized to the real aspect ratio of �

�=

��

���. 

a) (b)

(c)

Figure 5. (a) enhanced characters of two row plate, (b) inverted image, (c) vertical histogram and broken point

(a) (b)

(c) (d)

Figure 6. Character (digit) classification: (a) horizontal histogram, (b) characters separated, (c) width and area of the candidate of

characters, (d) example of results of character classification

In  the  case  of  two  row  character  plates,  a  horizontal histogram is set up to separate the first and the second row of character. A vertical histogram of each row of both kinds of plates is calculated as shown in Figure 6. Two thresholds are  issued  for  this  contest,  one  is  a  character  width (��� ) 

Page 51: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

48 Bui Huu Phu, Trinh Hoang Hon

and  the other is  the min area (����). (��� ) is  selected  by from 70% to 130% the real size;. This means that 

9 ≤ TCW ≤ 17                  (4) 

pixels.  For  example 

TCWmin = 0,7 x 40 x 

���

��� = 8,9 ≈ 9  (5) 

pixels, while Amin is defined as the product of the character width and the peak of vertical histogram. All the conditions are demonstrated  in  Figure 6. 

In  practice,  if  the  horizontal  histogram  of  two  row character plates and/or the vertical histogram have not been broken points,  this means that  the rows or characters could not be classified,  then  the plates are treated as  the negative error  of  the  previous  step;  the  negative  error  defines  that non-plate  is  undetected as  a plate. 

(a)

(b)

(c)

Figure 7. Complete process steps in ANPR: (a) plate extraction, (b) character/digit classification, (c) character/digit

identification

The last step for this phase is character identification; the supported  vector  machine  [1]  algorithm  is  used  to  identify the  extracted  characters.  The  training  set  of  characters  is automatically  extracted  as  previous  steps,  and  then  50 correct  ways  of  each  character  or  digit  are  chosen  by program. They are then used as the input data for the training function. The training process is performed in offline mode. 

Figure  7  illustrates  a  complete  process  steps  in  ANPR, consisting  of  the  input  image  and  the  result  of  plate extraction,  shown  in  Figure  7(a);  the  result  of  character classification,  shown  in  Figure  7(b);  and  the  character identification, shown  in Figure 7c. 

5. Experimental Results and Discussions

Based  on  the  proposed  algorithms,  the  authors  have developed  the ANPR software completely. The software is developed  based  on  C++  through  Visual  Studio  2008,  and uses  image  processing  library  OpenCV  version  2.4.9.  The authors have  set  up a ANPR system at An Suong An Lac Tolling  Station  for  testing  the  software  and  system.  The camera  used  for  testing  our  software  is  IRLab  with  the model  CIR- HUW34WP and  the  resolution of 700TVL. 

During  the  time  testing,  there  are  about  10000  vehicle samples  collected  and  tested.  The  authors  have  evaluated that  with about 9000 clear and good appearance plates,  the ANPR system can give very  good and  correct  results. The system  can  work  well  in  day  time  and  night  time.  In addition, the software can well recognize the number of the blue and red color plates. Below are some results that have done at An Suong An Lac Tolling Stations. 

Figure 8. Some test results of the proposed ANPR system

Although,  the ANPR software has given a good result, in  some  realistic  cases,  the  system  can  not  recognize  the number  of  plates.  After  reviewing  and  evaluating,  we  see that  there  are  some  reasons  why  the  ANPR  can  not  work well as follows: 

- The plates are damaged,  curved, distorted. 

- The plates are attached  to some abnormal  subjects. 

- The plates are too dim 

Page 52: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 49

In the future, we will consider developing new methods to improve the quality and correction of our ANPR system. 

6. Conclusions

In the paper, we have presented our proposal to develop ANPR  algorithm  and  system.  The  important  steps  in  the proposal  have  been  described  in  detail.  After  completely building  the  software  and  setting  up  the  system  at  An Suong An Lac Tolling Collection Station, the authors have tested  it  under  the  realistic  environments  for  a  month  with about 10000 vehicle number plate samples. As a result, we see  that  our proposed  ANPR  software  can  work  very  well and give very high precision of number recognition. In  the standard  condition,  the  ratio  of  the  correct  number recognition  is  approximately  100%.  However,  in  some special  cases  when  the  number  plates  are  damaged, distorted, or dim,  the software does not  work well. 

With  the  result,  it  is  obvious  that  our  proposed  and developed  ANPR  software  can  be  packed  to  be  used  for realistic  applications  in  the  future. 

Acknowledgment

The  authors  would  like  to  thank  National  Key Laboratory  of  Digital  Control  and  System  Engineering (DCSELAB)  and  Hochiminh  City  Department  of  Science and  Technology  for  supporting  and  funding  the  research project. 

REFERENCES

[1] "ANPR Tutorial". ANPR Tutorial. 15 August 2006. Retrieved 2012-01-24. 

[2] Shan Du; IntelliView Technol., Inc., Calgary, AB, Canada; Ibrahim, M.;  Shehata,  M.;  Badawy,  Wael;  Automatic  License  Plate Recognition  (ALPR):  A  State-of-the-Art  Review". IEEE. 1 Feb 2013. Retrieved 2014-01-09. 

[3] "An  introduction  to  ANPR". Cctv-information.co.uk.  Retrieved 2012-01-24. 

[4] "CCTV  network  tracks  getaway  car".  BBC  News.  21  November 2005. Retrieved 2013-08-12. 

[5] Amr  E.  Rashid,  “A  fast  algorithm  for  license  plate  detection”, International Conference on Signal Processing Image Processing & Pattern Recognition (ICSIPR), pp. 44-48, Feb. 2013. 

[6] S.L.  Chang,  L.S.  Chen,  Y.C.  Chung,  and  S.W.  Chen,  “Automatic license  plate  recognition”,  IEEE Transactions on Intelligent Transportation Systems, vol. 5, pp. 42-53, Mar. 2004. 

[7] V. Sharma, P. C. Mathpal, and A. Kaushik “Automatic license plate recognition  using  optical  character  recognition  and  template matching  on  yellow  color  license  plate”,  International Journal of Innovative Research in Science, Engineering and Technology, Vol. 3, pp. 12984 – 12990, May 2014. 

[8] Zheng, D., Zhao, Y., and Wang, J., “An Efficient Method of License Plate Location”, Pattern Recognit. Lett.., vol.26, pp.2431-2438, 2005. 

[9] Nelson,  C.,  and  Babu,,K.,  “A  License  Plate  Localization  using Morphology and Recognition”, IEEE India conference, pp.34-39, 2008. 

[10] Dingyun,  W.,  Lihong,  Z.,  and Yingbo,  L.,  “A  New  Algorithm  for License Plate Recognition Based on Improved Edge Detection and Mathematical  Morphology”,  IEEE International Conference on Information Science and Engineering, pp.1724-1727, 2010. 

[11] G.T. Shrivakshan, and C. Chandrasekar, “A Comparison of various Edge Detection Techniques used in Image Processing”, International Journal of Computer Science Issues, Vol. 9, Issue 5, No 1, September 2012. 

(The Board of Editors received the paper on 22/04/2016, its review was completed on 05/05/2016)

Page 53: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

50 Dam Nguyen Anh Khoa, Nguyen Hoang Thao Nguyen

RESEARCH ON APPLICATION OF SERVPERF MODEL IN ASSESSING VIETTEL’S MOBILE INTERNET SERVICE QUALITY IN DANANG CITY

Dam Nguyen Anh Khoa1, Nguyen Hoang Thao Nguyen2 1The University of Danang, University of Science and Technology; [email protected]

2Minh Toan Service & Trading Co. Ltd; [email protected]

 Abstract - Nowadays, telecommunication industry has grown rapidly in Vietnam market. The popularity of smart phones and tablets leads to the increase in users of Internet mobile services. In the race of profit, telecommunications providers in Vietnam have been improving service quality to satisfy current customers and attract potential customers. Despite being one of the three largest telecommunication providers with significant investment in this industry, Viettel’s quality of Internet mobile services has not really met customer expectations. This study applies the SERVPERF model to assess the Internet mobile service of Viettel and figures out the existing problems of this provider in Danang market. Then the author gives recommendations in terms of staff, convenience, and responsiveness to improve the quality of Viettel’s Internet mobile services.

Key words - telecommunications providers; Internet mobile services; SERVPERF model; service quality; customer satisfaction.

1. Problem Statement

Along  with  many  factors,  Mobile  Internet  users  are really not satisfied with the service quality. In spite of large investment  in  3G  technology,  Viettel  Corporation  has  not yet  earned  customer  satisfaction.Kotler  defined  customer satisfaction  as  the  extent  to  which  a  product’s  perceived performance  matches  a  buyer’s  expectations  [9]. Therefore,  Viettel  need  to  find  effective  measures  to develop  services  and  meet  customer  expectations.  To assess  the  service  quality  of  Viettel  Mobile  Internet,  we have  to  interview and  survey  users,  then analyze database through  SPSS  software  to  find  out  the  relationship  of customer  satisfactions  and  service  quality,  based  on theoretical  basis  and  suitable  analysis  model.  These analysis  models  such  as  SERVQUALI/SERVPERF  model [3] or Parasurman [1]  is one of  the effective approaches  to measure the service quality, but it is quite hard to learn and very  time-consuming  to  implement assessment  [12]. 

According to GSMA Intelligence [3], there had been by the  end  of  year  2013  about  123.7  million  mobile connections  in  Vietnam,  while  the  total  population  in Vietnam  is  92.1  million.  By  the  end  of  year  2013,  the number  of  Mobile  Internet  users  was  24.74  million (occupying  20%  mobile  connections),  an  increase  of 36.83%  year-on-year.  These  statistics  indicate  that  the Mobile Internet  is  fast becoming an important part of daily life in Vietnam. 

Nowadays,  mobile  Internet  is  a  potential  and competitive  market.  To  have  stable  foothold  and  improve service  quality,  each  company  always  has  to  set  up reasonable  strategies,  and  scales  to  capture  the  trend,  and overcome  weaknesses,  and  understand  feedbacks  from customers  [2].  Therefore,  understanding  consumer behavior  is  an  important  factor  in  the  process  of  building quality  scale  [4]  of  Mobile  Internet  services  in  Da  Nang City.  Research  objectives  include: 

-  Exploring components of  the service quality. 

-  Assessing  the  quality  of  Viettel’s  Mobile  Internet service  Da  Nang  City  at  present  by  applying  SERVPERF model. 

-  Understanding  customers’  behavior  in  using Viettel’s  Mobile  Internet  service  through  customers’ feedbacks. 

-  Finding  out  the  measures  to  overcome  weaknesses and  improve  Mobile  Internet  service  quality  of  Viettel  in Da Nang City. 

2. Research methodology

2.1. Data collection methods

Documentary  review:  Secondary  data,  such  as  books, articles,  academic  journals,  electronic  database  or  theses are  good  materials  for  reference. 

Primary Data: Based on the quantitative method, we use questionnaire to collect quantitative data by survey  links or hard  copy  questionnaires  to  send  out  to  Viettel’s  users  of mobile Internet services. Sample size is fixed at 300. 

2.2. Literature Review

2.2.1. Service

Services are economic activities offered by one party to another,  most  commonly  employing  time-based performances  to  bring  about  desired  results  in  recipients themselves or in objects or other assets for which purchasers have  responsibility  [6].  In  exchange  for  their  money,  time, and  effort,  service  customers  expect  to  obtain  value  from access  to  goods,  labor,  professional  skills,  facilities, networks,  and  systems;  but  they  do  not  normally  take ownership of any of the physical elements involved [7]. 

2.2.2. Nature of service

Intangibility:

Services differ from products in the way that they cannot be touched, felt, seen or tasted in the same way products can [9]. Unlike products, services are performed experiences and not  objects.  The  lack  of  tangible  attributes  causes  the services to be harder to evaluate than products [8]. 

Simultaneously:

The process of production and consumption of services occur  simultaneously.  Different  from  physical  production, production  of  services  is  unavailable  in  storage  to  deliver then  to  consumers.  The  manufacturing  process  occurs simultaneously  with  consumption  of  services  [10]. 

Heterogeneity:

Quality  of  service  usually  fluctuates  in  a  wide  range, depending  on  the  circumstances  that  create  services  (for 

Page 54: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 51

example:  suppliers,  time  and  place  to  supply  service). Consumers  can  evaluate  a  tangible  product  through product  design,  the  color  of  the  packaging  etc  and  can touch,  smell,  see, or  taste  the  product before purchase  [5]. 

Perishability:

Perishability  suggests  that  services,  unlike  products, cannot  be  stored  and  saved  for  a  later  occasion. Consumption of  services is  limited by  time [8]. 

2.2.3. SERVPERF model

In 1992, Cronin and Taylor worked together to present a new  model  which  can  replace  SERVQUAL  model. SERVPERF was developed by  their efforts  to get over  the “Perceptions  –  minus  –  Expectations”.  Besides  the  wide range  of  propositional  theoretical  concepts,  Cronin  and Taylor also provided the variety of realistic evidences in four industries  (namely  banking,  pest  control,  dry  cleaning  and fast  food)  to  reveal  the  superiority  of  SERVPERF  in comparison  with  SERVQUAL.  SERVPERF  model  uses only 22 questions, which ask about the customer perceptions in five dimensions to measure service quality [11]. 

2.2.4. Service quality and customer satisfaction

Figure 1. Customer perceptions of quality and customer satisfaction [11]

Figure  1  shows  the  relationship  between  customer satisfaction  and  service  quality.  The  author  has  shown  a situation  where  service  quality  is  a  focused  evaluation which  reflects  the  customer's  perception  of  reliability, assurance,  responsiveness,  empathy,  and  Tangibility  while customer  satisfaction  is  more  comprehensive  and  it  is affected by perceptions of  service quality, product quality, price,  situational  factors  and  personal  factors  [11]. 

2.2.5. Conceptual framework

Figure 2. Conceptual framework

Figure 2  shows the  following  hypotheses:

H1:  Tangibility  has  positive  relationship  with perceived  service  quality 

H2: Reliability  has positive  relationship  with perceived service  quality 

H3:  Responsiveness  has  positive  relationship  with perceived  service  quality 

H4: Assurance has positive relationship with perceived service  quality 

H5: Empathy  has  positive  relationship  with  perceived service  quality 

H6: Customer  satisfaction  has  a  positive  relationship with service quality. 

3. Data Analysis & Findings

3.1. Descriptive Statistics

3.1.1. Gender

In  this  research,  subjects  surveyed  mostly  under  20 years old and  from 25  to 35  years old  account 53.7%,  and 35.3%  respectively.  These  two  kinds  of  subjects  are  of great  influence on  the  research. 

3.1.2. Frequencies of Usage

Based  on  the  analysis  results,  most  of  the  respondents say that the use of Mobile Internet Service is necessary and almost  everyone  uses  Internet  every  day.  Only  10% sometimes use it and 0.3% never use it. 

3.2. Overall Satisfaction:

Conditions  to  ensure  reliability: 

Cronbach  Alpha ≥ 0.6 

Corrected  Item  - Total  Correlation > 0.3 

The  measure  taken  is  principal  component  because satisfaction scale is single direction variable. The scale will be  accepted  when: 

0.5 ≤ KMO ≤ 1 

Variance  ≥  50% 

Eigenvalues >  1 

3.2.1. Reliability of data – Cronbach Alpha test

Table 1. Cronbach Alpha test

Cronbach Alpha: 0.750 

N: 4  Corrected Item - Total Correlation 

SAT1  0.51 

SAT2  0.613 

SAT3  0.506 

SAT4  0.567 

From  Table  1,  Cronbach  Alpha  of  overall  satisfaction (SAT)  scale  is  0.750 > 0.6, and no variable  that  is  smaller than 0.3  in Corrected  Item-Total Correlation,  and  there  are also  no  variables  in  Cronbach's  Alpha  if  Item  Deleted bigger  than  Cronbach  Alpha  (0.750).  Therefore,  no variable  is  eliminated  and  overall  satisfaction  scale  is enough conditions  to  ensure  reliability  [11]. 

3.2.2. Exploratory factor analysis

Table 2 shows that four variables of overall satisfaction are extracted with one component with Eigenvalue = 2.305 > 1; % of Variance = 57.628% > 50%; and KMO = 0.759 is  in  the  range of 0.5  and 1.  If  all  variables  fully  meet  the 

Page 55: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

52 Dam Nguyen Anh Khoa, Nguyen Hoang Thao Nguyen

conditions,  overall  satisfaction  scale  is  accepted. 

Table 2. Component Matrix

Component Matrix

  Component 

SAT1  0.726 

SAT2  0.808 

SAT3  0.726 

SAT4  0.774 

Eigenvalue  2.305 

% of Variance  57.628% 

KMO  0.759 

3.2.3. SERVPERF model evaluation

According  to  literature  review,  SERVPERF  model  is divided  into  five  dimensions.  This  part  aims  to  test  these dimensions  of  SERVPERF  model  with  collected  data  with such  methods  as:  Cronbach  Alpha,  Exploratory  factor analysis  (EFA),  Correlation,  Regression,  T-Test,  and  One way-ANOVA  test. 

The result indicates that three dimensions, namely staff, convenience,  responsiveness  have  total  correlation  and Cronbach’s  Alpha  is  acceptable.  With  assurance dimension, Cronbach’s Alpha coefficient is <0.6 and it can not  delete  the  variable  to  increase  reliability  coefficient (because  reliability  analysis  model  requires  the  number  of variables  over  or  equal  3,  and  if  we  delete  the  variable,  it will  not  be  accepted)  thus  assurance  dimension  is  rejected from  research  model. 

Therefore,  SERVPERF  model  is  changed  about  the dimensions in quality of services after it is used to evaluate the service quality of Mobile Internet on cell phone from five dimensions  to  three  dimensions  and  it  also  changes  the name,  the  concept,  the  notation.  The  new  model  includes three dimensions: Staff, Convenience, and Responsiveness. 

3.2.4. Linear regression analysis

Each  dimension  has  several  observed  variables; therefore  we  need  to  calculate  the  mean  of  observed variables  in  each  dimension  group  before  testing  the relationships. Through factor analysis and Cronbach Alpha testing, research model are calibrated from five dimensions to  three  dimensions.  The  new  model  includes  three dimensions  renamed  as  Staff,  Convenience,  and Responsiveness.  Therefore,  we  calculate  the  mean  of calibrated  variables  by  the  Transform/Compute  command. It  can  also  be  used  to  collapse  several  variables  that measure  the  same  concept  into  a  single  variable,  thus increasing  the  reliability  of  the  measure.  To  calculate  the mean  score  for  each  dimension,  we  type  these  formulas into Numeric Expression box as shown in Table 3. 

Table 3. Average values of target variables

Target Variables Numeric Expression

STAFF  MEAN(RP7,AS4,EP1,EP2,EP3) 

CONVENIENCE  MEAN(TG2, TG3, TG4, TG5, RP1) 

RESPONSIVENESS  MEAN(RP2,RP5,RP6,RL1,RL2,RL3) 

To  test  the  suitability  of  the  research  model,  the 

correlation  matrix  between  dependent  variables  - Satisfaction  and  independent  variables  into  four  Servperf dimensions  are  set. 

Table 4. Correlation Matrix

  Staff Convenience Responsiveness Satisfaction

Staff 1       

Convenience .297**  1     

Responsiveness .377**  .250**  1   

Satisfaction .424**  .347**  .460**  1 

According to Table 4, if significant level of 1% is used, then independent variables such as Staff, Convenience and Responsiveness are significantly correlated with dependent variables  –  customer  satisfaction. 

Satisfaction correlates closely with  the 3 dimensions of SERVPERF  and  3  dimensions  are  also  closely  correlated with  each  other.  Therefore,  3  dimensions  are  also independent variables  in  the next regression model. Due  to the  correlation  of  these  dimensions,  testing multicollinearity  is  conducted. 

Table 5. Regression Analysis

Model Summary 

Model  R  R Square Adjusted R 

Square Std. Error of the Estimate 

1  0.564  0.318  0.311  0.55779 

Coefficients 

Unstandardized

Coefficients Standardized Coefficients

Model  B Std. 

Error Beta  t  Sig. 

(Constant)  0.919  0.231    3.982  0.000 

Staff  0.237  0.051  0.246  4.619  0.000 

Convenience  0.187  0.049  0.194  3.816  0.000 

Responsiveness  0.356  0.059  0.319  6.072  0.000 

According  to  Table  5,  we  have  three  independent variables with significant level less  than 0.05, namely Staff (0.237), Convenience (0.187), and Responsiveness (0.356). 

Then  the  following  multiple  regression  model characteristics  for  theoretical  models  are  consistent  with market  data: 

Satisfaction = 0.237×Staff + 0.187×Convenience

+ 0.356×Responsiveness + 0.919 ± 0.55779

From  these  results,  we  should conclude  that  the higher quality of staff are related to higher satisfaction, that higher convenience  is  associated  with  higher  satisfaction,  and responsiveness  is  strongly  related  to  satisfaction. 

4. Findings

4.1. Key finding 1: Exploring the dimensions of the service quality – SERVPERF model

According  to  the  SERVPERF  model,  there  are  22 questions  used  to  measure  the  service  quality  and  they  are based on the users’ perception alone. The questions cover the customer’s  assessment  through  5  dimensions:  Tangibility, Assurance, Responsiveness, Reliability and Empathy. 

Page 56: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 53

The reason why SERVPERF model  is used to measure Viettel’s  Mobile  Internet  service  is  its  simplicity. Generally,  SERVQUAL  uses  44  questions  in  both  two aspects  (customer’s  expectation  and  customer’s perception)  to  measure  the  service  quality  and  then  figure out the service quality by using the function: 

SERVICE QUALITY = PERCEPTION – EXPECTATION 

In  terms  of  SERVPERF,  only  the  customer’s perception is measured and the service quality is calculated more easily,so it prevents the insipidity of customers when they do the questionnaire. 

SERVICE QUALITY = PERCEPTION 

4.2. Key finding 2: Assessing the quality of Viettel’s Mobile Internet service Da Nang City at present by applying SERVPERF model

In the process of applying the SERVPERF model, with the combination  of  previous  studies  about  service  quality  and preliminary  studies,  22  variables  of  SERVPERF  model  are formed. After testing the reliability of the scale by Cronbach Alpha at the first time, 19 observed variables are retained. 

Secondly,  after  doing  EFA  analysis,  SERVPERF model had a change from five dimensions to 4 dimensions. Through  the  second  Cronbach  Alpha  test,  SERVPERF model  only  retains  three  dimensions  with  high  reliability. The dimensions are calibrated and  renamed as  follows: 

Staff  expresses  communication  skills,  expertise,  and empathy to gain trust  from the customers. 

Convenience  shows  mobility  and  convenience  for customers including factors related to facilities and services. 

Serving is the knowledge and style of service personnel making  customers  trust  (this  dimension  was  eliminated after  the  second Cronbach  Alpha  test). 

Responsiveness  shows  the  ability  to  meet  customers’ needs  of  service. 

With  the  result,  the  conclusions  will  be  conducted  as follows: 

Firstly, we can know the dimensions of  service quality and  the  impact  of  these  components  on  customer satisfaction. 

Secondly,  because  many  different  subjects  use  this service,  assessing  the  quality  of  service  by  the  views  of these  objects  is  obvious. 

Thirdly,  the  evaluation  by  the  explored  structure  does not reject or  reduce sense of  theory as  well as SERVPERF model because  the characteristics of observed variables  the old dimensions still exist in the new dimensions. 

4.3. Key finding 3: Understanding customers’ behaviors in using Viettel’s Mobile Internet service through customers’ feedbacks

Convenience  is  the  dimension  that  satisfy  customers most,  and  the  next  is  Staff,  but  Responsiveness  is  the dimension which has the lowest satisfaction degree. Testing deeper in customer satisfaction with such factors as income, gender, and education, we get some conclusions as follows: 

There  are  differences  in  Responsiveness  evaluation through  income.  With  people  whose  income  is  high,  their 

satisfaction  in responsiveness  will be  low. 

There  are  differences  in  Staff  evaluation  through Education. We can draw the conclusion that customers with high level of education will evaluate service quality strictly. 

There  is  no  difference  in  service  quality  assessing through  gender.  All  customers  in  two  genders  have equivalent  satisfaction  with  Mobile  Internet  Service  that they are using. 

5. Conclusions

In  conclusion,  this  research  explores  important dimensions  in  service  quality  assessing,  thus  finding  out suitable  model  for  this  study,  especially  in Mobile  Internet service  industry.  It  affirms  that  service  quality  can  be assessed from the view of customer satisfaction because of their  relationship.  Under  careful  consideration,  all collected  data  are  screened,  processed,  and  analyzed  to clarify  three  main  key  findings  of  the  research  including: exploring  dimensions  of  service  quality,  testing  the suitability  of  SERVPERF  model,  and  understanding customers’  behavior  through  their  feedback.  Then  at  last, some recommendations re presented to enhance the service quality  of  Viettel’s  Mobile  Internet  service  in  Da  Nang City, and in Viet Nam generally. 

However, this  study also reveals some limitations such as:  financial  difficulty,  and  academic  knowledge  barriers. In  addition,  the  project  has  some  certain  areas  which  are not  addressed  completely. 

6. Recommendations

6.1. Recommendation 1: To enhance the training for staff to be more aware of the relationship between service quality and customer satisfaction

Enhancing  the  awareness  of  staff  about  customer service  is  very  important.  Viettel  should  organize  training courses  for  staff  of  customer  service  department  to  help them increase their knowledge and skill to serve customers. For example, each month, we invite a speaker  to guide  the method  to  serve  customers.  Company  should  also  usually collect  feedbacks from customers  through hotline, email or survey. 

Selecting suitable  lecturers and documents  to  train staff is  the  second  important  point.  Viettel  should  combine theory  and practicability on  training programs;  it  helps  the staff  to orientate  the  proper  way on  job.  At  first,  they  can begin with small groups before expanding model. Besides, they  should  improve  staff’s  skill  of  using  computer, computer software as  well as English. 

6.2. Recommendation 2: To increase the level of satisfaction about Responsiveness dimension, company should add new features

Viettel  needs  to  upgrade  their  technology  to  improve service  quality.  They  should  apply  the  new  feature: DC-HSDPA (Dual Cell high-speed downlink packet access) to increase the speed of download. HSDPA is a product of 3G  technology;  it  allows  the network on UMTS system  to transmit data faster. HSDPA technology has its limits and to enhance  its  issues,  DC-HSDPA  is  introduced.  This  new 

Page 57: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

54 Dam Nguyen Anh Khoa, Nguyen Hoang Thao Nguyen

feature will help to increase the current rate six times It has good effect on customer satisfaction through the efforts. 

In the competitors’ website, the fee for each package is clearly  presented;  however,  Viettel  skip  this  step.This  will confuse  customers  when  they  are  reading  and  using  the service. Therefore, Viettel needs to be careful on designing and  announcing  information  to  customers. 

6.3. Recommendation 3: To improve the interface of Viettel to attract customers’ attention

The  company  should  enhance  the  interface of  website, layout the category, contents carefully to attract customers. Besides,  they  should  update  information  regularly  to  help customers capture the new information. The information in website at  this  time is outdated, and customers  find  it very difficult  to update news, event programs, or  tariff. 

Viettel  should  use  English  language  on  the  website. Now, they only use Vietnamese language and if they want to  expand  the  market  with  potential  customers,  they  have to do that. The foreigner can know the news or the feature of Viettel service when they visit the website. And through that, they will be aware of Viettel service and brand. 

REFERENCES

[1] ChiPhan and PhongNham,  “Impact of  service quality  on  customer 

satisfaction  of  automated  teller  machine  service:  Case  study  of  a private commercial joint stock bank in Vietnam”, Business: Theory and Practice, 2015, 16(3):280-289. 

[2] Anh Chu, Turku University of Applied Sciences, Factors influence customer satisfaction in mobile commerce, 2015. 

[3] Lien  Nguyen  and  Li  Long,  Soongsil  University,  A Study On The Effect of Mobile Communication Service Quality On Customers Loyalty in Vietnam, 2013. 

[4] Gilbert  A  Churchill,  Jr.  and  Lacobucci,  Marketing  research, Research:  Ethological  Foundations,  9th  edn.  USA:  Stratford publishing service, 2005. 

[5] Ishaq, M., “A study on relationship between service quality and customer satisfaction:  An  empirical  evidence  from  Pakistan  telecommunication industry”, Management Science Letters, 2011, 1(4), 523-530. 

[6] John Wiley & Sons, Marketing Research Essential, 5thEdn, Inc Carl McDaniel & Roger Gates, 2006. 

[7] K.  Hoffman  and  John  Bateson.  Services  Marketing:  Concepts, Strategies, & Cases, 2010. 

[8] Parasuraman A., Zeithaml, V. A., & Berry L., “A conceptual model of service quality and its  implications for  future research”, Journal of Marketing, 1985, 49, 41-50. 

[9] Philip  Kotlerand  Gary  Armstrong,  "Principles  of  Marketing",  14th Edns, Prentice Hall, 2012. 

[10] Kuo  YF,  “A  study  on  service  quality  of  virtual  community websites”, Total Quality Management & Business Excellence, 2003. 

[11] Lewlyn  and  R.  Rodrigues,  “Service  Quality  Measurement:  Issues and Perspectives”, Publisher: Anchor Academic Publishing, 2013. 

[12] Kumar  RaiCustomer,  Relationship  management:  Concepts  and cases, 2012. 

(The Board of Editors received the paper on 15/12/2015, its review was completed on 08/03/2016)

Page 58: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 55

STUDENT PLAGIARISM – CAUSES AND SUGGESTED SOLUTIONS

Vu Thi Chau Sa, Nguyen Pham Thanh Uyen

University of Foreign Language Studies, The University of Danang [email protected], [email protected]

 Abstract - This paper describes the phenomenon of plagiarism among students at the English Department, University of Foreign Language Studies, the University of Danang. This phenomenon can be chiefly attributed to the availability and the easy access to the internet and other digital information sources, students’ low English proficiency, improper learning strategies and lack of academic skills including quoting, referencing and paraphrasing. It is also due to the tolerant attitude of the university and the teachers as well as plagiarism acceptance among the student community. In order to prevent plagiarism, it is suggested that the university and the English Department should have transparent policies, reliable plagiarism detection tools and severe penalty systems. Besides, some courses should be modified to enhance students’ language and academic skills; also, the staff should set good examples in performing their professional skills. All of these measures are expected to be taken thoroughly and consistently.

Key words - plagiarism; academic integrity; English Department; causes; solutions.

1. Rationnales

One  of  the  major  objectives  of  university  education  is to  build  up  scientific  research  capacity  as  well  as academic  ethics  and  integrity  among  students  (Law  on University  Education,  2012).  However,  academic misconducts  have  been  a  big  concern  for  the  society  and the  education  community.  Plagiarism  is  one  of  the relatively  popular  and  increasing  acts  of  academic research  ethical  violation.  Despite  a  variety  of  anti-plagiarism  measures  being  applied,  this  type  of misconduct has not  yet  shown a  sight of decrease  in  level and  scope  but  increased  to  the  extent  that  was  so-called “epidemic  cheating”  (East,  2010;  Park,  2003).  Studies have  shown  that  plagiarism  at  various  levels  can  be  seen among  students  from  Europe,  America,  Asia  and  Africa, whose  majors  spread  from  natural  sciences  to  social sciences.  In  other  words,  the  misconduct  is  prevalent irrespective  of  disciplines,  nationalities  and  cultures,  and tends  to  multiply  together  with  the  rapid,  deep  and  strong advances  in  Information  Technology  (Park,  2003). 

In  our  country,  the  year  2010  witnessed  a  heated discussion  on  plagiarism  among  the  academic  community, starting  from  the  event  where  three  articles  by  a  group  of Vietnamese  authors  were  withdrawn  from  the  Euro Physics  Letters  (a  tear-one  European  physics  journal)  due to  serious  plagiarism  while  their  act  of  misconduct  was widely  announced  in  the  world’s  scientific  community. The  event  had  negative  effects  on  domestic  scientists  and damaged  the  image  of  Vietnam  in  the  eye  of  the international  academic  world  (Vũ  Phương  Anh,  2013; Trần  Nam  Dũng,  2013).  On  forums,  Vietnamese  social scientists  and  educators  expressed  various  viewpoints  on plagiarism,  then  its  different  aspects  were  mentioned  in  a series  of  articles,  such  as  “What  is  plagiarism?  What  does a  plagiarist  violate?”  and  “Preventing  plagiarism  from  a cultural  perspective”  by  Dr.  Vu  Thi  Phuong  Anh,  “The 

cultural  source  of  plagiarism”  by  Prof.  Ngo  Tu  Lap, “Plagiarism  and  scientific  ethics”  by  Dr.  Tran  Nam  Dung. According  to  a  study  by  Tran  Thi  Tuyet  (from  Hanoi National  University)  on  the  causes  of  plagiarism  among students  at  La  Trobe  and  Melbourne  Universities  released in  December  2012,  plagiarism  is  “the  result  of  the  mutual interaction  between  a  variety  of  personal  and  contextual causes”  such  as  writing  styles,  learning  styles,  learning motivation, academic skills, etc. The concerns of academic community  relating  to  the  misconduct  for  years  prove  that plagiarism  is  a  big  challenge  for  the  country’s  education and  science  development. 

Most  universities  across  the  world  have  anti-plagiarism  supporting  tools  for  students  and  apply  strict punishments  for  plagiarism  violators.  Nevertheless, universities  in  Vietnam,  especially  the  University  of Danang  (UD),  have  not  yet  paid  due  attention  to  this problem.  Very  few  studies  on  honesty  and  integrity  in academic  research  have  been  conducted;  moreover,  UD’s member  universities  have  not  imposed  specific regulations  on  plagiarism  prevention.  In  that  context,  we conducted  an  investigation  into  the  current  situation  of plagiarism  among  students  at  the  English  Department (ED),  University  of  Foreign  Language  Studies  (UFLS), the University of Danang. This paper provides a summary of  the  study  results,  suggests  causes  of  plagiarism  and puts  forward some fixing measures. 

2. What is plagiarism? Why shouldn’t we plagiarize?

According  to  Oxford  Dictionary  (2012),  plagiarism  is “the  practice  of  taking  someone  else’s  work  or  ideas  and pasing  them  off  as  one’s  own”.  Standler  (2000)  (cited from  Vũ  Phương  Anh,  2013,  p.2)  “in  mild  cases, plagiarism  may  mean  the  quoting  of  several  sentences without  the quotation marks and citation of  the authors. In worst  cases,  the  majority  of  the  writing  piece  or  work belongs  to  others,  the  plagiarist  eliminated  the  author’s name,  replaced  it  with  his/her  name  and  adjusted  the document  format”. 

At  universities  in  developed  countries,  the  concept  of plagiarism  is  clearly  defined  and  explained  in  regulations on  students’  academic  research  and  testing  and assessment,  which  are  maintained  in  libraries  and  course syllabi.  Always  accessible  to  students,  these  documents help  them  avoid  violations  warned  by  the  universities. After  looking  into  materials  from  various  universities, colleges  and  research  institutes,  we  would  like  to  present here the main types of plagiarism: 

-  Students  copy  partially  or  entirely  an  essay  or  work of  others  and  submit  it  under  their  name  (with  or  without permission of  the original  authors). 

Page 59: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

56 Vu Thi Chau Sa, Nguyen Pham Thanh Uyen

-  Students  quote  a  part  of  an  essay  or  work  of  others without  attribution. 

-  Students  copy  some  content  from  different  sources and  rearrange  it  into  their assignment. 

-  Students  paraphrase  others’  ideas  with  their  own words  without  attribution. 

-  Students  translate  entirely  others’  ideas  or  essays without  attribution. 

-  Students  investigate  and  synthesize  information  from newspapers,  magazines  and  online  media  on  the  Interner into  their  assignments  without  attribution. 

The  above-mentioned  behaviours,  regardless  of  being intentional  or  accidental,  are  considered  as  violations  of plagiarism. 

Plagiarism should be avoided for the following reasons: 

From  the  social  perspectives,  plagiarism  is  an  act  of stealing,  dishonesty  and  cheating;  therefore,  it  is  always criticized by the community. Plagiarism is not only an ethical issue  but  a  legal  one.  It  is  a  form  of  intellectual  property infringement, which is still a minor violation in Vietnam, yet an intolerable illegal act in many nations worldwide. 

From  the  education  and  training  perspectives, plagiarism  leads  to  the  formation  of  academics  who  are lazy  and  dependent  on  others’  ideas  and  available information  sources  while  losing  their  own  independent and  creative  thinking.  The  lack  of  academic  skills  results in  plagiarism,  which  in  turn  cause  students  to  lose  their confidence;  in  the long run,  when  integrating into regional or  international  academic  environment,  students  will  face many  difficulties,  barriers  and  surprises.  Moreover, honesty  in  learning  and  science  shows  one’s  self-respect, self-esteem  and  pride  of  their  hard-earned  achievements and  genuine  individual  capacity. 

From  the  scientific  and  advanced  education development  perspectives,  compromising  plagiarism helps  form  an  uncivilized,  unjust  and  unprofessional education  environment,  where  hard  work  and  intellectual property  are  underated.  In  testing  and  assessment, plagiarism  causes  the  unfairness  in  evaluating  learners’ efforts.  Many  plagiarism  cases  are  undetected  and  well applauded,  while  genuine  assignments  completed  with serious  efforts  are  not  highly  evaluated.  Besides, plagiarism prevention offers a  way  to  ensure reliability  for students’  testing  and  assessment,  which  is  a  significant component  in any curricula. 

3. The current situation of plagiarism among students at the English Department, University of Foreign Language Studies, the University of Danang.

3.1. Research method

We  conducted  a  survey  on  200  junior  and  senior students  at  the  English  Department  (ED),  UFLS  in schoolyear  2012-2013  and  interviewed  20  lecturers  of  the department,  who  are  leading  academic  writing  courses and  other  courses  with  big  assignments  or  graduation papersas  assessment  tools.  The  means  of  data  collection included  questionnaires  for  students,  interviews  for 

teachers,  and  students’  assignment  analysis.  Questions were  simple  and  clear;  researchers  were  ready  to  provide clarification  if  needed.  The  authors  committed  to  utilize the  collected  data  for  research  purposes  only  and emphasized  the  necessity  of  honest  responses  to  ensure the  study’s  reliability. 

3.2. Research results

3.2.1. Popularity

Plagiarism  was  common  among  students  at  the  ED. 100%  of  students  admitted  this  fact,  100%  of  lecturers acknowledged  that  they  usually  recognized  plagiarism violations  in  assessing  students’  big  assignments,  essays and  graduation  papers. 

86%  of  students’  assignment  samples  showed plagiarism  violations  under  different  forms;  the  most common  one  was  the  copying  a  part  of  someone  else’s assignment  and  citing  information  from  books, newspapers  and other  sources  without  attribution. 

3.2.2. Students’ knowledge

Most  students  did  not  understand  what  plagiarism  was and  misunderstood  that  plagiarism  only  meant  copying the  whole  assignment  of  others  without  the  authors’ permission.  There  was  a  correlation  between  students’ awareness  of  plagiarism  and  their  violation  rates.  For example,  supposing  that  paraphrasing  others’  ideas  with their  own  words  without  attribution  was  not  registered  as plagiarism,  students  committed  this  act  on  a  regular  basis. Similarly,  they  usually  translated  or  made  reference  to information  and  failed  to  make  attribution  without knowing that it was a violation of academic ethics. 

Therefore,  it  can  be  seen  that  plagiarism  behaviours among  students  can  be  intentional  (intentionally  copying or paraphrasing others’  work), or unintentional  (due  to  the lack  of  referencing  skills)  or  failing  to  understand  the seriousness  of  their  deed. 

3.2.3. Students’ attitude

In general,  students  failed  to  acknowledge  the  severity of  plagiarism  behaviours.  A  small  portion  (3%)  even supposed  that  plagiarism  was  allowed  by  the  university and  teachers;  42%  stated  that  the  act  was  accepted  widely by  their  friend  circle  and  the  student  community.  Only 27%  considered  it  as  a  violation  that  needed  preventing. Overall,  plagiarism  was  not  only  common  but  also registered as a natural and accepted deed among  students. 

3.2.4. Causes

Causes  for  students’  violation  of  plagiarism  are presented  as  follows. 

The  first  cause:  the  easier  internet-enabled  information and  reference  searching.  The  increasing  availability  and accessibility  of  informarion  regardless  of  time  and  place allows  one  to  google  out  a  series  of  relevant  data  and articles  with  just  a  few  words  typed  in  and  a  click.  The temptation  of  this  information  supporting  source  makes students  subjective,  dependent  and  refrain  from  working hard  for  their school  tasks. 

The  second  cause:  the  lack  of  confidence  in  one’s ability  to  express  himself  in  English  and  difficulties  in 

Page 60: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 57

choosing  appropriate  words,  structures  and  writing  styles. Consequently,  students  choose  to  borrow  someone  else’s words  to  replace  their  ideas. 

The  third  cause:  the  lack  of  students’  time  and  efforts invested  in big assignments or graduation papers. When  it comes  to  due  time  for  submission,  students  grow  to  be baffled  and  confused.  The  only  way  for  them  to  hand  in assignments  in  time is  to  take  risks and copy others’ work or  paraphrase  contents  from  online  sources  or  materials, books  and  newspapers. 

The  fourth  cause:  failure  to  apprehend  the  concept  of plagiarism.  The  misconception  and  misunderstanding  of plagiarism  lead  to  students’  higher  frequency  of  violation and no  chances  to  correct  their  wrongdoings. 

The  fifth  cause:  poor  academic  skills,  especially quoting,  citation  and  referencing  ones. On  the other  hand, a  popular  cause  is  the  failure  in  distinguishing  between applying  common  knowledge  and  rephrasing  others’ ideas.  Students  also  lack  skills  to  analyze,  evaluate  and synthesize  various  information  sources  and  opinions  then putting  forwards  their  personal  viewpoints. 

The  sixth  cause:  the  unavailability  of  appropriate regulations  on  plagiarism  prevention,  detection  and punishments.  The  unstrict  attitude  and  the  loosening  of academic  research  regulations  set  foundation  for  students to  think  that  plagiarism  is  natural,  popular  and  widely acceptable. 

The  seventh  cause:  students’  perspectives  and  attitude toward the course. A large number of students take certain courses  for  granted  and  refrained  from  working  hard  for big  assignments.  A  number  of  students  even  suppose  that the  completion  of  tasks  is  necessary  in  principle  only since  the  teachers  cannot  afford  time  to  read  and  score each  assignment  submitted  and  will  just  skim  through  for scoring,  therefore,  there  is  no  need  to  invest  a  lot  of  time and efforts  for  the exercise. 

3.2.5. Attitude of the University, Department and lecturers

Up  to  now,  there  have  been  no  official  documents  on punishing  plagiarism  behaviours  from  the  Ministry  of Education  and  Training,  the  University  of  Danang,  UFLS, the  English  Department  or  the  lecturers.  The  typical punishment forms decided by lecturers include warning, task redoing, or deducing 25% or 50% of the total task scores. 

The  plagiarism  detection  process  in  students  is  not consistent,  unified  and  frequent.  Most  detected  plagiarism cases  are  attributed  to  experiences  of  lecturers  through illogical  essay  structures,  abrupt  changes  in  writing  styles from  silly  to  very  coherent  with  solid  arguments,  careful and  precise  word  choices  or  comparison  with  completed assignments  of  previous  students. 

Some  teachers  spot  plagiarism  by  typing  a  suspected paragraph  and  searching  on  Google  to  trace  its  origins from  huge  online  databases.  As  for  students,  89% admitted  that  they  had  never  identified  as  committing plagiarism;  a  small  number  confessed  they  were  caught with  the  act  but  the  punishments  were  mild  warnings  and insignificant  score  deduction. 

The  university  and  the  department  have  not  issued specific  students’  guidelines  on  plagiarism  prevention. The  course  on  university  learning  methodology  comprises no  orientations  for  the  issue  as  well  as  the  fundamental regulations  on  assignment  implementation  and submission  at  university  level.  The  course  on  Scientific Research  Methods  incorporates  one  additional  reading  on plagiarism  but  often  neglected  while  instructions  on citing,  quoting,  referencing  and  other  research  skills account  for only  a  small  amount  of  course  time,  which  is inadequate  for  proper  skill  development  and  practice. 

The  University  of  Danang  requires  all  master graduation  papers  to  include  a  statement  of  authorship  in the  very  first  page  of  the  book.  However,  the  ED  has  not yet  requested  students  to  commit  to  no  plagiarism  in graduation  papers  as  well  as  in  big  assignments,  essays and other writing  tasks. 

To  sum  up,  the  university  and  lecturers  still underestimate  the  consequences  of  plagiarism  and  fail  to apply  appropriate  policies  and  measures  to  strictly prevent,  detect  and punish violations of plagiarism. 

3.3. Some suggested measures

3.3.1. The first measure

It  is  necessary  that  the  university,  departments  and lecturers  build  common  regulations  on  preventing, detecting  and  strictly  punishing  violations  of  plagiarism. For  instance,  copying  a  paragraph  is  equivalent  to  25%  of the  total  score  deduction,  entire  work  duplication  to  score zero,  etc.  Then,  these  regulations  should  be  announced publicly  and  repeated  in  each  course  where  students  are supposed  to  submit  assignments.  All  students  should  be required  to  write  “the  commitment  of  no  plagiarism”  on each  of  their  big  assignments,  theses  or  research  works. “No  plagiarism”  should  be  a  criterion  to  assess  students’ work.  On  the  other  hand,  it  is  advisable  that  electronic plagiarism  detection  systems  (e.g.  Turnitin)  be  utilized  so as  to save lecturers’  time and effort. 

A  resolute  attitude  toward  eliminating  plagiarism together  with  the  unity  and  consensus  among  levels  or among  lecturers  of  various  courses  is  the  prerequisite condition  to  improve  the current disturbing  situation. 

3.3.2. The second measure

It  is  important  to  educate  students  about  honesty  and integrity  in  academic  work,  pointing  out  the  positive reasons  for  plagiarism  prevention  right  from  the  start when  students  are  fresh  at  the  university.  These  contents should  be  embraced  in  both  courses  of  university  learning methodology  and  scientific  research  methods. Specifically,  different  types  of  plagiarism  behaviours should  be  clearly  defined,  explained  and  illustrated  by examples  so  that  students  can  have  a  sharper understanding of plagiarism to avoid  it. 

3.3.3. The third measure

The  training  of  academic  and  research  skills  for students  should  be  intensified,  particularly,  (1)  quoting, (2)  referencing,  (3)  distinguishing  between  common knowledge  (no  need  for  citation)  and  others  (that  need 

Page 61: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

58 Vu Thi Chau Sa, Nguyen Pham Thanh Uyen

citation)  and  (4)  paraphrasing  skills. 

It  is  recommended  that  more  time  and  more  practical tasks  be  designed  to  diligently  train  students  of  those practical  skills.  This  was  also  the  wish  of  most  students under  the  survey.  Websites  should  be  provided  for students  for  reference,  for  example,  “the  how  to  avoid plagiarism”  by  Sue  Thompson,  posted  on  Plagiarism Prevention  for  Students  Website  –  in  which,  academic research  skills  are  clearly  explained  with  examples, citation  and  comparison,  very  convenient  for  study. Besides,  available  online  is  a  convenient  APA-style citation  tool  at  http://citationmachine.net/index2.php  This tool can help save time and avoid mistakes in referencing. 

3.3.4. The fourth measure

Another way to address  the problem is  to help students develop  language  skills,  idea  expressions,  vocabulary  and structures  typical  in  academic  writing.  Currently,  the  ED has  a  team  of  native  volunteer  teachers,  who  can  be  a great  help  for  students  in  building  up  their  language  and proofreading  their  big  assignments  or  graduation  paper. We  believe  this  supporting  system  can  significantly decrease  plagiarism  among  students. 

3.3.5. The fifth measure

Lecturers  should  set  good  examples  in  academic research,  strictly  upholding  the  professional  academic spirit  in  teaching.  Lecturers  are  to  form  a  habit  to integrate  references  into  their  presentations  in  class  or  at conferences,  give  feedback  to  students  on  the  strong  and weak  points  of  their  assignments,  strictly  punish plagiarism  if  any,  creating  a  perception  among  students 

that  their assignments are strictly  monitored and  their hard work  is  highly  appreciated. 

4. Conclusion

In  order  to  fulfill  the  mission  of  education  in  training well-rounded  intellectuals,  the  goals  of  strengthening  the academic  ethics  teaching  as  well  as  eliminating  all  forms of  cheating  should be  implemented  thoroughly. 

The  current  situation  of  plagiarism  worldwide  and nationwide  has  shown  that  this  is  not  an  easy  task,  but with  patience,  determined  attitude,  together  with  effective measures, plagiarism  will step by step be pushed back. 

REFERENCES

[1] Luât Giao duc Đai hoc sô 08/2012/QH 13 ngay 18 thang 06 năm 2012. 

[2] Trân  Nam  Dung,  Đao  văn  va  đao  đưc  khoa  hoc  Nguôn: http://www.yenhuong.com.vn/zone/193/news/699-dao-van-va-dao-duc-khoa-hoc.aspx, truy câp ngày 12/03/2013. 

[3] Vu  Thi  Phương  Anh  (2013)  Đao  văn  la  gı,  va  ke  đao  văn  pham nhưng tôi gı? Nguôn: Vu Thi Phương Anh, Phong chông đao văn tư goc  nhın  văn  hoa.  Nguôn  http://sgtt.vn/Khoa-giao/132031/Phong-chong-dao-van-tu-goc-nhin-van-hoa.html truy câp ngay 12/03/2015. 

[4] East,  J.  (2010)  Judging  plagiarism:  A  problem  of  morality  ad convention, Higher Education, 59 (1) 69-83. 

[5] Park, C. (2003) In other words: plagiarism by university students – literature  and  lessons,  Assessment  and  Evaluation  in  Higher Education, 28 (5). 

[6] Trần  Thị  Tuyết  (2012)  The  perceptions  and  Attitudes  of International  Students  toward  Plagiarism,  The  ACPET  Journal  for Private Higher Education 1 (2). 

[7] Griffith  Institute  for  Higher  Education,  Good  Practice  Guide (2013) Issue of Academic Integrity: Plagiarism. 

[8] Oxford Dictionary (2012), Oxford, UK: Oxford University Press. 

(The Board of Editors received the paper on 28/05/2016, its review was completed on 05/06/2016)

 

Page 62: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 59

THE IMPACT OF FOCUS ON FORM IN LANGUAGE TEACHING

Nguyen Pham Thanh Uyen

University of Foreign Language Studies, The University of Danang; [email protected]

 Abstract - The benefits of focus on form instruction as “the miracle method that many teachers had always been searching for” (Poole, 2005, p.47) has been one of the main interests in the second language teaching community to date. This paper attempts to generalize findings from different empirical studies which contribute to the confirmation of the effectiveness of focus on form instruction, which can be implemented by using two typical techniques: input enhancement and corrective feedback in interaction to draw learners’ attention to formal language in the meaning-based context of learning. Five research articles descriptions and the summary of the contribution to the asserting the role of attention to form are presented and discussed, and on this base, some implications for teaching in the current context are recommended.

Key words - focus on form; grammar; attention; input and interaction; second language teaching.

1. Rationale

There  have  been particular  concerns  regarding  the  lack of  accuracy  in  learners’  performance  in  communicative language  teaching  and  learning.  Communicative  language teaching, as an innovated mode of teaching to the traditional method,  also brings  about  unexpected  results,  since  “some linguistic  features  do  not  ultimately  develop  to  target-like level” and “this is so despite years of meaningful input and opportunities  for  interaction”  (Doughty  &  Williams,  1998, p.2).  In  response  to  this,  Long  (1991)  and  Long  Robinson (1998)  put  forth  the  approach  of  focus  on  form  in  second language teaching, which can be described as an incidental attention  to  form  in  the  context  of  meaning-focused instruction. A more operational definition  is  that “focus on form consists of an occasional shift of attention to linguistic code features – by the teachers and/or one or more students –  triggered  by  perceived  problems  with  comprehension  or production”  (Long,  1991,  p.23).  The  noticeable  feature  is that focus on form can be initiated by learners, or set up by teachers,  material  designers  or  researcher.  Learner’ attentional  resources  can  be  achieved  pedagogically  by various  methods:  input  enhancement  (repeated  use  in  the input, explicit discussion of the form, enhance salience due to  typographic  modification  -  being  underlined  or italicized),  explicit  negative  feedback,  implicit  negative feedback – with recast is an example. The second language theory underpinning focus on form is the role of attention to form  in  promoting  second  language  acquisition.  Attention to form plays a key role in enhancing language learning, and focusing  on  learners’  attention  on  features  of  the  second language  is  a major  component of  focus on  form. Schmidt (1995) stated that “not all language features can be acquired when  learners’  attention  is  focused  exclusively  on meaning”  and  “input  and  interaction,  attention,  and awareness are all crucial for  learning”.

However,  conceptual  arguments  must  be  tested, verified and developed in empirical studies before they can meaningfully  guide  major  language  policy  and  curriculum 

initiatives  and  subsequently,  have  significant  effects  on millions  of  language  teachers  and  learners.  Therefore,  the effectiveness  of  these  above  techniques  in  focusing learners’  attention  to  formal  language  and  leading  to successfully  subsequent  language  production  needs  more support  from  empirical  research.. 

2. Procedure

The  studies  under  review  were  selected  by  considering the  objectives  of  the  empirical  research  and  the  findings with  practical  implications  and  implementation  of  focus-on-  form  instruction.  To  minimize  arbitrariness,  various measures  have  been  taken:  carefully  reading  the  abstracts, identifying  the  objectives,  going  through  the methodological  descriptions,  examining  the  strengths  and weaknesses  of  the  empirical  studies  and  evaluating  the contribution of  the  studies  to second  language  teaching. 

The paper starts with a brief description and explanation of the key terms,  i.e.  focus on  form versus  focus on forms, the  role  of  noticing  and  attention  in  second  language instruction, followed by the description of the five empirical studies.  The  assessment  of  the  studies  in  relation  to  the noticing and attention theory in second language acquisition is  presented  and  some  implications  in  implementing  input enhancement  and  corrective  feedback  in  form-focused instruction for language teaching are recommended.

3. Focus on form versus focus on forms

Focus  on  form  refers  to  an  approach  in  which  learners and  teachers  address  formal  features  of  language  that  play a  role  in  the  meanings  that  are  negotiated.  In  other  words, focus-on-form emphasizes meaning in communication and form  of  language  is  inadvertently  noticed.  This  is contrasted with a focus on forms, which emphasizes formal aspects  rather  than  meaningful  activities  (Carter andNunan,  2001).  Focus-on-forms  focuses  on  form  of  the language and draw  learners  to memorizing plenty of rules. Long (1991) have encapsulated the differences of these two extremes  in  grammar  instruction:  focus  on  form  refers  to drawing  students  attention  to  linguistic  elements  as  they arise  incidentally  in  lessons  whose  overriding  focus  is  on meaning or  communication. Meanwhile,  focus on  forms  is equated  with  the  traditional  teaching  of  discrete  points  of grammar  in  separate  lessons.  The  comparison  of  the features of  these  two approaches  is presented  in Table 1.

Table 1. Focus on form vs Focus on Forms

Focus on form Focus on Forms

Triggered  by  perceived  problems in comprehension or production 

Pre-selected in the syllabus 

Linguistic features are explored in contexts. 

Forms are taught in isolation 

Analytical approach  Synthetic  approach 

Page 63: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

60 Nguyen Pham Thanh Uyen

The word  form refers  to  language in form in general 

Forms refers to discrete, isolated,specific language forms. 

Learners  first  engage  in  meaning, then explore some linguistic features. 

Primary attention to form 

Occasional shift of attention to form. Most attention to form 

(Carter and Nunan, 2001; Long, 1995)

4. Noticing and attention in SLA

The central role of attention in naturalistic and instructed second  language  acquisition  has  been  identified  in  the research  of  SLA.  The  naturalistic  view  stresses  leaners’ attention  to  meaning  in  communication  in  the  process  of learning. The view of focusing on form emphasized the role of  attention  in  language  learning,  together  with  input  and interaction. There will be no learning without attention, and attention is required for learning (Schmidt, 1994).

Fine-grained  analysis  of  attention  states  three components  of  attention:  alertness,  orientation  and detection. Alertness represents an overall, general readiness to deal with incoming stimuli or data, orientation facilitates detection,  which  is  the  process  that  selects,  or  engages,  a particular and specific bit of information (Schmidt, 1995).

Different  types  of  attention  that  learners  may  pay  to language form are: noticing, understanding and awareness. Noticing is the process of bringing some stimulus into focal attention  and  is  the  necessary  and  sufficient  condition  of input  to  intake  for  learning,  therefore,  more  noticing  leads to more  learning  (Schmidt, 1995). Differently, Tomlin and Villa  (1994)  maintained  that  detection,  not  awareness,  is the  minimally  necessary  component  of  attentional  process in  second  language  learning.  Irrespective  of  the discrepancy about  the presence of conscious  registration  in addition  to  focal  attention,  there  is  an  agreement  that noticing,  or  being  aware  of  certain  forms,  requires  focal attention processing  to  internalise  input  into  intake.

The  hypotheses  illustrates  the  role  of  attention  and noticing  in  second  language  acquisition  are  the  Interaction hypothesis  (Long,  1996),  consciousness  raising  and  the noticing  hypothesis  (Schmidt,  1995).  The  Interactional hypothesis  holds  the  view  that  conversational  interaction promotes second language acquisition, and negative feedback during  interaction  draw  learners’  attention  to  the  form,  and consequently  causing  learners’ notice  the gap between  their own  output  and  the  target  model.  Learners’  attention specifically to the formal structures of the target language can be enhanced by consciousness raising, with the assistance of input enhancement (typographical modification, intonational focus…) (Sharwood Smith, 1993).

Findings  from empirical studies have provided  insights about the roles of input and interaction in drawing learners’ attention  to  form  and  consequently  promoting  success  in language  learning.

5. Description of the five studies

The  first  article  under  review  is  “Does  textual enhancement  promote  noticing?  A  think-aloud  protocol analysis”  by  Jourdenaise,  Ota,  Stauffer,  Boyson  and Doughty, 1995. This empirical  research was done with  the 

purpose to determine whether input enhancement technique (textual modification) can make target language forms more noticeable  and affect  learners online  processing. The  study took  place  in  Georgetown  University,  with  14  native speakers  of  English  in  Spanish  class.The  target  form  was “the  preterit”  (past  tense)  (Jourdenaise  et  al,  1995)  and imperfect  verbs.  Think  aloud  protocols  were  collected during  a  subsequent  task  in  which  participants  wrote  a picture-based narrative similar to that presented in the same text. The results of the study were that more episodes related to selection and conjugation of the target verbs were found in  enhancement  participant  protocol  than  the  comparison participants,  and  enhancement  participants  produced  more target features in their production. The logical interpretation for the results is that textual enhancement promotes noticing of  the  target  second  language  form  and  has  an  effect  on learners’  subsequent  output.

Another  study  focusing  on  the  effects  of  manipulating and enhancing input in drawing learners’ attention to form is executed by Joanne White in 1998. The context of the study is  an  elementary  school  near  Montreal,  Canada  with  three intensive grade 6 ESL classes and the target forms were the possessive determiners and third person singular pronouns. Three different groups  received  three  treatment  conditions: group  E  (N=27)  with  typographically  enhanced  input  plus extensive  reading  and  listening,  group  E  (N=30)  with  a typographically  enhance  input  flood,  and  group  U  (N=29) with  a  typographically  unenhanced  input  flood.  Data  were quantitatively  and  qualitatively  analysed  involving frequency  counts  and  accuracy  ratios  as  well  as  a  stage analysis of the learners’ development. The findings from this study  also  confirm  the  effficacy  of  input  enhancement  in speeding up acquisition of a language feature, but it raised a question  that  drawing  learners’  atttention  to  a  linguistic feature  is “not  adequate  in cases  involving L1-L2 contrast, they  need  more  explicit  instruction  in  more  advanced developmental stages” (White, 1998, p.106).

The above insight  leads to  the  consideration of another form-focused  technique  in  promoting  learners’  success  in language  learning. One  small-scale study on  the  impact of recast on  learners’  second  language production  was carried out by Zhaohong Han in 2003, in which eight adult learners of  English  were  divided  into  two  groups  (recast  and  non-recast)  and  produced  written  and  oral  narratives  prompted by  cartoon  strips  with  the  target  from  was  the  tense consistency  in  learners’  output.  The  methodology  adopted a  pretest  and  posttest  and  delayed  posttest  design,  with eight  regular  sessions  between  pretest  and  posttest  for  the recast  group  and  eight  regular  sessions  for  the  non-recast. The  study  concluded  that  recast  was  successful  since  it raised  learner  awareness  and  led  to  considerable improvement  in  learners’ performance in  the  target form.

The effect of recast was also the focus in the laboratory study  done  by  Leeman  in 2003  with  the  subjects  were 74 adult  learners  of  Spanish  and  the  target  form  was  noun-adjective  agreement.  Different  aspects  of  recasts  were investigated  by  providing  four  different  treatments  on  the subjects:  negative  evidence  alone,  enhanced  salience alone,  recasts  (as  a  combination  of  negative  evidence  and 

Page 64: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 61

enhanced  salience)  and  the  control  group  receiving ordinary models of the target form. The result was that the group  exposed  to  input  with  enhanced  salience  and  the recasts  group  performed  better  than  the  group  exposed  to unenhanced  input.  This  suggests  that  “enhancing  the salience of certain  forms certainly  led  learners  to attend  to those  forms,…  and  interactional  features,  recasts  among them,  can  lead  to  greater  development  by  highlighting specific  forms in  the input”  (Leeman, 2003, p.57).

The  impact  of  input  salience  and  interaction  remains  a concern of second  language researchers.  In a  study carried out  in  Midwestern  University  on  110  English  speaking learners of Spanish at  the age of 17-36 with an average of 3.5  years  of  Spanish  instruction,  GassTorres  (2005) investigated  the  effects  of  input  and  interaction  seperately and  in  combination.  The  language  focuses  were  gender agreement,  and  estar  +  location  and  seven  vocabulary items. The  effects of  input  and  interaction  were  examined in  four  different  conditions:  material  focused  solely  on input, material  focused solely  on  interaction,  input-focused material  followed  by  interaction,  and  interaction-focused material  followed  by  input.  The  findings  suggested  that input  and  interaction  in  combination  resulted  in  greater improvement  than  input  or  interaction  alone.  Besides,  the study  interpreted  the  differential  effects  of  input  and interaction  on  different  grammatical  areas  for  the complexity and abstractness of  those grammatical  features.

6. Evaluation of the studies in relation to the noticing and attention theory in SLA

The  five  studies  under  review  shed  some  light  on  the efficacy of input enhancement and interaction as the typical techniques  for  focusing  learners’  attention  to  form,  which is vital  in promoting second  language acquisition. The role of  input  enhancement  is  highlighted  in  the  sudy  done  by Journedaise  et  al  (1995),  which  asserts  that  typographical modification  may  lead  to  better  subsequent  second language  production  of  the  form.  In  the  process  input-intake  conversion,  textual  enhancement  was  a  driving factor  for  the  process  taking  place.

However,  the  role  of  typographical  modification  as  a technique  to  enhance  salience  of  input  is  not  a  single powerful  tool  for  directing  learners’  attention  to  the  target form.  White  (1998)  claimed  from  her  study  that  input enhancement is necessary, but not sufficient in speeding up language  acquisition,  especially  when  involving complexity  and  contrast  between  the  first  and  second language. Language development requires the assistance of explicit  instruction  and,  the  role  of  interaction  cannot  be underestimated.  The  small-scale  study  by  Han  (2003)  and the  laboratory  study  by  Leeman  (2003)  on  recasts  as component  of  interaction  provide  insights  about  the significant  function  of  attention  for  second  language uptake. While Han (2003) spotlights  the success of  recasts in  heightening  learners’  awareness  and  leading  to considerable  improvement  in  the  target  form,  Leeman (2003)  concentrates  on  the  ambiguous  status  of  recast, which  is  made  up  of  negative  evidence  alone,  enhance salience alone, and negative evidence and enhance salience 

in  combination.  The  underscoring  suggestion  from  her study is that the saliency of the new form within the recast is  the  most  helpful  in  catching  learners’  attention  and facilitates  the process of  input-intake conversion. Negative evidence  alone  is  of  minor  importance  in  accelerating  this process.  The  findings  strengthen  the  view  held  by  many interactionists  such  as  Long  (1996)  and  Pica  (1994)  that interaction  fosters  the  environment  for  developing  second language processing capacity with the presence of selective attention as an essential  factor.

The value of  interaction  in promoting  second  language acquisition  is  highlighted  by  Gass  and  Torres  with  the conclusion  that  “interaction,  as  an  attention-drawing device, followed by input, as a forum for data gathering, is the  most  powerful  of  the  externally  driven  enhancement” (Gass&  Torres,  2005,  p.24).  The  study  provides  further support  on  the  role  of  attention  in  second  language acquisition,  and  states  that  combination  of  treatments (input  followed by  interaction  but not  interaction  followed input) yields better learning rates than one treatment alone. One  important  rider  in  this  study  is  that  level  of  attention may  vary  according  to  the  complexity  and  the  nature  of each  language  area,  i.e.  vocabulary,  syntax  or morphosyntax  requires different  levels of  attention.

To sum up, the five studies contribute to the tenet about the  role  of  attention  in  language  learning  in  second language  theory  and  confirm  the  distinct  effectiveness  of input  enhancement  and  recasts  as  a  form  of  interaction  in improving  learners  language  output.  This  also  places  the focus  on  form  instruction  in  a  highly  valuable  position  in second  language  teaching,  and  serves  as  the  fundamental support  for  other  empirical  studies  on  the  effectiveness  of form-focused  instruction  in  different  learning  conditions.

7. Implications for teaching

The  studies  above  bring  about  some  thoughts  on innovation  in  our  teaching  context,  regarding  improving learners’  accuracy  in  the  second  language performance.

Firstly,  it  is proposed  that  implementing  focus-on-form would  be  productive  with  the  combination  of  different techniques, highlighting the target forms in the input (input enhancement) and recast as a type of interaction (and many other  types  such  as  clarification  request,  confirmation check,  etc.),  among  which,  the  ordering  input-interaction proves  to be  the  most effective.

Secondly,  the  complexity  and  properties  of  a  linguitic feature  should  be  taken  into  account  in  selecting  and designing a  focus-on-form  task. 

Thirdly,  salience  of  target  forms  in  the  input  is  very important in catching learners’ attention, even in corrective feedback.  Teachers  should  provide  learners  the  salience target  form,  which  enables  learners  noticing  their  errors and doing  uptake.

Finally,  the  studies  also  inspire  further  research  in investigating  the  effectiveness  of  form-focused  instruction among  which,  learners’  attention  to  form  is  the  essential factor  triggering  language  development.

Page 65: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

62 Nguyen Pham Thanh Uyen

8. Conclusion

Focus on form  instruction with the goal of accelerating learners  noticing  to  form  is  gaining  cogency  in  second language  teaching  and  learning.  Its  role  as  “a  cognitive focusing device or  advance  organizer  for  learner attention” is emphasized by many researchers such as R. Ellis (1993). Schmidt  and  Frota  (1986)  and  Sharwood  Smith  (1991).  It is  now  widely  recognized  that  a  pure  meaning-focused approach  to  second  langguage  teaching  is  not  promising and  fruitful.  Ellis  (1994,  cited  in  Schmidt,  1995,  p.47) maintained that  “there are many possible ways to combine exposure  to  input  and  communicative pratice  with  a  focus on  form  and  consciousness  raising”.  Schmidt  was  very optimistic  about  the  “theoretically  interesting  and practically  important  research  ahead”  which  may  provide answers  to  the  question  of  integrating  form-focused instruction  into  communicative  language  teaching.  The empirical  studies  under  review  in  this  paper  partly accomplish  the  confirmation  of  the  role  of  form  focus instruction  stills  needs  more  evidence  from  empirical research  in  diverse  instructional  practices  of  different cultural  and  educational  settings.  Personally,  I  think  that this  is  a  good  place  for  teachers  to  begin  their  study  on focus  on  form  instruction  to  enhance  the  effectiveness  of second  language  learning  and  teaching.

TÀI LIỆU THAM KHẢO

[1] Carter, R. and Nunan, D. (2001) The Cambridge Guide to Teaching English to Speakers of Other Languages. Cambridge: CUP.

[2] Doughty, C. and Williams, J. (1998) “Isues and Terminology”. In C. Doughty & J. Williams (Eds.). Focus on Form in Classroom Second Language Acquisition. (pp. 1-12). Cambridge: CUP.

[3] Gass  S.M.  &  Torres  M.J.A.  (2005)  “Attention  When?  An Investigation  of  the  Ordering  Effect  of  Input  and  Interaction”. Studies in Second Language Acquisition, 27, 1-31.

[4] Han, Z (2002). “A Study of the Impact of Recasts on the Consistency in L2 Output”. TESOL Quarterly, 36, 542-572.

[5] Jourdenais, R., Ota M., Stauffer, S., Boyson B. & Doughty C. (1995) “Does  Textual  Enhancement  Promote  Noticing?  A  Think-Aloud 

Protocol  Analysis”.  In R. Schmidt  (Ed.),  Attention and Awareness  in Foreign Language Learning (pp. 183-216). Honolulu: Second Language Teaching & Curriculum Center University of Hawaii at Monoa.

[6] Leeman,  J.  (2003)  “Recasts  and  Second  Language  Development: Beyond  Negative  Evidence”.  Studies  in  Second  Language Acquisition, 25, 37-63.

[7] Long, M. H. (1991). “Focus on Form: A Design Feature in Language Teaching Methodology”.  In K. de Bot, R. Ginsberg & C. Kramsch (Eds.),  Foreign  Language  Research  in  Cross  Cultural  Perspective (pp. 39-52). Amsterdam: John Benjamins.

[8] Long,  M.  H.  (1996).  “The  Role  of  the  Linguistic  Environment  in Second Language Acquisition”.  In Ritchie,  W.C.  and Bhatia,  T.K. (Eds.), Handbook of Second Language Acquisition. San Diego, CA: Academic Press, 413-68.

[9] Long,  M.  H.  &  Robinson,  P  (1998).  “Focus  on  Form:  Theory, Research and Practice”. In C. Doughty & J. Williams (Eds.), Focus on  Form  in Classroom Second Language Acquisition.  (pp. 15-41). Cambridge: CUP.

[10] Pica,  T.  (1994).  “Research  on  Negotiation:  What  does  It  Reveal about  Second  Language  Learning  Condition,  Process  and Outcome?” Language Learning, 44, 493-527.

[11] Poole,  A.  (2005)  “Focus  on  Form  Instruction:  Foundations, Applications and Criticism.” The Reading Matrix, 5 (1), 47-53.

[12] Sharwood  Smith,  M.  (1993).  “Input  Enhancement  in  Instructed SLA:  Theorical  Bases.”  Studies  in  Second  Language  Acquisition, 15, 165-179.

[13] Schmidt, R (1994). “Deconstructing Conciousness in Search of Useful Definitions for Applied Linguistics.” AILA Review 11, 11-26.

[14] Schmidt, R. (1995). “Conciousness and Foreign Language Learning: A Tutorial on the Role of Attention and Awareness in Learning”. In R.  Schmidt  (Ed.),  Attention  and  Awareness  in  Foreign  Language Learning  (pp.  1-64).  Honolulu:  Second  Language  Teaching  & Curriculum Center University of Hawaii at Monoa.

[15] Schmidt,  R.  &nFrota,  S  (1986).  “Developing  Basic  Conversational Ability  in a Second Language: A Case Study of an Adult Learner of Portugese”.  In  Day,  R.R.  (Ed.),  Talking  to  Learn:  Conversation  in Second Language Acquisition. Rowley, MA: Newbury House, 237-322.

[16] Tomlin, R.S., & Villa.  (1994) “Attention in Cognitive Science and Second  Language  Acquisition”.  Studies  in  Second  Language Acquisition, 16, 183-203.

[17] White,  J.  (1998)  “Getting  Learner’s  Attention:  A  Typographical Input  Enhancement  Study”.  In  C.  Doughty  &  J.  William  (Eds.), Focus on Form in Classroom Second Language Acquisition. (pp. 85-113). Cambridge: CUP.

(The Board of Editors received the paper on 02/06/2016, its review was completed on 13/06/2016)

 

Page 66: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 63

STRATEGIES AND FUNCTIONS OF OTHER-REPAIR IN ENGLISH AND VIETNAMESE CONVERSATIONS

Nguyen Thi Minh Hanh1, Nguyen Thi Quynh Hoa2  1Doctoral Student of the English Language Course 31 (2015-2019);[email protected]

2The University of Danang, University of Foreign Language Studies; [email protected]

 Abstract - Knowing the strategies which listeners use to ask for speakers’ trouble sources causing breakdowns in conversations and knowing the functions of other-repair are necessary because these factors help the interlocutors gain more effectiveness in communication. Schefloff et al. [3] mentioned other-repair with such features as positions, strategies and functions of correcting the trouble sources causing communication breakdowns from the listeners. The results of this research help the listeners know how to manage when they have difficulties in hearing and understanding the information from the speakers. This paper presents and analyzes the strategies and the functions of other-repair in English and Vietnamese conversations, based on the theory of Schegloff et al. [3] with the aim to discover the similarities and differences in the strategies and the functions of repairing the trouble sources from the listeners in two languages. The results will provide learners with some useful ways to make effective conversations.

Key words - other-repair; strategies; functions; conversation; the theory of Schegloff et al.

1. Introduction

In  daily  communication,  listeners  sometimes  cannot understand  all  the  utterances  from  speakers.  The  reasons are  that  the  listeners  cannot  hear  the  speakers’  utterances clearly;  or  the  listeners  can  hear  them  but  they  cannot understand  them  clearly  or  they  do  not  understand  the speakers’  thoughts.  All  of  these  difficulties  are  the  causes of  communication  breakdowns.  To  overcome  the  trouble, the  listeners  use  some  strategies  to  show  their  difficulties in  hearing  or  understanding  what  the  speakers  say.  Then, the  speakers  will  correct  their  trouble  sources  or  they  can express  their  thoughts  in  other  ways  so  that  the  listeners can understand  what  they  mean. Up  to now,  there has not been  any  research  on  this  matter  in  Vietnam.  Therefore, this  article  is  aimed  at  presenting  the  findings  of  the strategies  and  functions  of  other-repair  in  English  and Vietnamese  conversations  with  the  hope  of  contributing  a small part to the teaching and learning of the speaking skill. 

2. Theoretical Background

2.1. Emanuel Abraham Schegloff‘s theory of repair

Shegloff  et  al.  [3]  first  characterized  the  nature  and organization  of  repair  in  naturally  occuring  conversations. They gave  out  the  findings  of  the positions,  strategies  and functions  of  self  repair  and  other-repair.  They  also mentioned  that  other-repair  may  be  more  frequent  in interactions  among  “not-yet-competent”  speakers.  This comment  has  stimulated  a  lot  of  studies  on  other-repair  in interactions  with  non-native  speakers  (Hosoda  [1],  Wong [5],...) In this paper, we apply this theory to investigate and compare  the  strategies  and  functions  of  other-repair  in English  and  Vietnamese  conversations. 

2.2. Repair in Conversations

According  to  Schegloff  et  al.  [3,  p361],  “repair”  is  the 

treatment of trouble occuring in interactive language use or “a  mechanism  that  operates  in  conversation  to  deal  with problems  in  speaking,  hearing,  and  understanding  the  talk in  conversation”.  It  includes  processes  for  mutual comprehension  such  as  word  search  as  well  as  a replacement  or  correction  on  hearable  errors  or  mistakes. 

Schegloff  et  al.  [2]  gave  out  two  types  of  repair:  self-initiated  repair  and  other-initiated  repair.  Each  type consists  of  three  components,  namely  trouble - source, repair initiator and repair completion. 

- Trouble source refers to any element in a conversation which cause communication breakdown.  It could be found anywhere  during  conversational  interactions  and  any element could be  repaired by participants  in conversations, even if it is a grammatically correct form or a pragmatically appropriate  expression. 

- Repair Initiation: A  trouble-source  can  be  identified by the speaker in his/her own talk (i.e., self-initiated) or by the  recipient  in  someone  else’s  talk  (i.e.,  other-initiated), and  then  the  speaker  (self-initiator)  or  the  listener  (other-initiator)  initiates  to  use  the  repair  strategies  to  repair  it  or to ask  for  repair. 

- Other is  the  party  who  recognizes  the  trouble  source from the speakers and asks  for repair. 

- Repair strategies  include  the  interlocutor’s  verbal responses  to  another  interlocutor’s  wrong,  incomplete,  or silent responses. They also include interlocutors’ responses that  either  repair  the  trouble  directly  in  the  same  turn  or initiate  repair  that  another  interlocutor  will  complete. 

- Repair completion: After  a  trouble  source  is identified,  it  can  be  repaired by  the  self-initiator  or  by  the other-initiators. 

Schegloff et al. [4] divided the functions of other-repair into  three  types:  clarification  request,  confirmation  check and  comprehension  check. 

-Clarification request: When  the  information  provided is  insufficient or unclear,  the  listeners  initiate  repairs. 

- Confirmation check: When  the  listeners  are  afraid  of misunderstanding the utterance from the speakers, they ask for  confirmation. 

-  Comprehension check: When  the  listeners  cannot understand  the  utterance  from  the  speakers,  they  ask  for explanation. 

2.3. Other-Repair

According  to  Sack,  Schegloff  and  Jefferson  [4]  other-repair generally  involves a recipient of  the problematic  talk initiating  the  repair,  but  either  he/she  leaves  it  for  the speakers  of  the  trouble-source  to  deal  with  the  trouble 

Page 67: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

64 Nguyen Thi Minh Hanh, Nguyen Thi Quynh Hoa

themselves in the ensuing turn or he/she will repair it. 

For  example: 

(1)  S: Were you uh you were in therapy with a private doctor ?

H: yah

S: Have you ever tried a clinic?

H: What?

S: Have you ever tried a clinic?

H: ((sigh)) No, I don’t want to go to a clinic. [3, p.367] 

Instead  of  answering  the  speaker’s  (S)  question  after S’s  turn  is  finished,  the  hearer  (H)  initiates  repair  in  the fourth line by using wh-question word “what” that displays his/her  trouble  in  hearing  or  understanding  S’s  prior  talk. In the fifth line, S repeats his prior utterance in response to H’s  repair  initiation. 

(2) S: Coi chừng đi đậu phụng đó nghe!

H: Đi đâu cơ?

S: Đi đậu phụng!.. Cái anh!- Cô giao liên té nước lên thuyền.- Anh nhà báo ơi, đậu phụng ở quê em, ngoài Bắc các anh là lạc đó. Anh hiểu ra chưa?

H: À ra thế! Đi lạc. Đi lạc.- Lê nhắc lại, thích thú.

[Bồ câu không đưa thư, Nguyễn Nhật  Ánh] 

Similarly, in this example, H has trouble in understanding when S uses  her dialect  “đậu phụng”  to express  the  loss of way  and  H  initiates  repair  by  using  wh-question  “Đi đâu cơ?”. S tries to explain her dialect in her next response. 

Schegloff  [4]  investigated  and  systematically described other  -  repair  in  conversations.  This  type  of  other  -  repair has  four  strategies Using question words; Repeating a part of the trouble source turn plus a question word; Judging ideas from the speaker’s utterance; Repeating a part of the speaker’s talk with upward intonation and  it  has  three functions such as clarification request, confirmation check and comprehension check. 

3. Methodology

This study is conducted with the descriptive and analytic methods.  Three  criteria  to  select  samples  have  been established:  1-the  samples  have  to be conversations,  2-they have  to  contain  other  -  repair,  3-  the  sources  have  to  be reliable. The sources are 30 English stories and 30 Vietnamese stories in the 1970s. Each of them contains from 200 to 500 pages.The  year  of  publication  is  carefully  chosen  with  the hope  that  the  utterances  in  conversations  are  modern  and similar to what people say in daily conversations at the present time. Some of the data is taken from the internet. 300 English conversations and 300 Vietnamese conversations have been collected to build up the data with such a set of criteria. The numbers of conversations like this can be reliable enough and various to represent the features of other–repair. 

4. Findings and discussion

4.1. Strategies of Other -Repair in English and Vietnamese Conversations

4.1.1. Using question words

Question words in English consists of “what”, “who”...; 

in Vietnamese such as “Hả?”, “Cái gì?”, “Ai?”, “Ở đâu?”, “Tại  sao?”... 

(3)  S:“Let’s go.”

H:“Huh?”

S:“Let’s go,” I repeat, and with such obvious authority that she began to follow me as I walked toward the

[Love Story, Segal, E.] 

In  (3),  S  produces  the  trouble-source  because  H  does not understand where S  is going,  so H  initiates a  repair on that  trouble-source  with  “Huh” and in the next turn, S self completes by repeating the utterance along with the action. 

(4)  S:“Even the Sonovabitch?” she asked.

H:“Who?”

S:“Oliver Barrett III.”

H:“Ah, he’s a nice guy. You’ll really like him.”

[Love Story, Segal, E.] 

(5)  S: Nó bỏ đi rồi hở chị? 

H: Ai cơ?

S: Con mèo ấy.

H:Ừ, con mèo đã bỏ đi rồi.

[Kính vạn hoa, Nguyễn Nhật Ánh] 

(6)  S: Anh Sáu, thằng Lê đây mà !

H: Hả?

S: Lê nhà báo đây!

[Khắc khoải, Hồ Hải Học] 

In  these  above  examples,  Ss  produce  the  trouble-sources because Hs cannot know who Sonovabitch, Lê and Nó  are,  so  Hs  initiate  repairs  on  these  trouble-sources  by using question words “Who?”, “Ai cơ?”, “Hả?” and in the next turn, Ss self  complete. 

4.1.2. Repeating a part of the trouble source turn plus a question word

(7)  S: “Go to Cairo,” Teddy said without opening his eyes. 

H: “Sure. And do what?” 

S:  “Wait.” 

H: “Wait for what?” 

S: “Wait for the ground to shake. Stay away from the  embassy.” 

[The Brethren,  John Grisham] 

(8)  S: Cô ơi, cái chân... 

H: Chân em làm sao ? 

S: Trắng quá! Tôi sợ nó phát hiện. 

[Khắc  khoải,  Hồ  Hải  Học] 

In  these  two  above  examples,  Hs  repeat  a  part  of  Ss’ utterances  plus  question  words  “What”  and  “làm  sao?”  to show the wish for Ss to repair their utterances more clearly. 

4.1.3. Judging ideas from the speaker’s utterance

(9)  S: "You're  not a  woman," she  said.  "I  sometimes wonder if I am myself, the way I live." 

H: "You mean the impermanence?" 

S: She looked at him angrily. "No, I don't! I mean 

Page 68: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 65

the  monotony  with  nothing  to  show  for  it-no  kids.  You're married,  aren't  you?" 

[Gentlement  in  their  season,  Gabriel, F.] 

In  (9),  H  gives  the  judgement  of  what  S  has  just  said with  the  purpose  of  confirming  information  or  repair  it  to make  its meaning  more explicit. 

(10)  S:  Đáng  lo  ở  chỗ  tụi  mình  không  biết  Hiền  Hòa nói thật hay nói dối. 

H:  Ý  mày  muốn  bảo  ba  Hiền  Hòa  không  có  nhà nhưng Hiền Hòa vờ nói có ư? 

S: Có thể lắm! 

[Kính vạn hoa, Nguyễn Nhật Ánh] 

In this example, H gives the thoughts of what S has just spoken  with  the  hope  that  the  information  will  be reconfirmed  or  repaired  more  clearly. 

4.1.4. Repeating a part of the speaker’s talk with upward intonation

(11)  S: "We didn't strike yet, because I'm waiting for a stick."

H: "A stick?"

S: "That's right. A stick. And do you know what I'm going to do with the stick?"

[American Gods, Gaiman, N,]

H specifies the trouble source by repeating a partial part of  the  prior  talk A stick with  an  upward  intonation  in  the second  turn.  S  completes  the  repair  by  confirming  the utterance. 

(12)  S: Đây là người ta đánh nhầm.

H: Đánh nhầm? - Quý ròm kêu bật lên.

S: Ừ!

[Kính vạn hoa, Nguyễn Nhật Ánh]

In  this  example,  H  makes  a  partial  repeat  of  the  prior talk  with  upward  intonation  such  as  “Đánh nhầm?” to clarify what he/she has just heard from S. 

Table 1 below is the summary of the strategies of other-repair and the frequency of its presenting from 187 English conversations  and  180  Vietnamese  conversations. 

Table 1. Strategies of Other-Repair in English and Vietnamese Conversations

Strategies English Vietnamese

Occurrence % Occurrence %

1. Clarification request

50  26.7  63  35 

2. Confirmation check

72  38.5  50  27.8 

3.  Comprehension check

65  34.8  67  37.2 

Total 187/300 100 180/300 100

The statistics indicates that two strategies such as Using question words and  Judging ideas from the speaker’s utterance  are  more  commonly  used  in  English conversations  than  in  Vietnamese  ones.  This  shows  the difference  that  there  is  only  one  word you for  the  second person  in  English  conversations  and  the  interlocutors  use 

the  intonation,  so  these  two  strategies  are  chosen  to  use when  the  hearers  want  the  speakers  to  repair  their utterances.  In  Vietnamese,  it  is  impossible  to  say “Hả?”, “Ai?”, “Làm sao?” to  the  adults  or  the  people  with  their high  social  positions.  However,  more  Vietnamese  people use  the  strategies  Repeating a part of the trouble source turn plus a question word  and  Repeating a part of the speaker’s talk with upward intonation.  When  using  these two  strategies,  the  hearers  can  either  employ  words  of modality  like“ạ”, “chứ”, “chứ ạ” or  not  to  identify  their relationships  with  the  speakers. 

4.2. Functions of Other-Repair in English and Vietnamese Conversations

4.2.1. Clarification Request

(13)  S: "You've made me wonder about my own wife."

H: "Did you say 'wife' or 'life'?"

S: "I said 'wife'-though they're the same thing really."

[Gentlemen in their Season,  Gabriel,  F.] 

In  this  example,  H  hears  what  S has  just  asked, but  H wants  to  make  it  clearer,  so H  initiates  a  repair  and  in  the next turn, A self completes the utterance. 

(14)  S: Thưa cụ, bà con chúng con toàn người dưới Nam.

H:Nam nào? Nam Định hay Thái Bình hay Hà Nam, Phủ Lý?

S: Thưa với cụ, cả Nam Định và Hà Nam ạ.

[Tác phẩm văn học được giải thưởng HCM, Nguyên  Hồng]

In  (14),  the  phrase  người dưới Nam causes  some opacity to H because in Viet Nam, there are many localities whose  names  begin  with Nam or  includes  the  word Nam. So, H must ask S for clarification. 

4.2.2. Confirmation Check

(15)  S: "I don't know him. Is there any comparison?"

H: You mean in his attitude?"

S:"Yes".

[Gentlemen in their season,  Gabriel,  F.] 

In  the  example  (15),  H  hears  what  S  has  just  said clearly, but H does not want to cause misunderstanding, so H  asks  for  confirmation  of  what  S  is  thinking.  And  S confirms it in the next turn. 

(16) S: Đáng lo ở chỗ tụi mình không biết Hiền Hòa nói thật hay nói dối.

H: Ý mày muốn bảo ba Hiền Hòa không có nhà nhưng Hiền Hòa vờ nói có ư?

S: Có thể lắm!

[Kính vạn hoa, Nguyễn Nhật Ánh]

In  the  example,  the  other  initiator  uses  the  strategy  “ý mày muốn...” to affirm what S is saying and thinking. 

4.2.3. Comprehension Check

(17)  S: "You're perfectly right; I'm depressed. Let us talk about Hotchkis' wife. Last time we met I could see that you were about to meet her."

H: "How do you mean?"

Page 69: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

66 Nguyen Thi Minh Hanh, Nguyen Thi Quynh Hoa

S: "You looked lustful. I told Helen that your marriage was in danger. 'He's involved,' I said, 'with a woman for whom murder was done.”

[Gentlemen in their season,  Gabriel,  F.] 

In  this  example, H cannot  understand what S  is  saying although  H  hears  it  clearly,  so  H  initiates  repair  and  S explains to H in the next turn. 

(18)  S: À quên, thưa cô...việc đó thì em biết ạ.

H: Việc đó là việc gì?

S: Việc tại sao bạn Hiền Hòa bị điểm 2 đó cô.

[Kính vạn hoa, Nguyễn Nhật Ánh] 

The other-initiator does not understand  what S  has  just told her, so she must ask  for comprehension. 

Table 2 below  is  a  summary  of  the  functions of other-repair  and  its  frequency  taken  from  187  English conversations  and  180  Vietnamese  conversations. 

Table 2. Functions of Other-Repair in English and Vietnamese Conversations

Strategies English  Vietnamese 

Occurrence  %  Occurrence  % 

1. Clarification request 

50  26.7  63  35 

2. Confirmation check 

72  38.5  50  27.8 

3. Comprehension check 

65  34.8  67  37.2 

Total  187/300  100  180/300  100 

This  table  shows  that  three  functions  such  as “clarification request”,  “confirmation check”  and “comprehension check”  are  presented  in  English  and Vietnamese  conversations.  However,  the  function confirmation check  in  English  conversations  takes  up  the higher rates than in Vietnamese ones. The listeners ask for repair  because  they  want  the  speakers  to  confirm  their utterances  or  to  check  whether  the  speakers’  thoughts  are the same with the listeners’ ones. English have many multi-syllablic  words,  so  its  vocabulary  is  one  of  the  factors causing  the  trouble-sources  for  the  listeners. 

Meanwhile,  the  function comprehension check has  the highest  rate  in  Vietnamese  conversations. Vietnamese people  have  a  habit  of  beating  about  the  bush  and  their utterances have more underlying meanings, so the listeners must  ask  for  their  clarification. 

5. Conclusion

The  results  of  the  investigation  show  that English  and Vietnamese  conversations  cover  all  of  the  features  of strategies  and  functions  of  other-repair  according  to  the theory of  Schegloff et  al. There are four  strategies namely Using  question words; Repeating a part of the trouble source turn plus a question word; Judging ideas from the speaker’s utterance; Repeating a part of the speaker’s talk with upward intonation and  three  functions  namely clarification request, confirmation check and comprehension check. 

The  differences  in  strategies  and  functions  show  that each  language  always  reflects  the  cultural  features  of  its speech  community.  The  results  of  the  research  can  be applied  to  teaching English and Vietnamese conversations. The features of the strategies and functions of other - repair help  learners  know  how  to  employ  suitable  strategies  to show  their  problems  in  hearing  and  understanding speakers’  utterances. 

REFERENCES

[1] Hosoda, Y. (2000), “Other-repair in Japanese conversations between nonnative  and  native  speakers”,  Issues in Applied Linguistics,  11, p.39-65. 

[2] Sack,  H.,  Schegloff,  E.  &  Jefferson,  G.  (1974),  “A  simplest systematics  for  the  organization  of  turn-taking  in  conversation”, Language 50/4: p.693-735.3. 

[3] Schegloff, E.A., Jefferson, G., & Sacks, H. (1977), “The preference for  self-correction  in  the  organization  of  repair  in  conversation”, Language, 53, p.361-382. 

[4] Schegloff,  E.A.  (2000),  “When  others  initiate  repair”,  Applied Linguistics, 21, p244-267.

[5] Wong,  J.  (2000),  “Delayed  next  turn  repair  initiation  in native/nonnative  speaker  English  conversation”,  Applied Linguistics, 21, p.274-97. 

[6] Nguyễn Nhật Ánh  (2003), Kính vạn hoa, Tập 1-Tập 15, Nxb Kim Đồng. 

[7] Nguyễn Nhật Ánh (2003), Kính vạn hoa, Tập 31-Tập 45, Nxb Kim Đồng 

[8] Nguyễn Nhật Ánh (2007), Bồ câu không đưa thư, Nxb Trẻ. 

[9] Hồ Hải Học (2001), Khắc khoải, Nxb Thanh Niên. 

[10] Nguyên Hồng (2005), Tác phẩm văn học được giải thưởng Hồ Chí Minh, Quyển II, Nxb Văn học. 

[11] Gabriel  Fielding  (1966),  Gentlemen in Their Season,  William Morrow & Co, New York. 

[12] Gaiman, N. (2003), American Gods, Harper Collins Publishers Inc., New York. 

[13] John Grisham (2000), The Brethren, Arrow Books. 

[14] Segal, E. (2000), Love Story, Bantam Books. 

(The Board of Editors received the paper on 07/04/2016, its review was completed on 25/04/2016)

Page 70: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 67

LINGUISTIC FEATURES OF ADVERTISEMENTS ON ROAD SAFETY EQUIPMENT IN ENGLISH

Nguyen Thi Quynh Hoa1, Nguyen Thi Hong Minh2, Nguyen Ngoc Nhat Minh1 1University of Foreign Language Studies, The University of Danang; [email protected]

2Master Student of the English Language Course 28 (2013-2015) 

 Abstract - Nowadays, the use of road safety equipment to protect ourselves from accidents has become a great necessity in our lives. In this paper, we are interested in eight types of road safety equipment namely helmets, seat belts, child safety seats, safety vests, safety glasses, safety gloves, safety shoes and emergency motor/car kits with the aim to help customers choose the best and safest equipment for use in traffic. In line with this, we have collected and analyzed online advertisements on these types of road safety equipment with a view to finding out the common linguistic features in terms of their syntactic features, lexical choices and cohesive devices. We do hope that this investigation into advertisements on road safety equipment (ARSEs) at the linguistic level will be beneficial to the teaching and learning of English in Vietnam. This study may also be useful for those who are interested in advertising, especially advertisements on road safety equipment.

Key words - linguistic features; road safety advertisements; syntactic features; lexical choices; cohesive devices.

1. Rationale

Nowadays,  road  safety  has  become  an  increasingly growing public  concern since  it  is  closely  related  to  traffic safety.  In  order  to  protect  ourselves  from  road  accidents, we  must  equip  ourselves  with  the  safest  equipment.  As  a matter  of  fact,  the  need  for  road  safety  equipment  which includes  specially  designed  items  to  protect  people  - especially  pedestrians,  motorcyclists,  cyclists,  drivers  and passengers  in  transport  -  from  accidents  has  been increasing  rapidly. 

There are various kinds of road safety equipment which can help prevent and protect people  from accidents.  In  this article,  due  to  their  popularity  and  necessity,  the  eight essential kinds of road safety equipment namely seat belts, child safety seats, helmets, safety vest, safety glasses, safety gloves, safety shoes and motor/car kits  are  chosen  for investigation.  These  kinds  of  equipment,  especially helmets, are commonly used in our daily lives. 

Thanks  to  the  importance  of  road  safety  equipment  in transport,  advertisements  on  road  safety  equipment  have attracted much of our attention. To seek the information for road safety equipment, customers can look up on newspapers, magazines,  televisions  or  on  the  Internet.  Nowadays, however, searching on the Internet for information as well as advertisements  is  becoming  more  and  more  widespread.  In addition, online shopping has been increasingly popular in the world as well as in Vietnam. Therefore, ARSEs in this article are  selected  from  the  prestigious  websites  in  the  United Kingdom  and  the  United  States  of  America,  for  instance, www.amazon.com,  www.ebay.com,  www.bestbuy.com, www.tesco.com, www.argos.co.uk. 

This  research  is  conducted  with  a  strong  aspiration  to help  English  language  students  with  comprehension  and production  of  the  advertising  language.  Additionally,  this 

study will probably bring students and  teachers of English an insight into a number of  linguistic  features of ARSEs.

2. Theoretical Background

2.1. Definitions of Terms

-  Road  Safety  Equipment  is  considered  as  a  set  of specially  designed  items  necessary  for  protecting  people from  road  traffic  accidents. 

- Advertisements on road safety equipment are the ones that  introduce  to  customers  specially  designed  items necessary  for protecting people from road traffic accidents. 

All in all, advertisements on road safety equipment in this article  are  online  advertisements  in  the  field  of  road  safety equipment selected from prestigious websites of companies in the  United  Kingdom  and  the  United  States.  They  provide detailed information about the equipment or the products with a view to influencing the audience as well as persuading them to purchase the equipment or the products. 

2.2. Methodology

The aim of the study is to identify and clarify the nature of  ARSEs  in  order  to  find  out  their  linguistic  features  in terms  of  syntactic  features,  lexical  choices  and  cohesive devices.  In  order  to  achieve  this  aim,  we  combined different  research  methods  as  follows: 

The  descriptive  method  is  used  to  give  a  detailed description  of  linguistic  features  of  ARSEs. 

The  analytic  method  is  used  to  classify  and  justify  a certain  feature  or  characteristic. 

The  inductive  method  is  helpful  in  drawing  out  the generalizations  from the  findings and  making conclusions. 

Three criteria for selecting samples have been established: 1-the  samples  must  be  advertisements  on  road  safety equipment, 2-the sources of the samples must be the official websites in the United States and the United Kingdom, 3- The samples are from 100 to 300 words in length. 

With  such  set  of  criteria,  112  ARSEs  have  been collected  to build up  the data. 

3. Findings and discussion

3.1. Syntactic features of ARSEs

Advertising  language  has  specific  characteristics  in terms  of  syntax  and  syntactic  features.  In  order  to  make advertisements  become  more  persuasive,  advertisers  make great efforts to convey  the information in  the most concise manner.  ARSEs  are  not  exceptions.  The  outstanding syntactic  structures  in  ARSEs  are  the  passive  voice, relative  clauses,  imperative  sentences  and  conditional sentences.  In  112  collected  ARSEs,  the  passive  voice, 

Page 71: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

68 Nguyen Thi Quynh Hoa, Nguyen Thi Hong Minh, Nguyen Ngoc Nhat Minh

relative  clauses,  imperative  sentences  and  conditional sentences  are  used  with  high  percentages  for  the  purpose of making the ARSEs more appealing and persuasive. 

Here  is  the  distribution  of  the  passive  voice,  relative clauses,  imperative  sentences  and  conditional  sentences  in ARSEs. 

Table 1. Distribution of Passive Voice, Relative Clauses, Imperative Sentences and Conditional Sentences in ARSEs

Syntactic Structures Occurrence %

Relative Clauses  175  20.3 

Conditional  Sentences  89  10.3 

Passive Voice  473  54.8 

Imperative Sentences  126  14.6 

Total  863  100 

Table  1  shows  that  the  passive  voice  takes  up  the highest  percentage  in  ARSEs  with  54.8%,  relative  clauses account  for  20.3%  and  imperative  sentences  and conditional sentences are the lowest with 14.6% and 10.3% respectively. Here are a number of  reasons  for  this  trend: 

First of all, the passive voice is the most frequent because it makes ARSEs more objective and persuasive. The second reason is that relative clauses make the advertisements concise and  succinct.  Last  but  not  least,  imperative  sentences  and conditional  sentences  play  important  roles  in  urging customers to purchase the equipment. 

In the passive voice, we can see that two auxiliary verbs be  and  get  are  often  used  in  sentences.  However,  Quirk, R. et al.  [5, p.161] argue  that  the get-passive  is  avoided  in formal  style,  and  even  in  informal  English,  it  is  less frequent  than  the be-passive.  The  reason  for  this  trend  is that the get-passive puts the emphasis on the subject rather than  the  agent,  and  on  what  happens  to  the  subject  as  a result of the event. 

Conversely, it is interesting to know that, in ARSEs, two cases of the get-passive are found. Here are the examples: 

(1) Sharks first LED helmet: Get seen on those dark nights! 

(http://www.getgeared.co.uk/shark......300) 

(2) The ANSI 2 5-PT Breakaway Safety Vest system keeps you from getting caught on vehicles, machinery, and more. 

(http://www.tsasafety.com/ansi......safety-vest) 

Despite accounting for a very small percentage, the get-passive shows their necessity in replacing the be-passive in cases  where  there  is  a potential confusion. 

In  ARSEs,  relative  clauses  are  found  to  convey  the indispensable or  vital  information  about origins,  functions, and benefits of the equipment. The following examples are illustrated  for  each  kind. 

The origins of equipment 

(3)  The helmets, made with a composite fibreglass shell and polystyrene shock absorption liner, is fully leather liner. 

(http://www.davida.co.uk/type.php?id=speedster) 

The equipment’s  functions 

(4) The Viking wear ANSI 3 DOT safety Vest is designed for jobs and situations that demand maximum visibility. 

(http://www.tsasafety.com/viking....vest) 

The equipment’s benefits 

(5) This is a superb warm weather street riding glove that subtly incorporates advanced polymer knuckle guards to provide great impact performance and improved street styling. 

(http://www.jsaccessories.co.uk/spartan....black.html) 

The  results  also  suggest  that  relative  clauses  are essential  in  the  advertising  language  because  they  help  to arouse  the reader’s attention, proved by the high frequency in  ARSEs. 

It  can  be  easily  seen  that  the  affirmative  imperative sentences  with  a  high  percentage  (85.9%)  dominate  the negative  ones. 

Here  are  some  examples  of  affirmative  and  negative imperative  sentences: 

(6)  Get Yours today – because you deserve safety, comfort and peace of mind!

(http://www.jsaccessories.co.uk/spartan.....black.html) 

(7) Use for Striker Series Goggles only. 

(http://www.amazon.com/FAA.....B00701EIRS) 

(8)  Do not purchase this item, unless your seat belt metal tongue’s dimensions (where you need the extender) match all the above measurements.

(http://www.argos.co.uk/static/....2668938) 

One of the best ways to increase the consumption of the equipments  is  to  urge  customer’s  immediate  action.  In example  (6)  and  (7),  the  verbs get and try are  instances  of this  action.  They  appear  to  urge  customers  to  buy  the equipment  as  soon  as  possible.  Additionally,  get  and  try connote the meaning of doing the purchase voluntarily, not paying  money  to  buy  the  equipment.  Hence,  readers  can consider  these  imperative  sentences  as  recommendations. 

In example (8), the negative imperative sentence is used to stress the warning to customers. 

In  addition  to  relative  clauses,  conditional  sentences play an important role in ARSEs. The conditional sentence is  one  of  the  syntactic  features  that  need  studying  in advertisements,  especially  in  ARSEs.  Before  making  a decision  to  buy  any  equipment,  customers  often  have  a strong  tendency  to  wonder  whether  the  chosen  equipment is as good as they have expected or not. In this case, making customers  believe  in  the  equipment  is  very  important  and necessary. In ARSEs, three groups of conditional sentences are  identified: 

Group 1: persuading customers to buy their equipment with a number of sensible reasons. 

(9) If you are in need of a sturdy helmet for the great outdoors, the VFX-W is one of the best.

(http://www.revzilla.com/shoei....helmets) 

Group 2:  giving  customers  instructions  for  using  the road safety equipment. Below  is one example: 

Page 72: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 69

(10)  If you intend to wear over a bulky jacket; you will require at least one or two sizes larger than your regular size.

(http://www.ebay.co.uk/...221655699069) 

Group 3:  raising  questions,  making  customers  feel reasonable  to buy  the equipment: 

(11)  If an accident or personal injury were to occur during your trip, would you be ready to deal with it? 

(http://www.amazon.com/.....B0006MQJ20) 

As  can  be  seen  from  above,  the  unreal  conditional sentences are only used in group 3 with the aim to convince customers  to  buy  the  equipment  by  raising  some unexpected situations in traffic. However, this is not a good method  in  persuasion  because  readers  may  feel  stressed  or doubtful about the equipment at the thought that bad things may  happen  to  them.  That  is  the  reason  why  unreal conditional sentences are not commonly used in ARSEs. 

3.2. Weasel words in ARSEs

Hornby  [4,  p.1745]  defines weasel words as  terms  that are  deliberately  not  clear  or  frank,  used  when  one  wishes to avoid committing oneself  to a definite statement. 

Weasel  words  have  become  a  powerful  device  in advertising. Weasel words are used to evade or retreat from a  direct  or  forthright  statement  or  position.  Although  the ultimate goal of advertising is  to persuade readers  to buy a certain  kind  of  product,  the  word  “buy”  is  rarely  used  in ads.  Linghong,  [22,  p.73]  explains  that  because  the  word “buy” contains the meaning “to obtain something by giving money”  which  often  makes  people  associate  with  their “unwilling outgoing”. Accordingly,  in ARSEs, we found a wide  range  of  verbs  with  the  connotation  of  “buy”,  for example, “give, provide, offer, bring, help, keep, try”. Here is an example: 

(12) Give your child (and yourself) a smooth and easy ride with the SleekRide Premier Travel System featuring an OnBoard 35 Infant Car Seat with side impact protection. 

(http://www.walmart.com/.....36932147) 

The  word  “give”  here  connotes  the  meaning  of “causing someone to have something as present”, and so it avoids  giving  readers  the  impression  that  they  are  being persuaded or even lured to do the purchase. The advertisers use  weasel  words  to  convince  readers  that  they  are  trying to  offer  help  with  their  product  or  equipment  instead  of simply selling  it out. For example: 

(13) Provides protection whilst skating, scootering and skateboarding, with foam padding for extra comfort and fit. 

(http://www.argos.co.uk/....2268424) 

(14) Designed to offer secure protection to the head of your child should they ever require it, offering you some peace of mind.

(http://www.argos.co.uk/...1512975) 

In the above examples, a large number of verbs are used in order to persuade  the readers  to buy  the equipment such as  provide, offer, bring.  These  verbs  belong  to  the  offer group. According  to Wierzbicka  [6, p.191], offer has some typical  semantic  features: 

-  The  speaker  thinks  of  X  as  something  that  could  be good  for  the hearer. 

- The speaker thinks that the hearer may want it to happen. 

Thus,  when  we  offer  to  do  something  or  a  product offers something, we mean that we are willing to do it and will do it if the hearer says that he wants us to do it because X is beneficial  to  the hearer as  the customer. 

3.3. Personal reference in ARSEs

According  to  Halliday  and  Hasan  [1,  p.37],  personal reference  is  reference  by  means  of  function  in  the  speech situation,  through  the  category  of  person.  The  category  of personals  includes  the  three  classes  of  personal  pronouns, possessive determiners (usually called possessive adjectives) and possessive pronouns. In the collected data, only personal pronouns and possessive determiners were found. 

Below  are  some  examples  for  personal  references  and possessive  determiners: 

(15) In-Mold construction provides strength, integrity and is so lightweight, you’ll have to remind yourself that you’ve got a helmet on at all. 

(http://www.dickiesstore.co.uk/product/FA13310) 

(16). With a harness rated to 65 pounds, the Alpha EliteTM Convertible Car Seat lets you keep your child safely in a harnessed seat for longer.

(http://www.davida.co.uk/type.php?id=speedster) 

It  can  be  easily  seen  that  the  use  of  personal  reference you and  possessive  determiner your is  extremely  frequent in  ARSEs  in  private  and  in  advertising  in  common. Linghong  [2,  p.74]  takes  the  view  that  the  personal reference  you  and  possessive  determiner  your make  the language  sound  warm and  friendly,  helping  to narrow  the gap  between  the  advertiser  and  the  reader,  and  make  the advertisements  more  appealing. 

In  the  above  examples,  the  use  of  personal  reference you and  possessive  determiner your make  the  reader  feel that  he/she  is  the  particular  person  the  advertisers  care about  and  are  eager  to  help.  Through  the  use  of  personal reference  you  and  possessive  determiner  your,  the advertisers try to convince the reader that all the equipment they  offer  is  for  his/her  particular  needs  and  benefits,  and hence persuade  the  reader  to do  the purchase. 

3.4. Ellipsis in ARSEs

Nunan [3, p.25] defines ellipsis that a certain structural element is omitted from a sentence or clause and only can be recovered by referring to an element in the preceding text. Ellipsis  is normally an anaphoric relation and consists of  three  types:  nominal,  verbal  and  clausal.  However,  in ARSEs, only  nominal and verbal ellipses are found. 

Nominal 

(17) This vest is made of soft polyester mesh to keep you cool and has zipper front closure. It includes four front pockets, two Φ on chest and two Φ on lower waist.

(http://www.tsasafety.com/...vest) 

In the above example of nominal ellipsis, the noun as the subject of the sentence is omitted and it can be only referred 

Page 73: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

70 Nguyen Thi Quynh Hoa, Nguyen Thi Hong Minh, Nguyen Ngoc Nhat Minh

to the preceding text, which is the name of the equipment. 

Verbal

(18)  It still made to the same precise and exacting manufacturing standards as it has always been Φ, although now unable to be approved for road use due to recent regulatory changes. The helmet, made with a composite fibreglass shell and polystyrene shock absorption liner, is fully leather lined. 

(http://www.davida.co.uk/...Leather_Jackets) 

The  omitting  of  the  verb  made  in  the  clause  it has always been makes  the  sentence  more  appealing. 

3.5. Repetition in ARSEs

Repetition  is  an  expressive  means  of  language  used when  the  speaker  is  under  the  stress  of  strong  emotion.  It shows  the  speaker’s  state  of  mind.  In  ARSEs,  it  is  found that  repetition  is  used  mainly  as  a  means  to  bring  the specific  qualities  of  the  equipment.  Let  us  consider  the example  below: 

(19) The Premium Flame-Resistant Mesh Safety Vest by Occunomix protects you two ways and keeps you cool too. This safety vest boosts your visibility as well as provides flame resistance. Plus, it uses a mesh material for added ventilation. It is constructed of 100% ANSI Modacrylic mesh with NomexThreas FR binding and hook and loop closure. Plus, it uses 2’’W Flame-Resistant 3MTM

ScotchliteTM Reflective Material. One outside pocket for your tools. Material meets ASTM F1506.

(http://www.safetygearonline.com/...class-2-safety) 

In  ARSEs,  repetition  is  employed  to  make  the preceding element stand out and to intensify the benefits of the  equipment.  In  addition,  the  repetition  of  certain  safety expressions  can  help  the  reader  memorize  some  safety 

characteristics  of  the  equipment. 

3.6. Conclusion

This  article  is  aimed  at  clarifying  some  common linguistic features of ARSEs in  terms of syntactic features, lexical  features  and  cohesive  devices.  Hence,  this  article was of much benefit not only for writing advertisements on road  safety  equipment  in  English  on  websites  but  also  for the field of  teaching and  learning English. 

To  teachers: 

The study will probably be a useful resource for teaching English  to  Vietnamese  learners.  Hopefully,  the  result  of  this study will provide teachers with useful knowledge of linguistic features,  especially  the  linguistic  features  of  ARSES. Additionally, teachers can pay more attention to writing skill to help students know how to write advertisements in general and ARSES in particular effectively. 

To English  learners: 

This study will provide a good knowledge of linguistic features, especially the linguistic features of ARSEs, which help  them  have  a  basic  background  and  good  methods  to write an effective and persuasive  ARSE. 

REFERENCES

[1] Halliday,  M.A.K.  and  Hasan,  R.  (1976),  Cohesion in English, Longman, New York. 

[2] Linghong,  Z.  (2006),  “The  Linguistic  Features  of  English Advertising”, CALEA Journal. Inc. (Vol.29, No.1) 

[3] Nunan, D. (1993), Introducing Discourse Analysis, Peguin English. 

[4] Hornby,  A.S. (2010), Oxford Advanced Learner’s Dictionary, 8th

edition, OUP.

[5] Quirk, R. et al.  (1985), A Comprehensive Grammar of the English Language, London: Longman. 

[6] Wierzbicka, A. (1987), English Speech Act Verbs, Academic Press. 

(The Board of Editors received the paper on 26/11/2015, its review was completed on 22/01/2016)

Page 74: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 71

FUNCTIONAL ANALYSIS OF BEHAVIORAL CLAUSES DENOTING SMILING IN ENGLISH AND VIETNAMESE

Phan Van Hoa1, Tran Huu Phuc2, Nguyen Thi Tu Trinh3 1The University of Danang, Viet Nam; [email protected]

2University of Foreign Language Studies, the University of Danang, Viet Nam; [email protected] 3Department of English, College of Transport II, Viet Nam; [email protected]

 

Abstract - In his framework of functional grammar, Halliday [4] determines three kinds of meaning called textual, interpersonal and experiential. The experiential meaning is expressed in 6 process types: material, mental, relational, behavioral, verbal, and existential. Among them, smiling belongs to behavioural processes. Smiling not only serves as emotional expression functions but also has significant communicative and social ones. Smiling is considered as a universal emotion of human beings. However, the language used to express smiling could have dialects that differ subtly from each other. This paper is aimed at interpreting the linguistic expressions related to the meaning of smiling and describing the patterns of behavioural processes encoded in language. Based upon Halliday’s [4] experimental meaning analysis and the data collected in eight short stories and novels, this paper focuses on highlighting: (1) patterns of smiling processes, (2) functions of participants in smiling processes and (3) social functions of smiling.

Key words - functional grammar; smiling; behavioural clauses; processes; social functions.

1. Introduction

All forms of communication can be categorized as either verbal or nonverbal. Much of the communication that takes place  between  people  is  verbal;  it  is  based  on  language whereas  nonverbal  includes  the  use  of  visual  cues  such  as gestures,  facial  expressions  basically  known  as  body language.This paper focuses on transferring the meanings of smiling  in  the  light  of  Halliday’s  functional  grammar. Halliday [4] makes it very clear that his theory is intended to give an account of linguistic communication. Therefore, one of  the  fundamental  tenets  of  functional  grammar  is  that languages are primarily means of human communication. 

1.1. Theoretical Background

“A  Functional  Grammar  is  one  that  construes  all  the units  of  a  language-its  clauses,  phrases  and  so-on  as organic  configurations  of  functions.”[4].Thus,  Halliday’s aim  is  to  develop  a  grammar  system  as  instrument  for people’s communication, for social purposes. To him, there are  three  types  of  meaning  within  grammatical  structures: Experimental,  Interpersonal and Textual. Among them,  the Experimental  meaning  has  to  do  with  the  ways  language represents our experience of  the  world and  the inner world of  our  thoughts  and  feelings.  In  other  words,  we  have turned  our  experience  of  actions,  happenings,  feelings, beliefs,  situations,  states,  behaviours,  etc.,  into  meaning and  into wording. It construes  the word into a manageable set of Process  types and of Participants. Process  refers  to a semantic verb related to doing, feeling and anything that  it expresses  events,  relations,  physical,  mental  or  emotional 

states in the semantic system of the clause; due to functional features of process,  it  is  classified  into  material,  relational, mental,  verbal,  behavioral,  and  existential  and  its Participants  are  labelled  as  Actor,  Goal,  Senser, Phenomenon, Carrier, Behaver and other  terms. 

In  Halliday’s  transitivity  system,  the  material  process describes  concrete  and  tangible  actions  involving participants  as  Actor  and  Goal,  for  example: 

Thomas  Sent  her book  to David. 

Actor  Pro: material  Goal  Beneficiary 

Mental  processes  encode  the  inner  world  of  cognition, perception  and  affection.  There  are  two  constant participants  in  a  mental  process:  a  Senser  and  a Phenomenon,  even  if  the  Phenomenon  is  not  explicitly realized,  for  example: 

He  Loved  his wife  at first sight. 

Actor  Pro:mental  Phenomenon  Circumstance 

Relational  processes  are  processes  of  “being”.  That  is to  say,  there  are  always  two  participants  in  relational processes  which  consist  of  two  main  modes:  Attributive and Identifying:  - Attributive: “A is an attributive of X” 

- Identifying: “A is the identity of X” 

Abraham Lincoln  Was  very tall and thin. 

Carrier  Pro: attributive  Attribute  

Abraham Lincoln 

Was the16th president of the United States. 

Token  Pro:  identifying  Value 

Behavioural  processes  are  processes  of  psychological and  physiological  process,  like  breathing,  coughing, smiling,  dreaming,  chatting,  watching,  etc. These  construe human behaviour including mental and verbal behaviour as an active  version of verbal and mental processes. 

She   is listening  to the radio. 

Behaver  Pro: behavioral  behavioral circumstance 

Verbal  processes  can  be  identified  as  the  processes  of saying which are expressed by verbs tell, say, ask, suggest, etc. 

She  Talks  to him  about her childhood. 

Sayer  Pro: Verbal  Receiver  Verbiage 

Existential  processes  represent  experience  by  positing that  “there  was/  is  something”.  There  is  only  one participant  known as  the  Existent. 

Once upon a time  there  Was  a little girl. 

Circumstance    Pro: existential  Existent 

1.2. Some Previous Studies

Halliday’s  functional  grammar  has  been  studied  and developed.  Thomas  Bloor  and  Meriel  Bloor  [1]  present  a 

Page 75: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

72 Phan Van Hoa, Tran Huu Phuc, Nguyen Thi Tu Trinh

short account to the analysis of English for those starting out with  functional  grammar.  Eggins  [2]  introduces  the principles  and  techniques  of  the  functional  approach  to language.  Martinez  [5]  examines  objectivity  in  research articles with SFL application and proposes objectivity in the presentation of the text. Fowler [3] figures out that functional grammar is a semantic system to analyze representations of reality  in  a  linguistic  text  and  create  the  same  experience through  various  lexico-grammatical  options  influenced  by different  mind  styles  or  authorial  ideology.  From  our viewpoint, it is impossible to cover all matters of functional grammar in their work and Halliday [4] leaves some unsolved problems of this field especially behavioural clauses. 

In Vietnamese, Cao Xuân Hao [7] releases his book “Sơ thao ngư phap chưc năng” and he makes a breakthrough of grammar  study  by  introducing  functional  grammar  into Vietnamese  in  1991.  He  presents  Systemic  Functional Grammar raised by Halliday M.A.K [4] and he tries his best to cover a wide range of issues and terminologies of functional grammar but later in his preface of third edition of this work in 2006 [8] he states that this work is a kind of "navigation" of a new trend, namely, functional grammar and he leaves many existing  gaps  in  analyzing  Vietnamese  in  the  light  of functional grammar for next generation researchers. 

Diêp  Quang  Ban  [6]  offers  a  functional  analysis  of Vietnamese  clauses  with  three  metafunctions  mapped  on the structure clause. Nevertheless, he states  that he tries  to keep  some  good  points  of  traditional  grammar  and combines  these  with  the  achievements  of  functional grammar  in  analyzing  Vietnamese  clauses.  There  is  not  a clear-cut  analysis  of  functional  grammar  whilst  our  study is  carried  out  with  a  complete  shift  from  traditional grammar  to  functional  grammar. 

Hoàng Văn Vân [9] considers ‘cú’ in Vietnamese as an equivalent  unit  ‘clause’  in  English  for  the  functional perspective.  From  this,  he  initiates  a  new  way  in  the comparison  between  English  and  Vietnamese  in  terms  of functional units  in  languages  but he does not offer a  close examination  of  behavioral  processes.  In  this  paper,  we focus  on  analyzing  behavioral  clauses,  especially  the patterns  of  smiling  processes  and  the  social  functions  of smiling in English and Vietnamese. Less attention has been paid to Behavioral processes than other processes due to its complexity  and  ambiguousness. 

2. Method

2.1. Data collection

For this paper, in sections 3.1, 3.3 and 3.4, the collected data are examined at clause level since functional analysis is concerned  with  the  aspect  of  grammar  which  confines  to clauses;  whilst  in  section  3.2,  we  discuss  and  interpret behavioral processes of smiling. Hence, the selected data are put in both at clause level and textual contexts. In addition, this  study  employs  verbs  as  the  core  of  the  clauses.  The selection  of  clauses  began  with  selecting  verbs  that  realize the smiling process in eight 19th and 20th century short stories and novels. The  list of  short  stories and novels used  in  the research can be found in the data sources. We have decided to carry out the research in stories and novels but not in other 

genres since stories and novels reflect the reality via the lens and  skillful  wording  of  talented  writers.  Therefore,  the participants, processes and circumstances which are paid to attention  in  this  research  are  in  a  wide  range  of  use.  In addition,  they  are  fruitful  land  of  character’s  behaviours. Therefore,  they are rich in examples of behavioural clauses and we can explore more human’s behaviour smiling via the verbal channel. Finally, based on our set criteria to determine behavioural  clauses  denoting  smiling,  we  thoroughly selected  and  obtained  a  list  of  two  hundred  behavioural clauses  from  English  and  Vietnamese  short  stories  and novels.  “Jane  Eyre”,  “Rainbow”,  “Women  in  love”  and “Ulysses”  are  the  four  English  novels  written  by  Charlotte Bronte, David Herbert Lawrence and James Joyce. In  their works,  the  characters  with  their  personal  experience  and behaviours are brilliantly described via the lively wording of the  talented  writers.  Besides,  the  three  great  novels  “Sống mon”,  “Dê  men  phiêu  lưu  ky”,  “Sô  đo”  and  a  short  story “Canh  đông  bât  tân”  are  thoroughly  selected  due  to  their popularity  and  wonderful  narrative  devices  denoting personal experience and behaviours. 

2.2. Data analysis

We analyzed and figured out the patterns in English and Vietnamese and categorize participants  and circumstances. Then  we  investigated  the  similar  and  distinctive characteristics  of  behavioural  processes  denoting  smiling. Finally,  we  interpreted  the  findings  in  terms  of  instinct behaviour  and  social  behaviour  of  smiling  processes  and drew out some conclusions. 

3. Results and Discussion

The  most  typical  behavioural  process  clause  pattern consists  of  a  core  participant,  process  and  circumstance: 

Behaver + Process: Behavioural + Circumstance

3.1. Participant-Behaver

“It is the nature of the participants involved in the processes that determines the different process types”  [4]. A typical clause realized by a behavioural process has only one  participant:  “Behaver”  (Beh.). 

(1) 

She is smiling at me with these coral lips

Behaver Pro:

behavioural Circumstance

Circumstance: Manner

    [1A] 

(2) 

I smiled at Bessie’s frank answer

Behaver Pro: behavioural Circumstance

  [1A] 

(1) and (2) are behavioural processes; “smiling” is often used as an example of the behavioural process and “she” is interpreted  as  “Behaver”.  The  entity  displaying  the behaviour encoded  in behavioural process clauses above  is labeled “Behaver”. There  is only one participant occurring in  behavioural  process  clauses.  For  example: 

(3) He (Beh.) smiled faintly.  [4A]] 

(4) Gerald (Beh.) smiled grimly at  this humorism.  [4A] 

Page 76: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 73

(5) They (Beh.) both  laughed,  looking at each other. [4A] 

(6) He (Beh.)  laughed dangerously,  from  the blood.  [4A] 

Halliday  [4]  classifies  participants  into  simple participants  and  macro-participants: 

  Simple 

  Macro 

  Participants 

  Things 

  Quality 

(7) The two women (Beh.) were jeering at him.  [4A] 

It  is  clear  that  in  behavioural  clauses  with  process “smiling”,  “laughing”,  “jeering”  that  “Behaver” is  always endowed with a conscious being, namely things, not quality. Like in English, “Behaver” in Vietnamese behavioural clauses with the process “mỉm cười”or “cười” is acted by a person.

(8) Người đàn ông (Beh.) cười hề hề.  [6A] 

(9) Thịnh (Beh.) cười khanh khách.  [7A] 

(10)San (Beh.) cười phì một cái ra đằng mũi.  [5A] 

The “Behaver” introduced above is the one that smiles. For  example,  “Người đàn ông” in “Người đàn ông cười hề hề”. “Người đàn ông” is a human being, a conscious being. But  as  the  following  examples  illustrate,  a  part  of  body (face, eye) can be construed as conscious. 

(11) His eyes (Beh.) smiled on her, boldly.  [3A] 

(12) Buck Mulligan’s face (Beh.) smiled with delight. [2A] 

(13) M’Coy’s white face (Beh.) smiled about it at instants. [8A] 

(14)  The face of the Italian (Beh.)  flashed  with  a  non-comprehending  smile.  [2A] 

Aside from the role of a process, the process “smiling” can be nominalized and plays the role of a participant. This role is characterized as the process Range labeled “Behaviour”. 

(15) A little social smile (Behaviour) came on her face. [4A] 

(16)A soft smile (Behaviour) fitted over her grave face. [1A] 

(17) Attractive smile (Behaviour)  came  over  his  eyes  and brows.  [4A] 

(18)  The laugh (Behaviour)  was  repeated  in  its  low, syllabic tone, and terminated in an odd murmur.  [4A] 

(19)A slow mocking smile (Behaviour)  dawned  on Gudrun’s  face.  [4A]

(20)So many smiles (Behaviour)have  been  shed  into  Mr. Rochester’s  eyes  that  they  overflow  like  two  cups  filled above the brim  [1A] 

(21)A tolerant smile (Behaviour) curled his lips.  [2A] 

According  to  cognitive  perspective,  “Behaviour” above  is  commonly  called  “cognate  subject”  which  are derived  from  the  process  themselves  or  from  a  semantic unit  with  those  processes.  They  are  often  coupled  with  a delexicalized  verb  such  as come over, fit over, dawn, give, make… Such verbs have  lost  their  full  lexical content and become “dummies” in the context. While the kind of action “behaviour”  is  specified  by  the  noun,  as  a  participant function, the verb may be entirely general in meaning as in, have a smile on his/ her face. 

Below  is  an  example  of  the  smiling  process  which  is nominalized and  labelled as  a  behaviour  in Vietnamese. 

(22) Nụ cười đong đưa, tung tẩy trên khóe mắt.  [6A] 

3.2. Interpretation of behavioural processes denoting smiling

Behaviour is simply something you do in response to a situation.  It  can  be  determined  by  genetics,  the environment,  your  own  experience,  or  a  combination  of these  factors.  When  we  deal  with  smiling  processes,  two types  of  smiling  behaviours  are  explored:  instinct behaviour  and  social  behaviour.  How  do  you  react  when you are happy and  excited? You probably  smile or giggle. How do you react when you want to jeer at someone or let someone  or  something  down?  You  just  probably  mock  at him  or  it.  These  are  both  examples  of  the  smiling behaviour.  One  is  instinct  the  other  is  social.  All  these behaviours  are  coded  in  smiling  processes. 

(23) Xuân Tóc Đỏ lại cười hí hí như ngựa.  [8A] 

(24) To both of which questions the man grinned.  [4A] 

(25) Then she chuckled gleefully, and  turning to …  [4A] 

“Horse-laughing”, “grinning” and “chuckling”  are kinds  of  instinct  behaviours  when  you  are  full  of  joy  or excitement.  Naturally,  everyone  smiles  or  laughs  when they  are  cheerful  or  blissful.  In  this  case,  the  smiling behaviour  belongs  to  the  instinct  one.  However,  in  some cases,  it belongs  to  social behaviour as  follows: 

(26)  “You  utterly  misinterpret  my  words”,  I  said,  at  once seizing his hand: “I have no intention to grieve or pain you -  indeed,  I  have  not”.  Most bitterly he smiled - most decidedly he withdrew his hand from mine. [1A] 

(27)  Instead  of  speaking, I smiled.  [1A] 

In  (26)  “He”,  Mr.  Rochester  -  the  main  character  in Jane  Eyre,  the “Behaver” of  the  process  “smiling”  is  not happy  or  blessed  to  smile  in  this  case.  He  smiles  to  show his  terrible bitterness and disappointment when Miss. Eyre refuses  his  care  and  love.  Interestingly,  people  tend  to smile  to hide  their feelings when they are too disappointed and mentally or physically painful to speak out. In the light of  meanings  beyond  the  clause,  the  process  “smiling”  in (26) is completely different from the one in (27). “I”, Miss. Jane Eyre,  is smiling when Mr. Rochester urges her to  talk about  her  feelings,  thoughts  of  their  relationship.  In  this case,  she  smiles  when  she  has  no  answer  or  she  does  not want to reply. Occasionally when people want to express a mental  reaction  like  fear  or  anxiety,  they  smile.  Language is not only what people write and speak, but also the means by which this is done: the sounds spoken, the signs written or  read,  and  the  meanings  conveyed  by  them.  That  is meaning beyond the clause, which is clarified in functional grammar  raised  by  Halliday  [4].  Human  behaviours become  meaningful  only  in  the  context  of  social  life  and occur  as  language  and  through  language.  These  cases  are also found  in Vietnamese clauses denoting smiling as in: 

(28)  Chị cười mếu máo.  [6A] 

(29) Thằng Xuân cười tình, nháy một cái.  [8A] 

(30)  Tôi cười khểnh, nói lịch sự mỉa mai.  [7A] 

Page 77: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

74 Phan Van Hoa, Tran Huu Phuc, Nguyen Thi Tu Trinh

(31) Chúng  tôi nhắm mắt  lại cười vào mũi lão như thế  thì lão cáu lắm.                        [7A] 

In  fact,  it  is  impossible  to  have  a  clear  border  between instinct  behaviour  and  social  behaviour.  For  example,  as discussed above, smiling is neither 100% instinct nor 100% social.  Sometimes,  it  becomes  social  when  showing people’s sorrow, embarrassment, uncertainty, fear, surprise or  disappointment  and  so  on.  This  type  of  behaviour  may be called complex behavior. In this case, when we interpret complex  behaviour  expressions,  we  should  put  them  in certain  textual  contexts. 

Clearly,  human  behaviour  cannot  be  understood  if  we separate  language  and  social  practice.  Language  without social  practice  and  social  practice  without  language  are senseless.  From  this  perspective,  language,  as  an  essential component  of  social  practice,  reflects  our  experience. 

3.3. Circumstances

Halliday  [4]  classifies  circumstances  into  nine  types: Extent, Location, Manner, Cause, Contingency, Accompaniment, Role, Matter, Angle.  Circumstances  are very  significant  with  special  interpretations  wherever  they occur. Some circumstances just go with certain clauses. For example,  circumstances  of  Matter  are  fairly  popular  with mental,  verbal  and  behavioral  clauses  but  quite  rare  with the  other  process  types. 

After  we  thoroughly  investigate  and  analyze  the selected  data  based  on  Halliday  functional  grammar account,  three  certain  types  of  circumstance  are  found: Circumstance as Participant, Circumstance of Cause and Circumstance of Manner. 

3.3.1. Circumstance as participant

Let us take a look at the  following examples: 

(32)  The  two  sometimes  bestowed  a  courteous  word  or smile on me. (Circumstance: participant) [1A] 

(33)  He  smiled  at me  with  a  certain  smile  he  had  of  his own. (circumstance: participant) [1A]

(34)  I  smiled at him. (Circumstance: participant) [2A] 

To  Halliday  [4],  there  are  some  difficulties  in identifying  circumstantial  elements,  especially prepositional  phrases  functioning  as  circumstance.  The Behavioural  process  “smiling” usually  features  a prepositional phrase with on, at, with in (32), (33) and (34). In  the  above  examples,  Circumstances  are  prepositional phrases,  which  function  as  participants. 

(35) Nếu mỗi lần cha nhìn đăm đắm và mỉm cười với một người đàn bà mới chúng tôi lại thắt thẻo.  [6A] 

In  Vietnamese,  in  the  above  example  “với  một  người đàn  bà  mới”,  a  prepositional  phrase  is  also  labeled  as Participant  as  in English. 

3.3.2. Circumstance of cause

(36)  I  smiled  at the speaking likeness.  (Circumstance: Cause) [1A] 

(I was amused by the speaking likeness) 

(37) He  smiled at bronze’s teabathed lips. (Circumstance: Cause) [1A] 

(He  was  amused by bronze’s  teabathed  lips) 

In  (36)  and  (37),  the  prepositional  phrases  are  labeled as Circumstances of Cause  which construe  the reason  why the  process  is  actualized.  Particularly,  the  prepositions above are closely bonded  with verb “smile”. 

(38)  Tôi  bấm  bụng  nhịn cười thầy đồ Cóc  rồi  dùng  cái khoa giao thiệp hoa mỹ khôi hài đó đáp đùa lạ.  [7A] 

In the light of this analysis, the nominal group“thầy đồ Cóc” is  considered  as  Circumstance  of  Cause. 

3.3.3. Circumstance of manner

Halliday  [4]  figures  out  that  there  are  four subcategories  in  Manner,  namely  Means, Quality, Comparison and Degree. 

a. Quality

Quality is typically realized by an adverbial group, with a –ly adverb as Head. Phrasal  expressions of quality  in  the following  examples  modify  the  specifications  of  the manner  of  the  process  “smiling”  in  terms of speed, shape, tone, sound, etc. 

(39)  He  smiled,  uncomfortably, cynically. (Manner: Quality)  [3A]

(40)  Mr.  Bloom  smiled  joylessly on  Ringsend  road. (Manner: Quality) [2A]

She raised her small gloved fist, yawned ever so gently, tip tapping her small gloved fist on her opening mouth and smiled tinily, sweetly. (Manner: Quality) [2A] 

(41) He  smiles uneasily. (Manner: Quality) [2A] 

In  Vietnamese,  a  lot  of  adverbial  groups  served  as Circumstance: Quality are  found  in  this  study  since  they are  all-purpose  devices  which  help  writers  describe  their character’s  behaviour  efficiently.  Some  examples  are  as follows: 

(42) Phó Ðoan nhìn trộm nó mà mỉm cười toe toét.  [8A] 

(43) Anh cười nhạt. [7A] 

(44) Anh tôi cười khẩy.  [7A] 

(45) Lão ngoác mỏ ra cười khà khà rồi nói.  [7A] 

(46) Tôi giận lắm, nhưng chỉ cười thầm.  [7A] 

(47) Mấy đứa trẻ xem chọi dế cười ha hả.  [7A] 

As illustrated in the examples, Circumstance of Quality plays  a  crucial  role  in  demonstrating  the  different  types  of smiling  and  they  may  embody  the  interpersonal  metaphor that contains  the attitude of  the Behaver. 

b. Comparison

Comparison  is  typically  expressed  by  a  prepositional phrase with  like or unlike. For example: 

(48) He smiled like a weather man, like an ecstatic patron of recurrent light. (Manner: Quality) [1A]

In  Vietnamese,  circumstance  of  Comparison  is  always realized by the word “như” as  in the following example. 

(49) Bà Phó Đoan cười như trong rạp hát mà rằng: [8A] 

3.4. Troubleshooting

Material or behavioural processes

The  distinction  between  a  material  and  behavioural 

Page 78: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 75

process is sometimes vague and it is difficult to have a clear borderline. Let  us  consider  the  following  examples. 

(50) He is putting on a cheerful smile.  [4A] 

(51) She gave a wry smile.  [2A] 

If  we  analyze  these  two  examples  above  in  terms  of grammatical  labels  with  the core  element  of  process  “put” and “give”, they are material processes. When we examine them  in  terms  of  semantic  domain,  they  belong  to behavioural  processes.  Consider  the  two  pairs  of  clauses (50a) He is putting on a cheerful smile, (50b) He is smiling cheerfully and (51a) She gave a wry smile, (51b) She smiled wryly. These are synonymous  in terms of semantics but are completely different in the choice of participant and process. 

(50a) 

He  is  putting  on a cheerful smile. 

Actor Pro: material Circumstance: behaviour

(50b) 

He  is  smiling  cheerfully 

Behaver Pro: behavioural Circumstance: manner

(51a) 

She  gave  a wry smile. 

Actor Pro: material Participant

(51b) 

He  smiles  wryly 

Behaver Pro: behavioural Circumstance: manner

Halliday  [4]  states  that  “grammatical  and  semantic categories are not in one-to-one correspondence, then if we use  grammatical  terms  that  are  semantic  in  import,  we cannot expect  them to be appropriate for all  instances. The reason  is  quite  valid;  grammatical  labels  are  rarely appropriate for all instances of a category”. Likewise, some Vietnamese  clauses  are  either  material  or  behavioural  in terms of grammatical or semantic categories. For example, 

(52) Nương ôm bung bâu nở nụ cười. [6A] 

Actually,  the  verb  “nở”  itself  is  a  common  verb  in material  process,  but  in  the  expression  “nở nụ cười”, it contains the meaning of behaviour “smile” and it should be analyzed as a behavioural process. Here are some more examples. 

(53) Chúng tôi nhắm mắt, nhắm mũi lại lăn ra cười.  [7A] 

(54) Nói  tới chỗ này tôi mắc cười muốn chết.  [6A] 

4. Conclusion

Based on  the analysis  of  the  selected  data,  firstly,  it  is shown  that  the  typical  pattern  of  behavioural  processes denoting  smiling  is  Behaver + Behavioural process + Circumstance.  Besides,  Behaver  almost  functions  as participant  in  behavioural  clauses,  there  is  also  a  case  of nominalization  of  the  process  “smiling”  typically  labelled 

as  Behaviour.  Secondly,  when  we  deeply  interpret  the meaning of the process “smiling”, we find out that although the  process  “smiling”  belongs  to  behavioral  clauses,  there are  two different  kinds of  meanings  related  to  instinct  and social  behaviour.  The  former  is  inborn.  As  we  are  happy, satisfied  or  excited,  we  smile.  We  react  on  our  basic instincts.  But  the  latter  is  social.  We  cannot  simply interpret  human’s  behaviours  based  on  their  natural instincts  because  in  many  cases,  people  try  to  hide  their true  feelings  and  behaviours  via  common  behaviours.  To deal with them, we suggest interpreting human’s behaviour of  smiling  in  the  context  of  social  life.  That  is  what Halliday  states  in  his  work  [4].  Finally,  there  is troubleshooting  when  we  analyze  behavioural  clauses  that denote  smiling  meaning.  That  is  whether  it  is  material  or behavioural.  Once  again,  in  this  paper,  we  do  believe  that there  is  a  tight  and  mutual  relationship  between  human language and human behaviour. In other words, in real life, human  behaviour  is  coded  in  words  and  expressions  and these  words  and  expressions  are  clearly  interpreted  and encoded  based  on  Halliday’s  functional  grammar  account. 

REFERENCES

[1] Bloor, T. and Bloor, M. (1995). The Functional Analysis of English: A Hallidayan Approach. Edward Arnold. 

[2] Eggins,  S.  (1994).  An introduction into Systemic Functional Linguistics. London and New York: Continuum. 

[3] Fowler,  R.  (1996).  On Critical Linguistics1. Texts and Practices: Readings in Critical Discourse Analysis. London: Routledge. 

[4] Halliday  M.A.K.  (1994). An Introduction to Functional Grammar. Arnold, London. 

[5] Martinez,  I.  (2001).  Impersonality in the Research Article as Revealed by Analysis of the Transitivity Structure.  English  for Specific Purposes, 20(3), 227-247. 

[6] Diêp Quang Ban (2009). Ngư phap Tiêng Viêt. Nxb Giao duc Viêt Nam. 

[7] Cao Xuân  Hao  (1991). TiêngViêt – Sơ thao ngư phap chưc năng. Nxb KHXH. Ha Nôi. 

[8] Cao Xuân Hao  (2006). Tiêng Viêt – Sơ thao ngư phap chưc năng. Nxb KHXH. Ha Nôi. 

[9] Hoang Văn Vân  (2002). Ngư phap kinh nghiêm cua cu tiêng Viêt, mô ta theo quan điêm chưc năng hê thông. Nxb KHXH. Ha Nôi. 

DATA SOURCES

[1A] Bronte, C. (1847). Jane Eyre. Smith, Elder & Co. of London, England. 

[2A] Joyce, J. (1922). Ulysses. Dover publications, Inc. New York. 

[3A] Lawrance, D.H. (2004). The Rainbow. Collector’s Library, China. 

[4A]  Lawrance,  D.H.  (1920). Women in Love.  Dover  publications,  Inc. New York. 

[5A] Nam Cao (1956). Sống mòn. Literature Publishing House. Viet Nam. 

[6A]  Nguyễn  Ngọc  Tư  (2011).  Cánh đồng bất tận.  Youth  Publishing House. Viet Nam. 

[7A] Tô Hoài (1941). Dê men phiêu lưu ky. Kim Dong Publishing House. Viet Nam. 

[8A]  Vũ  Trọng  Phụng  (2014).  Tuyên tâp Vu Trong Phung, Tập 1, Literature Publishing House. Viet Nam. 

(The Board of Editors received the paper on 17/05/2016, its review was completed on 14/06/2016)

Page 79: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

76 Luu Quy Khuong, Vo Thi Hoang Ngan, Nguyen Ngoc Nhat Minh

A CRITICAL DISCOURSE ANALYSIS OF DISCURSIVE STRATEGIES USED IN ECONOMIC NEWS IN ECONOMIST.COM AND TUOITRE.VN

Luu Quy Khuong1, Vo Thi Hoang Ngan2, Nguyen Ngoc Nhat Minh1 1University of Foreign Language Studies, The University of Danang; [email protected] 

2American Academy English Center (AMA); [email protected]

 Abstract - Economic news we read everyday is probably our main source of economic knowledge.Thus, it has an important role in shaping our public knowledge, attitudes and behavior. Concerned with significance of critical comprehending of economic news, this research is conducted to investigate how writers in economist.com and tuoitre.vn address economic issues as well as discover similarities and differences of English and Vietnamese economic news. More importantly, the researcher aims at shedding light on implications of critical discourse analysis (CDA) for understanding and writing economic news. In this study, Van Dijk’s framework [4] is employed to detect 12 common discursive strategies used by journalists in 200 samples (100 samples in English and 100 samples in Vietnamese) collected from the two newspapers in English and Vietnamese: economist.com and tuoitre.vn. Findings show that discursive strategies are used differently in the two languages to address economic issues based on different ideologies of the writers.

Key words - critical discourse analysis; discursive strategy; economic news; ideology; journalism.

1. Introduction

Accompanying  the  rapid  advancement  of  science  and technology  in  the  21st  century  is  the  great  dependence  of positive and negative changes  in  the society on media.  It  is because news reports we read every day are probably the main source of political and social knowledge, belief and attitudes to the world. Thus, the media’s central role in moulding public knowledge,  attitudes,  and  behavior  justifies  the  increasing attention of discourse analysis practitioners to it. 

Very necessary  as  a  critical  discourse analysis of news discourse is, the application of critical discourse analysis in media  research  is  relatively  new.  According  to  Van  Dijk [3],  numerous  levels  of  description,  from  grammatical description  to  more  complex  properties  such  as  coherence relations  between  sentences,  topics,  schematic  forms  as well  as  rhetorical  dimensions  can  be  employed  to  analyze news discourse.  This  can be done  by  analyzing  the  use of discursive strategies used in English and Vietnamese news discourse,  which  is  also  the  ultimate  aim  of  this  research. This research is hoped to bring about some contributions to the  readers,  EFL  students  and  teachers  in  comprehending and writing economic news in the two newspapers. 

2. A brief review of the previous studies related to the research

Van Dijk [3] offered us a systematic analysis of news as discourse  and  myriad  of  examples  of  structure  analysis  of international news and domestic news. Fairclough and Wodak [1]  proposed  a  detailed  work  on  basic  tenets  and  8  basic principles  of  CDA.  Their  framework  focuses  on  three components:  textual analysis  including  Halliday’s  systemic functional linguistics,  discourse practices  and  social practices. Sana, Hafiz, Maria, Zikra and Huma [2] carried out a research on the choice of lexical items representing different 

ideologies and concluded that the representation of news is the display of writers’ ideologies in a hidden way through lexical items  to  manipulate  ideas  in  such  a  way  to  make  up  the readers’  minds.  Zhang  [5]  brought  up  an  exploration  of linguistic  features,  news  production  and  social  contexts  of political  news  reports  based  on  Fairclough’s  three dimensional  framework and Halliday’s  functional grammar. Zhang  [5]  strengthened  the  view  that  language  in  the  news report  are never bias-free and branded by  social values and different  ideology,  that  is,  with  the  same  event,  different writers from different points of view which are determined by their  own  values  and  perspectives  make  an  effort  to  guide readers’ opinion towards the writer’s interest. 

3. Some theoretical concepts

3.1. Critical discourse analysis

There  has  been  much  research  on  CDA  for  decades, however, Van Dijk’s research [18] offered the most unified and  systematic  critical  analysis  of  discursive  strategies  in news  with  abundance  of  illustrative  examples.  According to  Van  Dijk  [4,  p353],  CDA  is  “a type of discourse analytical research that primarily studies the way social power abuse, dominance, and inequality are enacted, reproduced, and resisted by text and talk in the social and political context.” CDA differs itself from other disciplines of  discourse  analysis  in  the  way  that  it  explores  the relationship  between  language  and  society. 

According  to  critical  discourse  analysts,  the  use  of language  is  considered  as  a  form  of  social  practice.  All social  practices  are  inseparable  to  specific  historical contexts  and  situational  contexts;  all  social  practices  are employed  to  reproduce  and  enact  social  relations.  That  is why  discourse  is  influenced  by  social  structures  and reproduced  in  social  interaction.  Conforming  to  these requirements,  the  main  tenets  of  CDA  are  suggested  by Van Dijk [12] as follows: 

1.  CDA  addresses  social  problems. 

2.  Power  relations  are discursive. 

3.  Discourse  constitutes  society  and  culture. 

4.  Discourse  does  ideological  work. 

5.  Discourse  is  historical. 

6. The link between text and society is mediated. 

7.  Discourse  analysis  is  interpretative  and  explanatory. 

8. Discourse is a form of social action. 

3.2. Ideology

Ideologies are the fundamental beliefs of a group and its members, that is, it is defined as “a systems of ideas which 

Page 80: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 77

are  socio-cognitively  defined  as  shared  representations  of social  groups  and  more  specifically  as  the  ‘axiomatic’ principles of such representations” [4, p115]. 

3.3. Discursive strategies (DSs)

The  word  ‘discursive’  means  relating  to  discourse  or modes of discourse. The word ‘strategy’ can be understood as  conscious  and  strategic  discourse  choice  adapted  to specific  situation  and  individuals. 

According  to  Van  Dijk  [18],  discursive  strategies,  in terms  of  critical  discourse  analysis,  are  linguistic  moves language  users  use  to  influence  or  control  readers’  minds. Discursive strategies are represented in news in the way that different,  possibly  opposed  opinions,  beliefs,  interests  of different ideologically conflicted groups are hidden beneath ideological  representations  of  social  events.  Such representations are often spelled along “Us” versus “Them” dimension, in which speaker of one group has a tendency to illustrate  them  and  their  group  in  positive  terms  and  other groups  in  negative  terms. Given  these content of  ideology, Van Dijk [4] tried to incorporate such underlying ideologies to  expressions  in  discourse,  to  be  specific,  to  DSs  in  his ‘ideological square’ theory. The ‘ideological square’ theory covers a very general strategy of most ideological discourse: 

- Say positive things about “Us” 

- Say negative things about “Them” 

Because  of  the  scope  limit,  the  researcher  only examines  12  discursive  strategies  among  40  discursive strategies  in  Van Dijk’s  framework  [18].  After conducting a  research on  frequency of  40  strategies  mentioned  in  100 economic  news  (50  Vietnamese  economic  news  and  50 English  economic  news),  the  researcher  chooses  twelve mostly  used  strategies  [18]  for  investigation. 

-  Authority:  language  users  can  employ  a  discursive move  of  authority  in  which  they  mention  or  quote authorities  to support  their argument. Authorities  here may include  organizations  or  people  who  are  generally recognized  as  experts,  leaders,  the  government,  scholars, the media,  the church or the court, etc. 

-  Categorization:  groups  tend  to  be  distinguished  and categorized  so  that  the  writer  can  attribute  positive  or negative  characteristics  to  them  and  distance  in-group  and out-group  members. 

-  Contrast:  this  is  a  prevalent  strategy  which emphasizes Our good things and Their bad things in which ideologies  are  represented  in  polarized  terms  in  order  to differentiate  in-group  and  out-group  membership. 

-  Empathy:  the  use  of  empathy  can  have  an  important role in managing positive impression of the readers towards the writer, which contributes to the credit that the writer has, and to the reliability of the argument of the writers. 

-  Explanation:  the  negative  actions  of  in-group members  tend  to  be  explained  away,  whereas  negative actions  of  out-group  members  tend  to  be  explained  as  an inherent property of the whole group. 

- Fallacy: fallacy is identified when in an argument, the relations between premises and a conclusion may be faulty or  conjectural  without  solid  evidence. 

-  Generalization:  language  users  may  choose  to generalize  or  make  the  claims  broader  and  more  generally applicable  to  illustrate  their  ideology. 

-  Implication:  News  discourse  writer  will  leave  much information  implicit,  either  because  it  is  a  common knowledge  known  in  the  readers’  culture  or  because  it  is the  information  inconsistent  with  their  positive  self-image and the writer does not want to present  it openly. 

-  Lexicalization:  a  major  discursive  strategy  (DS)  of ideological  analysis.  To  refer  to  the  same  person,  same group or social issues and event, language users can have a variety  of  word  choices,  depending  on  discourse  genre, personal context  (opinions, standpoint, perspective,…) and social  context  (in-group  membership,  out-group membership,  dominance  relation)  and  socio-cultural context  (norms,  values). 

-  Norm  expressions:  The  writer  may  want  to  use  norm-statements about what ‘we’ and ‘they’ should or should not do. 

-  Number  game:  Numbers  and  statistics  are  the  major means to emphasize objectivity which represents the factual information against subjective opinion and comment. So one of  the  best  move  to  objectivity  is  to  use  numbers  and statistics to make them credible for the argument. 

-  Presupposition:  most  of  the  meaning  of  the  text  is presupposed  to  be  known  by  the  readers.  Presupposition may represent  the truth values which are taken  for granted or  unchallenged. 

3.4. News

News is information about events or happenings which is reported by newspapers, radio, or television. News’ purpose is to inform readers of what is happening in the world around them.  Common  topics  for  news  include  war,  politics  and business, athletic contests, quirky or unusual events, etc. 

News must be factual, which means that news must be based on actual occurrences, situations, thoughts and ideas. News  must  be  accurate,  balanced,  concise  and  clear. 

The  samples  are  collected  in  two  reputable  and  reliable newspapers: economist.com and tuoitre.vn. economist.com is a reputable English weekly newspaper owned by the Economist Group and edited in offices in London. tuoitre.vn is one of the most read online newspaper of Vietnam. It is the official organ of Vietnam’s Youth Community. Because of their equivalent popularity and credibility in the two countries, economist.com and tuoite.vn are opted for investigation in the research. 

4. Research Procedure

In order to conduct the research, the following steps are taken.  Firstly,  to determine  the  length  of  the  samples,  500 news  in English  and Vietnamese  are  investigated  in  terms of number of words.  As a  result,  samples  which have 900 to 1000 words are chosen for investigation because of their popularity  in  the  total  news  investigated.After the  average length of news is set, news about specific economic events or  happenings  reported  in  the  two  online  newspapers  are collected and  two economic  news about  the same event  in English  and  Vietnamese  are  paired  to  be  compared.  After collecting the data, 100 news in English and 100 articles in Vietnamese  are  put  into  investigation.  The  researcher 

Page 81: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

78 Luu Quy Khuong, Vo Thi Hoang Ngan, Nguyen Ngoc Nhat Minh

detects,  describes  and  analyzes  discursive  strategies  used and  the  way  journalists  represent  different  ideologies  by using discursive strategies. Finally,  the  research  results  are compared  and  contrasted  to  point  out  the  similarities  and differences between the two languages. The researcher also thus  suggests  some  implications  for  news  readers  and teaching and  learning English as a foreign  language. 

5. Analysis of DSs in English Economic News (EENs) and Vietnamese Economic News (VENs)

5.1. DS of authority

The  strategy  of  authority  is  a  common  move  used. However, in ENs, this  strategy is used in a canny way. 

(1)  The most influential, by Peter Petri, Michael Plummer and Fan Zhai, for the ENst-West Centre, a research institute, forecasts that the deal would raise the GDP of the 12 signatories by $285 billion, or 0.9%, by 2025 [7]. 

In example (1),  the strategic use of authority brings out the credibility of  the opinions  stated  in  the news by  citing opinions  of  a  person  whose  job  is  closely  related  to  the field, in particular, a banker, who does calculate and predict the  rise  and  fallacy  of  the  economy  and  who  is  under  the direct influence of bobbing of  figures and quotes. 

The  strategy  of authority can also  work  toward  overall negative  characterization  of Others.

(2) “Nếu người ta thật sự tin rằng cá nuôi cần phải được kiểm tra nhiều hơn thì tại sao không phải tất cả các loại cá nuôi?”  - ông Matt Fass, chủ tịch Công ty Các sản phẩm biển quốc tế, một nhà phân phối ở Virginia, nói với AP.Lý do thật  sự, theoông Fass,  là  tiền bạc” [11]. 

There is a conflict of interest between the Vietnamese writer and the American writer on this matter so in order to convince readers that the Vietnamese writer’s argument is authentic and logical, he/she quotes supportive statements from the director of a  big  American  company  related  to  the  field  concerned  –  a marine product company. This strategy kills two birds with one stone.  Taking  an  opinion  from  an  authoritative  figure  in America to support Vietnam is a judicious move, on one hand, to prove that Vietnam’s actions are of no illegality, even from the perspective of an authority in America, on the other hand, to demonstrate the internal division in America, to show that not all citizens or authorities in America agree with the decision to impose dumping suit on Vietnam. 

5.2. DS of categorization

The  DS  of  categorization  is  exercised  in  the  news  to distance  “Us” and “Them”. 

(3) Some Asians are blaming the West [9]. 

The  DS  of categorization “Asians”  and  “the  West”  is used  to  pronounce  the  disparity  of  Asian  countries  and Western countries, further accentuates  the wrongdoing that Asians blame on Westerns. 

(4)  AP  cho  biết  các  nhà  nuôi  cá  Mỹ  đang  ráo  riết  vận động hành lang để lại có một đạo luật mới: họ muốn những con cá nhập khẩu từ VN lại được gọi là… cá da trơn, và do đó sẽ bị đặt  dưới một  chế độ  kiểm tra  mới mà  họ đã  thúc đẩy thông qua Quốc hội Mỹ năm 2008 [11]. 

The  DS  of  categorization  is  exercised  in  the  news  to 

distance Vietnamese  exporters and Vietnam’s  catfish  from American  farmers  and  America’s  catfish.  In  specific,  the phrase  “các nhà nuôi cá Mỹ”  is  adopted  to  address American  farmers  and  American  authorities,  while  an inclusive noun “Việt Nam” is used, on one hand, to include the whole Vietnamese people and authorities to the writer’s side, on  the other hand,  to assert  that “tra” and  “basa”  fish are  the  specials  of  Vietnam  and  Vietnam  produces  the incomparable catfish in  terms of quality. 

5.3. DS of contrast

The  contrast  between  “Us”  and  “Them”  can  also  be subtly  expressed  by  description  of  an  event  or  a  process. For example, in the following example, the writer describes the  process  to  launch  a  product  in  China  and  a  Western software  firm. 

(5) Whereas a Western software firm  typically releases an early  “beta” version of a product only  to a  select group of  guinea-pigs,  Chinese  firms  are  more  likely  to  launch theirs straight  into the  market  [8]. 

The  software  firm  in  the  West  conforms  to  standard process  of  launching  a  product,  while  Chinese  firms  are depicted as  conversing  the process  for  sake of profits. 

(6)  Phố  Main  là  tên  phố  thông  thường  ở  các  thị  trấn trung lưu tại Mỹ, đối ngược với Phố Wall giàu có [13]. 

Here,  the contrast between Main Street and Wall Street is  drawn  to  assert  the  polarization  between  middle  class and bankers  and businessmen  representing Wall  Street. 

5.4. DS of empathy

In discourse about economics, strategy of empathy may be  largely  strategic and  is  intended  to manage  the writer’s impression  with  the  readers.  However,  there  is  no  DS  of empathy  used  in  EENs.  Let  us  explore  an  example  of empathy used  in  VENs. 

(7) “Thần mưa không nghe  lời cầu khẩn của chúng  tôi và ông Thủ tướng Modi cũng giả điếc trước lời cầu xin giúp đỡ  của  chúng  tôi.  Tôi  đang  nợ  nần  ngập  đầu”  -  ông Tarachand Mathur nói trong nước mắt, tay chỉ ra cánh đồng trồng lúa mì thất bát của mình [14]. 

Here,  the writer uses a  tragic story of a  farmer  in  India to  evoke  pity  in  the  readers,  which  helps  to  prove  his/her argument  that  Indian  government  should  not  deprive farmers of their  lands. 

5.5. DS of explanation

The  strategy  of explanation  is  exploited  in  a  way  that negative acts of out-group members are explained  in detail or  positive  act  of  in-group  members  are  ignored  or explained away, as shown in the examples below: 

(8)Instead,  most  economists  use  what  is  known  as computable  general  equilibrium  (CGE)  analysis... Researchers line things up so that the model yields the same output as a real benchmark year. Once that is achieved, they “shock”  the  model,  adjusting  trade  barriers  to  see  how outcomes shift, both immediately and over time. [7] 

Specifically, in example (8), the assets of CGE, a method which  the  writer  advocates  are  deciphered  meticulously. Meanwhile,  in  example  (9)  below,  the  deficiency  of  the 

Page 82: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 79

view: bailing out working class Americans or bailing out no one can help American economy is pointed out. 

(9) Nhưng  thời  thế đã  thay đổi.  Nhiều người  trẻ  ở Mỹ than thở nền kinh tế ì ạch đang giết chết “giấc mơ Mỹ”, ... Họ than phiền dù học hành và làm việc chăm chỉ đến mấy cũng  không  tiết  kiệm  đủ  tiền  để  mua  nhà,  học  đại  học, hưởng các dịch vụ y tế... Điều đó hoàn toàn trái ngược với những gì chúng tôi được dạy từ nhỏ: “Là một người Mỹ có nghĩa là có quyền tiếp cận với sự thịnh vượng” [13]. 

With  a  detailed  explanation  of  how  hard  it  is  for American  people  to  realize  their  American  dream  in  the present,  the  writer  expresses  his/her  underlying  ideology: there is a big gap between notion of American dream and a harsh reality of economic downturn.

5.6. DS of fallacy

Fallacy is one of the very effective DS used in expressing ideologically  different  opinions  and  in  the  articles,  it  is employed cleverly. Have a look at these examples: 

(10) Many will not have jobs to go back to [9]. 

Without  any  solid  scientific  evidence,  the  writers represents  his/her  own  formulation,  prediction  based  on his/her  knowledge  and  asserts  it  as  it  is  true  to  make  the readers believe  in  what he/she stated. 

(11)  Nếu  điều  đó  xảy  ra,  họ  sẽ  đánh  mất  “định  mức  tín nhiệm” cả đời và sẽ rất khó có thể vay tiền mua nhà ở Mỹ [13]. 

Here,  the  writer  states  his/her  argument  and  prediction about difficulties  that American people have to face to buy a  house  for  themselves  and  made  the  readers  believe  in what  he/she  believes. 

5.7. DS of generalization

The  strategy  of  generalization  is  intended  to  manage opinions and  impression  of  the  scale  and  popularity of  the subject. This strategy can be exploited to give the impression about large scale of the subject as in the example: 

(12)  China's  breakneck  growth  has  stalled.  The  rest  of East  Asia,  too,...  has  found  itself  hit  as  hard  as anywhere in the world and in some cases harder [8]. 

The lexical choice “anywhere” is used to make readers believe  that  the  whole  globe,  not  China  only  has  to  suffer from  a  halt  in  economic  upheaval.  This  type  of  strategy  is meant to include all other countries in the world in economic subsidence,  to  shift  the  attention  of  the  readers  away  from China’s failure and diminish that failure off China. 

(13)  Cuộc  gặp  đó  cho  thấy  các  nước  BRICS  vẫn  chưa chung  một  bầu  trời  với  nhau  cho  lắm,  mỗi  nước đều giữ những góc  trời  riêng  [16]. 

In  example  (13),  a  concrete  event  or  action  is generalized, which makes  the claim broader and applicable to every one or almost everyone at least. This happens with the quantifier for noun “đều” to include all countries to the actions  concerned. 

5.8. DS of implication

The strategy of implication is proved effective in hinting the bad sides of “Them” or good sides of “Us” which can be interpreted in one or many ways, depending the context. 

(14)  This  orthodoxy  rests  on  three  propositions:  that CEO  pay  just  keeps  on  going  up;  that  it  is  not  tied  to performance;  and  that  boards  are  not  doing  their  job  of holding fat cats’ paws to the  fire [10]. 

Interesting  to  the  analysis,  the  job  of  holding  fat  cats’ paws to the fire is considered a very intrigue and dangerous one,  which  leads  to  the  interpretation  of  the  sentence  as follows:  the  pay  of  CEO  always  increases,  although  their performance  is  not  boosting  nor  they  are  doing  anything threatening  or  complicated. 

(15)  Cuộc  gặp  đó  cho  thấy  các  nước  BRICS  vẫn  chưa chung  một  bầu  trời  với  nhau  cho  lắm,  mỗi  nước  đều  giữ những góc  trời  riêng  [16]. 

Here,  the  strategy  of  implication  is  observed  in  the phrase “chung một bầu trời” and “giữ những góc trời riêng” which  can  be  understood  that  members  of  BRICs  do  not put  their  alliance ahead of  their  own benefits:  they  do not see  eye  to  eye  in  many  issues  and  are  not  willing  to compromise  for  the best of  their alliance. 

5.9. DS of lexicalization

As regards the analysis of lexicalization of the news, the choice of words can be effective in representing ideologically controlled opinions of the writers. For example, 

(16)  This  week,  however,  as  they  feasted  to  the deafening rattle of the firecrackers lit to greet the Year of the Ox,  their celebrations  had an anxious tinge. [9] 

The opinion represented is very explicit through the means of lexicalization, as is most obvious in the choice of “feasted” instead  of  “celebrate”,  “tinge”  instead  of  “feeling”,  along with  the  lexical  choice  of  “rattle”,  “firecrackers”  and “greet”,  all  of  which create  sound  effect of  festival. So  the writer’s opinion that Chinese celebrates a well-off festival is made clear through a clever use of lexicalization. 

(17) “Cơn điên ngày thứ sáu đen tối” [15] 

The  opinion  represented  is  very  explicit  through  the means of lexicalization, as is most obvious in the choice of “đen  tối”  instead  of  “đen”  in  the  translation  of  “Black Friday”  into Vietnamese “Thứ sáu đen  tối”. While  “black” in  “Black  Friday”  originally  indicates  benefits,  and  “Black Friday” means moving from the red (indicating losses) to the black  (indicating  profits),  the  phrase  can  be  translated  as “Thứ sáu đen”,  the writer intentionally mistranslate “black” into “đen tối”, an explicit forms of derogation term. 

5.10. DS of norm expressions

Economic news relates much of advice or comment on what is best for one economy or the whole world economy. As a result, strategy of norm expressions is one of the most important  strategies  to  suggest  measures  and  solutions  to economic problems. In the following examples, the writers used  norm expressions  to  recommend  to  save  Asia’s countries  from  smash  by  developing  internal  economic strength  and  detaching  themselves  from  dependence  of export  in  the  first example, and  in  the  second example  the writer  gave  advice  on  authorities  to  boost  development  of agriculture. 

(18) To get onto a  sustainable  long-term growth path  -and  to  help  pull  the  rest  of  the  world  out  of  recession  - 

Page 83: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

80 Luu Quy Khuong, Vo Thi Hoang Ngan, Nguyen Ngoc Nhat Minh

Asia's  economies  need  to  become  less  dependent  on exports in other ways [9]. 

(19) Tiếp theo đó, các đảng phái này phải phối hợp nhau để cải thiện cuộc sống của người dân nông thôn [14]. 

5.11. DS of number game

Number game  is  a  powerful  tool  in  ideological management.  It  is  even  more  powerful  in  economic  news where statistics  is the most  influential way to conceive and analyze  economic  development  or  evaluate  an  economic event or phenomenon. This strategy  is used many times in the news  to  articulate  the quantity, comparison,  contrast as shown respectively in  the examples below. 

(20)  China’s  lunar  new  year  sees  the  world's  largest migration,  as tens of millions of workers flock home.[9] 

(21) Thực tế, khoảng 1/2 người Mỹ ở nhà thuê phải chi hơn 30% tổng  thu nhập cho việc  thuê nhà,  tăng kỷ  lục 12 điểm % cơ bản so với cách đây 10 năm.[13] 

5.12. DS of presupposition

The  use  of  presupposition  can  be  most  effectively exploited when it is used in line with characterization of Us and  Them  regarding  good  points  and  bad  points respectively.  The  writer’s  ideological  stand  is  represented by the use of the word “even” as follows: 

(22) Even  in  China,  exports  are  spluttering,  down  by 2.8% in December compared with  the previous  year  [9]. 

Here,  the  lexical  item  “even” bears  a presupposition  that China’s  export  was  strong  and  is  supposed  to  remain  strong during the economic slump. However, the economic downturn is so devastating that it can make China’s export fall. 

Another  lexical  item  which  can  bear  a presupposition is “tiếp tục”. 

(23) Báo cáo tháng 6 năm nay của Goldman Sachs ghi nhận: “Những năm gần đây, các nước BRICS đã tiếp tục vươn lên mạnh mẽ trên bảng xếp hạng quy mô các nền kinh tế [16]. 

The use of “tiếp tục” suggests  that members of BRICs did climb to a higher position in economic ladder once and then they were making a consistent effort to gain economic achievement  in  recent  years. 

Statistics  in  the tables below summarize the occurrence and percentage of twelve DSs examined in EENs and VENs. 

Table 1. A Summary of DSs Used in EENs

DSs in EENs Occurrence %

Lexicalization 1842  50.49 

Number game 703  19.27 

Implication 342  9.38 

Presupposition 284  7.79 

Authority 252  6.91 

Categorization 148  4.06 

Explanation 76  2.08 

Fallacy 57  1.56 

Generalization 134  3.67 

Norm expressions 32  0.88 

Contrast 29  0.79 

Empathy 0  0.00 

Total 3648  100.00 

Table 2. A Summary of DSs Used in VENs

DSs in VENs Occurrence %

Number game 850  23.3 

Lexicalization 709  19.4 

Authority 578  15.8 

Implication 129  3.5 

Presupposition 126  3.5 

Generalization 34  0.9 

Explanation 32  0.9 

Empathy 17  0.5 

Norm expressions 14  0.4 

Categorization 13  0.4 

Fallacy 8  0.2 

Contrast 4  0.1 

Total 2514  68.9 

6. Findings

To  put  statistics  for  DSs  used  in  economist.com  and tuoitre.vn in comparison and contrast, the researcher draws out  some  following  similarities  and  differences  between English  and  Vietnamese. 

6.1. Similarities

The first similarity is that the strategies of number game, authority,  lexicalization,  implication,  presupposition are considered most effective and  important  in economic news in both languages, as evident in its popularity among the DSs concerned. The reason is understandable: 

Firstly, economics is a field which is based on statistics and  figures  to  generalize  the  situations  and  make predictions,  that  is  why  the  strategy  of  number game dominates  economic  news. 

Secondly,  different  from  other  field,  in  economics, there  are  a  variety  of  ideas  and  predictions  regarding economic  issues,  that  is,  each  person  can  interpret economic  statistics  in  a different  way,  whether  positive  or negative.  As  a  result,  it  is  not  as  persuasive  for  journalists to  make  their  own  arguments  as  to  quote  specialists’, authorities’,  government’s  and  experts’  opinions.  That  is why DS of authority is  favored in economic news. 

Thirdly,  much  as  dry  and  rigid  economic  news  may have  been,  DSs  of  lexicalization,  implication, presupposition add  flavor  to  economic  news,  making  the news  more  interesting  and  impressive. 

6.2. Differences

In  general,  that  English  writers  employ  more  DSs  than Vietnamese ones is proved by the fact that occurrence of all DSs in economist.com is 1.5 times higher than that in tuoitre.vn. 

Moreover,  occurrence  of  each  DS  varies  when comparing  between English  and  Vietnamese. 

In  particular,  albeit  DS  of  authority  occupies  a  large proportion in both English and Vietnamese economic news, its occurrence in Vietnamese economic news is twofold that in  English  economic  news.  It  can  be  said  that  the  role  of government,  authorities  or  experts  is  more  emphasized  in Vietnamese economic news than in English ones. This reflects the respect for authority of Vietnamese people, in specific, the 

Page 84: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 81

Vietnamese  are  supposed  to  take  a  very  limited  role  in experiencing,  assessing  or  taking  initiatives  in dealing  with economic issues, hence, opinions, guidelines and predictions about economic issues are mostly led by the government or experts.  In  contrast,  in  English  economic  news,  the government or experts play a less prominent role in guiding the public’s opinions and actions and the writer or readers are supposed to be more engaged, more critical and initiative in understanding and dealing with economic issues. 

Secondly,  high  in  occurrence  in  both  languages  as implication  and  presupposition  are,  the  two  DSs  in  English economic news are used much more times than in Vietnamese economic news. This difference can be explained in  terms of ideological positioning. To make it clear, the disparity between English  and  Vietnamese  economic  news  in  the  use  of implication  and  presupposition  represents  the  link  between comprehensibility of  economic  news and education or  social position  of  speakers  that  the  newspapers  target.  The economist.com  is  the  newspaper  which  offers  authoritative insight and penetrating opinion on economic news, meanwhile, tuoitre.vn normally provides readers with informative account or description of economic events and issues in the world. In line with that function, economist.com caters a version of news with much of implication and presupposition, whereas writers in  tuoitre.vn may be consciously aiming  to make  their report simplified,  thus  making  their  news  palatable  to  common readers, not just the elite. 

Thirdly, the DS of explanation also accounts for a higher proportion  in  English  economic  news  than  in  Vietnamese ones. With focus on analyzing and giving insightful opinions on  an  issue,  writers  in  economist.com  have  a  tendency  to give many detailed explanations of the news. 

Fourthly,  the  DS  of  generalization  ranks  6th among  all DSs used in Vietnamese economic news, while it takes the 9th  position  in  English  economic  news,  which  can  be concluded  that  Vietnamese  writers  tend  to  use  more  of generalization strategy than English writers. The difference can  be  explained  that  Vietnamese  are  collectivists,  who usually  have  a  tendency  to  assign  individual  attributes  to the whole  group. 

Another  difference  worth  mentioning  is  that  the occurrence of use of categorization in English news is nearly 11 times as many as  that  in Vietnamese news, namely 148 times and 13 times respectively. It may be that the journalists in English economic news show no fear of conflict, as would be expected  in an English news source. English  journalists are considered as more openly critical  in  their outlook and analysis of an economic event, so they incline to categorize themselves  and  other  countries  that  do  no  good  for  their country  more  often  than  Vietnamese  journalists.  In contradiction  to  English  journalists,  Vietnamese  journalists seem  to  try  to  go  great  lengths  to  avoid  sharp  contrast between  “Us”  and  “Them”  and  to  be  neutral  in  some economic issues, especially international economic issues. 

This  explanation  can  be  applied  to  clarify  why Vietnamese  journalists  have  a  trend  to  use  more empathy and  fewer contrast strategies  than English ones. Both  later strategies are used to emphasize the strong position or more affirmative  and  candid  opinions  of  the  writers,  thus 

employed more by English journalists. The distinction can be  seen  in  the  more  use  of  empathy  by  Vietnamese journalists, which can bring out  their neutral  tone. 

One  noteworthy  discrepancy  is  that  in  VENs,  strategy of empathy appears 14  times  in  the corpus of  the  research, however,  there  is  no  strategy  of  empathy  used  in  EENs. This can be  interpreted by  the  fact  that English  journalists in  economist.com  try  to  be  objective  in  their  account  and analysis  of  economic  events,  that  is,  not  to  take  sides  or give  any  empathetic  comment  on  the  events.  However, Vietnamese  are  collectivists  who  have  tendency  to  show sympathetic  expressions  towards  others’  mishap. 

Last  but  not  least,  fallacy  and  norm expressions  are other  domains  in  which  ideological  stances  may  be expressed.  It  is  proved  that  more  powerful  arguers  may manage  the  opinion  of  the  readers  by  making  self-serving arguments  more  prominent  and  affirmative.  Because  of economic  and  military  strength  of  America,  its  media’s voice  is  more  influential  than  that  of  Vietnam,  thus American  journalists  are  more  vigorous  arguers.  That  fact can shed  light on how English  journalists employ more of fallacy and norm expressions than Vietnamese ones. 

7. Conclusion

The data analysis  reveals  that  language and  ideology  is mutually  determined.  In  detail,  the  language  used  by journalists  in  specific  and  the  language  in  news  discourse in general  is biased and  the  journalists  report an economic events or  issues  in  accordance  with  their own  interest  and ideologies.  Therefore,  they  use  DSs  to  represent  their  own ideologies  and  opinions.  Moreover,  the  use  of  DSs  in English and Vietnamese bears  some similarities as well as differences.  The  research  brings  about  practical implications  for  readers,  students  as  well  as  teachers. Firstly,  the  research  helps  to  raise  readers’  critical awareness  of  news  discourse  as  well  as  achieve  a  better understanding  of  what  they  read  in  economic  news. Secondly,  it  helps  learners  to  be  aware of biased  nature of news discourse to conduct a selective acquisition of foreign thoughts,  beliefs  and  ideologies.  Therefore,  learners  can decide  which  set  of  thoughts,  beliefs  and  ideologies  is worth  adopting  and  transmitting  and  which  one  is  not suitable  to  their  own  culture,  thus  resisting  the  imposition of  foreign  ideologies  on  them.  Last  but  not  least,  teachers can  introduce  DSs  or  other  parts  of  this  framework  to students  so  that  students  can  learn  how  to  analyze  a discourse  critically.  Furthermore,  the  findings  of  the  study can be beneficial to teachers in a way that they can be more aware  of  the  discourse  they  use  as  a  material  in  class  to avoid  using  negative  embedded-ideology  materials. 

REFERENCES

[1] Fairclough,  N.  L.,  &  Wodak,  R.  (1997),  “Critical  Discourse Analysis, in Van Dijk T.A”, Discourse Studies: A Multidisciplinary Introduction, 258-284. 

[2] Sana,  N.,  Hafiz,  B.  A.,  Maria,  K.,  Zikra,  F.,  &  Huma,  N.  (2013), “Media  Discourse  and  Their  Implicit  Idelogies”, Asian Journal of Social Sciences & Humanities, 328-337. 

[3] Van  Dijk,  T.  (1988),  News Analysis.  New  Jersey:  Lawrence Arlbaum Associates. 

Page 85: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

82 Luu Quy Khuong, Vo Thi Hoang Ngan, Nguyen Ngoc Nhat Minh

[4] Van  Dijk,  T.  (2003),  Ideology and discourse: A Multidisciplinary Introduction, Barcelona: Ariel. 

[5] Zhang, M, (2014), “A Critical Discourse Analysis of Political News Reports”, Theory and Practice in Language Studies, 2237 - 2277. 

[6] Bail-outs and safety nets. (2015, August 12). Retrieved October 10, 2015, from http://www.economist.com/blogs/democracyinamerica/2013/08/libertarian-populism 

[7] A  weighting  game.  (2015,  May  30).  Retrieved  October  10,  2015, from  http://www.economist.com/cge15 

[8] The China wave. (2014, September 11). Retrieved October 10, 2015, from http://www.economist.com/news/business/21616974-chinese-management-ideas-are-beginning-get-attention-they-deserve-china-wave 

[9] Asia's  suffering.  (2009,  January  29).  Retrieved  October  10,  2015, from  http://www.economist.com/node/13022085 

[10] Bargain bosses. (2012, December 06). Retrieved October 10, 2015, from  http://www.economist.com/node/21562189 

[11] Cá  tra  lại  bị  xử  ép  ở  Mỹ.  (2009,  July  12).  Retrieved  October  10, 

2015,  from  http://tuoitre.vn/tin/kinh-te/20090702/ca-tra-lai-bi-xu-ep-o-my/324463.html 

[12] 5  điều  khiến  người  Mỹ  luôn  cảm  thấy  nghèo.  (2014,  May  12). Retrieved  October  10,  2015,  from  http://tuoitre.vn/tin/kinh-te/20140512/5-dieu-khien-nguoi-my-luon-cam-thay-ngheo/606345.html 

[13] "Giấc mơ  Mỹ"  tan  vỡ.  (2011,  October  17).  Retrieved October  10, 2015,  from  http://tuoitre.vn/tin/the-gioi/20111017/giac-mo-my-tan-vo/460801.html 

[14] Chính phủ Ấn Độ nhượng bộ nông dân. (2015, April 26). Retrieved October  10,  2015,  from  http://tuoitre.vn/tin/the-gioi/20150426/chinh-phu-an-do-nhuong-bo-nong-dan/738884.html 

[15] Cơn điên "thứ sáu đen tối" ở Mỹ. (2011, November 27). Retrieved October  10,  2015,  from  http://tuoitre.vn/tin/the-gioi/cau-chuyen-cuoi-tuan/20111127/con-dien-thu-sau-den-toi-o-my/466891.html 

[16] BRICS:  Từ  ước  mơ  đến hiện  thực.  (2011,  October  01).  Retrieved October 10, 2015, from BRICS: Từ ước mơ đến hiện thực 

(The Board of Editors received the paper on 05/11/2015, its review was completed on 06/03/2016)

Page 86: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 83

ENHANCING INTERCULTURAL SENSITIVITY AND PROBLEM-SOLVING SKILLS OF LANGUAGE LEARNERS VIA CRITICAL INCIDENTS IN

CROSS-CULTURAL COMMUNICATION: A CONSTRUCTIVIST APPROACH

Ho Si Thang Kiet

University of Foreign Language Studies, The University of Danang; [email protected]

 Abstract - This paper describes an action research study which uses critical incidents in a cross-cultural communication course at a university in Vietnamto enhance intercultural sensitivity and problem-solving skills of English learners with a constructivist approach to language learning. The findings show that by actively engaging in the critical incidents the students were able to enhance their intercultural sensitivity about the ways in which different expectations, values, beliefs and behaviours can affect communication across cultures. They were also empowered with a variety of problem-solving skills to deal with cross-cultural misunderstandings in the incidents. The learners also positively evaluated the use of critical incidents as an effective way of cross-cultural learning. The study is expected to be used as a reference for implementing a critical incident-based pedagogy in cross-cultural communication courses.

Key words - intercultural sensitivity; problem-solving skills; critical incidents; cross-cultural communication; constructivist.

1. Introduction

In  the  globalization  trend,  our  world  has  become  a ‘global village’ where intercultural contacts between people from different cultural backgrounds are part of everyday life for  many  people.  The  possibilities  for  intercultural communication  have  become  greater  than  ever  and  their benefits are visible in the foreign language classroom (Vogt, 2006).  A  misunderstanding  can  easily  occur  in  a  cross-cultural  encounter  when  people  do  not  understand  each other’s  cultural  values  and  beliefs.  Intercultural  sensitivity has become an important goal of foreign language teaching and learning in response to the need for language learners to function  effectively  in  an  increasingly  multicultural  world. This  study  investigates  how  language  learners  understand cross-cultural  communication  problems  in  a  target community  and  how  they  develop  intercultural  sensitivity and  problem-solving  skills  to  solve  misunderstandings  in cross-cultural communication dilemmas. 

2. Theoretical background

2.1. Critical incident and its value

A  critical  incident  is  a  narrative  that  illustrates  a misunderstanding  between  two  or  more  people  from different  cultural  backgrounds.  Educators  have  used critical  incidents  as  a  method  for  developing  learning  in  a range  of  professional  disciplines  such  as  nursing, education, and social work. In the fields of intercultural and cross-cultural  communication,  it  is a  standard  training  tool (Cushner  and  Brislin,  1996).  Apedaile  and  Schill  (2008) define  critical  incidents  in  intercultural  communication training  as  “brief  descriptions  of  situations  in  which  a misunderstanding, problem, or conflict arises as a  result of the  cultural  differences  of  the  interacting  parties,  or  a problem  of  cross-cultural  adaptation  and  communication” (p.7).  In  this  study,  the  students’  critical  incidents  refer  to 

cross-cultural dilemmas  in  which misunderstandings occur due  to different  cultural  values and beliefs of participants. 

Critical  incidents  can  contribute  to  the  development  of students’  personal  learning  and  growth.  Cope  and  Watts (2000)  claim  that  “critical  incidents…accelerated  [the] process  of  learning  and  growing  self-awareness,  and therefore  often  proved  to  be  seminal  moments  within  this process  of  change  (p.113).  Tripp  (1993)  argues  that “critical incidents should question the way things normally operate”  (p.28).  This  can  make  learners  think  how  the participants  act  or  behave  in  such  a  way  and  critically analyze  the  hidden  cross-cultural  misunderstandings  that occur  in  cross-cultural  communication.  The  opportunity given  to  students  to  think  critically  and  analytically  about a  cross-cultural  dilemma  promotes  their  intercultural sensitivity  and  fosters  their  motivation  for  learning  about culture-based  behaviour  in  intercultural  communication. 

2.2. Intercultural sensitivity

Hammer,  Bennett  and  Wiseman  (2003)  distinguish between  “intercultural  sensitivity”  and  “intercultural competence”.  According  to  them,  the  term  ‘‘intercultural sensitivity’’  refers  to  “the  ability  to  discriminate  and experience  relevant  cultural  differences”,  while “intercultural  competence”  is  “the  ability  to  think  and  act in  interculturally  appropriate  ways”  (p.422).  In  this  study, intercultural  sensitivity  refers  to  the  students’  ability  to demonstrate  their  awareness  of  cultural  differences  that cause  misunderstandings  in  the  critical  incidents.  Hammer et  al.  (2003)  argue  that  greater  intercultural  sensitivity  is associated  with  greater  potential  for  exercising intercultural  competence.  Intercultural  sensitivity  is, therefore, essential for language learners to acquire in order to  become  interculturally  competent. 

Intercultural  sensitivity  is  a  developmental  process. Bennett  (1993)  proposes  the  Developmental  Model  of Intercultural  Sensitivity  (DMIS)  over  a  continuum  from Denial, Defense and Minimization (ethnocentric stages),  to Acceptance,  Adaptation  and  Integration  (ethnorelative stages).  The  model  assumes  that  a  person  develops  his  or her  competence  in  intercultural  relations  as  the  experience of  cultural  differences  becomes  more  complex  (Vogt, 2006). However, the DMIS gets critics from some scholars. Scarino  (2009)  argues  that  the  linear  progression  of  the model  does  not  accord  with  the  complexity  of  the development  of  intercultural  sensitivity;  while  Liddicoat, Papademetre,  Scarino,  and  Kohler  (2003)  claim  that  the model  assumes  that  language  learners  have  no  prior exposure  to  issues  of  intercultural  communication.  Once learners have acquired intercultural sensitivity, they will be 

Page 87: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

84 Ho Si Thang Kiet

able  to avoid stereotypes and make cultural generalizations to deal with  intercultural  incidents. 

2.3. Stereotypes and generalizations

According  to  Levine  and  Adelman  (1993),  stereotypes are exaggerated beliefs  and  images  about groups of people which are often based on a  lack of  information or contact, while  generalizations are  general beliefs  and  images about groups  of  people  which  are  based  on  some  common sources  of  information.  In  this  study,  stereotypes  refer  to false beliefs about people of the target culture in the critical incidents,  while  cultural  generalizations  refer  to  general beliefs  about  the  target  culture  that  the  students  need  to gain  for  accurate  judgment. 

To  become  interculturally  competent,  language learners  need  to  use  cultural  generalizations  to  predict  the outcomes  and  participants’  behaviours  in  the  critical incident.  Cultural  generalizations  can  prevent  them  from falling into cultural stereotypes which usually create a false impression,  inaccurate  observations  and  reinforce  their cultural  biases.  Apedaile  and  Schill  (2008)  argue  that cultural  generalizations  can  provide  clues  to  better understand  people’s  behaviours  and  actions. 

3. Methodology

Traditionally,  learners  are  provided  with  a  critical incident  that  has  a  number  of  explanations.  They  are encouraged  to  select  the  one  that  best  explains  the misunderstanding  and  mark  their  answers  with  "the  best choice",  "satisfactory",  "less  than  satisfactory",  or  "the worst  choice"  (Cushner  and Brislin,  1996). However,  such a  way  to  deal  with  critical  incidents  may  have  some negative points as in real life situations there might be more than one explanation  that can  be considered appropriate or correct.  In  addition,  learners  rely  too  much  on  the  given options  for  explanations  rather  than  developing  their  own critical  thinking  for  problem-solving  skills.  To  avoid  this drawback,  this  study  adopts  a  constructivist  approach  to language learning, which is “a theory about knowledge and learning…  [that]  defines  knowledge  as  temporary, developmental,  socially  and  culturally  mediated..." (Brooks  &  Brooks,  1993,  p  vii).  The  central  principles  of this  approach  are  that  “learning  involves  an active  process in  which  learners  construct  meaning  by  linking  new  ideas with  their  existing  knowledge."  (Naylor  &  Keogh,  1999, p.93). Applying this concept of the constructivist approach, the participants in this study actively construct meaning by connecting  their  own  ideas  with  their  existing  knowledge of  cross-cultural  communication  in  the  course  in  dealing with  cross-cultural problems  in  the critical  incidents. 

To  deal  with  the  issues  above,  the  study  is  aimed  at answering  the  following  research  questions: 

(1) How do the language learners enhance intercultural sensitivity and problem-solving skills through critical incidents?

(2) How do the language learners evaluate the benefits of critical incidents in cross-cultural communication?

One  hundred  and  twenty  third-year  students  of  the English major at a university in Vietnam participated in the 

study.  These  students  were  chosen  as  they  were  studying the  cross-cultural  communication  course  which  the  author was  teaching.  As  this  study  was  a  kind  of  action  research on  the  author’s  own  teaching,  the  participants  were  not representatives  for  the  whole  population.  The  research instruments for data collection include the critical incidents (CI)  created  by  students’  groups,  classroom  observations and  evaluation  questionnaire.  The  criteria  for  selecting  the samples  of  the  students’  critical  incidents  are  that  they  all reflect  the  topics  and  the  key  content  of  the  course including cross-cultural contacts, cross-cultural adjustment process,  verbal  and  non-verbal  communication,  friendship and  acquaintances,  family  types,  educational  values, stereotypes  and  ethnocentric  judgments  in  cross-cultural communication.  The  samples  focus  on  American  culture and the students’native culture, for the course mainly deals with  American  culture  in  cross-cultural  communication. The samples of critical  incidents  include  the  following: 

CI#1:  Stereotypes  about  black  people 

CI#2:  Cross-cultural  contact  with  Americans 

CI#3:  Adjustment  process  in  the  American  society 

CI#4:  Communication  styles  between  American  and Vietnamese  cultures 

CI#5:  Ethnocentric  judgments  about  American  foods 

CI#6:  Non-verbal  communication  between  American and  Vietnamese  cultures 

CI#7:  Socializing  with  American  friends 

CI#8:  American  and  Vietnamese  perceptions  of friendship 

CI#  9:  American  and  Vietnamese  parenting  styles 

CI#10:  American  culture  of  learning 

Classroom  observations  were  made  by  the  author  to record  the students’ solutions to  the critical  incidents. Two groups  of  learners  worked  face-to-face  in  the  classroom; one  group  presented  their  critical  incident,  the  other  group discussed  together  to  work  out  the  cross-cultural misunderstandings  in  the  incident  and  came  up  with appropriate  solutions  to  the  cross-cultural  problems.  The students engaged in What, Why and How questions to work out  the  cross-cultural  misunderstanding  in  each  incident based  on  the  cross-cultural  values  of  the  selected  samples (CI#1-CI#10): 

• How did  the cross-cultural misunderstanding occur in the  incident? 

• Why did the participants in the incident act/behave the way they did? 

•  What  cultural  values  appear  to  be  important  in  the participants’  actions? 

•  What  should  have  been  done  to  avoid  the  cross-cultural  misunderstanding? 

After the students finished their presentations of critical incidents,  they  were  all  asked  to  complete  a  short evaluation  questionnaire  which  was  used  to  examine  how the  students  evaluated  the  use  of  critical  incidents  in  the course.  The  questionnaire  consisted  of  ten  statements  for evaluation  on  a  five-point  Likert  scale  (1=strongly 

Page 88: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 85

disagree;  2=disagree;  3=neither  agree  nor  disagree; 4=agree;  5=strongly  agree)  (Table  1).The  statements  were constructed  on  the  values  of  critical  incidents  in  cross-cultural  communication as described  in  section 2. 

Table 1. Students’ evaluation questionnaire

No. Statementsfor evaluation Rating scale

1. I found critical incidents an effective way of learning about other cultures in cross-cultural communication. 

1 2 3 4 5 

2. I was able to minimize cultural shock in dealing with other cultures. 

1 2 3 4 5 

3. I was able to use cultural generalizations to predict the outcomes and participants’ behaviours. 

1 2 3 4 5 

4. I was able to cultivate attitudes of curiosity, openness, appreciation and empathy towards other cultures. 

1 2 3 4 5 

5.  I was able to develop my problem-solving skills.  1 2 3 4 5 

6.  I was able to enhance my intercultural sensitivity.  1 2 3 4 5 

7. I was able to mediate between cultures to find the most appropriate way for both cultures. 

1 2 3 4 5 

8. I was able to successfully cope with the new intercultural  environment. 

1 2 3 4 5 

9.  I was able to develop my critical thinking skills.  1 2 3 4 5 

10.  I was motivated a lot to learn about other cultures.  1 2 3 4 5 

For data  analysis,  the study deals  with both qualitative and  quantitative  approaches  due  to  the  nature  of  the research. The  qualitative approach  was used  to  find  outthe emerging  themes  of  the  students’  problem-solving strategies  as  solutions  tothe  critical  incidents,  while  their strategy use was also quantified  to  illustrate which strategy was  used  the  most.  In  addition,  the  quantitative  approach with  one  sample  t-test  was  also  applied  in  the  analysis  of the  students’  evaluation  questionnaire  for  the  comparison of  the means. 

4. Findings and discussion

4.1. Learners’ demonstration of intercultural sensitivity and problem-solving skills

From  the  analysis  of  the  students’  solutions  to  the critical  incidents,  nine  themes  have  emerged  as  problem-solving  strategies  with  a  total  of  twenty-three  uses  as shown in Table 2. The total of uses refers to the number of strategy  use  by  the  groups  of  students  when  they  offered solutions  to  the critical  incidents. 

Table 2. Problem-solving strategies in students’ critical incidents

No. Problem-solving strategies Total of

uses Percentage

S1 Consulting people of the target culture for advice 

1  4.3% 

S2 Making inquiries about unfamiliar situations in the target culture with native speakers 

1  4.3% 

S3 Using cultural values of the target culture to explain the incident 

6  26.1% 

S4 Using cultural values of one’s home culture to explain the incident 

4  17.4% 

S5 Suggesting different ways to tackle the incident 

1  4.3% 

S6 Mediating between the two cultures to reach a cross-cultural perspective 

5  21.8% 

S7 Raising awareness of cultural differences to minimize cultural shocks 

3  13.2% 

S8 Avoiding ethnocentric judgments to deal with the incident. 

1  4.3% 

S9 Avoiding stereotypes to deal with the incident. 

1  4.3% 

Total  23  100% 

(Note: S=Problem-solving strategies) 

As  can  be  seen  from  Table  2,  using  cultural  values  of the  target  culture  to  explain  the  incident  (S3)  is  the  most important problem-solving  strategy which accounts  for  the highest  percentage  (26.1%), while  using cultural  values of one’s  home  culture  to  explain  the  incident  (S4)  is  in  the third position with 17.4%. It is important for participants in a cross-cultural  encounter  to contrast  cultural values of  the target  culture  with  one’s  home  culture  so  that  they  can avoid  the  wrong  assumption  about  the  other  culture.  For example,  in  the  CI#2,  privacy  and  equality  are  the  two important  cultural  values  in  the  American  society,  while the  concept  of  these  two  values  is  quite  different  in  the Vietnamese  culture.  For  Americans,  the  emphasis  on privacy  exists  as  individuals  feel  their  needs  must  be respected.  The  American  tendency  is  to  minimize  status differences  rather than  to emphasize  them, while  there is a hierarchy  between  the  boss  and  the  subordinates  at  the workplace  in  Vietnamese  culture.  Similarly,  in  the  CI#8, the  concept  of  friendship  for  American  people  is  very different  for  Vietnamese  people  in  that  American  people tend  not  to  have  a  deep  friendship  with  someone  unless they  feel  they  are  committed  to  it.  In  the  CI#4,  while  the American business people actively engaged in the business meeting,  their Vietnamese partners  tended  to  wait  for  their turn. This indicates that American people have a preference for  the  “high  involvement”  communication  style  whereas Vietnamese  people  are  in  favour  of  the  “high considerateness”  pattern.  In  the  CI#6,  American  people should not misinterpret the Vietnamese lack of eye contact as a lack of attention or interest because such behaviour can mean  respect  and  deference  in  a  hierarchical  culture. Contrasting  cultural  values  of  the  target  culture  with  the ones  of  their  home  culture,  the  students  were  able  to develop awareness of cultural differences  in order to better understand  the  participants’ behaviours  in  the  incident. 

The  second  important  problem-solving  strategy  is  to mediate  between  the  two  cultures  to  reach  a  cross-cultural perspective  (S6),  which  accounts  for  21.8%.  This  strategy is  crucial  for  language  learners  to  become  interculturally competent.  For  example,  the  CI#9  refers  to  different parenting  styles  between  an  American  father  and  a Vietnamese mother in a cross-cultural family. The students mediated  between  the  American  culture  and  the Vietnamese  culture  to  adopt  a  cross-cultural  perspective that is appropriate for both cultures. For instance, the cross-cultural  parents  should  encourage  their  children  to  be independent  by  themselves  even  from  an  early  age although  they  can  still  take  some  care  of  their  children. They  should not  forbid  their  children  to  leave  home at  18 years  old,  but  spend  time  on  sharing  their  experiences about  life  with  their  children  and  give  support  to  them 

Page 89: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

86 Ho Si Thang Kiet

whenever  they  need.  Such a  cross-cultural  perspective  can reconcile  cultural  differences  between  the  two  cultures  so that  the  cross-cultural  family  can  avoid  conflicts  in parenting and  feel happy  together. 

Raising  awareness  of  cultural  differences  to  minimize cultural  shocks  (S7)  is  the  fourth  important  problem-solving  strategy  with  13.2%.  The  CI#10  shows  that  an awareness  of  independent  study  and  plagiarism  in American  universities  could  prevent  the  Vietnamese student  from  getting  shocked.  Especially,  this  strategy  is essential for an individual’s adjustment to a new culture. In the  CI#3,  the  Vietnamese  girl  (Huong)  and  the  Japanese girl  (Harumi)  went  through  the  same  stages  from  the honeymoon period  to culture shocks and  initial adjustment when  they  first  arrived  in  the  USA.  However,  while Harumi  fell  into  depression  and  then  decided  to  return  to Japan,  Huong  was  able  to  skip  the  depression  stage  and moved  directly  to  the  final  stage  of  acceptance.  By acquiring  language  and  cultural  knowledge  of  the  target culture as well as intercultural sensitivity with great effort, Huong  successfully  integrated  into  the  target  culture.  This confirms  that  Bennett  (1993)’s  DMIS  over  a  linear progression is not realistic. A person’s adjustment to a new culture can be different  for different people as  it depends a lot on their intercultural sensitivity and ability to cope with changes  in  their  life,  which  can  make  their  adjustment process  in  the  target culture shorter or  longer. 

The  students  also  used  some  other  problem-solving strategies with equal  frequent use (4.3%). For  instance,  for the CI#8 the students suggested different ways to tackle the incident  (S5)  via  facebook,  email  or  phone  calls  to  get  in touch  with  the  American  friend  who  seemed  to  ignore  his two friends. In the CI#5, Minh had difficulty adjusting to the American  society  because  of  his  ethnocentric  judgments about  the  American  foods  with  which  he  could  not accurately interpret the cultural values and behaviour of his American homestay  friend except  through his own cultural perspectives.  Avoiding  ethnocentric  judgments  (S8)  is, therefore,  a  good  strategy  to  solve  cross-cultural misunderstandings.  Similarly,  the  CI#1  shows  that stereotypes  can  be  dangerous  as  they  are  formed  with exaggeration  and  lack  of  information  or  contact  about  the target people. The stereotype that black people are dishonest people  is  completely  wrong.  Avoiding  stereotypes  (S9) definitely  can  help  solve  the  false  assumptions  that  the American  couple  had  for  the  black  boy  in  the  incident. Consulting  people  of  the  target  culture  for  advice  (S1)  or making  inquiries  about  unfamiliar  situations  in  the  target culture with native speakers (S2) can also be good strategies to use. For the CI#7, such strategies can help the Vietnamese girl avoid embarrassment when her American  friend asked about the bill and the shop where she had bought the gift. 

In short, the students used a variety of strategies to find out  solutions  to  cross-cultural  misunderstandings  that occurred  in  the  incidents.  Among  them,  an  understanding of  cultural  values  of  the  target  culture  and  one’s  home culture, and  the ability  to mediate between cultures are the most  important  strategies  to  deal  with  the  cross-cultural problems  in  the  incidents. 

4.2. Learners’ evaluation of critical incidents

Apart  from  the  students’  participation  in  solving  the cross-cultural  misunderstandings  in  the  critical  incidents, they  also  positively  evaluated  the  use  of  this  technique  in the course  (Table 3). 

The results in Table 3 show that the majority of students agreed  that  critical  incidents  can  help  them  enhance  their intercultural  sensitivity  with  the  highest  mean  (M=4.43, SD=.589,  t=26.489, p<0.05),  followed closely by problem-solving  skills  (M=4.41,  SD=.494,  t=31.256,  p<0.05).  This shows  that  the  students’  awareness  of  cultural  differences between  cultures  enabled  them  to  adopt  problem-solving skills  to  deal  with  the  cross-cultural  misunderstandings  in the  incidents.  The  students  were  also  able  to  use  cultural generalizations,  rather  than  stereotypes,  to  predict  the participants’  behaviours  (M=4.18,  SD=.496,  t=25.929, p<0.05)  so  that  they  could  understand  what  caused  the misunderstanding  in  the  incident.  The  students  found critical  incidents  an  effective  way  of  learning  about  other cultures  in  cross-cultural  communication  (M=4.38, SD=.522,  t=29.056, p<0.05) and  this  technique made  them feel  more  motivated  in  cross-cultural  learning  (M=4.08, SD=.656,  t=18.098,  p<0.05). 

Moreover,  the  students  were  also  able  to  cultivate positive  attitudes  towards  other  cultures  as  they  became more open, sympathetic and appreciative of cultural values in  other  cultures  (M=4.23,  SD=.498,  t=27.151,  p<0.05). Such positive attitudes  were essential  for  them to decentre from  their  own  culture  and  mediate  between  cultures  to find appropriate ways for both cultures (M=4.20, SD=.422, t=31.144,  p<0.05).  This  is  the  evidence  of  the  students’ acquisition  of  intercultural  competence  through  critical incidents.  Being  interculturally  competent,  the  students were  able  to  cope  with  the  new  intercultural  environment successfully  (M=3.88,  SD=.700,  t=13.817,  p<0.05). Finally,  through  critical  incidents,  the  students  were  also able  to  develop  critical  thinking  skills  (M=3.86,  SD=.598, t=15.717, p<0.05) and minimize cultural shock to deal with other  cultures  (M=3.80,  SD  =.616,  t=14.220,  p<0.05). 

Table 3. Learners’ evaluation of critical incidents

Learners’ evaluation N M S.D. t p*

1. I was able to enhance my intercultural  sensitivity. 

120  4.43  .589  26.489  .000 

2. I was able to develop my problem-solving skills. 

120  4.41  .494  31.256  .000 

3. I found critical incidents an effective way of learning about other cultures in cross-cultural communication. 

120  4.38  .522  29.056  .000 

4. I was able to cultivate attitudes of curiosity, openness, appreciation and empathy towards other cultures. 

120  4.23  .498  27.151  .000 

5. I was able to mediate between cultures to find the most appropriate way for both cultures. 

120  4.20  .422  31.144  .000 

6. I was able to use cultural generalizations to predict the outcomes and participants’ behaviours. 

120  4.18  .496  25.929  .000 

7. I was motivated a lot to learn about other cultures. 

120  4.08  .656  18.098  .000 

8. I was able to successfully cope with  120  3.88  .700  13.817  .000 

Page 90: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 87

the new intercultural environment. 

9. I was able to develop my critical thinking  skills. 

120  3.86  .598  15.717  .000 

10. I was able to minimize cultural shock in dealing with other cultures. 

120  3.80  .616  14.220  .000 

*  Significant  at  p  <0.05  (N=number  of  participants,  M=Mean, SD=Standard deviation, t=one sample t-test value, p= probability value). 

In  short,  the  students  positively  evaluated  the  use  of critical  incidents  in  the  cross-cultural  communication course  thanks  to  the  benefits  they  gained.  They  believed critical  incidentis  an  effective  way  of  cross-cultural learning  which  helped  them  enhance  their  intercultural sensitivity,  develop  their  problem-solving  skills,  adopt positive  attitudes  and  acquire  the  ability  to  mediate between  cultures  to  successfully  cope  with  intercultural encounters. 

5. Conclusions

The  study  has  provided  positive  findings  which  show that  by  actively  engaging  in  the  critical  incidents  the students were empowered with a variety of problem-solving strategies  to  deal  with  cross-cultural  misunderstandings  in the  cross-cultural  dilemmas.  The  students  positively evaluated  the  use  of  critical  incidents  in  the  course  as  an effective way of  cross-cultural  learning which helped  them enhance  intercultural  sensitivity  and problem-solving  skills to  successfully  cope  with  the  new  intercultural environment.  Adopting  the  constructivist  approach  to language  learning,  the  study  shows  that  the  students developed  a  realistic  sense  of  challenges  to  meet  cultural conflicts  and  tensions  in  cross-cultural  communication dilemmas.  The  nature  of  the  cross-cultural  communication study  enabled  them  to  see  cross-cultural  situations  from different  perspectives,  cultivate  attitudes  of  curiosity, openness, appreciation and empathy towards other cultures, and  develop  intercultural  sensitivity  of  different  cultural values that have an impact on people’s behaviours in cross-cultural  communication.  The  study  offered  the  students valuable  opportunities  to  engage  in  the  target  culture 

through critical incidents at a deeper level while connecting classroom learning to situations that potentially occur in the global  community.  With  intercultural  sensitivity  and problem-solving  skills  acquired  from  critical  incidents, language  learners  are  able  to  become  interculturally competent  to  successfully  deal  with  cross-cultural encounters in reality. With such an outcome of  the study, a critical  incident-based  pedagogy  can  be  beneficial  for language learners in a cross-cultural communication course. 

REFERENCES

[1] Apedaile, S. and Schill, L. (2008). Critical incidents for intercultural communication:  An  interactive  tool  for  developing  awareness, knowledge and skills. NorQuest College. 

[2] Bennett,  M.  J.  (1993).  Towards  ethnorelativism:  A  developmental model  of  intercultural  sensitivity.  In  R. M.  Paige  (Ed.), Education for  intercultural  experience  (2nd)  (pp.  21-72).  Yarmouth,  ME: Intercultural Press. 

[3] Brooks,  J.  and  Brooks,  M.  (1993).  The  case  for  the  constructivist classrooms. Alexandria, VA: ASCD. 

[4] Cope, J. and Watts, G. (2000). Learning by doing. An exploration of experience,  critical  incidents  and  reflection  in  entrepreneurial learning.  International  Journal  of  Entrepreneurial  Behaviour  and Research, 6(3), 104–124. 

[5] Cushner,  K.  and  Brislin,  R.  (1996).  Intercultural  interactions:  A practical guide. London: Sage. 

[6] Levine, D.R. and Adelman, M.B. (1993). Beyond language: Cross-cultural communication. USA: Prentice Hall Regents. 

[7] Liddicoat,  A.  J.,  Papademetre,  L.,  Scarino,  A.,  and  Kohler,  M. (2003). Report  on  intercultural  language  learning. Canberra,  ACT: Commonwealth of Australia. 

[8] Hammer, M. R., Bennett, M. J., and Wiseman, R. (2003). Measuring intercultural  sensitivity:  The  intercultural  development  inventory. International Journal of Intercultural Relations, 27, 421-443. 

[9] Naylor, S. and Keogh, B. (1999). Constructivism in classroom: Theory into practice. Journal of Science Teacher Education, 10, 93-106. 

[10] Scarino,  A.  (2009).  Assessing  intercultural  capacity  in  learning languages:  Some  issues  and  considerations.  Language  Teaching, 42(1), 67-80. 

[11] Tripp,  D.  (1993)  Critical  incidents  in  teaching:  Developing professional judgement. London: Routledge. 

[12] Vogt, K. (2006). Can you measure attitudinal factors in intercultural communication?  Tracing  the  development  of  attitudes  in  e-mail projects. ReCALL, 18(2), 153-173.

(The Board of Editors received the paper on 01/03/2016, its review was completed on 27/04/2016)

Page 91: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

88 Pham Thi Thanh Ly

HUMOR STRATEGIES IN ENGLISH AND VIETNAMESE SITCOMS FROM PRAGMATIC PERSPECTIVES

Pham Thi Thanh Ly

FPT University; [email protected]

 Abstract - This study aims to explore how English and Vietnamese sitcom characters violate Grice's Cooperative Principle [2] as humor strategies in their daily conversation to create humor. In the light of Grice’s Cooperative Principle, the conversational maxims violated as humor strategies in English and Vietnamese sitcoms are figured out to help EFL learners improve their English competence. Under the investigation into 300 samples from 26 English and Vietnamese sitcoms, we find out 12 groups. The analysis where the descriptive method has been used combined with the qualitative and quantitative approaches is carried out to find out similarities and differences of humor strategies in English and Vietnamese sitcoms.

Key words - pragmatics; humor; humor strategies; sitcoms; cooperative principle; languages.

1. Introduction

Sitcom, the blending of situation and comedy, has been more and more popular among people all over the world. It is also a good audio-visual resource for EFL learners. Humor in it has, however set up a  lot of obstacles  for non-English native  audiences  in  understanding  the  humor  in  English sitcoms. It is worthwhile to study humor mechanism to help the audience have a better understanding and appreciation of humor  in  such  TV  series  and  meanwhile  to  help  EFL learners  improve  their  English  competence  as  well.  This being  the  case,  the  research  attempts  to  study on  the  inner mechanism of humor within the framework of the theoretical perspective - Grice’s Cooperative Principle and make some tentative explorations in this direction. 

In  order  to  achieve  the  above  aims  and  objectives,  the following research questions  are put  forward: 

1.  What  maxims  of  conversation  are  violated  to  create humor  in English and Vietnamese  sitcoms? 

2.  What  kinds  of  humor  strategies  resulting  from Grice’s  Conversational  Maxim  Violation  are  used  in English  and Vietnamese  sitcoms? 

3.  What  are  the  similarities  and  differences  in  humor strategies  resulting  from  Grice’s  Conversational  Maxim Violation  in English and Vietnamese  sitcoms? 

In this research, 450 episodes from 26 ESs and VSs (ESs and VSs in abbreviation for English sitcoms and Vietnamese sitcoms) are collected, 150 samples in English and the same number in Vietnamese are picked out for analysis. 

One  main  feature  of  sitcoms  is  canned  laughter. Therefore,  for  objectiveness,  judging  whether  a  line  of sitcoms  is  funny  or  not  is  based  on  the  occurrence  of canned  laughter  in  the  characters’  conversations. 

For data  analysis,  three following  steps  are carried out: examining  which  conversational  maxim  is  violated,  under each  maxim,  determining  which  humor  strategy  is  used, comparing  and  contrasting  to  find  out  the  similarities  and differences between  the  two  languages. 

2. Humor strategies resulting from violated maxims

Four  maxims  of  Grice’s  Cooperative  Principle  [2],  i.e. Quality,  Quantity,  Relation  and  Manner  are  used  to examine  how  the  characters  violate  the  principle  to  evoke the audience’s  laughter. We also  find out  humor  strategies which  result  from  Grice’s  Cooperative  Principle  Violation and put  them  into  suitable maxims. This  study  is outlined to  give  a  look  at  frequency  of  humor  strategies  classified into  maxims  at  first  and  then  to  analyze  the  humor strategies one by one in individual maxim. 

2.1. Maxim of Quality

2.1.1. Irony

Irony  refers  to  the  strategy  that  the  speaker  expresses something  that  is  completely  different  from  the  literal meaning in order to make fun of or tease someone else. 

(2.1) Ms. Novak: I have a painting, a sculpture and a photograph that I think you’ll like. Here’s the painting. This was painted by a Russian artist that I really like. It’s called “Sun on the water”. The artist was inspired by looking at the sea. What do you think?

Cheryl: It’s fantastic.

Marie: How interesting!

Bob: It’s very blue. (Top  Notch  TV) 

Cheryl, Marie and Bob are working in a travel agency. Ms. Novak who  is a  friend of  their boss Evans talks about 3 art pieces for decorating the office. She shows the painting which has nothing but a big blue rectangle and a small red circle in it.  However,  Ms.  Novak  praises  the  piece  with  gorgeous words. The  utterances  given by  Cheryl, Marie  and Bob are appreciations of the painting, and these even appear to be an act  of  insincerity.  As  a  matter  of  fact,  their  admiration statements are meant to tease Ms. Novak by implying that she does  not  have  good  sense  of  art.  Thus,  the  comments  "it’s fantastic", “how interesting” and “it’s very blue” are ironical expressions to ridicule Ms. Novak’s sense of art. 

2.1.2. Exaggeration

Exaggeration  refers  to  the  way  that  the  speaker overstates  the  features,  defects  or  the  strangeness  of someone or  something. 

(2.2) Mộng Vân: Thôi nè, mọi người tới đông đủ rồi, bây giờ mình ra xe đi nhà hàng nhe.

Hoa: Ááá, bây giờ là giây phút trọng đại nhất cuộc đời tôi đã tới. Giây phút tôi mong chờ cuối cuộc đời đã đến. Trời ơi, tôi được ăn giập mật rồi, tranh thủ ăn đi, ăn thủng nồi trôi rế, sau đó đẻ cũng vừa lòng. Há há há.

Mộng Vân: Ờ, thôi đi đi mọi người ơi.

Hoa: Á… á… (la lên vì đau bụng)

Page 92: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 89

Mọi người: Cái gì vậy? Cái gì vậy?

Hoa: Có một sự đau nhẹ.

Mọi người: Hả? Đau nhẹ?

(Tiệm bánh hoàng tử bé) 

Hoa is so excited with the wedding of her friend Mong Van.  When  hearing  the  invitation  to  the  restaurant,  she speaks out her excitement with exaggeration words such as “giây phút quan trọng nhất cuộc đời tôi” (the  most important moment in my life), “giây phút tôi mong chờ cuối cuộc đời” (the  moment  I  long  for  till  the  end  of  my  life), “được ăn giập mật” (eat until my gall is bruised), “ăn thủng nồi trôi rế” (eat until the pot is pierced and the pot holder is drifted). The humor of the scene escalates toits pitch with her words  “Có một sự đau nhẹ” (there  is  a  little  pain)  which implies the birth pangs. The amusing exaggeration in Hoa’s utterances evokes the audience’s laughter. 

2.1.3. Meiosis

The  speaker  makes  up  a  meiosis  in  order  to  solve problems  or  avoid  others'  accusations  in  an  embarrassing situation.  Meiosis  strategy  is  seldom used  in  both ESs  and VSs. Take a deeper look into some following examples 

(2.3) Phoebe: Oh, I didn't know you wanted her too!

Monica: Huh!

Rachel: Well, I mean, sure, of course. But... you already gave that to Monica, so...

Monica: You know, I would give her up, for you.

(Friends) 

Phoebe  promises  Monica  to  give  her  a  painting  which she  makes  by  herself.  In  fact,  Monica  does  not  want  that painting at all. Rachel does not want to tell Phoebe the truth that she dislikes that painting, so she is trying to think of a meiosis  to  avoid  getting  that  painting.  The  incongruity comes  from  the  discrepancy  between  Rachel's  lying  and her  real  feelings.  This  incongruity  can  be  resolved  when the audience found that Rachel is making meiosis to let the chance  of getting  that  painting  slips  away  unnoticeably.  It is  the process  that evoked  the  audience's  laughter. 

2.2. Maxim of Quantity

In  the  violation  of  Quantity  Maxim,  we  have  two contrary  strategies,  i.e.  (i)  too  much  unnecessary information,  (ii)  less  informative  response  strategy. 

2.2.1. Too much unnecessary information

This  strategy  states  that  one’s  contribution  should provide sufficient, but not too much information. If speaker provides  much  more  information  than  enough  to  be socially  appropriate,  he  creates  surprise  for  the  hearer  as well as the audience, and hence, comic effect is produced. 

For  instance: 

(2.4) “Has this... ever happened to you?

From today, dialing 999 won't get you the emergency services.

And that's not the only thing that's changing.

Nicer ambulances, faster response times, and better looking drivers mean they're not just the emergency services; they're "your" emergency services. So remember the new

number. That's... 0118 999 881 999 119 725......3!” (The IT Crowd) 

Moss invents an emergency service which is in his idea much  better  than  service  999.  He  makes  an  advertisement clip in TV which is transcript in (2.4). The audience cannot stop laughing as hearing such a long and hard-remembering phone number. Nicer ambulances, faster response times, and better  looking  drivers  in  the  advertisement  but  too complicated number lead to non-stop laughing. 

2.2.2. Less information response

Besides  providing  superflous  information,  another strategy  is  used  when  the  speaker  provides  less  than enough  information.  This  is  employed  when  the  director aims at  stressing on  the  contrast  between  the characters or situations. Have a look into an  instance of  this  strategy. 

(2.5) Jen: Guess who I'm about to meet now? Helen Bewley. Oh, come on. She took that football team to court for institutional sexism. Won massive damages and now she's head CEO of BHDR Industries.

Moss: Sorry, I kind of switched off after the word, football.(The IT Crowd) 

Jen  enthusiastically  tells  Moss  about  her  news.  Since she is  so excited,  she speaks very quickly and  floods Moss with  information,  in  which  he  is  not  interested.  Even though  Jen  considers  her  news  very  interesting  and entertaining,  she  does  not  realize  that  Moss,  who  is certainly  not  the  most  social  character  in  the  series,  would find  her monologue  unnecessarily  prolonged. The  viewers find  the answer of Moss amusing, because  they can  relate to  his  situation  that  someone  provides  too  much information on an  uninteresting  subject. 

2.3. Maxim of Relation

Grice's  Maxim  of  Relation  requires  the  speaker  to  say something  relevant  to  the  context.  Four  kinds  of  humor strategies  violating  the  Maxim  of  Relation  are  found, including  irrelevant  statements,  icebreaker,  changing  the topic  and “no offence”. 

2.3.1. Irrelevant statement

Speakers may make some irrelevant comments in order to  refuse  to  answer  some  embarrassing  questions  or  to emphasize something or  to  tease someone. For  instance: 

(2.6) Monica: What do you think?

Chandler: I think.... I think I can see your scalp.

Monica: Don't you just love it?

Ross: Ye... Yeah....You got shellfish in your head.

(Friends) 

Monica  just  comes  back  from  the  hairdressing  salon. She  is so excited and satisfied with her new hair style, but her friends do not  think so. When Monica asks her friends' opinions about her new hair style, she expects to hear some good comments because she herself likes it very much. Her friends do not  feel  the same, and, as a matter of  fact,  they think  that Monica's hair style  is  rather weird. Nonetheless, they  do  not  want  to  tell  Monica  the  truth,  so  they  give Monica  some  irrelevant  answers  when  she  asks  for  their opinions.  Their  responses  do  not  match  what  Monica  asks 

Page 93: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

90 Pham Thi Thanh Ly

for,  but  this  kind  of  response  is  relatively  safer  in comparison  with  the  consequences  if  they  just  go  ahead and boldly tell her the truth. 

2.3.2. Icebreaker

Sometimes people will  say  something  that  is  irrelevant to  the  current  context  so  as  to  avoid  silent  and  awkward moments  being  produced  between  or  among  interlocutors. 

(2.7) Bà Hoa: Định lấy tiền của chị hả, đâu có dễ vậy. (vứt tờ hóa đơn tính tiền)

Ông Bảo: (tuýt còi)

Bà Hoa: Ủa, gió thổi mất tờ hóa đơn của tui đâu rồi ta. Đâu rồi, đâu rồi? (giả vờ tìm quanh) À đây rồi.

Ông Bảo: Trời lặng im như vậy mà bảo có gió, định qua mắt tui hả, đừng có nằm mơ.

(Tiệm bánh hoàng tử bé) 

Hoa is embarrassed, she does not know what she should do and she has to say something to save the face. “Ủa, gió thổi mất tờ hóa đơn của tui đâu rồi ta” (Ooh, where has the wind blown the bill away?) are uttered to achieve the purpose. 

2.3.3. Changing the topic

Speakers  may  change  the  topic  of  the  conversation  in order  to  divert  attention  from  the  current  situation  or  to show that they are not  interested in  the previous topics. 

(2.8) Chandler: Yeah. I mean, this girl could decide against adoption or she could like another couple better.

Phoebe: What are you gonna name the baby?

Chandler: I can develop a condition in which I talk and talk and no one hears a word. (Friends) 

Monica  and Chandler  are  telling  their  friends  that  they are  not  getting  what  they  hope  for  by  adopting  a  baby, because  they know there may be a  lot of difficulties in  the process  of  adoption.  Apparently, Phoebe  does  not  pay  any attention  to  what  Chandler  says  about  how  difficult  the process  will  be,  and  she  just  keeps  asking  some  questions irrelevant  to  the topic  that  they are discussing. 

2.3.4. “No offence”

The  speaker  says  something  to  upset  or  insult  the hearer,  but  the  hearer  does  not  feel  insulted.  This  strategy is  usually  used  in  the  interactions  among  friends, colleagues  or  people  who  have  known  each  other.  It  is uttered  to upset or  insult  the hearer but  the hearer does not feel insulted, so it is usually embeded with hedges. 

(2.9) Jen: It's a date, I'm sure it is. Why else would he ask me out?

Moss: Well, don't take this the wrong way, but could he have thought you were a man? (The IT Crowd) 

Jen wonders whether her colleague, Philip, asked her out on a date or friendly night out. Roy and Moss speculate that Philip might be homosexual. Jen’s question is rhetorical. She does  not  expect  her  colleagues  to  actually  answer  it, especially not in the way Moss does. Even though Moss uses the hedge "don’t take this the wrong way", he still untactfully suggests that Jen looks like a man. "No offence" is often used in the sitcom to create a lot of funny moments. 

(2.10) Trình: Ủa, anh Huỳnh sao tới sớm vậy? Định

tập thể dục ở công ty hả?

Huỳnh: Dụng cụ gì mà dụng cụ, cái gậy chơi gôn, ông nội.

Trình: Gậy chơi gôn hả. Trời ơi, đắt tiền lắm nha. Anh lượm ở đâu vậy?

Huỳnh: Cái gì?Cái gì? Lượm ở đâu á hả, mua đó.

(Camera  công  sở) 

(2.11) Andrei: Chào hai bà chị xinh đẹp, hai bà chị dùng gì ạ?

Maika: Trời đất ơi, lại đây chị coi coi. Nhân viên mới đây đó hả. Đẹp trai dễ sợ không. Mũi nó đẹp ha, mũi thiệt không em?

(Tiệm bánh hoàng tử bé) 

In  (2.10)  and  (2.11),  with  “no  offence”  strategy,  the charactennrs  utter “Anh lượm ở đâu vậy?” (where did  you pick  it  up?)  and “mũi thiệt không em?” (Your  nose  isn’t fake,  is  it?). If  these  utterances  are  made  without  hedges “Trời ơi, đắt tiền lắm nha” (Oh  my  god,  it  looks  classy) and “Đẹp trai dễ sợ không. Mũi nó đẹp ha” (Wow, handsome boy! Beautiful nose!), they are actually insulting to  the  listeners.  The  hedges  and  “no  offence”  utterances create  a  contrast  that  amuse  the  audience. 

2.4. Maxim of Manner

Three  strategies  violating  Maxim  of  Manner:  lexical puns,  referential  ambiguity,  without  brief  and  ordered utterance  are  found.  Lexical  puns  are  discussed  with respect  to  the  type  of  their  underlying  ambiguity: phonological,  morphological  and  lexical  ambiguity. 

2.4.1. Lexical puns

a. Phonological ambiguity

Phonological  ambiguity  plays  with  sounds.  It  is  a change  at  the  phonological  level  that  initially  causes  the dual meaning (Jojić, Olja) [5]. 

(2.12) Frasier: Just as I thought. You bought the Diego sweater.

Martin: Well, what's the big deal? It's just a sweater.

Frasier: It is not "just a sweater," it is a work of art by Spain's fabled master weaver Diego – who uses only the soft chin hairs of Andalusia mountain goats. Our sweater man could only get one this year. Niles and I made a pact that neither of us would buy it. (to Niles) You can't even keep a simple sweater pact!

Martin: Ah, Ronee – now there's a gal who can keep a sweater packed! (Frasier) 

Frasier and Martin are seated at a table of Café Nervosa. Niles enters with a GAP shopping bag. Frasier snatches the shopping  bag  and  pulls  out  a  white  cashmere  sweater. Martin  teases  Frasier.  The  phonetic  pun  in  (2.12)  is  based on  the exploitation of  the entirely distinct but phonetically identical  noun “pact” and  adjective “packed”. 

Phonological  ambiguity  can  also  be  the  product  of phonetic  similarity,  not  only  identity.  This  is  otherwise known as "paronymy", the similarity in both pronunciation and  orthography 

(2.13) Bà Hoa: Trời ơi, mới sáng sớm mà gặp trai đẹp kiểu này thì chiều nay đông khách, làm móng mệt xỉu luôn

Page 94: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 91

à nha.(Kevin bỏ đi, bà Hoa níu lại)

Bà Hoa: Kevin, có chuyện gì mà mới sáng sớm chị thấy em u sầu, xanh xao, xuống sắc, mặt xấu xí vậy?

Kevin: Để em yên đi, em đang chán nản lắm rồi đó.

(Tiệm bánh hoàng tử bé) 

In (2.13),  the audience laughs  for  the phonetic pun:  the consonants  /x/ and /s/  in “u sầu, xanh xao, xuống sắc, mặt xấu xí”. 

b. Morphological ambiguity

The examples below illustrates the way reinterpretation is used  to  create  humor.  By  eliminating  prefix  “de”,  basis “filed” continues to exist as a nonce structure which generates humor.  Consider  the  example  below  in  the  situation  of Evelyn's house; Charlie used to date Tommy's daughter Olivia whom  he  dumped  without  explanation;  Olivia  shows  up unexpectedly with Tommy at Evelyn's house 

(2.14) Charlie: Anyway, Tommy seems like a real nice guy. I am very happy for you. Goodnight.

Evelyn: Charles. You are not going anywhere. This man is very important to me.Now, we are going to have a nice dinner, you are going to be charming and Tommywill remain oblivious to the fact that you defiled his daughter.

Charlie: Hey, she wasn't exactly filed when I met her.

(Two and a Half Men)

c. Lexical ambiguity

Lexical  ambiguity  refers  to  an  individual  lexical  item which expresses more than one meaning. Meaning opposition is generated on the basis of the descriptive and figurative (or idiomatic) uses of the word. The speaker attempts to use this strategy on purpose to make fun of the hearer or to lead the hearer to interpret the messages in a wrong way. 

(2.15) Trình: Trời ơi sếp ơi, bữa nay sếp nuôi chim nữa hả sếp?

Tài: Trời ơi, tôi đâu có rảnh đâu mà nuôi chim. Con chim này của ông chủ tịch đó. Ông chủ tịch đi vắng, nhờ tui giữ hộ đó.

Trình: Trời ơi, đúng là chim ông chủ tịch nha, đẹp ghê.

Tài: Nè, đừng nói là chim ông chủ tịch, mà đây là con vật yêu quý của ông chủ tịch nghe hông.

(Camera  công  sở) 

Tai  and  Trinh’s  intended  meanings  of  the  lexeme “chim”  (bird  vs.  male  sexual  organ)  are here  contrasted  to create  humor. 

2.4.2. Referential ambiguity

Referential  ambiguity  refers  to  a  sentence  or  a  phrase where the referent is not clear. This type of ambiguity will make  the  hearer  confused  about  what  the  speaker  really refers to at that moment. 

(2.16) Jen: I've got Aunt Irma visiting.

Moss: Oh, do you not like Aunt Irma? I've got an aunt like that. (Roy and Moss look confused)

Jen: It's my term for my time of the month.

Moss: What time of the month? The weekend? (The IT Crowd) 

Jen  tries  to explain  to Moss and Roy  that  she  is a  little bit grumpy during her period of menstruation. She uses the term "Aunt Irma" to deliver the message. 

At  first,  Jen  does  not  provide  enough  information, because  she  does  not  want  to  talk  Moss  and  Roy  openly about  her  private  matters.  “Aunt Irma”  refers  to menstruation as Jen’s  thinking and  it also  refers  to an aunt named  Irma  as  Moss  and  Roy’  thinking.  While  Roy manages  to  decode  Jen’s  message  after  she  decides  to specify her explanation, Moss does not get  the meaning of her  words.  The  audience  finds  it  funny,  because  Moss seems  to overlook  the  implicature. 

2.4.3. Without ordered and brief utterance strategy

People sometimes do not talk in an orderly way because they are eager  to  explain something or  accuse someone of what  he did before or embarassed with something. 

(2.17) Beo: (slowly start talking) Kính thưa má, sở dĩ mời má ra đây, giờ phút này, không có gì lớn nhưng má phải chứng kiến có một cuộc họp đột xuất ngoài ý muốn của chúng con, nhưng không họp thì không được. Vì vậy, chúng ta phải họp. Hôm nay, ba đi vắng, đại diện trong gia đình chỉ còn có má, con muốn nói với má là… đã lâu lắm rồi gia đình mình không có họp, cho nên bây giờ mình họp lại để củng cố trong thời gian ăn nhờ ở đậu ở đây. Trong lúc nhà chúng ta đang sửa thì gia đình mình ở đợ bên này, có nhiều vấn đề xảy ra mà không ai biết, nó cũng không lớn gì. Nói chung là họp … không coi báo.

(Gia đình  đốc-tờ Beo) 

In  (2.17), Beo’s  family has  a meeting  on  cutting  down expenses.  Just  for  the  purpose  of  organizing  a  family meeting, Beo  is  so  embarassed  that he  says “họp”  (meet), “cuộc họp”(meeting) 6 times without brief and ordered way. Besides,  some  phrases  like  “giờ phút này, không có gì lớn”(at this moment, there is nothing serious), “ba đi vắng” (Dad  is  absent  from home) “con muốn nói với má là…”(I would  like  to  talk  to  you  that…), “nó cũng không lớn gì”(there is nothing serious) make the utterances disordered. 

3. Similarities and differences

The  results  and  analyses  show  that  close  relationships between  humor  and  the  violation  of  Grice’s  Cooperative Principle do in fact exist. It is found that a lot of funny lines can  result  from  certain  kinds  of  humor  strategies  which violate  Grice’s  Principle. 

As regard to maxims, it is found that in ESs, the violation of Maxim of Quality is most frequently used (42%). Second is  Maxim  of  Relation  (29.3%).  Maxim  of  Manner contributes  20.0%  while  Maxim of  Quantity  makes  up  the least, 8.7%. In addition, in VSs, Maxim of Manner ranks top with 35.3%. Second and third are Maxim of Quality (28.0%) and Maxim of Relation (24.7%) respectively. Similar to ESs, the  lowest  is  Maxim  of  Quantity  (12.0%).  Furthermore, humor strategies violating Maxim of Quantity count for the least in both ESs and VSs, 8.7% of ESs and 12% of VSs. 

With  reference  to  strategies,  it  is  found  that  less information  response  strategy  is  the  least  frequently  used among  all  humor  strategies  employed.  Its  frequency  is 2.0% in ESs and, similarly, only 1.3% in VSs. Meiosis, less 

Page 95: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

92 Pham Thi Thanh Ly

information  response,  icebreaker,  changing  the  topic  and referential  ambiguity  make  up  a  small  rate,  not  more  than 5% for each and under 20% for  total. 

3.1. Similarities

There  are  some  remarkable  similarities  in  humor strategies  violating  Grice’s  Cooperative  Principle  in  ESs and  VSs. 

Firstly,  looking  at  the  result  in  the  Table  4.1,  we  find out  that  there  are 12  humor  strategies  and  3  sub-strategies violating  four  maxims  of  Grice’s  Cooperative  Principles. All of them occur in both ESs and VSs. 

Secondly, humor strategies violating Maxim of Quantity count for the least in both ESs and VSs. 8.7% of ESs and 12% of VSs are shown in the results. Note that all of the maxims can be violated individually, but some of them frequently co-occur. The violation of the maxim of Quantity is usually tied to  the  violation  of  the  maxim  of  Manner,  and  this  happens when a character either says too much, or remains obscure and does not say enough. In this case, we count for Manner. When people  exaggerate,  they  violate  Quality  and  tend  to  violate Quantity  for  saying  too  much  unneccessary  information.  In this  case,  we  count  for  Quality.  Therefore,  Quantity contributes the least in both ESs and VSs. 

Table 1. Frequency of humor strategies in ESs and VSs

Strategies English sitcoms Vietnamese sitcoms

N. % N. %

Maxim of Quality 63 42.0 42 28.0

Irony  32  21.3  18  12.0 

Exaggeration  24  16.0  20  13.3 

Meiosis  7  4.7  4  2.7 

Maxim of Quantity 13 8.7 18 12.0

Too  much  unnecessary information 

10  6.7  16  10.7 

Less informative response  3  2.0  2  1.3 

Maxim of Relation 44 29.3 37 24.7

Irrelevant statement  22  14.7  11  7.3 

Icebreaker  5  3.3  5  3.3 

Changing the topic  7  4.7  4  2.7 

"No  offence"  10  6.7  17  11.3 

Maxim of Manner 30 20.0 53 35.3

Lexical puns  18  12.0  33  22.0 

Phonological ambiguity 8 5.3 18 12.0

Morphological ambiguity 4 2.7 7 4.7

Lexical ambiguity 6 4.0 8 5.3

Referential ambiguity  5  3.3  6  4.0 

Without  brief  and ordered utterance 

7  4.7  14  9.3 

Total 150 100.0 150 100.0

Thirdly,  it  is  noted  that  Less  Information  Response Strategy  is  the  least  frequently  used  among  all  humor strategies to be employed. Its frequency is 2.0% in ESs and, similarly, only 1.3% in VSs. 

Fourthly,  Meiosis,  Less  Information  Response, Icebreaker,  Changing  The  Topic  and  Referential Ambiguity make up a small rate, not more than 5% for each and under 20% for  total. 

3.2. Differences

First,  Quality  in  ESs  and  Manner  in  VSs  make  up  a notable rate. The results show that the strategies of Quality, in  ESs,  are  most  employed  (42%)  and  the  strategies  of Manner,  in  VSs,  is  highest  contributed  (35.3%). 

Secondly, Irony in ESs and Lexical Puns in VSs are the strategies making up the highest rates. Each of them counts up to one fifth of the whole, i.e. Irony 21.3%, Lexical Puns 22.0%.  Lexical  Puns  refers  to  the  ambiguity  in phonological,  morphological  and  lexical  aspects.  Lexical Puns  are  common  methods  in  arousing  laughter  in Vietnamese  funny  stories.  Sitcoms  are  hence  affected  by this  tradition. In contrast,  Irony is  used more in ESs. 

Finally,  there  are  some  strategies  which  make  up relatively  converse  percentage.They  are  Irony,  Irrelevant Statements,  “No  offence”,  Phonological  Ambiguity.  The rate  of  Irony  is  21.3%  in  ESs  and  12.0%  in  VSs;  the proportion  of  Irrelevant  Statements  is  14.7%  in  ESs  and 7.3% in VSs;  “No offence” is  recorded at 6.7% in ESs and 11.3% in VSs; and Phonological Ambiguity is 5.3% in ESs and 12.0% in VSs. 

The  study  of  humor  in  sitcoms  from  pragmatic perspectives  offer  English  teachers  and  learners  a  general view of humor strategies by violating conversation maxims in  both  English  and  Vietnamese.  It  would  be  a  good reference  for  them  in  systematically  understanding  humor strategies  resulting  from  violating  maxims.  It  would  help them recognize humor situations in order to understand the speaker’s  intention,  hence  to  improve  communication competence.English  learners  should  know  the  purpose  of each  humor  utterance,  and  realize  the  strategy  that  the speaker uses to create humor in every English conversation. With each specific purpose, the learners can choose the most appropriate humor strategies to communicate effectively. 

REFERENCES

[1] Attardo, S. (1994), Linguistic Theories of Humor, Berlin: Mouton de Gruyter. 

[2] Grice, P. (1975), Logic and Conversation, In P. Cole, & J. L. Morgan (Eds.), Syntax and semantics (Vol.3): Speech acts (pp. 41-58), NY: Academic Press. 

[3] Ho, L. & Le, T.H. (2002), Sử dụng Từ ngữ trong Tiếng Việt (Thú chơi chữ), Nxb Khoa học Xã hội. 

[4] Holmes, J. & Marra, M. (2002), Over the Edge? Subversive Humor between Colleagues and Friends, Humor, 15(1), 65-87. 

[5] Jojić,  Olja  (2013), Lexical Pun in Sitcoms,  Series:  Linguistics  and Literature Vol. 11, No 1, 2013, pp. 23 - 34, Facta Universitatis. 

[6] Levinson, S. C. (1983), Pragmatics, Cambridge University Press. 

[7] Ross, A. (1998), Language of Humor, London: Routledge. 

[8] Seewoester,  S.  (2011),  "The Role of Syllables and Morphemes as Mechanisms in Humorous Pun Formation",  In:  Dynel, Marta  (ed.), The Pragmatics of Humor across Discourse Domains, John Benjamins Publishing Company, Amsterdam/Philadelphia, pp. 71-104. 

(The Board of Editors received the paper on 31/12/2015, its review was completed on 07/04/2016)

Page 96: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 93

NONVERBAL STRATEGIES USED IN CLOSING A CONVERSATION AT OFFICES BY ENGLISH AND VIETNAMESE STAFF AND MANAGERS

Hoang Tra My

Mientrung University of Civil Engineering; [email protected]

 Abstract - A conversation can be closed verbally or nonverbally. While people can learn to speak a language, they need to experience to behave appropriately. Furthermore, behaving well in the mother tongue is difficult but much more challenging in a foreign language. For this reason, the present study is to compare and contrast the ways English and Vietnamese staff and managers utilize nonverbal strategies to terminate their conversations at offices. From conversation analysis perspective, 60 English and 60 Vietnamese conversations with closing sections gathered in films are selected basing on strict criteria on contents, airtime and broadcast channels. Nonverbal closing strategies are noted down, generalized, compared and contrasted in both languages. As similarities, English and Vietnamese subjects often perform physical behaviors of standing up and moving towards the door due to the typical setting – working environment. Regarding differences, as opposed to English subjects, Vietnamese subjects tend to produce indirect closings by employing more numbers and types of nonverbal strategies in combination with roundabout leg movement. Especially, English subjects show their attentiveness by direct eye contact while Vietnamese ones display their respect and attention by smiling and head-nodding.

Key words - conversational closings; conversation closing strategies; nonverbal strategies; conversation analysis; conversations at offices; conversation between managers and staff

1. Introduction

1.1. Aims of the study

Human  communication  process  can  be  carried  out  in various  channels,  among  which nonverbal  communication is  regarded  as  the  most  basic.  According  to  Knapp,  Hall and  Horgan  [9],  nearly  65%  of  all  human  communication is expressed via nonverbal cues, which  indicates  its crucial role  in  daily  social  interactions.  Sharing  the  same  point  of view,  Bruce  [2]  even  claims  that  more  than  85%  of  all human  communication  is  nonverbal. 

Moreover,  behaving  appropriately  and  effectively  in face-to-face  conversations  with  others  is  exceedingly challenging, especially the process of closing a conversation. A  conversation  can  be  closed  verbally  or  nonverbally. Closing  a  conversation  verbally  seems  to  be  less  difficult thanks  to  the  speakers’  linguistics  competence  and knowledge; however, to produce proper nonverbal behaviors at  the  end  of  a  conversation,  participants  need  sufficient cultural background knowledge as well as experience. 

Additionally, currently, there are lots of Vietnamese people working with those coming from English speaking countries. The need of communication among  them is becoming more and  more  vital.  At  offices,  Vietnamese  parties  have  lots  of obstacles  in  understanding  as  well  as  communicating nonverbally with foreigners. Particularly, they have difficulties in breaking contact with foreigners because “knowing how to close or say goodbye in one native language does not ensure success in another language” [1, p.6]. 

Consequently,  this  study  is  designed  to  equip  English and  Vietnamese  staff  and  managers  with  adequate nonverbal  strategies  to  help  them  terminate  their 

conversations  at  office  courteously.  This  study  is  only limited  to  the  description  of  nonverbal  strategies  taken  by both English and Vietnamese staff and managers. From the description,  some  similarities  and  differences  between English  and  Vietnamese  subjects  in  the  ways  of terminating a conversation will be presented and discussed. It  is hoped  that  the study will provide Vietnamese users of English with essential nonverbal  strategies  to help  them to behave  appropriately  and  politely  with  English  speaking partners at offices  in  the process of closing a conversation. Precisely,  this  study  is  to  answer  two  research  questions: (1) what are nonverbal strategies employed by English and Vietnamese  staff  in  closing  conversations  at  offices?  And (2)  what  are  nonverbal  strategies  utilized  by  English  and Vietnamese  managers  in closing conversations at offices? 

1.2. Literature review

1.2.1. Conversational closing

Historically, conversational closing was  first developed by  Goffman  [5].  Besides  Goffman,  Schegloff  and  Sacks [16] may  also be  considered  other groundbreakers  with  an extension  of  their  earlier  work  on  conversational  openings with  the  data  collected  from  500  telephone  conversations. Following  researchers  have  developed  this  area unsystematically  from  numerous  perspectives. 

As  regards  the  data  sources,  due  to  the  challenges  in gathering  naturally  occurring  conversations  as  the  data  for analysis,  researchers  have  delved  into  this  field  in  various ways.  Lots  of  researchers  have  made  use  of  conversations in  written  genre  [1]  while  some  others  take  advantage  of telephone  conversations  [7]  or  rely  on  some  channels  of mediated  communication  like  online chats  [15]  or  talk show interviews  [13].  Particularly,  there  have  been  some researchers  who  try  to  record  naturally  occurring conversations  ([6],  [10])  or  create  nearly  natural  data  via role-plays  with  the  help  of  volunteers  [17].  In  connection with  perspectives,  conversational  closing  can  be approached  in  pragmatics  or  conversation  analysis.  For example, from pragmatic perspective, David et al. [3] focus upon  politeness  strategies  used  in  closings  of  service encounters  in  Government  agencies  or  from  conversation analysis  perspective,  LeBaron  and  Stanley  [10]  specially analyze a single naturally occurring encounter between two clients in a beauty salon. 

1.2.2. Nonverbal conversational closing strategies

Despite  the  essentiality  and  importance  of  nonverbal behaviors  in  closing  a  conversation,  this  field  has  been examined extremely limitedly worldwide and totally absent in Vietnamese due to the restricted accessibility of data sources. Factually, this area has only been inspected as a small part in bigger studies. From its background, some significant results 

Page 97: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

94 Hoang Tra My

from previous investigations can be remarked. Regarding the level of intimacy among partners, Summerfield and Lake [17] assume  that  friends  look  at  their  partners  more  often  than strangers. Likewise, Knapp, Hart, Friedrich and Shulman [8], with the data of formal interviews between acquaintances and strangers of equal and unequal status, introduce a number of nonverbal behaviors associated to leave-taking, for example, breaking eye contact, smiling, nodding head, leg movement, leaning forward and movement in the direction of proposed exist.  In  addition,  by  observing  nonverbal  behaviors  of departure  of  an  individual  in  an  F-Formation,  Kendon  [6] realizes  some  remarkable  movement  behaviors  including stepping backwards, then stepping back into the group, and finally walking away.  Focusing on more diverse behaviors, Lockard, Allen, Schiele, and Wiemar [11] put forward some other nonverbal strategies indicating imminent departure like unequal weight stances and weight shifts, breaking of eye contact and hand gestures. Erickson [4] adds postural shifts as a signal of a change in topic or an intention to part. Finally, O’Leary  and  Gallois  [14,  p.8-24],  with  the  attention  to  the relationship of parties,  investigate  the last  ten  turns of  two-party conversations in comparison with  the ten middlemost turns. They claim that unlike strangers, friends employ more activities, behavior clusters and specific appointments with continuity statements.  However,  both  of  them  have  a preference  for  smiling, using hand gestures, looking away along  with  leverage/ lean forward and grooming  by  the departing  subject  as  well  as  head nodding  by  the  staying subject. In conclusion, the background of this field points out that studies on nonverbal strategies in closing a conversation are deficient and unsystematic. Among researches in this field, the study by O’Leary and Gallois [14, p.8] seems to be the most  sufficient.  Being  well  aware  of  no  existing  previous framework  on  nonverbal  behaviors,  they  analyze  the  data basing  on  their  own  framework  including  categories  of looking,  head  movement,  arm/hand  movement,  facial expressions, trunk movement and leg movement. In the same way,  in  this  study,  the  writer  takes  note  every  nonverbal behavior of subjects and then summarizes from the most to the least popular ones. The categories of nonverbal behaviors are illustrated in the following Table: 

Table 1. Categories of nonverbal behavior used in data analysis (Extracted from O’Leary and Gallois, [14, p.8])

Looking + At: eyes and nose pointed at partner's face 

+ Away: eyes and nose pointed away from partner's face 

Head Movement 

+ Shaking: movement from side to side 

+ Nodding: movement up and down 

Arm/Hand Movement 

+ Gesture: movement accompanying own speech 

+ Grooming: touching of own body (to stroke or groom) 

+ Leveraging: hands placed on arms of chair in a manner that would assist rising from chair 

Facial Expression 

+ Smiling: raising or upturning of the corners of the mouth 

Trunk Movement 

+ Leaning forward: movement of trunk forward 30° or more from previous position 

+ Leaning backward: movement of trunk back 30° or more from previous position 

+ Standing: rising from a sitting to standing position. 

Leg  + Orientation (while standing): any movement of 

Movement  legs resulting in a significant change in posture 

+ Door: trunk oriented in direction of door. 

1.3. Methodology

The  results  of  this  study  base  on  the  data  of  120 conversations  (60  English  and  60  Vietnamese). Conversations selected must have the closing sections and be between two participants – a staff and a manager with the age from 20 to 60. To ensure equivalent contents and forms,  English  and  Vietnamese  films  selected  have  to follow the same criteria such as broadcast channels, airtime and contexts. Exactly, Vietnamese movies must be aired in the  golden  hours  on  Vietnam  Television  (VTV)  –  the national broadcaster of Vietnam while English movies are selected  from  Vietnam  Cable  Television  (VTVCab) channels  such  as  HBO,  Star  movie,  Star  world.  These movies  must  also  be  produced  from  2000  up  to  date, discussing  current  issues  in  modern  contexts  of  offices. From  these  criteria,  one  English  film  -  “House  of  cards” and two Vietnamese films - “Đối thủ kỳ phùng” and “Cảnh sát hình sự - Chạy án” are selected. 

All  nonverbal  behaviors  performed  by  English  and Vietnamese  subjects  in  closing  sections  of  selected conversations  are  noted  down  then  generalized  from  the most  to  the  least  popular  ones.  These  strategies  are analyzed  and  evaluated  basing  on  their  frequency  of appearance in relation with 60 collected conversations. The conclusions display both similarities and differences in the ways  the  subjects  in  both  languages  terminate  their conversations nonverbally at offices. 

2. Results and Discussions

2.1. Nonverbal strategies by English and Vietnamese staff

Nonverbal strategies taken by English and Vietnamese staff are presented in the Figure 1 below: 

Figure 1. Nonverbal strategies by English and Vietnamese staff

Note:

1: Looking at partner’s face, eyes 

2: Breaking eye contact 

3. Looking away from partner’s face 

4: Head Nodding 

5: Smiling 

6: Standing up 

7:  Movements  oriented  in direction of door 

8: Packing things up 

9: Hand Shaking 

10: Arm/Hand gesture 

11: Turning back 

12: Touching shoulder 

13: Looking at the watch 

14: Wearing the coat 

15: Leaning forward 

16: Holding the other’s hands 

17: Gazing at objects at a distance 

18: Moving closer 

19: Holding hands in front of 

0

10

20

30

40

50

1 3 5 7 9 11 13 15 17 19

English Vietnamese

Page 98: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 95

In  overall,  nonverbal  behaviors  of  Vietnamese  staff  are more  intricate  than  those  of  English  ones  because  of  more number and  types of strategies  employed. Vietnamese  staff produce  166  nonverbal  strategies  categorized  into  18  types whist  English  staff  only  need  129  ones  categorized  into  13 types.  Unlike  the  Vietnamese,  the  English  belong  to  low-context  culture;  hence,  they  have  low  use  of  nonverbal elements in communication. Their communication is mainly expressed  explicitly  via  words.  Furthermore,  the  ways  they restore  each  strategy  are  also  different.  To  depict  the similarities and differences, these nonverbal strategies will be analyzed from the most to the least frequency of occurrence. 

With  reference  to  the  most  frequently  employed nonverbal  strategies,  it  is  notable  that  the  strategies  of standing up and moving towards the door are made use of most often with 25% and 63.3% by English staff and 28.3% and  73.3%  by  Vietnamese  ones  respectively.  Their  regular appearance is accounted by the typically official architecture and  working  environment.  It  can  be  inferred  that  in  both cultures,  staff-manager  conversations  often  occur  in  the managers’  rooms  and  the  difference  between  these  two strategies implies that staff may be sitting or standing while talking  to  their  managers.  Except  for  these  two  strategies, English staff prefer looking at partner’s eyes or faces (65%) while  Vietnamese  staff  enjoy  nodding heads  (65%)  and smiling (28.3%) to end conversations with their managers at offices. Significantly, English  individuals highly appreciate direct eye contact in interaction. In fact, direct eye contact is highly  valued  in  the  U.S  culture  and  in  communication, direct  eye  contact  is  to  convey  the  attentiveness,  respect, truthfulness,  and  self-confidence  [12,  p.56].  It  can  be inferred that the excessive employment of direct eye contact of  English  staff  in  examined  conversations  is  to  show  the deference  and  attentiveness  towards  their  managers.  In contrast, in Vietnamese culture, it is especially inappropriate and even impolite for the less powerful partners like staff to look directly and constantly at the eyes or faces of the more powerful  ones  like  their  managers.  This  finding  is  in agreement  with  Martin  and  Chaney’s  point  of  view.  They suppose  that  people  in  many  Asian  countries  are uncomfortable with direct eye contact. They are inclined to look  below  the  partners’  chin  during  the  conversation because looking into the partner’s eyes would be quite rude [12,  p.57].  The  thorough  observation  of  the  collected  data reveals that Vietnamese staff’ eye contact is  inconstant and varying or  they express  the  respect  towards  their managers by  avoiding  direct  eye  contact  and  most  of  the  cases,  they look at  their managers’ chin rather than  their eyes.  Instead, Vietnamese staff have a tendency to nod their heads or smile at  their  managers.  According  to  Martin  and  Chaney  [12, p.58], smiling accompanied by a slight nod-heading, in some cultures, is restored in conversation to acknowledge what the partner has said. Likewise, head nodding and smiling are a display  of  agreement,  contentment  and  involvement  in  the conversation.  The  repeated  occurrence  of  these  strategies exposes the staff’ acknowledgement and involvement in the talk  with  their  managers.  Surprisingly,  smiling  and  head-nodding  appear  in  only  two  (3.3%)  and  five  English conversations  (8.3%).  In  English  speaking  countries, smiling associates with happiness [12, p.58]; hence, it seems 

to  be  inappropriate  for  them  to  smile  in  a  formal conversation with their managers at offices. 

With  regard  to  the  less  frequently  used  nonverbal strategies, both English and Vietnamese staff can inform the conversational  closings  by  packing things up  and handshaking.  The  act  of  packing  things  up  accounts  for 16.7% in both languages. Generally, the staff will come into their  managers’  rooms and  they  may carry  something  with them  like  their  handbag  or  a  folder  of  document.  By collecting or packing these things, the staff notice or inform their managers about  the ending of  their  conversations and then their leaving. The act of handshaking makes up 10% in English  and  13.3%  in  Vietnamese.  Handshaking  is  an extremely popular behavior in Western countries, especially at  the  beginning  of  a  meeting.  However,  due  to  the globalization of business, this behavior has become common in  business  around  the  world.  It  can  be  inferred  that  in English and Vietnamese official environment, it is proper for participants to shake their hands at the end of a conversation. Moreover,  English  staff  also  employ breaking eye contact while  Vietnamese  ones  make  use  of  moving closer to the partner  to  notify  the  closing.  That  the  act  of  breaking  eye contact  is  employed  to  terminate  a  conversation  has  been proved  by  earlier  researchers  [8,  10].  This  reassures  the importance of eye contact in interaction of English subjects. The act of moving closer to the partner to inform the closing of Vietnamese partners is an illustration of the Vietnamese’s indirectness. Being an Asian country, Vietnamese culture is group-oriented;  hence,  working  harmoniously  within  a group  is  highly  valued  whist  directness  and  forthrightness are considered rude or impolite [13, p 47]. 

Regarding  rarely  exploited  strategies,  nonverbal strategies  including  looking away from the partner’s face, looking at the watch, arm or hand gesture, turning back and touching the partner’s shoulder  are  used  remarkably restrictedly  in both  languages.  In  fact,  these strategies only occur in one or two conversations among 60 ones examined. The tremendous limitation of these strategies is explained by the  partners’  inequality  of  power.  In  both  languages,  it  is inappropriate or even impolite for the less powerful partners to  look  away  or  turn  back  from  the  more  powerful  ones, except for some extraordinary or emergency situations. It is also worth noting that the touching behaviors are uncommon in English speaking countries [12, p.67] or they do not have a habit of touching. In addition, there also exist some other strategies which are only taken by Vietnamese staff such as gazing at distant objects, leaning forward, wearing the coat, holding the other’s hands and holding their own hands in front of.  Because  of  exceedingly  rare  appearance,  it  is  not advisable  for  these  strategies  to  be  exploited  in conversational closing sections. 

In conclusion, English and Vietnamese staff are different in the way they make use of their looking, facial expressions, head  movement  and  postural  shifts  to  signal  their conversational  closings.  English  staff  prefer  direct  and instant eye contact as well as straight movement towards the exit  while  Vietnamese  staff  enjoy  smiling,  nodding  their heads  and  moving  towards  their  managers  before  moving towards  the  door.  Nevertheless,  they  both  rarely  look  way 

Page 99: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

96 Hoang Tra My

from  their  partner’s  eyes  or  faces,  look  at  the  watch,  turn back, touch their managers’ shoulders and so on. 

2.2. Nonverbal strategies by English and Vietnamese managers

Nonverbal strategies taken by English and Vietnamese managers are presented in the Figure 2 below: 

Figure 2. Nonverbal strategies by English and Vietnamese

managers

Note:

1: Looking at partner’s face, eyes 

2:  Movements  oriented  in direction of door 

3: Standing up 

4: Breaking eye contact 

5: Looking away from partner’s face 

6: Working again 

7: Turning back 

8: Shaking hands 

9: Leaning backward 

10: Nodding head 

11: Smiling 

12: Leaning forward 

13: Wearing the coat 

14: Looking around 

15: Arm/Hand grooming 

16: Arm/Hand Leveraging 

17: Packing things up 

18: Looking at the watch 

19: Touching shoulder 

20: Moving closer 

21: Gazing at objects at a distance 

22: Arm/Hand gesture

Although  the  total  number  of  nonverbal  strategies employed by English and Vietnamese managers is nearly the same, with 121 and 122, the frequency of occurrence of each strategy is exceedingly dissimilar. With regards to the most frequently used strategies, the behavior of looking at the partner’s faces/ eyes  accounts  for  the  highest restoration  by  English  managers  with  50%.  English managers  prefer  stable,  straight  and  instant  eye  contact. Contradictorily, Vietnamese ones usually nod their heads and smile  to  indicate  the  closing  with  56.7%  and  31.7% respectively. As discussed above, English native speakers highly appreciate direct eye contact in interaction because it  shows  the  attentiveness,  respect,  truthfulness, and  self-confidence.  With  the  exploitation  of  direct  eye  contact, English managers express their directness as well as their concentration  on  what  the  staff  has  said.  Contrary  to English  managers,  Vietnamese  managers  smile  and  nod their  head  to  support  what  their  staff  has  said.  It  can  be inferred that Vietnamese managers are more pleasant and affable to talk to than English ones due to their enormous utilization  of  smiling  and  head-nodding.  Next,  the behaviors of standing up and moving towards the door are performed  fairly  frequently  with  21.7%  and  38.3%  by English managers and 15% and 23.3% by Vietnamese ones respectively As discussed above,  the high employment of 

these  two  strategies  is  due  to  the  special  architectural structures and working environment at offices. 

In terms of the less frequently used nonverbal strategies, English  managers  tend  to  utilize  behaviors  which  make them and their staff becomes more distant such as breaking eye contact (13.3%), looking away from partner’s face or eyes (11.7%), working again (11.7%), turning back (10%) and  leaning backward  (8.3%).  These  behaviors  are significant  signals  of  closing because  the  managers  show their  incorporation  in  continuing  the  conversation. Especially,  the  behaviors  of  working again and turning back seem to threaten the staff’ faces because the managers reveal that they are not eager or happy to continue talking with them. In normal conversations, these strategies may be considered  inappropriate  or  even  impolite  in  English culture. However, in conversations of unequal power, it is acceptable  for the more powerful partners – the managers to make use of these strategies to close a conversation with the less powerful partners – the staff. 

In contrast, Vietnamese ones rarely utilize these strategies, for instance, turning back (3.3%), leaning backward (1.7%) or working again (0%). Instead, they have a tendency to use behaviors creating the closeness like looking at partner’s eyes or faces  (18.3%),  touching partner’s shoulder  (15%)  and moving closer to the partner (13.3%). The Vietnamese culture is  collectivism  or  group-oriented;  hence,  behaving  and working harmoniously in a community is greatly appreciated whereas  directness and  straightforwardness  are  regarded  as rude or impolite [13, p. 47]. For this reason, they try to behave closely and warmly even at the leave-taking of a conversation. Especially,  in  Vietnamese  culture,  the  act  of  touching partner’s  shoulder  is  the  privilege  of  the  more  powerful partners  to  show  their  sympathy and  encouragement  to  the less powerful ones. Exceptionally, handshaking is a behavior performed quite similarly by the managers in both languages, with 13.3% and 10%. 

Last but not least, despite the appearance of a variety of nonverbal  strategies,  most  of  them  are  employed  in  an extremely small percentage. The rarely used strategies by both  English  and  Vietnamese  managers  are  wearing the coat, leaning forward, looking at the watch, looking around, packing up things, gazing objects from distance and arm/ hand gesture. Factually,  these  strategies appear only  in  one  or  two  conversations  in  both  languages. Because  of  their  unpopularity,  it  is  advisable  for  the managers  in  both  languages  to  avoid  or  limit  the  use  of them to close a conversation with their staff. 

In summary, in closing a conversation with their staff at offices, English and Vietnamese managers are similar in the regular exploitation of standing up and moving towards the door. As regards the differences, English managers tend to concentrate on the eye contact by  looking at the partner’s eyes or faces, looking away and breaking eye contact and keep distant from their staff by working again, turning back, and leaning backward.  Vietnamese  managers,  inversely, have  a  preference  to  make  them  closer  to  their  staff  by nodding head, smiling, moving closer to the partner and touching partner’s shoulder. These  differences  can  be accounted  by  the  individualism  of  English  culture  and 

0

5

10

15

20

25

30

35

1 3 5 7 9 11 13 15 17 19 21

English Vietnamese

Page 100: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 97

collectivism or group-oriented of Vietnamese culture. 

3. Conclusions and suggestions for further studies

3.1. Conclusions

To compare  the employment  of  nonverbal  strategies of the  subjects  in  the  two  languages,  there  exist  much  more differences than similarities. As regards similarities, official working environment accounts for the massive employment of  the  strategies  like  standing up  and  moving towards the door by both subjects. Likewise, normal physical behaviors give an explanation for the occurrence of packing things up and handshaking of subjects in both languages. 

In  connection  with  differences,  generally,  nonverbal behaviors  by  Vietnamese  subjects  are  much  more complicated  than  English  ones  due  to  more  numbers  and types  utilized.  In  addition,  because  of  belonging  a  high-context  culture,  Vietnamese closings  are  rather  roundabout or  indirect  with  the  preference  of  moving closer to the partner  and  touching the partner’s shoulder  before departing.  These  strategies  are  used  to  help  Vietnamese subjects  to  avoid  hasty  or  sudden  closings  which  may threaten the interlocutor’s face in Vietnamese culture. On the contrary,  belonging  to  a  low-context  culture,  English subjects tend to be goal-focused and straightforward. That is the  reason  why  they move  towards  the door  right  after  the conversation finishes and are uncomfortable with touching. Furthermore, English subjects show their involvement in the conversation by direct eye contact whist Vietnamese display their attention and politeness by smiling and head-nodding. It  can  also  be  inferred  from  the  exploitation  of  these strategies  that  the  relation  between  Vietnamese  staff  and managers  is  rather warm and close whereas  that of English ones is rather formal and distant. Finally, English managers appear more powerful than Vietnamese ones through the use of  such  strategies  as  working again, turning back and leaning backward. It can be concluded that English subjects tend  to  focus  on  the  goal  in  interaction  or  produce  work-based conversations whilst Vietnamese ones concentrate on both the effectiveness of the work and the establishment of rapport  among  interlocutors  in  interaction.  The  features  of low-context  culture  of  English  and  high-context  culture  of Vietnamese justify for these differences. 

3.2. Suggestions for further studies

The author is well aware of the limitation as well as the weakness of using the conversations in films as the data. The study  will  be  much  more  valuable  and  meaningful  if naturally  occurring  conversations  are  collected  as  the  data for  analysis;  hence,  it  is  advisable  for  other  researchers  to examine conversational closing strategies with real life data. Moreover,  because  of  being  conducted  in  conversation 

analysis  perspective,  this  study  cannot  expose  the  cultural origin  of  nonverbal  behaviors  of  subjects  in  the  two languages.  A  further  study  to  examine  English  and Vietnamese  nonverbal  behaviors  in  closing  a  conversation under the cultural perspective is particularly meaningful and interesting.  Finally,  to  produce  a  good  closing,  verbal strategies play  an extremely  essential  role;  consequently,  it is better for other researchers to focus on verbal strategies in combination with nonverbal ones in closing a conversation. 

REFERENCES

[1] Bardovi-Harlig,  K.,  Hartford,  B.A.S.,  Mahan-Taylor,  R.,  Morgan, M. J., & Reynold, D. W., “Developing pragmatic awareness: closing the  conversation”, ELT Journal, 45, 1991, 12 (4-15). 

[2] Bruce,  T.,  Early childhood education.  London:  Hodder  Headline Group, 2005. 

[3] David, M., Hei, K. & DeAlwis, C., “Politeness Strategies in Openings and Closings of Service Encounters  in Two Malaysian Government Agencies”, The Journal of the South East Asia Research Centre for Communication and Humanities, 4 (2), 2012, 17 (61-77). 

[4] Erickson, F., One function of proxemic shifts in face-to-face interaction, In A. Kendon, R. Harris, & M. R. Key (Eds.), Organization of behavior in face-to-face interactions, The Hague: Mouton, 1975. 

[5] Goffman, E., “On cooling the mark out: some aspects of adaptation to failure”, Psychiatry, 25, 1952, 13 (451-463). 

[6] Kendon, A.,  “The F-formation  system: The  spatial organization  of social encounters”, Man Environment Systems, 6, 1976, 6 (291-296). 

[7] Khadem,  A.  &  Rasekh,  E.  A.,  “Discourse  Structure  of  Persian Telephone Conversation: A Description of the Closing”, International Review of Social Sciences and Humanities, 2 (2), 2012, 12 (150-161). 

[8] Knapp,  M.L.,  Hart,  R.P.,  Friedrich,  G.W.,  &  Shulman,  G.M.,  “The rhetoric of goodbye: Verbal and nonverbal correlates of human leave-taking”, Speech Monographs, 40 (August), 1973, 17 (182-198). 

[9] Knapp,  M.,  Hall,  J.,  &  Horgan,  T.,  Nonverbal communication in human interaction, Harcourt College Pub, 4th ed., 1996. 

[10] LeBaron,  C.  D.,  &  Stanley,  E.  J.,  “Closing  up  Closings:  Showing  the Relevance  of  the  Social  and  Material  Surround  to  the  Completion  of Interaction”, Journal of Communication, September, 1976, 24 (542-565). 

[11] Lockard, J. S., Allen, D. J., Schiele, B. J., & Wiemar, M J., “Human postural signals: stance, weight-shifts, and social distance as intention movements to depart”, Animal Behavior, 26, 1978, 6 (219-224). 

[12] Martin,  S.  J.,  &  Chaney,  H,  L.,  Global  business  etiquette:  a  guide  to international communication customs, London: Praeger Publisher, 2006. 

[13] Martinez, R.E., “Accomplishing closings in talk show interviews: A comparison  with  news  interviews”, Discourse Studies,  5(3), 2003, 20 (283-302). 

[14] O’leary,  M.  J.,  &  Gallois,  C.,  “The  last  ten  turns:  Behavior  and sequencing  in  friends’  and  strangers’  conversational  findings”, Journal of Nonverbal Behavior, 9, 1985, 20 (8-27). 

[15] Pojanapunya, P. & Jaroenkitboworn, K., “How to say ‘‘Good-bye’’ in Second Life”, Journal of Pragmatics, 43, 2011, 12 (3591–3602). 

[16] Schegloff, E. A. & Sacks, H., “Opening up closings”, Journal of the International Association for Semiotic Studies, 8, 1973, 39 (289-327). 

[17] Summerfield, A. B. & Lake, J. A., “Non-verbal and verbal behaviors associated with parting”, British Journal of Psychology, 68, 1977, 4 (133-136). 

(The Board of Editors received the paper on 03/03/2016, its review was completed on 07/04/2016)

Page 101: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

98 Bui Trong Ngoan, Ho Thi Duyen

RULES OF SWITCHING MEANINGS TO FORM NEW WORDS WITH TWO METHODS OF METAPHOR AND METONYMY

IN THE SYSTEM OF MODERN VIETNAMESE

Bui Trong Ngoan1, Ho Thi Duyen2 1University of Education, the University of Danang; [email protected]

2Cao học Ngôn ngữ K28, Đại học Đà Nẵng; [email protected]

 Abstract - There always exist new things, phenomena, concepts in our society, which creates the introduction of new words. Therefore, the emergence of new word is a regular process of linguistics for the enrichment of Vietnamese. However, there are not many scientific studies of this issue. Meanwhile, two methods of changing metaphor and metonymy to create new words are very popular and play an important role in forming structure of new words. After carrying out the research, we find that the majority of new words which are formed by switching meaning use existing units, not potential units. In order to identify the object, show the features, characteristics, and states or operation of new things, Vietnamese people have used existing word units for combination based on associative relations. In addition, studying methods of word formation with metaphor and metonymy not only helps us exploit the depth of creating new word but also contributes to better understanding cognitive process as well as Vietnamese culture.

Key words - switch meaning; metaphor; metonymy; new words.

1. Introduction

Within  ten  recent  years,  together  with  the development in  economy,  society,  science,  technology  and  international contact, there has been a change in thinking and accordingly, there has been a considerable increase in Vietnamese words. It can be said that the appearance of new words is an usual growth  of  languages  in  general  and  of  Vietnamese  in particular to enrich languages. However, there has not been much  research  on  this  issue.  It  was  not  until  in  2008  that there  was  “A  dictionary  of  new  Vietnamese  words” compiled by Vietnam Language Institute. 

The  birth  of  the  dictionary  should  have  been  an opportunity  for  language  researchers  to  discuss  and investigate  new  words  but  it  was  not  the  case.  Therefore, discussion  about  the  formation  of  new  words  is  of  great scientific  value. 

In  Vietnam,  much  research  on  terminology  always mentions the concept of new words and their formation but there  has  not  been  a  thorough  study  of  new  words. Meanwhile,  two  methods  of  switching  meanings  to  form new  words,  namely  metaphor  and  metonymy,  are  very popular  and  play  a  key  role  in  forming  new  words.  In addition,  understanding  the  two above-mentioned  methods not  only  helps  to  exploit  the  depth  of  word  formation  but also  enhances  the  understanding  of  cognition  process  and Vietnamese  culture. 

For  the  above  reasons,  we  research  on  the  rules  to switch  meanings  to  form  new  words  with  metaphor  and metonymy  in  the  system  of  modern  Vietnamese  new words.  The  data  we  focus  on  is  the  vocabulary  in  “A dictionary  of  new  Vietnamese  words”  compiled  by Vietnam  language  Institute  in  2008  and  published  by  Ho Chi Minh city publisher. 

2. Rules to switch meanings to form new words with metaphor and metonymy

After  survey  and  investigation,  we  find  out  4  rules  to switch  basic  meanings  to  form  new  words  with  metaphor and  metonymy.  They  are  Metaphor-  a  popular  and diversified  method  to  switch  meaning;  metaphor  to  form new  meanings-  a  base  to  form  new  words;  metonymy-  a popular  method  to  switch  meanings  in  context,  and forming  new  words  by  combining  metaphor  with metonymy. 

2.1. Metaphor - a popular and diversified method to switch meaning

By  examining  the  system  of  modern  Vietnamese  new word in “A dictionary of new Vietnamese words” compiled by  Vietnam  language  Institute  in  2008,  we  see  that  most new  words  are  formed  by  switching  the  metaphoric meaning.  The  number  of  new  words  by  switching  the metaphoric  meaning  is  275  words,  accounting  for  78.2% while  the number of new words by switching the meaning with  metonymy  is  78  words,  making  up  21.8%.  This  is usual  with  any  vocabulary  system.  In  Vietnamese  as  well as  in  other  languages,  metaphor  and  metonymy  are  two popular methods to switch the meaning. Metaphor plays an important  role  in  forming  new modern Vietnamese  words, accounting  for a number 3.5  times  larger than  metonymy.. 

Based  on  the  similar  relationship  among  objects  and phenomena,  metaphor  forms  a  large  number  of  words, enriching  Vietnamese  vocabulary.  We  have  analyzed  in detail subtypes of metaphor which base on the similarity in form,  color,  function,  characteristics,  action…Most  people think  that  metaphor only exists  as  nouns and  noun  groups but this is no longer true. 

In the system of new words of modern Vietnamese, we have examined and found 173 words as metaphors based on the  similarity  in characteristics,  features,  actions and action ways. Of 173 words, 103 are metaphors of actions and action ways,  making  up  36.9%.  Considering  some  examples,  we can  see  the  abundance  and  diversity  of  the  method  of switching the metaphoric meaning to form new words. 

Metaphors based on  the  similarity  in characteristics  are metaphors  of  characteristics.  This  type  of  metaphor  is popular in noun groups, verb groups such as a golden goal, a  golden  hand,  red  spot,  fair  play,  unfair  play…  [8].  This type of metaphor accounts for 25.1%. Metaphors of actions are  ones  based  on  the  similarity  in  actions,  action  ways. This type of metaphor makes up 36.9%. 

Apart  from  the  abundance  in  sub  types,  metaphor  can 

Page 102: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 99

switch the meaning within the word. It means that only the meaning  of  one  or  two  words,  not  of  all  the  words,  are switched. For example, pillow cake, petrol tree, credit card, market  goods…  [8]. 

In  the noun  group Market goods,  only  the  meaning  of the  word market is  switched to mean cheap or low quality goods.  (Nowadays,  some  artists  claim  to  paint  market pictures but when their pictures are sent to the gallery, they are  still  copied  and  made  fake)  [8,  p.101].  In  the  group industrial concrete, only  the  meaning  of  industrial  is switched  to  mean  available, professional or fresh as  in fresh concrete [8,  p.14]. 

There are cases when the meanings of the whole group are switched. For example, the group the plan fails to mean unwanted pregnancy in (She knows well all the women in her  charge  and  detect  in  time  those  whose  plan  has  failed to  encourage  them  to  get  rid  of  pregnancy  early  to  keep their  health  safe)  [8,  p.272].  This  type  of  metaphor occupies  a  small  number). 

There are cases when the meanings of the new word are switched  with  metaphor  and  the  word  belongs  to  two subtypes. For example, the word áo phông (jumper), a kind of T-shirt made of cotton, with picture or word at the front or at the back [8,  p.2]  can  be  metaphor  based  on  the similarity  in  form  (phông)  or  based  on  the  similarity  in function  (áo).  Another  example  is  the  word  bán hoa (selling flowers: a prostitute) can be a metaphor of  feature (hoa: flower) or one of actions (bán: selling). Why the word bán hoa belongs  to  two  sub  types  of  metaphor  is  that  the meaning  of bán is switched as an action while the meaning of hoa is switched as a feature. 

Thus,  it  can  be  said  that  in  the  new  word  system  of modern Vietnamese, metaphor is a key and popular method to switch the meaning with different sub types. The number of  words  whose  meanings  are  switched  with  metaphor  in the new word  system of modern Vietnamese  is  very  large and  belongs  to  different  sub  types.  Sometimes,  the  same word,  the same group belongs  to different sub  types. 

2.2. Metaphor makes new meanings - a base to form new words

“Metaphor goes through our life. It exists not only in language but also in thinking and actions. The concept system based on which we think and act is metaphor in nature”.  Actually, metaphor plays  a very  important  role  in forming words. Together with examining new words whose meanings  are  switched  with  metaphor  and  metonymy,  we also  find  a  large  number  of  words  whose  meanings  are switched  without  being  new  words.  They  only  have  new meanings  and  are  also  called  multi-meaning  words.  We think  that  these  words  will  become  new  words  through change  and  meaning  switching.  Of  the  two  methods  of switching  meanings  with  metaphor  and  metonymy.  Nearly 100% words have their meanings switched with metaphor. 

For this reason, a part of our study is  for understanding the  meaning  switching  with  metaphor  to  form  new meanings without forming new words. 

Through  examination,  we  find  75  words  whose meanings are switched  to form new meanings as  shown  in 

table  1 

Table 1. Words with meanings switched to form new meanings

Parts of Speech   Number  Percentage (%) 

Noun  33  44 

Verb  25  33.3 

Adjectively  17  22.7 

Total  75  100 

Considering  some  examples  with  the  data  taken  from new word system of modern Vietnamese, we can see  their meaning  switching  better: 

“Bèo”  means  a  plant  living  in  the  water  which  can  be used  as  feed  for  animals  or  as  manure  (cutting  water-fern, cutting potato). “Bèo” also means  low price, very cheap as in  (I  didn’t  sell  the  thing  because  it  is  paid  at  a  vey  low price)  [8,  p.13]. 

Another  example  is  the  word  mềm  which  has  6 meanings, one of which  is new. The word is often used  in spoken  language  to  mean  at  a  reasonable  price  as  in  good quality  things  at  reasonable prices  [8, p.151]. 

These  words,whose  meanings  if  switched  another  time or combined with other words may become new words, for example,  “harvest  success”  (harvest);  “lose  some  shots  in row” (shots); (miss being on duty” (miss); father of Romeo and Juliet play  (father) [8]. 

It can be affirmed that the birth of “A dictionary of new Vietnamese  words”  is  very  necessary  to  explain  enquiries and  make  clear  these  new  words.  In  the  future,  with  the continual  change  to  meet  the  demand  for  communication, Vietnamese  will  become  richer,  more  diversified  because of the switched, changed and added meanings to make new words. 

2.3. Metonymy- a method to switch meaning in context

Through survey and statistics, we see that the number of words  whose  meanings  are  switched  with  metonymy  is much smaller than that with metaphor. In practical usage, the number  of  words  whose  meanings  are  switched  with metonymy is very large but through the survey with the new word system, the number is very small, of 78 words, making up 21.8%. What is the reason for this? The question attracts the  attention  of  many  language  researchers  who  study  the method of switching word meanings with metonymy. 

Let  us  consider  the  following  examples:  “lái” means “drive” “lơ” means “sub-drive”. The  meanings  of  these two  words  are  not  switched;  they  are  only  used  in  brief forms.  However,  when  we  say  “một lái”,  “một lơ”,  the same  way  as  in  “một đen”  “một sữa”  (a  cup  of  black coffee, a cup of brown coffee),  then the meanings of  “lái” “lơ” “đen” “sữa” are switched with metonymy based on the logic  relations  between  “job  and  job  doer”  “container  and thing  contained”.  Similarly,  the  word  “bảo  kê”  whose  old meaning  is  to  insure,  protect,  used  negatively,  now  means the  people  who  do  the  work  of  protecting.  Thus,  the meaning  of  “lái”, “lơ”, “đen”, “sữa”, “bảo kê”  in  a particular  context  is  switched  with  metonymy.  However, when  these  words stand  alone, out of context,  they do not have  switched  meaning  with  metonymy  any  more. 

Page 103: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

100 Bui Trong Ngoan, Ho Thi Duyen

Therefore, when these words appear in the dictionary, they only have their original meaning. 

From  the  above  analysis,  we  can  reach  the  conclusion that  the  process  of  switching  meaning  never  stops,  it always  continues  and  develops  in  different  ways. Metonymy  never stops  in a  fixed position  in vocabulary,  it continues in its own way in the language world. And it can be  denied  that  metonymy  becomes  more  vivid  in  context and  more  diversified  when  it  is  put  in  different  contexts. Our study of this issue has taken initial steps. We hope that there will be further research on this  issue. 

In  the  article  “Metonymy  from  the  perspective  of cognition” the writer Ta Thanh Nhan discussed: “Metaphor is  related  with  the  principle  of  selection  and  replacement on  the  basis  of  similarity.  Metonymy  is  related  with  the principle  of  combination  and  continuity  on  the  basis  of continuity.  According  to  structuralism,  metaphor  is  related with  the  change  axis  while  metonymy  is  related  with  the combination  axis  of  language”  [7,  p.47].  Now,  we  have realized  the  reason  why  the  number  of  new  words  whose meanings are switched with metonymy is smaller than that with  metaphor.  If  a  word  is  put  in  context  in  the combination  axis,  its  switched  meanings  with  metonymy will be  richer and  more diversified. 

2.4. Forming new words with the combination of metaphor and metonymy

New words can be formed not only with their meanings switched  with  metaphor  or  metonymy  separately  but  also with the combination of the two methods. 

Let  us  consider  the  example,  “bàn tay vàng”  in  “The contest has selected 54 contestants with golden hand.” means  “a  people  who  is  skillful  at  a  labour  or  technical operation”.  Thus  in  the  above  group,  the  word  “hand”  is switched  with  metonymy  to denote  a people and  “gold”  is switched  with  metaphor  to  denote  a  good  and  rare skill..Thus, metaphor is the key basis to switch the meaning of the group “bàn tay vàng” to make it become a new word. Previously,  this  change  appears  only  in  poetry,  when  the meaning  of  a  word  depends  on  context.  Now  the  change appears  in  common  vocabulary”. Hoa khuê các (flowers of nobility), bướm giang hồ (errant butterflies” is an example. 

There  has  been  a  change  in  word  formation  in Vietnamese.  It  is  influenced not only by  language change, word  borrowing,  language  interference  (Chinese,  English, French …) but also by western culture.  It  is  this  that  leads to  the  appearance  of  a  series  of  sentence  structures  of  the language.  “More than one flower have fallen” [6, p.30] or “fresh concrete”, “golden score”, “high technology”, “clean technology” [8] are examples of new structures. 

Besides  the  influence  of  languages,  western  culture  in the  way  of  thinking,  translating,  writing,  new  words  are also  affected  by  the  internal  change  of  Vietnamese.  In poetry,  there  appear  new  words  whose  meanings  are switched  with  the  two  methods  to  create  an  imagery  and figurative way of speaking,  then the birth of new words  is obvious. It  is  the natural development of  language. 

3. Conclusion

Vietnamese  is  developing  incessantly  and  identifying its  development  is  very  complicated.  However,  it  can  be affirmed  that  formation  of  new  words  cannot  be  without meaning  switching  In  the  study,  we  see  that  most  new words  which  are  formed  through  meaning  switching  use existing word units, not new ones. To name objects, denote features or characteristics, states or activity of new objects, Vietnamese  people  always  use  existing  words  for combination  based on  the  relationship of  connection. 

Apart  from  the  above-mentioned  rules  in  new  word formation,  there  are  other  rules  of  switching  meaning  in Vietnamese  new  word  system.  However,  they  are  not popular, so,  they are not mentioned  in our study. Together with the development of language with the timeline, we can affirm  that  the  appearance  of  new  rules  of  meaning switching  is  obvious.  Together  with  the  methods  of forming  new  words,  switching  meaning  will  become  the key  method  to  increase  Vietnamese  vocabulary.  Through the  study,  we  believe  that  word  metaphor  and  metonymy will make language develop more. They not only enrich the language  but  also  express  the  way  of  thinking,  way  of living and culture of a community, a people. 

We  hope  that  there  will  be  further  research  on  new word system in other aspects such as semantics, phonology and  grammar. 

REFERENCES

[1] Trần  Thanh  Ái  (2009), Dictionary of Borrowed Words of Modern Vietnamese, Hanoi National University Publisher. 

[2] Đỗ Hữu Châu  (2004), Textbook of Vietnamese Vocabulary.  Hanoi Education University Publisher. 

[3] Nguyễn Văn Khang  (2013), Foreign Words in Vietnamese.Ho Chi Minh University Publisher. 

[4] George  Lakoff.  &  Mark  Johnson  (2003),  Metaphors we live by, London: University of Chicago press, Chicago, USA. 

[5] Hoàng Phê (editor) (2010), Vietnamese Dictionary. Encyclopedia. 

[6] Trần  Đình  Sử  (General  Editor)  (2007),  Vietnamese Language, advanced 11, volume 2. Ho chi Minh city Publisher. 

[7] Tạ  Thành  Tấn  (2014),  “Metonymy from Perspective of Cognition (6BC/2014 VN), Science. Hanoi University of Education. 

[8] Language  Institute  (2008), Dictionary of Vietnamese New Words HochiMinhcityPublisher. 

(The Board of Editors received the paper on 02/06/2016, its review was completed on 10/06/2016)

Page 104: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 101

A STUDY OF SYNTACTIC AND LEXICAL FEATURES OF THE INTRODUCTION OF ENGLISH M.A. THESES IN LINGUISTICS

IN VIETNAM AND AUSTRALIA

Tran Thi Ngoc Phuong

University of Foreign Language Studies, The University of Danang; [email protected]

 Abstract - Based on the theories of discourse analysis, this study focuses on describing and analyzing typical discourse features of English language master thesis introductions in Australia (A-ELMTIs) and English language master thesis introductions in Vietnam (V-ELMTIs) in terms of syntactic and lexical features. From the investigation, we have found out their differences and similarities. With regard to syntactic features, it is evident that the largest differences are in the use of simple and compound sentences. Simple sentences are used with far greater frequency in V-ELMTIs than in A-ELTMIs, whereas there is more use of complex sentences in A-ELTMIs. Lexically, A-ELMTIs use a higher proportion of “contrast terms” and “quantifiers and quasi-negatives” than V-ELTMIs do. Meanwhile, the use of “contrast terms” and “negatives” is very low in both.

Key words - master’s (MA) thesis; discourse analysis; syntax; lexicon; English language.

1. Introduction

To get a master’s degree in a certain field, students usually write a  thesis  to fulfill the requirements of the course or  the degree, and hence, the introduction to theses plays an integral part in this process. It is the introduction that helps the readers decide  whether  they  are  interested  in  that  topic  or  will continue to read through the thesis or not. At the very least, introductions  consist  of  a  rationale,  aims  and  objectives,  a scope  of  the  study,  significance  of  the  study,  research questions and an overview of the structure of the thesis. 

Even  if  the  theses  are  written  in  English,  there  are differences  in  the  way  the  introductions  are  written  in universities in Vietnam and in Australia. For years, Australia is a country whose educational environment has attracted a great number of Vietnamese students. Therefore, in order to help  Vietnamese  students  to  undertake  research  or  write  a thesis  in  Australian  universities  with  less  trouble  and  less confusion, it is necessary to carry out research on this issue. Moreover,  research  on  the  differences  and  similarities between  English  Language  Master’s  Theses  (ELMTs)  in Vietnam  and  Australia  will  help  to  promote  training  in Masters of Arts in Linguistics in Vietnam to an international level in order to achieve a global educational standard. 

This study is part of a larger study that aims to analyze the  discourse  features  of  the  introductions  of  master’s theses  written  in  Englishin  the  field  of  linguistics  in Vietnam  and  in  Australia.  Due  to  space  limitations,  this particular  study  is  limited  to  describing  the  discourse features of  the introductions of  the  theses  in  terms of  their syntactic  and  lexical  features  in  order  to  illustrate  the potential  differences  in  writing  theses  in  different  regions even  when  the  same  language  is  used.The  syntactic  and lexical  aspects  are  less  obvious  than  the  layout  and structure,  but  research  into  other  types  of  documents suggests  that  differences  exist  [9],  hence  they  form  the focus of the current  study. 

2. Theoretical Background

2.1. Discourse analysis

Brown  and  Yule  [2,  p.iii]  describe  discourse as“language  in  use”  and  remark  that  “the  term  discourse analysis  has  become  to  be  used  with  a  wide  range  of meanings  which  cover  a  wide  range  of  activities  at  the intersection  of  many  disciplines  from  sociolinguistics, psychological  linguistics  to  computational  linguistics”. Based  on  concepts  proposed  by  Salkie  [10,  p.  ix],  Cook [5,  p.  156]  argues  that  discourse  is  “stretches  of  language perceived  to  be  meaningful,  unified  and  purposeful”. Furthermore,  Nunan  [7,  p.  5]  asserts  “Discourse  can  be defined  as  a  stretch  of  language  consisting  of  several sentences  which  are  perceived  as  being  related  in  some way. Sentences can be related not only in terms of the ideas they  share,  but  also  in  terms  of  their  functions”.In conclusion,  all  the  above  concepts  of  discourse  have mentioned  the  application  of  language.  Hence,  recently discourse  analysts  have  tended  to  base  their  research  on observing  language  usage  during  conversations  in sequences  of  sentences.  The  analysis  of  discourse  is, necessarily,  the  analysis  of  language  in  use.  As  such,  as Brown  and  Yule  argue,  it  cannot  be  restricted  to  the description of  linguistic forms independent of  the purposes or  functions  which  these  forms  are  designed  to  serve  in human relationships [2, p. 1]. 

2.2. Cohesion

Cohesion  can  be  thought  of  as  all  the  syntactic  and lexical links that connect one part of a text to another. This consists of the use of synonyms, lexical sets, pronouns, verb tenses, time references, grammatical reference, and so forth to help  to  sequence a  text and  link  ideas  and arguments  in the text. Halliday suggests that a text “has texture and this is what distinguishes it from something that is not a text… The texture  is  provided  by  the  cohesive  relation”  [6,  p.2]. Cohesion  refers  to  the  explicit  linguistic  devices  that  are expressed partly  through  the  syntax  and partly  through  the vocabulary.  In  other  words,  cohesion  consists  of  syntactic cohesion and lexical cohesion. While the term may be used in a much broader sense as well, in the context of the current study, the focus is on these two main elements. 

3. Method

3.1. Data Collection

The  introduction  texts  analyzed  in  this  study are  taken from a total of 30 ELMTs in Vietnam (15) and in Australia (15)  on  topics  related  to  linguistics.  All  theses  are  written in  English  and  include  a  chapter  entitled  “Introduction” ranging  in  length  from  700  -  1400  words.  Thesis 

Page 105: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

102 Tran Thi Ngoc Phuong

introduction samples are  those  in  the  library of, University of  Foreign  Language  Studies,  the  University  of  Danang and  the  University  of  Foreign  Language  Studies,  Vietnam National University,  Hanoi or  published online.  A  total  of 15  master’s  theses  are  obtained  from  Australian universities  in  the  field  of  linguistics  through  the  thesis collection  of  The  University  of  Queensland  and  through contacting both  teachers and students directly  in Australia. Authors  of  all  theses  in  Vietnam  are  Vietnamese  while authors  of  theses  in  Australia  are  varied  in  their  native languages  including  English,  Chinese,  Indonesian, Swedish and  Vietnamese. 

3.2. Data Analysis

After  collecting  the  data,  these  are  categorized  and divided  into  Australiansources  and  Vietnamese  sources. The introductions are analyzed in terms of the syntacticand lexical features using both both qualitative and quantitative methods.For  lexical  choice,  software  named  AntConc is used  to  count  the  tokens  (the  total  number  of  words),  and look  inside  that  for  the  types  (the  number  of  repeated words).  From  this,  it  is  possible  to  identify  the  range  of words  being  used  (type-token  ratio)  and  the  most frequently used words  in the theses. 

4. Results & Discussion

4.1. Syntactic Features

In this part, we would like to investigate some syntactic devices  used  in  Australian  thesis  introductions (A-ELMTIs)  and  Vietnamese  thesis  introductions (V-ELMTIs), particularly passive voice and sentence types. 

4.1.1. Voice in A-ELMTIs and V-ELMTIs

In  English,  the  passive  voice  is  a  syntactic  form  in which  the  subject  receives  the  action  of  a  transitive  verb, where  the  passive  sentence  emphasizes  the  process  rather than who  is performing  the action  [14]. Quirk  [9] suggests that  the  passive  voice  is  more  commonly  used  in informative  than  in  imaginative  writing.  The  get-passive often  reflects  an  unfavorable  attitude  towards  the  action [7]. Fortunately, only be-passive is found in our data as can be found  in  the examples  in Vietnamese thesis #14 [V-14] and Australian  thesis #4  [A-4]: 

(1)  The fact that little research has been done on discourse features of AdEs and little instruction has been given about it in academic writing course in Vietnam creates a need to have research on it. [V-14] 

(2) It was also found that the teacher tended to perceive the classroom environment that was more positive than they perceived as actually being the case. [A-4] 

Two  types of passive voice are  investigated  in  the  study; passive  with  purpose  and  passive  without  purpose.  In  this paper,  passive  voice  with  purpose  is  a  specific  passive voice  used  when  talking  about  the  aims  and  objectives  or placing the emphasis on the goal (e.g., I was fined 500.000 VND  for  speeding).  Meanwhile,  passive  voice  without purpose  is  a  general  passive  voice  which  moves  the emphasis  from  who  is  performing  the  action  to  the  object or  the  process.  (e.g., It is believed that  the  rising  oil  price will have a huge impact on  food prices). 

Table 1. Distribution of Passive Voice in A-ELMTIs and V-ELMTIs

Passive Voice A-ELMTIs V-ELMTIs

Occurrence % Occurrence %

With purpose  36  11.4  54  18.6 

Without purpose  279  88.6  237  81.4 

Total 315 100 291 100

The  rate  of  using  passive  voice  for  purpose  in  A-ELMTIs  and  V-ELMTIs  is  quite  modest,  accounting  for 11.4%  and  18.6%  respectively.  As  observed  and  analyzed from  the  data,  the  majority of  cases  of passive  voice  with purpose  are  used  to  point  out  the  aims  or  purposes  to conduct  the  theses  which  are  considered  as  an  essential requirement  for  any author. For  example: 

(3)  This study was aimed at developing and then observing the use of a computerized simulation as a language teaching tool which is designed to help learners to maintain motivation through their language study through involving them in meaningful interactions, thus encouraging learners to continue with their language studies. [A-1] 

(4)  The study is expected to investigate and describe syntactic features, lexical features and cohesive devices used in this type of discourse. [V-7] 

Meanwhile,  in  some  cases,  in  order  to  write  the introduction, authors  tend  to use  the passive  voice without purpose  to  emphasize  the  objects  or  certain  things mentioned. That  is  also  the  reason  for  this  kind of passive voice to be used very frequently in both ELMTIs, reaching 88.6%  and  81.4%  respectively.  For  example: 

(5) Action Research is also different to empirical research which tends to be done by a researcher on “subjects” who have little to do with the research process. [A-7] 

(6) Issues of personal, social, and cultural identity were challenged every day. [A-6] 

(7)  This absence of the mentioned above factors in identifying and recognizing the information organizing devices and the relationships between portion of pieces of information will be compensated by resorting the linguistic materials. [V-10] 

(8) This thesis is predicted to help learners and users of English understand and use tautologies properly. [V-13] 

To  sum  up,  in  the  current  study,  the  passive  voice  is used  predominantly  to  focus  on  the  object  rather  than  the goal  or  the  performer  of  the  action,  which  is  a  technique used quite  regularly  in  academic  writing. 

4.1.2. Sentence Types

According  to  Thorne  [12],  sentence  type  includes  four categories;  simple  sentences  (consisting  of  one independent  clause),  complex  sentences  (containing  one independent  clause  and  one  or  more  dependent  clauses), compound  sentences  (containing  two or  more  independent clauses  joined  together  by  a  coordinator,  conjunctive adverb or semicolon) and compound-complex sentences (a combination  of  two  or  more  independent  clauses  and  one or  more  dependent  clauses). 

Page 106: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 103

Table 2. Distribution of Sentence Types in A-ELMTIs

Sentence Types Sentences %

Simple  160  27.1 Complex  285  48.2 

Compound  69  11.7 Compound-Complex  77  13.0 

Total  591  100 

The  results  show  that  compound-complex  sentences appear  to  be  used  rather  modestly  in  A-ELMTIs, (i.e. 11.7% and 13.0% respectively),and simple and complex sentences are frequently used. It is quite surprising, however, that complex sentences are the most preferred in A-ELMTIs than  simple  ones,  and  that  they  account  for  the  highest percentage  of  48.2%  while  simple  sentences  make  up  a markedly smaller percentage of 27.1%. 

Table 3. Distribution of Sentence Types in V-ELMTIs

Sentence Types Sentences %

Simple  299  45.2 Complex  228  34.5 

Compound  72  10.9 Compound-Complex  62  9.4 

Total  661  100 

In  contrast,  in  V-ELMTIs,  compound  and  compound-complex  sentences  appear  with  modest  percentages (i.e.  10.9%  and  9.4%  respectively),and  simple  sentences are the most preferred in V-ELMTIs, making up the highest percentage  of  45.2%  with  complex  sentences  still accounting  for  a  comparatively  large  proportion  of  34.5%. 

4.2. Lexical Choice

Alo [1] defines lexis as “…the level of linguistic analysis and  description  concerned  with  the  way  in  which  the vocabulary of a language is organized”. In linguistics, Yeibo [13] describes lexis as the storage of language in our mental lexicon  as  prefabricated  patterns  that  can  be  recalled  and sorted into meaningful speech and writing. Thus, lexis, as a concept, has a distinct identity from other traditional  levels of  linguistic study or  interpretation,  as  it  refers  specifically to  the  word-stock  of  a  language  from  which  writers  and speakers make choices for self-expression according to their purpose or intended meaning.For the purpose of this study, the  following  linguistic  indicators  defined  by  Swales  and Feak  [11]  are  used  in  the  analysis:  contrastive  terms (i.e.  however;  yet;  while/  meanwhile;  but;  although; nevertheless),  quantifiers  and  quasi-negatives  (i.e.  limited; few; little) and negatives (none of; not been; no). 

4.2.1. Contrastive terms

A  concordance  search  is  conducted  and  examined  to determine the role of contrastive terms in the establishment of opposite statements, as listed  in  the table below. 

Table 4. Contrastive Termsused in A-ELMTIs and V-ELMTIs

Contrastive Terms

A-ELMTIs V-ELMTIs

Occurrence % Occurrence %

But    28  33.7  35  50 

However  23  27.7  16  22.8 

Although  6  7.2  7  10 

While/ meanwhile 24  28.9  8  11.4 

Yet    2  2.4  2  2.9 

Nevertheless  0  0  2  2.9 

Total 83 100 70 100

A  significantly  high  usage  of  “but”  is  found  in  both A-ELMTIs  and  V-ELMTIs,  making  up  33.7%  and  50% respectively.  “But”  usually  signals  two  types  of  contrast: (i)  “denial-of-expectation”  (what  is  expected  after  a reading of the first conjunct turns out not to be true from a reading  of  the  second);  and  (ii)  the  “marker  of  semantic contrast”  (Celce-Murcia  &  Larsen-Freeman,  [3]). “However” is  another  contrastive  term  used  frequently  in both ELMTIs with 23 instances (27.7%) in A-ELMTIs and 16  cases  (22.8%)  in  V-ELMTIs,  but  this  word  alone  does not guarantee a clear  indication of  the gap between  issues. With  nearly  the  same  number  of  examples  in  A-ELMTIs and  V-ELMTIs  (6  cases  and  7  cases  respectively), “although”  seems  to  be  a  popular  choice  after  “but, however, while” for the expression of knowledge when the authors  want  to  hedge  the  weaknesses  identified  in  the already  used  research  and  point  out  what  need  to  be studied. There  is  insufficient  space  to provide examples of all  of  the  sentences  types,  but  two  of  the  more  notable expressions  are “yet” and “nevertheless”.  There  are  only two  cases  each  for  A-ELMTIs  and  V-ELMTIs  for “yet”, and an example of each is given below. 

(9) It is interesting that people use incomplete sentences in conversations and even in written texts, yet they are still successful in communication; and that a set of separate sentences put together can make sense while correct sentences connected by lots of cohesive devices cannot. [V-11] 

(10)  Language loss research may be conducted in a variety of way. It may be studied in its sociocultural, political, pedagogical or psycholinguistic context; yet all aspects will deal with the competence-performance dichotomy as expressed in Chomsky’s model… [A-15] 

Two  clear-cut  cases  of  the  use  of  “nevertheless”  are found  in  V-ELMTIs  while  no  cases  are  found  in A-ELMTIs  to  express  opposing  ideas  as  in  the  following examples. 

(11) Nevertheless, the study of culture, especially cross-culture, is not recognized well enough in Vietnam. [V-6] 

(12) Especially, all risks of medicine are enumerated in advertisements so as to help people avoid unexpected reactions and allergies. Nevertheless, it is sometimes difficult to express medical terms in simple ways without changing their meanings. [V-9] 

The reason for  the lack of use of this expression in  the Australian theses is not clear, but it could simply be a result of the sample size in the current study. 

4.2.2. Quantifiers and quasi-negatives

According  to  Swales  and  Feak  [11,  p.258],  the  “most common way to indicate a gap is to use a ‘quasi-negative’ subject”.  Quantifiers,  such  as  the  following,  could  be helpful  in  pointing  out  the  shortcomings  of  the  previous research  and  thus  preparing  ground  to  accommodate  the current  work.  “Few”  and  “little”,  although  not morphologically  negative,  are  negative  in  meaning  and  in 

Page 107: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

104 Tran Thi Ngoc Phuong

syntactic  behavior.  There  is  a  different  trend  in  using quantifiers  and  quasi-negatives  in  A-ELMTIs  and  V-ELMTIs, as shown  in the table below: 

Table 5. Quantifiers and quasi-negatives used in A-ELMTIs and V-ELMTIs

Quantifiers and quasi-negatives

A-ELMTIs V-ELMTIs

Occurrence % Occurrence % 

Limited    4  26.7  5  41.7 

Few  8  53.3  0  0 

Little  3  20  7  58.3 

Total 15 100 12 100

In  particular,  while  “few” with  a  53.3%  occurrence seems  to  be  at  the  top  in  A-ELMTIs,  “Little”  which  is found  with  a  58.3%  occurrence  seems  to  be  at  the  top  in V-ELMTIs,  no  cases  of  “little”  are  found  in  the  A-ELMTIs.  Using  “limited”  is  one  way  to  show  that  other investigators’  work  or  the  scope  of  the  thesis  has  been limited  in  certain  ways  or  to  certain  areas,  and  thus  it  is intended  to  be  encompassed  by  the  present  research.  The word “limited” appear  four  times  in  A-ELMTIs  and  five times  in  V-ELMTIs.  Some  examples  of  usage  from  the sample are given below: 

(13) Of the relatively few studies that have specifically addressed the role of written autobiographical narrative, Pavlenko’s (1998; also Pavlenko&Lantolf, 2000) research is most relevant to mine. [A-11] 

(14) Many studies regarding the speech act of request, giving and receiving compliments, promising or addressing terms and so on have been carried out in Vietnam and in other interlanguage of English learners of different language backgrounds, but little attention is paid to the speech act of complaining. [V-4] 

(15)  However, research on the topic of language chunks is limited, particularly compared with studies in syntax, phonology, discourse and other aspects of second language acquisition (SLA). [A-14] 

The  role  of  limiting  the  scope  of  the  respective  areas being  described  is  very  clear  from  the  above  examples.  It can be contrasted with the  following  section. 

4.2.3. Negatives

The third category of the linguistic indicators studied in this  data  analysis  is  negatives.  As  Celce-Murcia  and Larsen-Freeman  [3,  p.196]  explain,“The  chief  use  of negatives  is  directed  at  a  proposition  already  in  the discourse”  and  they  are  used  more  to  respond  than  to initiate.  They  further  elaborate  that  one  might  assume  that the  negative  would  receive  prominent  stress  whereas  it  is reduced  to  mitigate  the  disagreement,  presumably  in  the interest  of  maintaining  social  harmony.  Negatives  are generally  known  to  be  used  for  pinpointing  something which  is  either  faulty  or  has  not  been  paid  sufficient attention  to.  One  would  then  assume  the  use  of  negatives as  a  natural  choice  to  pave  the  way  for  one’s  own  work. Contrary  to  this  speculation,  the  tendency  of  the  usage  of negatives  is  lower  here  when  compared  to  that  of conjunctions  and  quantifiers/quasi-negatives,  as  shown  in 

the  following  table. 

Table 6. Negatives used in A-ELMTIs and V-ELMTIs

Negatives A-ELMTIs V-ELMTIs

Occurrence % Occurrence % 

None    0  0  0  0 

Not been  2  100  3  100 

No  0  0  0  0 

Total 2 100 3 100

“None”  and  “no”  do  not  appear  in  any  of  the  thesis introductions, while “not been” occurs  twice in A-ELMTIs and  three  times  in V-ELMTIs. For example: 

(16)  There have not been a great number of computerised simulations documented to date, but the reactions of learners to the ones that have been utilised have been very positive so far. [A-1] 

(17)  In other words, complaining in an area that has not been researched much. [V-4] 

It might be thought that the use of “none” and “no” are too  definitive,  indicating  that  there  are  absolutely  no examples  of  research  that  have  been  conducted  before.  In both of  the examples  above,  “not been” has been  softened through  the  use  of  “a  great  number”  and  “much” respectively,  suggesting  that  there  are  studies  that  have been carried out before, although these may not necessarily be  described  in  the  introduction. 

5. Conclusion

This  study  describes  an  analysis  of  the  syntactic  and lexical  features  of  master’s  thesis  introductions  written  in English  in  Australia  and Vietnam  to  identify  if differences exist in ELMTIs written in these two different environments. With regard to syntactic features, it is evident that the largest differences  are  in  the  usage  of  simple  and  compound sentences.  Simple  sentences  are  used  with  far  greater frequency  in V-ELMTIs  than  in  A-ELTMIs, whereas  there is more use of complex sentences in A-ELTMIs. With regard to lexical choice, both ELMTIs in Australia and Vietnam use a  specific  number  of  “contrast  terms”,  “quantifiers  and quasi-negatives” as well as “negatives” to express opposite statements  among  related  issues.  In  particular,  A-ELMTIs use a higher proportion of “contrast terms” and “quantifiers and  quasi-negatives”  than  those  in  V-ELTMIs,  namely “contrast  terms” and  “negatives”, which are used at  a very low rate in both. 

Thesis writing is a specialized form of writing requiring knowledge  of  not  only  vocabulary  and  syntax  but  also  of discourse  features.  While  similar  findings  appear  in  other types  of  documents  [9],  it  should  be  pointed  out  that  the purpose is not to distinguish ELMTIs from other genres, but rather to shed light on thesis introductions written in English in  different  environments.Through  investigating  the discourse features of A-ELMTIs and V-ELMTIs, learners of English who intend  to pursue a master’s degree  in English linguistics  can gain a better  understanding of  how to  write their theses and of the potential variations that might exist. It is  hoped  the  research  can  contribute  to  our  knowledge  of typical discourse features in writing of this kind. 

Page 108: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 105

REFERENCES

[1] Alo, M. (1995), Applied English Linguistics: An Introduction, Port-Harcourt. Aeddy Link. 

[2] Brown,  G.  &Yule,  G.  (1983),  Discourse  Analysis,  Cambridge University Press. 

[3] Celce-Murcia,  M.  &  D.  Larsen-Freeman  (1999),  The  Grammar Book, 2nd ed. Boston: Heinle and Heinle. 

[4] Choudara, R. &Kono, Y. (2012). Beyond more of the same: The top four emerging markets  for  international student  recruitment. World Education News & Reviews, 25 (9).  Retrieved  from http://papers.ssrn.com/sol3/papers.cfm?abstract_id=2187362. 

[5] Cook, G. (1998), Discourse, Oxford University Press, Oxford. 

[6] Halliday, M.A.K. & Hasan, R. (1989), Language, context, and text. Oxford University Press, Oxford, UK. 

[7] Nunan, D. (1993), Introducing Discourse Analysis, Penguin English. 

[8] Pennycook,  A.  (2013).  The  Cultural  Politics  of  English  as  an International Language. Routledge, New York. 

[9] Quirk, R et al.  (1985), A Comprehensive Grammar of  the English Language, London: Longman. 

[10] Salkie, R. (1995), Text and Discourse Analysis, Routledge, London & New York. 

[11] Swales,  J.M.  &  C.  Feak  (2004),  Academic  Writing  for  Graduate Students.  Essential  Tasks  and  Skills,  2nd  ed.  Ann  Arbor:  The University of Michigan Press. 

[12] Thorne,  S.  (1997),  Mastering  Advanced  English  Language, Macmillan press. 

[13] Yeibo,  E.  (2011),  “Patterns  of  Lexical  Choices  and  Stylistic Function in J.P. Clark-Bekederemo’s Poetry”, International Journal of English Linguistics, 1 (1), 138. 

[14] http://en.wikipedia.org/wiki/English_passive_voice#Usage_and_style 

(The Board of Editors received the paper on 05/10/2015, its review was completed on 20/01/2016)

Page 109: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

106 Ho Trinh Quynh Thu

MOVEMENT TERMS IN ENGLISH AND VIETNAMESE CONCEPTUALLY METAPHORICAL EXPRESSIONS OF LOVE

Ho Trinh Quynh Thu

PhD Candidate, University of Foreign Language Studies, The University of Danang; [email protected]

 Abstract - Movement has a tremendous impact on human actions and thoughts because it is closely attached to our daily activities. As a result, terms of movement play an important role in expressing changes in both physical and emotional worlds, including love. Love becomes more vivid and diversified thanks to the terms of movement, which is a result of our investigation under the light of the conceptual metaphor theory raised by Lakoff and Johnson. Examining more than 700 terms of movement in metaphorical expressions of love extracting from 254 English poems and the same number of Vietnamese ones, we have found out that all the key conceptual metaphors of love are similar between English and Vietnamese. Interestingly, a lot of linguistic metaphors are also the same in the two languages. These resemblances may be put in plain words by the universality of metaphor. However, coming from two different cultures, some terms of movement in metaphorical expressions of love are found different between English and Vietnamese.

Key words - metaphor; conceptual metaphor; metaphorical expressions; movement terms; English; Vietnamese

1. Introduction

While other sciences study the nature and the operation mechanisms of love, linguistics studies how the concept of love  is  expressed  via  language.  In  fact,  for  lack  of  an adequate  vocabulary  to  clearly  explicate  and  discuss  the abstract  idea  of  love,  our  language  utilizes  metaphors  that draw  from  concrete  experience  as  a  means  to  relate  this emotion  in  understandable  terms  [3]. Love  is  thus  perhaps the most highly “metaphorized” emotion concept and more and  more  attractive  to  researchers. 

Based  on  the  conceptual  metaphor  theory  raised  by Lakoff  &  Johnson  [9]  and  the  typical  English  love metaphors Lakoff & Johnson [9], Lakoff [8] and Kövecses [3]  offer,  the  conceptual  metaphor  of  love  has  been  more examined  in  monolingual  (i.e.  English,  Chinese, Hungarian, Vietnamese,...) or bilingual  (i.e. English versus such  another  as  Chinese,  Persian  or  Vietnamese)  data  in different  registers  (e.g.,  psychology,  literature  in  general, poetry,  song  lyrics,  …).  Several  researches  have  also proved  the  universality  and  variation  of  the  conceptual metaphors  of  love  in  different  languages  [4;  13;  14]. However,  we  have  not  found  any  study  relating  to movement terms  metaphorically  used  to  conceptualize love, which will be studied in details in this paper. 

Among  many  senses  of  love,  romantic  love  -  the  love between  male  and  female  -  provides  one  of  the  most powerful  motivations  for  human  action  [1].  Therefore  in the  limitation  of  this  research,  we  only  focus  on investigating this kind of love. 

2. Theoretical background

2.1. Metaphor and metaphorical expressions

Unlike  traditional  views  treating  metaphors  as  a linguistic  phenomenon,  a  product  of  outstanding  talents, cognitive  approach  shows  that  metaphor  is  a  ‘property  of 

concepts’  [5];  and  that  ‘locus  of  metaphor  is  thought’  [8]. It  is  pervasive  in  our  everyday  way  of  thinking,  speaking and  acting  [8]. 

Metaphor  in  the  light  of  cognitive  view  is  called cognitive  or  conceptual  metaphor.  Its  working  mechanism is a cross-domain mapping which is defined as “a fixed set of ontological correspondences between entities in a source domain  and  entities  in  a  target  domain”  [7;  8].  The cognitive  mappings  of  metaphors  are  tightly  structured, asymmetric,  unidirectional,  partial  based  on  daily experience  and  have  a  definite  structure:  TARGET-DOMAIN  IS/AS  SOURCE-DOMAIN  [8]  (Figure  1). 

Figure 1. Conceptual mapping

In  the  mapping,  linguistic metaphors  (or  metaphorical expressions)  are  what  expressed  by  language;  and conceptual metaphor  (or metaphorical concept)  refers  to a mental  representation  describing  how  two  words  or expressions  from  apparently  different  domains  may  be associated at an underlying cognitive level. Let us consider the instance of the metaphor LOVE IS/AS A JOURNEY. In this metaphor, “LOVE IS A JOURNEY” is the name of the mapping  or  conceptual  metaphor;  LOVE  is  the  target domain, JOURNEY is the source domain; such sentences as We can’t turn back now [8] and Đôi ta lên thác xuống gềnh (Ca dao) (We are up hill and down dale) [14] are individual linguistic metaphors or metaphorical expressions. 

2.2. Identification of metaphorical expressions

Identification  of  linguistic  metaphors  is  an  important step  in  the  procedure  for  studying  metaphors  because  to know the existence of conceptual metaphors in a discourse, we need to know which linguistic metaphors point to them [5].  It  helps  ensure  the  reliability  and validity  of  the  study results.  In  this  study,  we  will  apply  the  approaches  to metaphor  identification  raised  by  Pragglejaz  Group  [11] and  the extension of Pragglejaz’s procedure  including four steps:  (1)  Read  the  entire  text–discourse  to  establish  a general understanding of  the meaning. Next,  (2) determine the  lexical  units  in  the  text–discourse.  Then  (3)  take  into account  what  comes  before  and  after  the  lexical  unit, determine  if  it  has  a  more basic  contemporary  meaning  in other  contexts  than  the  one  in  the  given  context.  If  yes, decide  whether  the  contextual  meaning  contrasts  with  the basic  meaning  but  can  be  understood  in  comparison  with it. If yes, (4) mark the lexical unit as metaphorical. 

Page 110: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 107

3. Research methodology

3.1. Data collection

The  data  for  investigation  are  collected  from  eight English  and  Vietnamese  poetry  books  with  254  poems  in each  language.  They  are  all  about  love,  the  matter  we  are interested  in  and  possibly  regarded  as  equivalent  in composing  time (during  the 20th century).  In English,  they are Love poems by  Jason  Sturner, Love poems  (vol.1)  by Bobette Bryan, Love poems by Nicolas Gordon, Heart clips by  Alan  Harris  and A collection of 100 greatest poems by many authors.  In Vietnamese,  there are Bởi vì ta yêu nhau by many authors, Thơ tình nữ thi sĩ Việt Nam by Kiều Văn, Xuân Diệu: Ông hoàng của thơ tình yêu by Hà Minh Đức. 

3.2. Research methodology

To  carry  out  this  study,  we  employ  descriptive, statistical  and  comparative  methods.  They helps  us analyse,  understand  and  synthesize  love  metaphorical expressions,  discover  the  cultural  features  that  have  an effect  on  expressing  love  metaphors  and  determine  the similarities  and  differences  of  love  metaphorical expressions  between  English  and  Vietnamese. 

4. Findings and Discussion

4.1. Findings

After  investigating  the  poetry  books  above,  we  find over  700  metaphorical  expressions  of  love  (encompassing 366  English  and  360  Vietnamese  ones).  They  are  rather diversified and manifested in Tables 1 and 2. 

Table 1. Word classes (WCls) expressing movement in English love metaphorical expressions

WCls No Expressions

Verb  244 

course,  drip,  flow,  instil,  stir,  swirl,  lock, catch,  release,  melt,  consume,  drift,  stop,  go, come,  enter,  back,  bend,  depart,  dip,  lose, miss, bear, sail, scale, wait, roam, alter, reach, give,  receive,  accept,  soar,  step,  run,  move, follow, pound, linger, … 

Noun  11 turn,  turning,  journey,  giving,  exchange, conceal,  parting 

Adjective  5  wandering, slow, unreachable, given Preposition  22  into, off to, past, through, from … to, down, across 

Others  84 free from, channel through … into, fall in, take …to,  skip  a  beat,  fall  apart,  go  away,  break  from,betray … out of, bring … to, carry off, come off,…

Table 2. Word classes (WCls) expressing movement in Vietnamese love metaphorical expressions

WCls No Expressions

Verb  252 

thả, vuột khỏi, chắt lọc, chảy, chìm, chuốc, lạc, cuộn,dốc, hút,  tát,  tràn, ngả  nghiêng,  luyến,  rơi,  xuống,xuôi, trộn, đi, đến, ở lại, ùa, đuổi, xuyên, ẩn, bỏ, chạy,chờ, nằm, nâng, ở lại, ra đi, rón rén, sinh sôi, về, trao,bước, dẫn dắt, chen, đỗ, đợi, gặp, nổi trôi, ra… 

Noun  2  quán tính, chuyến hành trình 

Adjective  8  ào ạt, bất biến, chậm 

Others  98 thổi bùng, xoay tròn, chìm lặn, băng qua, bỏ … đi, bước (đến, lùi, ra, tới, vào, xuống), cưỡi sóng, tan vào, đi cùng, đưa về, len vào, quay trở lại,… 

Underlying  these expressions are five major conceptual metaphors  of  love  in  both  English  and  Vietnamese.  They include  the  source domains  namely object,  journey,  living 

organism, container and  unity. 

4.2. Discussion

4.2.1. Terms of movement in English and Vietnamese metaphorical expressions of love

Movement  is  defined  as  the  act  or  process  of  moving; especially,  change  of  place,  position  or  posture  [2]. In  this part, we focus on discussing how movement terms are used in  linguistic  metaphors  of  love.  First,  let  look  at  the following  example, 

(1) And love burst into bloom, with a very special fragrance 

(Martin  Johnson, Surprised by love) 

In  this  verse,  the  verb  “burst”  describes  the  process  of changing love shape. The preposition “into” perhaps makes a decisive contribution to this change and the final product is bloom.  It  is movement. The movement  may change  the look (as in example 1) and the structure inside as well. 

(2) There's a batch of romance 

now simmering in the heart 

  (Jason  Sturner, A holiday for the heart) 

It is interesting to find that via the conceptual metaphor LOVE IS  A  CONTAINER,  the  love  in  (2)  is  expressed  as some fluid that is filled in the heart by the term “simmer”. This  verb  is  additionally  defined  as  to  cook  something  so that it is almost boiling [2]. As such, love here may also be conceptualized as fire. When it is said to be simmering, the love is gradually changing its inner structure and towards a complete  alternation  of  its  appearance.  In  other  words,  the movement  of  the  elements  inside  love  produces  the changes  of  its  posture.  Yet,  it  is  difficult  to  realize  this moving process until  the  final  product  appears. 

Contrary  to  this  type  of  movement,  the  act  of  moving from  one  place  or  position  to  another  may  be  easier  to realize.  Following  are  some  such  instances. 

(3) Love loves not lust, but finds its joy in giving: 

Pleasure,  yes, but passion slowly  fades. 

(Nicholas  Gordon, Please don’t mind) 

(4) We do not need gold coins 

when  love comes without  cost 

(Jason  Sturner, About love) 

(5) We fell in love the best way, sight unseen 

Pure hunger than nor feast nor flesh could sate, 

Two hidden  flames  fair fed by phrases burning 

(Nicholas  Gordon, We met…) 

(6) The dream  seemed  impossible, 

far away ... unreachable. 

(Bryan B., Sailing On Dreams of You) 

In  all  four  stanzas  above,  there are  changes of position of  love  or  of  the  persons  in  love.  In  (3)  and  (4),  love  is personified,  so  it  can come and find its joy in giving. Both the  noun  “giving”  and  the  verb  “come”  imply  changed positions.  If  the  position  of  love  in  (3)  alters  when  it  is given from one to another, the love in (4) changes its place by  itself. Meanwhile,  the  movement  in  (5)  and  (6)  is  done by  the persons who are  in  love; and  love  is  the destination they  like  to  reach.  The  phrasal  verb  “fall  in”  describes  a 

Page 111: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

108 Ho Trinh Quynh Thu

process of moving from a higher position toward the inside of  something  lower.  Accordingly,  someone  falls in love, which  arouses  an  image  of  that  he  is  sinking  inward  love. However,  whether  the  result  of  this  love  is  the  goal  the couple arrives at or it is just a dream that is never reachable as  in (6). The missing  feeling appears to be a general state of  mind  that  everybody  in  love  may experience once  they cannot have their expected love, which explains  the reason why we can also find it in Vietnamese. 

(7) Dẫu biết lòng vẫn yêu em 

  Nhưng anh đã đi sau một bước. 

Anh không nỡ làm khổ đau người đến trước. 

Đành hẹn em thôi ở kiếp sau này. 

(Though  my  heart  still  loves  you,  I  have  to  make  a promise  for  the  next  life  to  see  you  first.  I  decide  to  give this opportunity  to the person coming to you before me) 

(Thanh Tùng, Đành hẹn) 

Moving  terms  in  this verse are applied  to  relate  lovers’ acts, including the verbs đi (go) and đến (come). When they are  in  love,  the  couple  always  dream  of  going  with  each other  to  the  end  of  their  lives.  Nevertheless,  just  a  slow-paced  step,  the  dream  vanishes,  the  opportunity  has belonged  to  another. 

It can be said that an everlasting love is always couples’ desires;  however,  everything  sometimes  seems  unlike  the expectation: 

(8) Khi tất thảy sự si mê đã hết 

Chợt thấy trái tim em 

Như hòn cuội bẽ bàng 

Anh lia nó vào bên đường cát bụi 

Ai nhặt nó lên như trái tim vàng? 

(When all passion runs out, I feel ashamed that my heart is  like  a  stone  you’ve  thrown  to  a  dusty  roadside;  but regarded as a gold heart, it  is picked up by another.) 

  (Nguyễn Thị Thu Hương, Ai?) 

The image “heart” is a symbol of love in many different cultures. It stands for the woman’s love in this stanza. This love has just completed an unexpected travel from a man’s hand  to  the  roadside  and  finally  to  another  man’s  hand. Thanks to the words lia … vào (throw  to), nhặt … lên (pick up),  we  can  catch  a  passive  movement  the  love experiences.  Anyway,  the  end  of  this  love’s  journey  is fairly  good;  therefore,  let  receive  it  without  hesitation. 

(9) Hãy yêu đi khi tình yêu đã đến 

(Let’s  love once love arrives) 

(Thanh Tùng, Yêu để đời thêm yêu) 

Different from (8) where it can only change its position due to the impact from its outside, the love in (9) can move without any help. Structuralized as a living organism, love can  come.  It  is  verb  “đến”  (arrive)  that  gives  us  such comprehension. 

As  mentioned  above,  everyone  always  desires  for  an eternal  love  where  they  are  able  to  live  forever  with  their beloved. Also  in  this aspiration, Xuan Dieu conceptualizes love as a unity of wave and shore in which he is waves. 

(10) Anh xin làm sóng biếc (…) 

  Cũng có khi ào ạt 

  Như nghiến nát bờ em 

(I wish to be waves (…) sometimes impetuous as if they could grind  the shore  into flour) 

  (Xuân  Diệu, Biển) 

The Vietnamese adjective “ào ạt” (impetuous) in these lines refers to strong and quick movement. This adjective, on the one hand, tells us one of the features of waves, corresponding to the impetuosity  of  a  man  in  love.  On  the  other  hand,  “ào  ạt” represents the man’s violent love for the woman he loves. 

In  general,  movement  terms  are  used  in  metaphorical expressions  of  love  are  popular  in  both  English  and Vietnamese  poetry.  Due  to  these  terms,  love  becomes diversified  and  more  concrete.  There  are many  similarities found in English and Vietnamese movement terms used for love expressions. However, born in different cultures, these terms relatively vary in the both languages. We will discuss these problems right in the next part. 

4.2.2. Universality and variation of using movement terms in English and Vietnamese love metaphorical expressions

The  act  of  moving  can  be  found  in  both  English  and Vietnamese  metaphorical  expressions  of  love.  The  word kind  mainly  used  to  describe  movement  is  verb  (66.67 percent  in  English  and  70  percent  in  Vietnamese)  though we also discover some other classes of words employed for movement  in love linguistic metaphors (see Tables 1, 2). 

As mentioned above, movement terms used  in linguistic metaphors mainly belong to five concepts in both English and Vietnamese  including  object,  journey,  living  organism, container  and  unity  (see  Table  3).  Interestingly,  object  and journey are two concepts topping the others in both languages. Object is used the most frequently in English and ranks second in Vietnamese. Conversely, journey tops in Vietnamese and follows object in English. These analogies may be illuminated by the universality of conceptual metaphors. 

Table 3. Five major conceptual metaphors for love in English and Vietnamese

LOVE IS … ENGLISH VIETNAMESE

frequency  %  frequency  % OBJECT  124  33.88  102  28.33 

JOURNEY  105  28.68  121  33.61 LIVING 

ORGANISM 63  17.21  31  8.61 

CONTAINER  24  6.56  29  8.05 UNITY  11  3.01  44  12.22 

OTHERS  39  10.66  33  9.17 

Surprisingly,  besides  the  source  domains,  English  and Vietnamese  also  share  linguistic  metaphors  of  love  that contains  movement  terms. They  may  be  the  motion  verbs (e.g., go – đi, come – đến, run – chạy, bring – mang đến…) utilized  to personify  love;  for  example, 

(11a) Love  … comes and goes as  it  decides 

  (Nicholas  Gordon, Love is like cat) 

(11b) Tình yêu đến, tình yêu đi, ai biết! 

(One guesses  if  love comes and goes!) 

  (Xuân  Diệu, Giục giã) 

Page 112: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 109

Love  is additionally conceptualized as an object whose position may be changed by the actions of sending, giving, receiving, taking in English and cho, gửi, trao, tặng, nhận, lấy in  Vietnamese. 

(12a)  I give you my heart 

  (Bryan, True love) 

(12b) Ngậm  ngùi tặng trái tim lưu lạc 

  (Grieved at giving you my drifting heart) 

  (Xuân  Diệu, Muộn màng) 

Beside the similarities, there still exist some differences in using movement terms between English and Vietnamese love  metaphorical  expressions. They  may  be  results  of  the distinctions  of  customs,  habits  and  lifestyles  that  poets  in different  cultures  go  through. 

Although  two  languages  share  the  same  conceptual metaphors, their frequency is not the same (see Table 3). As mentioned  above,  while  OBJECT  metaphor  ranks  first  in English  with 33.88 percent,  it  ranks  second  in  Vietnamese with 28.33 percent. The leader in Vietnamese is JOURNEY metaphor  (making  up  over  33  percent),  but  it  follows OBJECT metaphor in English with 28.68 percent. The third frequent metaphors are LOVE IS A LIVING ORGANISM (accounting  for 17.21 percent)  in English and LOVE IS A UNITY in Vietnamese (over 12 percent). 

These differences may be caused by cultural distinction. Influenced  by  industrial  culture,  the  Westerners  (including Northern  American  and  Western  European)  are  usually  in favour of materialism. This explains why  the largest part of English love metaphorical expressions comes from the source domain  of  object.  On  the  other  hand,  Western  cultures conceive love as personal and internal experiences [12]. It is the result of a person’s private wishes and desires; that is, love is  coveted  by  virtue  of  a  person’s  personal  benefit.  In consequences, once this benefit is not met, love will no longer exist; and the two persons in love will also not be a couple as a unity. Meanwhile, the Vietnamese believe in God and fate [10].  When  two  persons  are  in  love,  they  think  it  is  their predestination. They are bound together in love and marriage with a red thread by matchmaker God. Therefore, they tend to make every effort  to maintain  their  relationship despite any difficulties or obstacles. It may be the reason for journey and unity metaphors to be more common in Vietnamese poetry. 

In  addition,  examining  the  love  metaphorical expressions,  we  discover  some  interesting  distinctive characteristics between English and Vietnamese. Let us look at  the  following  extract  as  an  example  where  Vietnamese love does an action that cannot be found in English; 

(13) Lòng ta hãy ôm trong như giếng tạnh 

Nước vẫn sâu khơi mà bờ vắng lạnh; 

Tình! Chính ngươi đến soi mặt, êm sao! 

  Thả gàu múc nước,  rúng  trăng sao. 

(My  heart  is  like a  well deserted but  with  fresh  water; Love! you come with it to look your face, which makes me pleasant; but your scooping water makes a disturbance here) 

  (Xuân  Diệu, Con sáo sang sông)  

The actions of “đến soi mặt” (coming to look at its face in  a  well) and  “thả gàu  múc nước”  (scooping water out of a  well)  are  imbrued  with  Vietnamese  culture.  Along  with banyan-tree  and  public  court,  well  is  very  important  and characteristic  in  Vietnamese  traditional  villages;  it  is  also the  beginning  place  of  love  [15].  As  a  result,  it  cannot seemingly  be  found  anywhere  accept  Vietnam. 

5. Conclusion

As  an  abstract  domain,  love  is  fairly  variably described thanks to metaphors with movement terms in both English and Vietnamese. A majority of these terms are expressed by verbs. 

Because  of  the  universality  of  metaphor,  love  is uncovered  to  be  conceptualized  in  five  similar  source domains in the two languages namely object, journey, living organism, unity and container. Besides the same conceptual metaphors,  both  languages  also  share  many  linguistic metaphors,  which  can  be  explained  by  Kovecses’s  [6] argument:  ‘there may be some universal basis  for the same metaphors to develop in the diverse languages’. 

Despite  the  universality  of  love  conceptual  metaphors in English and Vietnamese,  there  are still  some variations. While  following  the  OBJECT  in  English,  JOURNEY metaphor  is  the  leader  in  Vietnamese.  In  addition,  some terms of movement used in Vietnamese love metaphorical expressions are not found in English. These differences can be  regarded  as  results  of  cultural  distinctions. 

REFERENCES

[1] Bartels  A.  and  Zeki  S.,  “The  neural  correlates  of  maternal  and romantic love”, Neuro Image, 21, 2004, 1155– 1166. 

[2] Encyclopedia  Britannica  Company, Merriam-Webster Collegiate Dictionary, 11th Edition, 2010. 

[3] Kövecses Z., Metaphor and Emotion: Language, Culture, and body in human feeling, Cambridge: Cambridge University Press, 2000. 

[4] Kövecses Z., “Universality and Variation in the Use of Metaphor”, The 2006 and 2007 Stockholm Metaphor Festivals,  Eds. Johannesson  &  Minugh,  2008,  51–74,  Stockholm:  Department  of English, Stockholm University. 

[5] Kövecses  Z.,  Metaphor: A Practical Introduction,  2nd  Edition, Oxford: Osford University Press, 2010. 

[6] Kövecses  Z.,  “Metaphor  and  Culture”,  Acta Universitatis Sapientiae, Philologica, 2(2), 2010, 197-220. 

[7] Lakoff  G., Women, Fire,  and Dangerous Things: What Categories Reveal about the Mind, University of Chicago Press, 1987. 

[8] Lakoff G., The Contemporary Theory of Metaphor, Second Edition, Cambridge: Cambridge University Press, 1993. 

[9] Lakoff G. and Johnson M., Metaphors We Live By, The University of Chicago Press, 1980. 

[10] Norenzayan A.,  Lee A.,  “It was meant  to happen: explaining cultural variations in fate attributions”, J Pers Soc Psychol, 98(5), 2010, 702-720. 

[11] Pragglejaz  Group,  “MIP:  A  Method  for  Identifying  Metaphorically used Words in Discourse”, Metaphor and Symbol, 22(1), 2007, 1-39. 

[12] Tessari H., “Love in words: Experience and conceptualization in the modern English  lexicon  of  love”,  Perspectives on Variation: Sociolinguistic, Historical, Comparative, Delbecque N., Auwera J. & Geeraerts D.  (ed.), 2005, 143-176, Berlin & New York: Mouton de Gruyter. 

[13] Zitu  Lv.,  “Universality  and  Variation  of  Conceptual  Metaphor  of Love  in  Chinese  and  English”,  Theory and Practice in Language Studies, Vol. 2, No. 2, 2012, 355-359. 

[14] Phan Văn Hòa, Hồ Trịnh Quỳnh Thư, “Ấn dụ ý niệm ‘Tình yêu là cuộc hành trình’ trong tiếng Anh và tiếng Việt”, Tạp chí Ngôn ngữ và Đời sống, 9(191), 2011, 15-19. 

[15] http://vanhoagiaoduc.vn/bao-van-hoa-giao-duc-thu-vi-gieng-lang-13265.html 

(The Board of Editors received the paper on 01/15/2016, its review was completed on 03/23/2016)

Page 113: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

110 Le Thi Phuong

IDENTIFICATION OF THE FREQUENCY OF DRUG RESISTANCE MUTATIONS OF HELICOBACTER PYLORI IN GASTRIC PATIENTS IN HAI DUONG

PROVINCIAL GENERAL HOSPITAL

Le Thi Phuong

Hai Duong Medical Technical University; [email protected]

 Abstract - In this study, 131 gastric biopsies were taken from patients with gastritis who came to Hai Duong Provincial General Hospital for examination and treatment by request from January 2015 to July 2015 and they met the criteria: i) aged from 18-80; ii) infected with chronic gastritis, ulcer or gastric cancer; iii) not using antibiotic for a month before endoscopy. These patients were taken for endoscopy to have endoscopic biopsy samples at the antrum, body and edge of the gastric ulcer, organizations suspected of contracting stomach cancer. These DNA gastric biopsies were extracted and the 23S rRNA gene was amplified to detect Helicobacter pylori (H.pylori). The 23S rRNA gene in patients with H.pylori positive was sequenced to determine mutation related to anti-drug of H.pylori. The results have shown that 58 of 131 (44.2%) gastric patients were infected with Helicobacter pylori and 15 of 58 (25.8%) patients with Helicobacter pylori infection were found to have mutations.

Key words - Mutation; Helicobacter pylori; Drug Resistance; Frequency; Gastric Ulcer.

1. Introduction

Gastritis  is  a  pathological  condition  that  is  relatively clear,  causing  mucosal  irritation  by  exogenous  or endogenous factors. H. pylori is known as a major cause or culprit  of  chronic  gastritis,  peptic  ulceration  and  is  the strongest known risk  factor for gastric cancer, especially in developing countries  [5, 7]. Many studies have  shown  that H. pylori  is  the  leading  cause  of  pre-gastric  cancer  and gastric  cancer  [8].  People  with  H.pylori  infection  increase the risk of gastric cancer 6 times higher than normal people. 

In  recent  years,  gastric  diseases  related  to  H. pylori have been treated by using a regimen of anti- acid secretion and antibiotic  in Vietnam as well as many countries  in  the world.  In  fact,  the  appearance  of  drug  -  resistance  of H.pylori strains  has  reduced  the  effect  of drug  eradication, so  many  patients  were  in  the  wrong  treatment  of H.pylori eradication  or  incomplete  treatment. 

Amoxicillin  (Amox)  and  Clarithromycin  (Cla)  are frequently  used  in  the  treatment  of  H.pylori  eradication (Dr.  Nguyen  Van  Thinh,  2010  -  Hospital of Post and Telecoms), 23.7 % were  found drug  -  resistant of H.pylori, much higher than other countries in Europe, America, West Asia, Hong Kong, Japan, and a little higher than Korea [4, 6]. 

It  is  quite  necessary  to  apply  modern  biomedicine techniques as PCR to determine  the antibiotic resistance of H.pylori strains  to have  effective  treatment. 

2. Subjects and methods

2.1. Subjects

131  patients  were  examined  by  request  from  January 2015  to  July  2015  in  Hai  Duong  Provincial  General Hospital  and  met  the  criteria:  i)  chronic  gastritis,  gastric ulcer  or  gastric  cancer.  ii)  not  using  antibiotic  for  one month  before  endoscopy. 

2.2. Methods: Cross - sectional study

2.2.1. Sampling process

131 patients  were  taken  for  endoscopy,  then  images of endoscopy were taken to determine the types of gastritis as: chronic  gastritis,  gastric  ulcer,  gastric  cancer.  The endoscopic biopsy samples were taken at  the antrum, body and  edge  of  the  gastric  ulcer,  organizations  suspected  of contracting  stomach  cancer. 

The  biopsy  samples  were  stored  in  liquid  nitrogen  at  -200 C or -700 C  until  research.

2.2.2. DNA extraction

DNA was extracted by improved conventional methods in  accordance  with  our  lab’s  conditions.  The  steps  were performed as follows:  the samples were crushed  into flour, added  100  µl  of  LB  (lysis  buffer)  to  break  up  the  cells, incubated  at  370C  for  an  hour;  added  2.5  µl  protease K (20mg/ml) and incubated at 560C overnight (8-16 hours); added a volume of 200 µl solution of CH3COONH4 7.5M, incubated  at  40C  for  an  hour;  centrifuged  12,000  rpm,  at 40C for 30 minutes; collecting the solution in the upper part (repeating  this  steps  two  times);  added  500  µl  of  96% ethanol  (stored  in  cold),  samples  were  stored  at  -200C  for 2  hours;  centrifuged  at  12,000  rpm,  stored  at  40C  for 30 minutes; precipitated; added 500 µl of 70 % ethanol (to wash  the  collected  precipitate),  centrifuged  at  12,000  rpm, at 40C  for  20  minutes;  precipitated;  samples  were  dried  at the temperature of  the  room. 

The precipitate was dissolved in 30 µl of TE buffer and the samples were stored at -200C. 

After  DNA  extraction,  the agarose  gel  electrophoresis was used for DNA qualitative  analysis. 

2.2.3. PCR amplification of 23S rRNA to identify the point mutations of H.pylori

The 23S rRNA fragment gent was peculiarly amplified for  two  purposes:  i)  to  determine  H.pylori.  ii)  to  analyse and  determine  resistant  mutations  of  H.pylori  to  Cla  by DNA  sequencing. 

PCR  was  performed  with  1-  10  mg  of  genomic  DNA containing  the  specific  primer  pairs  and  components  of reaction. 

2 µl DNA (1-10  ng) was  added  into  the 23-μl  reaction mixture for H. pylori-specific 23S rRNA gene amplification. 

Forward:  5’-CCACAGCGATGTGGTCTCAG; 

Reverse:  5’-  CTCCATAAGAGCCAAAGCCC 

(F:  positions  1891-1911;  R:  positions2200–2220). 

The  thermal  cycler used was set  at 940C  for 5 minutes 

Page 114: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016 111

in the first round; 35 cycles consist of: 1 min. at 940 C, 45 sec. at 560 C, 1 min. at 720 C. The last round was set for 10 minutes. at 720C. PCR products were analysed on Agarose gel 1.2%, 0.5 xTBE buffer. 

2.2.4. Analysis of point mutations in bioinformatics program

Agarose  gel  electrophoresis  1.5%  was  used  to  check PCR products, 0.5xTAE buffer and cleaned with QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). PCR sequencing was performed with Macrogen (Korea). 

3. Results

3.1. Total of DNA extraction 

Total  of  gastric  biopsy  specimens  of  patients  with gastritis who were DNA extracted in Hai Duong Provincial General  Hospital  were  checked  on  agarose  gel  1.2%. Figure  1  shows  the  light  trails  on  agarose  gel  1.2%  after electrophoresis  as  a  result  of  being  DNA  extracted  from specimens. The bands in most lanes were bright and clear with molecular size of larger than 10 kb, which has shown high purity of being extracted DNA and less prone. 

Figure 1. Agarose gel electrophoresis of total DNA products extracted from samples

M: 1kb DNA ladder; 1→ 16: total DNA samples 

The  results  show  that  obtained  products  can  be guaranteed for both quality and quantity in further studies. 

3.2. PCR reaction

The  23S  rRNA  gene  fragment  which  was  amplified from DNA biopsy samples on agarose gel 1.2% was a band of about 400 bp in size; there might have 3 bands in many cases  (Figure 2). Because of  the specific character of  the 23S rRNA which carried a lot of repeated fragments, PCR products together formed different complexes. 

1 2 3 4 5 6 7 8 M 9 10 11 12 13 14 15 

Figure 2. Checking PCR products of the 23S rRNA with agarose gel electrophoresis

M:  DNA  standard  ladder  100  base  pairs;  Positive samples: 3,4,5,6,7,8,12,13,15; Negative samples: 1,2,9,14. 

3.3. Amplification and sequencing the 23S rRNA for H.pylori infection identification

Of  131  patients  who  were  examined  in  Hai  Duong Provincial  Hospital,  the  results  of  PCR  show  58  DNA samples  with  positive,  58/131  patients  with  H.pylori infection (H.pylori infection incidence was 44.2%). 

DNA  fragments  were  amplified,  directly  sequenced and scanned by the BLAST program to determine if there was  H.pylori  origin.  For  instance,  PCR  products  of  the patient  ID  199  were  99%  similar  to  the  23S  rRNA  gene sequences in 52 H.pylori strains. 

Figure 3. The 23S rRNA fragment sequence

3.4. Searching for resistant mutations to Cla by using bioinformatics method

Many  studies  have  shown  that  there  were  3  points  of resistant mutations at 2142 (A2142G and A2142C) and at 2143 (A2143G) in the peptidyl transferral of the 23S rRNA gene [2].

We used the method of revealing point mutations in the 23S rRNA to identify Clarithromycin resistance. However, we could not make antibiogramme due to severe infection among bacterium. Bacterium did not continue to develop; they only existed in the coccoid form. 

The resistant mutations to Cla at A2143G were present in 20.6% (12/58) and T2182C were present in 5.2% (3/58) (Figure 4) by using DNA test and bioinformatics. Hence, the incidence of both mutations was 25.8% (15/58). These mutations  decreased  the  association  with  drugs,  the mutation  at  A2143G  made  resistant  bacteria  to Clarythromicin at a high level (4 µg/ml). 

Figure 4. A2143G and T2182C in the 23S rRNA resistance to Cla were found in H.pylori strains isolated from patients

There  were  not  any  resistance  mutations  to  Cla  in H.pylori, so they were sensitive to Clarithromycin (74.2%). Therefore, Cla is still used to eradicate H.pylori at present. 

Page 115: PREFACE - udn.vntapchikhcn.udn.vn/OrtherFile/2016_7_14_10_31_795so6... · Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy 6 Applying automation in remote health

112 Le Thi Phuong

Figure  5  shows  the  results  of  the  23S  rRNA  fragment gene  sequence  from  antidrug  patients  with  H.pylori infection. 

A2143G mutation

Figure 5. The results of the 23S rRNA gene sequence from samples with positive mutations

3.5. The results on the prevalence of H.pylori resistance to antibiotic

Table 1. The prevalence of patients carried mutations in the 23S rRNA gene (resistance to Cla)

Results  Patients carried mutations   Rates % 

Non-mutations  43/58  74.2 

Mutations  15/58  25.8 

Total  58  100 

Hence,  the  number  of  H.pylori  resistance  to  Cla  was 25.8% in Hai Duong. The figure was higher than that of 5.5 % in the study by Nguyen Thuy Vinh et al (2004, Hanoi), but lower than that of 38.5% in the study by Le Dinh Minh Nhan et al  (2006, Ho Chi Minh City). However, our  study results  were  in  accordance  with  studies  in  Asia.  The number  of  Cla  resistance  increased  from  12.8%  up  to 23.8%  (from  2000  to  2009  in  China),  from  7.00%  up  to 15.2% in Japan, from 7.6% up to 18.6% in Korea [1, 9]. 

Hansomburana et al (Thailand, one of South Esat Asian countries)  reported  that  the  prevalence  of  mutations  was the  most  common  at  A2142G  (36.4%)  and  18.2%  of H.pylori strains  simultaneously carried  two mutations. The study  by  Abadi  A.T  et  al  in  Iran  (2011)  detected  93.7% mutation  resistance  to  Cla  at  A2143G and  3.1%  mutations at  A2144G,  but  not  any  H.pylori  strains  simultaneously carried  two  mutations. 

The  studies  in  Viet  Nam  showed  that  mutations  were primary  at  A2143G.  According  to  the  study  by  Nguyen 

Duc Toan (2012), the number of mutations at A2143G was 33.3%;  there were not any  mutations at  A2142G [3]. 

One  of  the  most  concerned  issues  is  multi  drug resistance (MRD). Currently, the prevalence of MRD tends to  increase,  a  major  cause  of  treatment  failure.  However, our  study  in  Hai  Duong  shows  that  there  was  only  Cla resistance,not  Amox  resistance  in  patients.  Therefore,  it  is very  important  to  design  regimens  for  patients  with H.pylori infection in Hai Duong. 

4. Conclusion

Of  131  gastric  patients  came  to  Hai  Duong  Provincial General  Hospital  for  examination  and  treatment,  58 patients  (44.2%)  were  found  H.pylori  infected.  The  23S rRNA gene fragment from patients with H.pylori infection was  sequenced  to  detect  Cla  resistance  mutations.  The frequency  of  A2143G  mutation  was  found  in  12  of  58 patients  (20.6%)  and  T2182C  in  3  of  58  (5.2%).  The number of patients with H.pylori infection did not carry Cla resistance mutations was 74.2%. Hence, Cla is still used to eradicate H.pylori at  present. 

REFERENCES

[1] Kim Jung Mogg1, Joo Sung Kim, Nayoung Kim, Yeoung Jeon Kim, In Young Kim, Young Joon Chee, Chul-Hoon Lee, and Hyun Chae Jung,  2008.  Gene Mutations of 23S rRNA Associated with Clarithromycin Resistance in Helicobacter pylori Strains Isolated from Korean Patients. J. Microbiol. Biotechnol. 18(9), pp.1584-1589. 

[2] Mégraud  Francis and Lehours  Philippe,  2007.  Helicobacter pylori Detection and Antimicrobial Susceptibility Testing.  Clin Microbiol Rev. 2007 Apr; 20(2): 280-322. 

[3] Nguyen  Duc  Toan,  Nguyen  Van  Thinh,  Nguyen  Thi  Nguyet, Nguyen Thi Hong Hanh, Duong Thu Huong, Ta Long, Le Huu Song, 2012.  The circumstances of antibiotic resistance of Helicobacter pylori in patients with gastritis and peptic ulcer. Vietnamese Journal of Science and Digestion, 7(27), pp. 1783-1788. 

[4] Nguyen  Thi  Hong  Hanh,  Nguyen  Thi  Nguyet,  2004.  HP1125 variants. Genetics and Applications, (3), pp. 5 -10. 

[5] Nguyen Thi Nguyet and Nguyen Thi Hong Hanh, 2004. The sequence of a domain in HP1125 gene coding for an outer membrane protein of Helicobacter pylori. Genetics & Applications 2, pp.19-24. 

[6] Nguyen  Van  Thinh,  Nguyen  Thi  Nguyet  and  Nguyen  Thi  Hong Hanh, 2007. “Summary of scientific reports and conferences”. Basic research in the life sciences, pp.196-198. 

[7] Stephens  J.C.,  Stewart  J.A.,  Folwell  A.M.,  Rathnone  B.J.,  1998. “Helicobacter pylori cagA status, vacA genotype and ulcer diseases”. Eur J Gastroenterol Hepatol, pp. 381-384. 

[8] Ta Long (2003), “Peptic disease and Helicobacter pylori bacteria”. Hanoi Medical Publishing House. 

[9] Wu  W.,  Yang  Y.,  Sun  G.,  2012.  “Recent insights into antibiotic resistance in Helicobacter pylori eradication”,  Gastroenterol  Res Pract, pp 723- 783. 

(The Board of Editors received the paper on 18/01/2016, its review was completed on 01/04/2016)