Journal of Clinical Virology 45 (2009) 179–184

Contents lists available at ScienceDirect

Journal of Clinical Virology

journa l homepage: www.e lsev ier .com/ locate / j cv

Preparing the outbreak assistance laboratory network in the Netherlands for thedetection of the influenza virus A(H1N1) variant

Adam Meijera,∗, Antoine Beerensb, Eric Claasc, Mirjam Hermansd, Arjan de Jonge, Richard Molenkampf,Hubert Niestersg, Pieter Overduina, John Rossenh, Rob Schuurmani, Petra Wolffs j, Ron Fouchierk,Albert Osterhausk, Martin Schuttenk, Marion Koopmansa,k

a National Institute for Public Health and the Environment, Bilthoven, The Netherlandsb Laboratory for Infectious Diseases, Groningen, The Netherlandsc Leiden University Medical Centre, Leiden, The Netherlandsd Jeroen Bosch Hospital, ’s-Hertogenbosch, The Netherlandse University Medical Centre St Radboud, Nijmegen, The Netherlandsf Academic Medical Centre, Amsterdam, The Netherlandsg University Medical Centre Groningen, Groningen, The Netherlandsh St. Elisabeth Hospital, Tilburg, The Netherlandsi University Medical Centre Utrecht, Utrecht, The Netherlandsj Maastricht University Medical Centre, Maastricht, The Netherlandsk Erasmus Medical Centre, Rotterdam, The Netherlands

a r t i c l e i n f o

Article history:Received 2 June 2009Accepted 3 June 2009

Keywords:InfluenzaPandemicA(H1N1)vMolecular diagnosticsLaboratory networkProficiency

a b s t r a c t

Background: Late April 2009, human infection with variant influenza virus A(H1N1)v emerged in theNorthern Americas posing a threat that this virus may become the next pandemic influenza virus.Objectives: To prepare laboratories for surge capacity for molecular diagnosis of patients suspected forA(H1N1)v infection in the Netherlands.Study design: A panel of 10 blinded specimens containing seasonal A(H1N1) or A(H3N2), orA/Netherlands/602/2009(H1N1)v influenza virus, or negative control was distributed to the outbreakassistance laboratories (OAL) together with influenza virus A (M-gene), swine influenza virus A (NP-gene) and influenza virus A(H1N1)v (H1v-gene) specific primers and probes and protocol (CDC Atlanta,USA). Laboratories were asked to implement and test this protocol.Results: All OAL were able to detect A(H1N1)v using the CDC M-gene reagents, the majority with similarsensitivity as the in-house M-gene based assays. RT-PCRs used in routine diagnostic setting in the OALspecifically designed to detect H1, H3, or NS1 from seasonal influenza A viruses, did not or at very low levelcross-react with A(H1N1)v. The CDC swine NP-gene and H1v-gene RT-PCRs showed somewhat reducedsensitivity compared to the CDC and in-house M-gene RT-PCRs. In contrast, in-house developed A(H1N1)vspecific H1v-gene and N1v-gene RT-PCRs showed equal sensitivity to CDC and in-house M-gene RT-PCRs.Conclusions: The Dutch OAL are prepared for detection and specific identification of A(H1N1)v, although

some level of cross-reactivity was observed with seasonal influenza viruses. Additionally, M-gene basedgeneric influenza A virus detection is recommended to be able to detect emerging influenza A viruses inroutine settings.

© 2009 Elsevier B.V. All rights reserved.

Abbreviations: A(H1N1)v, variant influenza A(H1N1) virus of swine origin, naming according to latest WHO decision; M, gene encoding the influenza virus matrix protein;HA, gene encoding the influenza virus hemagglutinin; NA, gene encoding the influenza virus neuraminidase; Swine NP, gene encoding the swine influenza virus type A specificnucleoprotein; NS1, gene encoding the influenza virus type A non-structural protein 1; H1v, gene encoding the influenza virus A(H1N1)v specific HA; N1v, gene encoding theinfluenza virus A(H1N1)v specific NA; NIC, National Influenza Centre; PCR, polymerase chain reaction; RT, reverse transcriptase; RT-PCR, reverse transcriptase polymerasechain reaction; Ct value, cycle threshold value is the number of cycles required for the fluorescent signal to cross the threshold, i.e. exceeds the background level; OAL, outbreakassistance laboratories.

∗ Corresponding author at: Centre for Infectious Disease Control, National Institute for Public Health and the Environment, PO Box 1, 3720 BA Bilthoven, The Netherlands.Tel.: +31 30 2743595; fax: +31 30 2744418.

E-mail address: adam.meijer@rivm.nl (A. Meijer).

1386-6532/$ – see front matter © 2009 Elsevier B.V. All rights reserved.doi:10.1016/j.jcv.2009.06.003

1 inical

1

AttplotlNhdkEosiTdytdaodMAsbcCIICwp

2

pA

3

3

tTid(t

3

hvap

80 A. Meijer et al. / Journal of Cl

. Background

Late April 2009, infection of humans with influenza virus(H1N1)v emerged in Mexico and the USA and was rapidly spread

hroughout the world by travellers.1–4 Because of the imminenthreat that this virus can cause the next influenza pandemic,5

reparedness plans were activated, including the preparation ofaboratories for surge diagnostic capacity in response to largeutbreaks of (emerging) respiratory infections.6 The outbreak assis-ance laboratories (OAL) network consists of the two referenceaboratories (RIVM and Erasmus MC) in the WHO recognized Dutchational Influenza Centre (NIC) and nine regional laboratories, andas been equipped since 2006 with standardized protocols for theetection of A(H5N1) avian influenza viruses.7 These protocols areept up to date by the NIC that also participated in the bi-annualQAP studies of the WHO for the detection of A(H5N1) virus as partf the WHO accreditation process.8 Based on results in these EQAPtudies both reference laboratories are listed as laboratories hav-ng the capability for diagnosing patients infected with A(H1N1)v.9

hrough the recently established GISAID influenza virus sequenceatabase, A(H1N1)v sequences were rapidly shared.10 In silico anal-sis confirmed that influenza A virus detection protocols targetinghe M-gene provided by the NIC to the OAL should be able toetect A(H1N1)v. Provided protocols for the subtyping of H5, H7nd seasonal H1 and H3 viruses were expected not to cross-reactn basis of sequence comparison, thereby offering the ability toiagnose A(H1N1)v by exclusion, i.e. positive in influenza A virus-gene and negative in all subtyping RT-PCRs. Since a positive

(H1N1)v specific RT-PCR is however required for proper diagno-is, A(H1N1)v specific primers and probes were designed on theasis of initially available sequences. These assays were used suc-essfully to diagnose the first cases.11 During the validation process,DC Atlanta, USA, released their protocol as part of the WHO Global

nfluenza Surveillance Programme in which the NIC participates.12

n view of the potential rapid increase of diagnostic need, theDC protocol accompanied with pre-ordered primers and probesere distributed to the OAL and supplemented with a proficiencyanel.

. Objectives

To implement the CDC protocol in the OAL and to compare theerformance of the CDC protocol against routinely used influenzavirus RT-PCRs.

. Study design

.1. Preparation of kits based on CDC protocol

Primers and probes as specified in revision 1 of the CDC pro-ocol were ordered in bulk (BioLegio, Nijmegen, The Netherlands).he primers and probes have specificity for generic detection ofnfluenza A viruses targeting the matrix (M) gene, for genericetection of swine influenza A viruses targeting the nucleoproteinswine-NP) gene and for specific detection of A(H1N1)v targetinghe hemagglutinin gene of A(H1N1)v (H1v).

.2. In-house PCR assays

Primers and probes sequences and detailed protocols of in-ouse RT-PCRs used for routine molecular diagnosis of influenzairus are available upon request. The two reference laboratoriesnd one OAL laboratory developed A(H1N1)v specific primers androbes (Table 1).

Virology 45 (2009) 179–184

3.3. Proficiency panel

A panel of 10 blinded specimens containing influenzaviruses A(H1N1), A(H3N2) and heat-inactivated (45 min 70 ◦C)A/Netherlands/602/2009 (H1N1)v, and negative controls was dis-tributed to all laboratories (Table 2). Virus stocks were diluted intransport medium to obtain virus concentrations that can regu-larly be detected in influenza A virus infected patients. Per panelspecimen 900 �l was distributed at ambient temperature by courierdelivery on the day of panel preparation. CDC primers and probes, ahardcopy of the CDC protocol revision 1 and a positive control werealso distributed.

3.4. Requested testing

The laboratories were asked to test 10-fold serial dilutions in RT-PCRs according to the CDC protocol, in influenza A virus RT-PCRsused routinely in the own laboratory and with newly developedA(H1N1)v specific primers and probes, if already available. Thelaboratories were asked to report the qualitative and quantitativeresults and details of the methods used.

4. Results

4.1. Characteristics of methods used

Routine diagnostic methods are not standardised in The Nether-lands, similar to in many other countries. As a consequence,although OAL used the same primers and probe sets, methods dif-fered in the use of equipment, kits and the amount of RNA or cDNAthat was added to the (RT)-PCR mix (Fig. 1).

4.2. Qualitative results

All OAL were able to detect seasonal viruses and detect andidentify A(H1N1)v using CDC primers and probes and in-houseinfluenza A virus assays (Table 3). Assays for subtyping of seasonalhuman H1 and H3 viruses correctly identified the hemagglutininsubtypes of the seasonal viruses in the panel but, as expected, wereunable to subtype A(H1N1)v. The main reason for not having a 100%correct score was having a positive CDC swine-NP assay with sea-sonal A(H1N1) and A(H3N2) viruses. High Ct values (>37.00) withthe undiluted specimen and rapid disappearance of positive sig-nal in the serial dilutions showed that this only happened at highviral load. Similarly, one laboratory found one A(H3N2) contain-ing specimen positive with the CDC H1v assay (Ct value 37.71).One laboratory was not able to detect A(H1N1)v with the CDC H1vassay. This laboratory had one false positive negative control within-house M-gene assay, whilst the CDC M-gene assay was negative.In-house NS1-gene based assays, designed for detecting seasonalhuman influenza A virus, as expected, did not detect the A(H1N1)vvirus or with drastically reduced sensitivity.

4.3. Quantitative results

Five of seven laboratories using a one-step RT-PCR approachwith the pre-ordered CDC primers and probe set followed the CDCprotocol unmodified (i.e. using Invitrogen Superscript III PlatinumOne-Step Quantitative Kit and CDC temperature protocol) except forthe amount of RNA added to the reaction mix (ranging from 9.5 to20 �l). Two laboratories used another one-step RT-PCR kit. All labo-

ratories that used a one-step approach detected A(H1N1)v and theseasonal viruses using the CDC M-gene assay with similar Ct values(SD range: 0.98–2.33) (Fig. 1). Similarly, these laboratories detectedA(H1N1)v using the CDC swine-NP and H1v assays with similar Ctvalues (SD range: 2.69–2.88 and 1.88–2.04 respectively), although

A. Meijer et al. / Journal of Clinical Virology 45 (2009) 179–184 181

Table 1In-house A(H1N1)v specific primers and probes sets developed by members of the OAL.

Name Target genea Sequence RT-PCR chemistryb Sourcec

H1-Sw-1304F H1v TTTGGACTTACAATGCCG Two-stepd RIVMH1-Sw-1410R H1v TAGCTGGCTTCTTACCT Two-stepd RIVMH1-Sw-1357P H1v GACTACCACGATTCAAATGTGAAGA Two-stepd RIVM

H1swl-sense H1v GGCCATTGCCGGTTTCATTG One-stepe LUMCH1swl-antisense H1v TATCCTGACCCCTGCTCATTTTG One-stepe LUMCH1swl-probe H1v ATCCATCTACCATCCCTGTCCACCC One-stepe LUMC

MexFluN1-Fwd N1v ACATGTGTGTGCAGGGATAACTG One-stepf EMCMexFluN1-Rev N1v TCCGAAAATCCCACTGCATAT One-stepf EMCMexFluN1-Probe N1v ATCGACCGTGGGTGTCTTTCAACCA One-stepf EMC

a H1v: hemagglutinin gene coding for H1 of A(H1N1)v virus; N1v: neuraminidase gene coding for N1 of A(H1N1)v virus.b RT-PCR chemistry used during development and validation.c C: Le

for PC

CsotNCvtpotNwhht2hv(u(t

4

Ag

TP

P

o

RIVM: National Institute for Public Health and the Environment; Bilthoven; LUMd Promega AMV RT for copy DNA step and Roche LightCycler Taqman Master Mixe Qiagen One Step RT PCR Kit.f ABI GeneAmp EZ rTth RNA PCR Kit.

t values were slightly higher than with the “gold standard” one-tep CDC M-gene assay (Fig. 1). Two laboratories using an in-housene-step M-gene assay reported similar Ct values as the labora-ories using the “gold standard” (Fig. 1). The one-step in-houseS1-gene assay used in one laboratory showed slightly highert values compared to the “gold standard” for seasonal influenzairuses, but expectedly had greatly reduced sensitivity for detec-ion of A(H1N1)v. Laboratories using a two-step approach with CDCrimers and probes detected seasonal viruses and A(H1N1)v withverall slightly higher Ct values compared to laboratories usinghe “gold standard” (Fig. 1). Ct values of the two-step CDC swine-P and H1v assays were considerably higher compared to thoseith one-step or two-step CDC M-gene assays (Fig. 1). Two-step in-ouse M-gene assays used by eight laboratories showed a slightlyigher Ct value with seasonal viruses and A(H1N1)v compared tohose with the “gold standard”, and were more variable (SD range:.32–3.86) (Fig. 1). Again, the two-step in-house NS1-gene RT-PCRad considerably higher Ct values with the seasonal influenza Airuses compared to one-step and two-step CDC M-gene assaysFig. 1). A correlation was found between increasing specimen vol-me equivalent cDNA input and increasing sensitivity in swine-NPR2 = 0.8890) and H1v (R2 = 0.8905) two-step CDC assays, but not forhe M-gene (R2 = 0.2452) two-step CDC assays with A(H1N1)v.

.4. Comparison CDC and in-house A(H1N1)v specific assays

Ct values of the in-house developed H1v and N1v assays with(H1N1)v were similar to those of one-step and two-step CDC M-ene assays (not shown). None of these in-house A(H1N1)v specific

able 2anel composition and expected results.

anel specimen number Virus Dilution of virus stocka Expec

Influe

1 A/NL/308/2008(H1N1) 1:100 Pos (12 A/NL/562/2009(H3N2) 1:100 Pos (13 Transport medium Neg4 A/NL/558/2009(H3N2) 1:100 Pos (15 A/NL/602/2009(H1N1)v 1:100 Pos (16 A/NL/158/2008(H1N1) 1:100 Pos (17 Transport medium Neg8 A/NL/602/2009(H1N1)v 1:1000 Pos (19 A/NL/470/2009(H3N2) 1:100 Pos (1

10 A/NL/095/2008(H1N1) 1:100 Pos (1

a Dilution in virus transport medium.b Between brackets the maximum dilution of the specimen positive in the M-gene, sw

ut at the National Institute for Public Health and the Environment.

iden University Medical Centre, Leiden; EMC: Erasmus Medical Centre, Rotterdam.R step.

assays showed cross-reactivity with the specimens containing sea-sonal A(H1N1) or A(H3N2) virus (Table 3).

5. Discussion

We showed that with the implementation of the CDC protocolthe OAL network is prepared for the detection and specific identifi-cation of A(H1N1)v virus. However, we identified some issues thatshould be resolved, i.e. reduced sensitivity of the CDC swine NP andH1v assays in certain circumstances, cross-reactivity of these assayswith seasonal influenza viruses and the absence of broad reactingin-house influenza A virus detection assays in laboratories usinghuman influenza A virus specific NS1-gene based assays. The impor-tance of proficiency testing as learning tool for improving sensitivityand specificity of molecular diagnostics in relation to seasonalinfluenza and avian influenza A(H5N1) has been demonstratedbefore.8,13,14 Therefore, following communication of the first resultsof the proficiency panel to the OAL network, most laboratories tookaction to improve the assays using the CDC primers and probes setsin addition to the in-house influenza A virus detection assays. Ourcomparative evaluation clearly illustrates one of the challenges inimplementing (molecular) diagnostics for a new pathogen, namelythe lack of standardisation of these techniques among laboratories.In theory, implementing standardised assays has important bene-

fits as the quality of the assay can be assured and kept up to date bythe NIC. For that reason the laboratory network in the United King-dom is obliged to use CE marked kits provided by the NIC accordingto European law on the use of kits for patient diagnosis.15 Obtainingthis will not be straightforward, as standardisation is currently not

ted resultsb

nza A Swine influenza A A(H1N1)v Seasonal human influenzavirus subtyping

:10,000) Neg Neg H1:100,000) Neg Neg H3

Neg Neg Neg:100,000) Neg Neg H3:100,000) Pos (1:10,000) Pos (1:10,000) Neg:10,000) Neg Neg H1

Neg Neg Neg:10,000) Pos (1:10,000) Pos (1:10,000) Neg:10,000) Neg Neg H3:100,000) Neg Neg H1

ine NP-gene and H1v-gene assays according to the CDC protocol revision 1 carried

182 A. Meijer et al. / Journal of Clinical Virology 45 (2009) 179–184

Fig. 1. Protocols (N = 14) used for influenza virus molecular detection in 11 outbreak assistance laboratories involved in preparing for surge diagnostic capacity for respiratorydisease outbreaks. Flow diagram shows the variations in RNA extraction platforms, cDNA synthesis, PCR chemistry and amplification platforms, and amount of cDNA or RNAinput into the PCR reaction. Weight of the lines reflects the number of laboratories using a particular step. Closed circles indicate steps that were shown to be critical, anddotted lines show steps for which no significant differences were observed in assay performance. Results of RT-PCR are expressed in the table for each of the specimens in thepanel for the different targets used and split in one-step or two-step RT-PCR format, by showing the average Ct and standard deviation (SD) for the one-step M-gene basedprotocol using CDC primers and probe as the “gold standard”, and the delta average Ct and SD for all other targets by one- or two-step RT-PCR approach compared to the“gold standard”. Greyed cells indicate a deviation from the expected result.

A. Meijer et al. / Journal of Clinical Virology 45 (2009) 179–184 183

Table 3Correct score per laboratory for detection and identification of the panel specimens.

Laboratory Datasets Correct score detection and identification using primers and probesa Remarks

CDC and in-house routineinfluenza A virus (Max 40 points)

In-house human subtype (H1 andH3) (Max 20 points)

In-house A(H1N1)v (H1v or N1v)(Max 10 points)

1 2 39 20 10 CDC NP with A(H1N1) (n = 1); Ct38.30

2 1 36 NAb NA CDC NP with A(H1N1) (n = 3) orwith A(H3N2) (n = 1); Ct >38.00

3 1 37 NA 10 CDC H1v negative with A(H1N1)v(n = 2)False positive negative specimen(n = 1)

4 1 35 20 NA CDC NP with A(H1N1) (n = 4); Ct>37.00CDC H1v with A(H3N2) (n = 1); Ct37.71

5 5 40 20 NA

6 1 37 20 10 CDC NP with A(H1N1) (n = 2) orwith A(H3N2) (n = 1); Ct >40.00NS1 human influenza A virusdetects A(H1N1)v with reducedsensitivity Ct > 34.00

7 2 40 NA NA8 1 38 NA NA NS1 human influenza A virus does

not detect A(H1N1)v9 2 40 NA NA

10 2 40 20 NA11 1 40 20 NA

a For each correct result according to the expected results as displayed in Table 1, one point was given; thus, a maximum of 10 points for the 10 panel specimens for eachtarget. For CDC primers and probe sets M (10 points), swine-NP (10 points), H1v (10 points) and influenza A virus detection with in-house primers and probe sets (M or NS1)( enza v2

egaatdfsarrdscabeviitiHmartadmmf

10 points), which totals for all correct 40 points. For in-house human seasonal influ0 points. For in-house A(H1N1)v assays a maximum of 10 points for H1v or N1v.b NA = not applicable as not reported.

ndorsed by the professional organisation of medical microbiolo-ists in The Netherlands. The standardisation approach, however,lso has its downsides: CE marking is a time-consuming processnd is not possible during outbreak response situations. Also, inhe phase when genetic data of the target pathogen is scarce, someifference in procedures can be valuable, e.g. when a standard test

ails due to mutation in the genome at the 3′ end of primer bindingites. Here, we show our approach to obtain this type of data withinvery short time frame by networking capacities from laborato-

ies with high level expertise in molecular diagnostics. Our studyapidly identified which steps in the assays are most critical, therebyirecting the focus for evaluation of new methods (PCR chemistry,ample input volume, choice of targets). Having sufficient surgeapacity to develop a properly validated protocol, implementingnd distributing in-house developed assays to OAL therefore maye in the first phase of the pandemic a more appropriate nationalmergency plan. Based on this study, the NIC is now working onalidated assays for the specific detection of A(H1N1)v which fitn the protocols that have been distributed previously to the OALn response to the threat of A(H5N1) influenza virus. Results withhe two-step CDC swine-NP and H1v assays suggest that sensitivitys correlated with the amount of cDNA input in the PCR reaction.owever, a reduced sensitivity may also be caused by imperfectlyatching primers and probes. The forward CDC swine NP primer

nd the H1v probe show one mismatch with A(H1N1)v and theeverse H1v primer shows one or two mismatches depending onhe virus strain used in in-silico analyses. Whether the PCR results

re affected by this depends on the PCR chemistry used, as enzymesiffer substantially in mismatch tolerance. This is a strong argu-ent in favour of standardisation of protocols once they have beenade available and validated. Nevertheless, the preferred approach

or highly specific and sensitive detection is to develop matching

irus H1 and H3 subtyping a maximum of 10 points each, which totals for all correct

primers and probes. We also evaluated performance of routinelyused influenza A virus diagnostic RT-PCRs as an indication of theavailable routine laboratory capacity if the A(H1N1)v virus shouldspread as a pandemic strain. This confirmed that the M-gene basedmethods worked well, and that NS1-gene based assays developedto specifically detect seasonal human influenza A viruses were, asexpected, not suitable for detection of A(H1N1)v. We strongly rec-ommend running validated M-gene based RT-PCRs in face of thecurrent situation. If other targets continue to be used, care shouldbe taken to properly validate these methods against the A(H1N1)vinfluenza virus and other zoonotic influenza viruses. In conclusion,by implementing the CDC primers and probes in RT-PCR protocolsrunning at AOL network laboratories the network is now preparedfor specific molecular diagnosis of patients suspected for infectionwith influenza virus A(H1N1)v when the need for surge capacitycommences.

Funding

This study was partially funding by the Ministry of Health, Wel-fare and Sport in The Netherlands.

Competing interests

None declared.

Ethical approval

Not required.

1 inical

A

tpJNIn

R

National Influenza Centres: results of two subsequent external quality assess-ments. In: Programme and Abstract Book Third European Influenza Conference.

84 A. Meijer et al. / Journal of Cl

cknowledgements

The authors thank Mariam Bagheri and Ton Marzec for preparinghe panels, Harrie van der Avoort for organising the shipment of theanels, Jojanneke Dekkers, Nathalie Bus, Lotte Broers, Caroline de

ong, Ronald Huijsmans, Judith Kuijpers, Tim Schuurman, Lilli Gard,ellie Nieuwenhuizen, Noortje van Maarseveen, Yvette van Aarle,

.R. Roozeboom and S. Rebers for technical assistance in the OALetwork laboratories.

eferences

1. Centers for Disease Control and Prevention (CDC). Swine influenza A (H1N1)infection in two children—Southern California, March–April 2009. MMWR MorbMortal Wkly Rep 2009;58:400–2.

2. Centers for Disease Control and Prevention (CDC). Update: infections with aswine-origin influenza A (H1N1) virus—United States and other countries, April28, 2009. MMWR Morb Mortal Wkly Rep 2009;58:431–3.

3. Centers for Disease Control and Prevention (CDC). Outbreak of swine-origininfluenza A (H1N1) virus infection—Mexico, March–April 2009. MMWR MorbMortal Wkly Rep 2009;58:467–70.

4. Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team. Emergenceof a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med 2009[May 22; Epub ahead of print].

5. Fraser C, Donnelly CA, Cauchemez S, Hanage WP, Van Kerkhove MD,Hollingsworth TD, et al. The WHO rapid pandemic assessment collaboration.Pandemic potential of a strain of influenza A(H1N1): early findings. Science 2009[May 14; Epub ahead of print].

6. van Asten L, van der Lubben M, van den Wijngaard C, van Pelt W, VerheijR, Jacobi A, et al. Strengthening the diagnostic capacity to detect Bio Safety

Virology 45 (2009) 179–184

Level 3 organisms in unusual respiratory viral outbreaks. J Clin Virol 2009;45:185–90.

7. National Institute for Public Health and the Environment. Diagnostiekvoor influenza A (H5N1) op het RIVM—1 juni 2006; 2009. Available from:http://www.rivm.nl/cib/infectieziekten-A-Z/infectieziekten/aviaire influenza/publicatie aviaire influenza deel III.jsp [Accessed 29.5.2009].

8. WHO external quality assessment project for the detection of subtype influenzaA viruses by polymerase chain reaction—summary analysis, 2007 and 2008.Wkly Epidemiol Rec 2008;83:401–12.

9. World Health Organization. Countries able to perform PCR to diagnoseinfluenza A (H1N1) virus infection in humans; 7 May 2009. Available from:http://www.who.int/csr/resources/publications/swineflu/country pcr capacity/en/index.html [Accessed 28.5.2009].

10. Bogner P, Capua I, Lipman DJ, Cox NJ, and others. A global initiative on sharingavian flu data. Nature 2006;442:981.

11. ProMED-mail. Influenza A (H1N1)—worldwide (17). ProMED-mail 2009; 8 May:20090508.1722; 2009. http://www.promedmail.org [Accessed 29.5.2009].

12. World Health Organization. CDC protocol of realtime RTPCR for influenzaA(H1N1), 28 April 2009 revision 1 (30 April 2009); 2009. Available from:http://www.who.int/csr/resources/publications/swineflu/CDCRealtimeRTPCRSwineH1Assay-2009 20090430.pdf [Accessed 28.5.2009].

13. Mackay WG, van Loon AM, Niedrig M, Meijer A, Lina B, Niesters HG. Molec-ular detection and typing of influenza viruses: are we ready for an influenzapandemic? J Clin Virol 2008;42:194–7.

14. Meijer A, MacKay WG, van Loon AM, Niedrig M, Lina B, Niesters HGM. Moleculardetection and identification of human and avian influenza viruses by European

2008 [Abstract 2-004].15. Curran MD, Ellis JS, Wreghitt TG, Zambon MC. Establishment of a UK

national influenza H5 laboratory network. J Med Microbiol 2007;56(Pt 10):1263–7.