THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol . 263, No. 31, Issue of November 5, PP. 16297-16302,1388 Printed in W.S.A.

Production and Characterization of Human Basic Fibroblast Growth Factor from Escherichia coZi*

(Received for publication, February 22, 1988)

Charles H. Squires, John Childs, Stephen P. Eisenberg, Peter J. PolveriniS, and Andreas Sommer From Synergen, Znc., Boulder, Colorado 80301 and the $Department of Pathology, Northwestern University Medical School, Chicago: Illinois 6061 1

The cDNA sequence coding for human basic fibro- blast growth factor (bFGF) has been cloned down- stream of a transcription promoter recognized by the bacteriophage T7 RNA polymerase. Initiation of trans- lation at the fgf gene has been coupled to upstream translation of a fragment of the T7410 gene. Expres- sion of the fgf gene in this system can lead to an accumulation of approximately 40 mg/liter/A6,,,, unit of bFGF. This material can be purified close to homoge- neity from a soluble protein extract on a heparin- Sepharose column. bFGF so obtained has been shown to have bioactivity indistinguishable from human pla- cental fibroblast growth factor in mitogenicity, syn- thesis of plasminogen activator, and angiogenesis as- says.

Fibroblast growth factors (FGFs)’ are heparin-binding polypeptide mitogens that have been isolated from a variety of human and animal tissues and from normal as well as from tumor cell lines (1-4). Based on their specific affinity for heparin and their isoelectric points, all FGFs can be classified as either acidic fibroblast growth factor (aFGF) or basic fibroblast growth factor (bFGF) (5-7). The genes for both aFGF and bFGF have been cloned (8-12).

FGFs promote the proliferation of sensitive target cells such as vascular endothelial cells and fibroblasts (2, 3), they are chemotactic for a variety of cell types (13-15), and induce the synthesis of collagenase and plasminogen activator in endothelial cells (13). Both aFGF and bFGF are angiogenic “in uiuo” (13, 16-21), and both have neurotrophic properties (22-24). Exogenously supplied FGFs have effects on wound healing (25-27), bone healing (28), vascular grafting (29, 30), lens regeneration (31, 32), and limb regeneration (33).

Natural bFGF is available in small quantities. To ensure a reliable supply of bFGF for preclinical studies in these areas, we have developed a recombinant DNA method for the pro- duction of bFGF from Escherichia coli. The cDNA sequence for bFGF has been cloned downstream of a promoter recog- nized by the RNA polymerase of bacteriophage T7. This 23- base pair promoter sequence shares no homology with that recognized by the E. coli host RNA polymerase (34), and there are no known T7 promoter sequences in the E. coli genome.

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The abbreviations used are: FGF, fibroblast growth factor; aFGF, acidic fibroblast growth factor; bFGF, basic fibroblast growth factor; IPTG, isopropyl P-D-thiogalactopyranoside; SDS, sodium dodecyl sulfate; PBS, phosphate-buffered saline; HPLC, high pressure liquid chromatography.

Besides its selectivity, the T7 polymerase initiates transcrip- tion efficiently and elongates RNA chains at a rate approxi- mately 5 times faster than the E. coli enzyme (35-37). In addition, the T7 polymerase is not subject to transcription termination following amber mutations (38, 39) and so is probably not subject to transcription termination as a result of slow translatability of an mRNA. These facts make expres- sion of cDNA clones in E. coli by T7 polymerase transcription very attractive.

We have previously reported the primary structure of a human placental bFGF with an extended amino terminus and the molecular cloning of fgf from a human cell line, SK-HEP- 1 (12). Here we describe the expression of human fgf gene in E. coli, the purification of the mitogen from E. coli cell lysates, and the functional characterization of the purified human recombinant bFGF.

MATERIALS AND METHODS

Strains, Plasmids, and Media E. coli B strain BL21(DE3) (40) is a lysogen of a X phage containing

T7 gene 1 (coding RNA polymerase). Gene 1 in this phage (DE3) is controlled by the lacUV5 promoter-operator sequence and is inducible with IPTG. E. coli strain JM107 (41) does not contain gene 1 and was routinely used as a host for plasmid construction.

Plasmid PET-3b (42) is a derivative of plasmid pBR322 and con- tains the T7 gene 10 promoter, the translational initiation site for the gene 10 protein, its first 11 codons, and T@, the transcription termination signal recognized by T7 RNA polymerase. These se- quences have been inserted at the BamHI site of plasmid pBR322 so that transcription will occur counterclockwise on the map, opposite to that for the tet gene.

Growth media were either Luria broth (43) (liquid or solidified with 1% agar) containing 10 pg/ml tetracycline or 100 pg/ml ampi- cillin as needed or M9 minimal medium (43) supplemented with the same antibiotics.

DNA Methods Restriction enzymes, T4 DNA ligase, and polynucleotide kinase

were obtained from N. E. Biolabs and used according to their rec- ommendations. Synthetic DNAs were prepared using the Applied Biosystems model 380A DNA synthesizer. These oligonucleotides were gel-purified before annealing, kinasing, and cloning. The se- quences of synthetic DNAs were confirmed after cloning by the dideoxy method using denatured plasmid DNA as substrate (44, 45) and synthetic oligonucleotide primers to adjoining plasmid or fgf sequences.

Purification of Recombinant bFGF E. coli BL21(DE3) containing the plasmids pJU1004 or pJU1005

were grown at 30 “C in Luria broth containing tetracycline (10 pg/ ml), and bFGF synthesis was induced in late log-phase growth by the addition of IPTG (0.1 mM). The cells were harvested 2 h postinduc- tion by rapid cooling on ice followed by centrifugation at 10‘ X g at 4 “C. The cell pellets were resuspended in 4 ml of 50 mM Tris-HC1, pH 7.5 (buffer A) per g of cell, wet weight. A cell lysate was prepared by passing the cell suspension through a French pressure cell a t 1200

16297

16298 Human Basic Fibroblast Growth Factor from E. coli p.s.i. The cell lysate was adjusted to 0.5 M NaC1, and the cell debris was removed by centrifugation at lo' X g for 60 min at 4 "C. The supernatant fraction containing the recombinant bFGF was further diluted with buffer A containing 0.5 M NaCl to a volume correspond- ing to 5 ml/g of cells, wet weight and applied directly to a heparin- Sepharose column (0.6 ml of resin/5 ml of cell lysate) previously equilibrated in buffer A containing 0.5 M NaC1. After sample appli- cation, the column was washed with 2 column volumes of equilibration buffer and then with buffer A containing 1 M NaCl until the Am of the column effluent reached base-line value. The recombinant bFGF was eluted from the heparin-Sepharose resin with buffer A containing 2 M NaCI. bFGF expression levels and yields at various stages of the purification were estimated by laser densitometer scanning of Coo- massie-stained SDS-polyacrylamide gel electrophoresis gels (46) and Western blots (Promega Biotech) using known quantities of purified recombinant bFGF as standards. Protein concentrations were deter- mined by the Bradford assay (47).

Bioassays

Mitogenicity-Purified recombinant bFGF was assayed for mito- genic activity on 3T3 fibroblasts. Cells were seeded into 96-well microtiter plates (Corning) in Dulbecco's modified Eagle's medium (GIBCO) containing 10% calf serum (Colorado Serum Co.) (lo' cells in 200 pl/well). The cells were incubated for 7 days at 37 "C. The spent medium was then removed and replaced with 200 pllwell of fresh Dulbecco's modified Eagle's medium containing 0.4% calf serum and 0.5 pCi of [3H]thymidine/well. Recombinant bFGF samples to be tested were diluted into PBS containing 0.1% bovine serum albu- min and added to the culture wells in 25-pl aliquots. The cells were incubated for 24 h. The medium was removed, the wells washed 1 X with PBS, 2 X with methanol, and 4 X with water. Each well was filled with ice-cold 5% (w/v) trichloroacetic acid and the plate incu- bated for 10 min on ice. This procedure was repeated once, and the wells were washed 4 X times with water. The cells were solubilized with 200 p1 of 0.3 N NaOH, and 150-p1 aliquots were counted in a Beckman liquid scintillation counter. Assays were routinely carried out in duplicate or triplicate.

Synthesis of Phminogen Activator-Ninety-six-well microtiter plates were coated with 1.5% gelatin (Kodak 16552) in PBS for 30 min. The gelatin solution was removed, the wells washed 2 times with

PBS, and bovine capillary endothelial cells (lO'/well) plated in 200 pl of minimum Eagle's medium a (GIBCO 320-2571) supplemented with 5% calf serum (Colorado Serum Co.), penicillin/strepomycin (100 units/100 pglml), and fresh glutamine (4 mM). The medium was changed 4 days after plating. Recombinant bFGF samples to be tested were diluted into PBS containing 0.1% bovine serum albumin and added to the cells in 25-pl aliquots 7 days after initial cell plating. The cells were exposed to the bFGF overnight at 37 "C. The culture medium was then aspirated and the cells washed 2 times with cold PBS. The cells were solubilized in Triton-phosphate buffer (680 pl of phosphoric acid, 500 pl of Triton X-100, water to 100 ml, pH 8.1, adjusted with NaOH) for 10 min at room temperature. Twenty-five- p1 aliquots of the soluble cell lysates were transferred to a fresh microtiter plate and assayed for plasminogen activator activity (American Diagnostics Inc. spectrophotometric PA-assay kit) using urokinase to establish a standard curve.

Angiogenesis Assay-Angiogenic activity was evaluated in corneas of 150-200-g male Fisher rats (Harlan Laboratories, Madison, WI) as previously described (48). Briefly, samples of control buffer or various concentrations of human recombinant or placental bFGF were combined with an equal volume of Hydron polymer (49) and were pipetted on top of 1.5-mm diameter Teflon rods. Pellets were air-dried for 1-2 h in a laminar flow hood and stored overnight at 4 "C. Just before implantation, pellets were rehydrated with a drop of PBS, a pocket was surgically made within the corneal stroma, and pellets were positioned 1.5 mm from the limbus. Corneas were ex- amined daily for 7 days and were perfused with colloidal carbon (Pellikan, Hanover, FGF) just before death. Excised corneas were fixed, photographed, and processed for light microscopic examination. Neovascular responses were scored as positive when unidirectional in-growth of capillary sprouts and hairpin loops was observed. Neg- ative responses were recorded when only an occasional capillary sprout or hairpin loop was detected or when no evidence of sustained growth was observed.

RESULTS

Construction of Plasmid pJU1003"The expression vector prepared for fgf is derived from one constructed by Rosenberg et al. (42) (PET-3b) containing a T7 promoter and DNA

I. €coRI/€coRV digest 2.Klenow DNA Polym.

3. Ligate t p JUlOOl

I

I. Bglll.Su/l digest 2 Add €coRl/&II

let gene fmgment T7P

FIG. 1. Construction of T7 promoter expression plasmid pJU1003. Plasmid pJUlOOl is identical to PET-3b (42) except the 185-bp segment between EcoRI and the EcoRV site adjacent to T4, the T7 RNA polymerase transcription termination signal, has been removed. Plasmid pJU1002 contains a polylinker cloning fragment inserted at the BamHI site of plasmid pJU1001. The BamHI site of this polylinker is nearest the T7 promoter, and the XhoII site most distal. The GATC sequence at the junction of ChI and SmI sites in this sequence is a site of methylation (DAM) in E. coli. The ChI site is therefore useful in plasmid DNA obtained from dam- E. coli cells. The EcoRIISaQ tet gene fragment was obtained from a derivative of pBR322 which had had its Hind111 and BamHI sites within the tet regulatory and coding sequences altered by bisulfite mutagenesis (S. Eisenberg, unpublished results) such that this DNA was no longer a substrate for these enzymes but still conferred the Tet' phenotype.

Human Basic Fibroblast Growth Factor from E. coli 16299

coding for the first 11 amino acids of a highly expressed T7 protein, 610, as well as T6, a transcription termination signal recognized by the T7 RNA polymerase. For our purposes, it was modified to confer tetracycline resistance and to include a polylinker sequence containing a range of plasmid-unique cloning sites.

To prepare plasmid PET-3b for the synthetic polylinker sequence containing the sites BamHI, EcoRI, ClaI, SmaI, HindIII, KpnI, SpeI, and XhoII, we first removed the endog- enous EcoRI, ClaI, and HindIII sites from PET-3b (Fig. 1). Addition of the polylinker fragment results in plasmid pJUlOOZ (Fig. 1). The fet gene was restored to this plasmid as shown using an EcoRI to SalI (approximately 650 base pairs) fragment from a homologous tet gene that had been altered by bisulfite mutagenesis to remove its BamHI and HindIII sites only. The resulting plasmid, pJU1003, confers both ampicillin and tetracycline resistance on E. coli and was used to clone the fgf gene.

Construction of Phage T7 Polymeruse-directed Expression Plasmids for fgf-To obtain maximal efficiency of transla- tional initiation for bFGF, we constructed plasmids in which bFGF was translationally coupled (50) to another highly expressed gene. Two such constructs were made. In one, we used the first 7 codons of the E. coli ompA leader (ompAL) (51). Four double-stranded synthetic oligonucleotides were prepared to make this plasmid. Their sequences, in the con- text of the FGF expression unit, are given in Fig. 2 A . The 5' sequence of the fgf gene was adapted with a sequence contain- ing the 5"untranslated and first 7 codons of the ompA leader and sequences translationally coupling the leader to the bFGF sequences. The 3' end of the fgf gene was adapted using a synthetic oligonucleotide extending from the BamHI site of the cDNA clone through the translation termination codon and ending in a HindIII site. This oligonucleotide changes a C to a T (position 644, Fig. M) , destroying the BamHI site at that point but not altering the amino acid coding sequence. These synthetic fragments, along with the NcoI to BamHI portion of the fgf cDNA (12) and BamHI/HindIII-digested pJU1003, were mixed and ligated. E. coli strain JM107, which does not contain T7 RNA polymerase, was transformed and appropriate clones were identified by restriction analysis. A clone containing the correct DNA sequence at both the 5' and 3' ends of fgf was named plasmid pJU1004. This plasmid was transformed into strain BLZl(DE3) that contains an inducible T7 RNA polymerase. IPTG was added to a midlog culture to induce production of FGF and the level of expres- sion measured by quantitative Western blotting. After 2 h of induction at an Am of approximately 1, less than 1 mg/liter/ A m unit of bFGF accumulated in these cells.

In another construct, we coupled the initiation of transla- tion (50) of the bFGF transcript to the phage T7 gene 10 N- terminal sequence present in plasmid pJU1003. This was done by digesting plasmid pJU1004 with the enzymes BamHI and NcoI (both unique to the plasmid) and replacing the ompAL translational coupler sequences with the synthetic sequence shown in Fig. 2B. When this completed plasmid, pJU1005, was inserted into strain BL21(DE3) and the T7 RNA polym- erase induced with IPTG, the expression of bFGF was high. Growth of this strain, expression conditions, and purification of the recombinant protein are described below.

Purification of FGF from E. coli Cells"BL21(DE3) cells containing plasmid pJU1005 synthesize, upon induction with IPTG, the recombinant human bFGF in amounts exceeding 10% of the total cell protein or 40 mg/liter/Am unit (Fig. 3A, lanes 1 and 2 ) . When cells were grown at 30 "C, the synthe- sized bFGF accumulates in the soluble cell lysate fraction

A .

T 7 Promoter PO 40 60

CGWTTAATACGACTCACT ATAGGGAGACCAWGGTT TCCCTCTAGAAATMTTTTG

R E eo %ri Gene 10 loo

TTTAACTTTAAGAAGGAGAT ATACAT ATG GCT AGC ATG ACT GGT GGA CAG CAA Met Ala Ser Met T h r G l y G l y G l n G l n

I2O BamH I I EcoR I 140

ATG GGT CGG GAT CC G AAT TCG ATA TCT CGT TOG AGA TAT TCA TGA Met G l y Arg Asp P r o A s n Ser I l e Ser Arg T r p A r g T y r Ser End

160 RES Start O ~ ~ A L 110

CGTATTITGGATWTAAC~GCGCM ATG AAA MG ACA GCT ATC GCG ATC Met L y r Lyr Thr Ala l l e Alo I le

RBS Stort FGF Ncol TTG GAG GAT TAA ATG GGG ACC ATG G c D N A BASES 11-412 (ref. 12) Leu G l u A s p End Met G l y T h r Met 640

680 680 ma

GGATCIAWAGGKCTGGGCAG&G~ATACTTTTTCTTCCMlGTCTGCTAAGAGCTGA End

CTGCMGCTT

B .

T7 Promoter 20 40 BO

CGAPATTAATACGACTCACT A T A G G G A G A C W P G G T T TCCCTCTAGAAATAATTTTG

Stort 010 TTTAACTTTAAGAAGGAGAT ATACAT ATG GCT AGC ATG ACT GGT GGA CAG CAA ATG

Met A l o Ser Met T h r G l y G l y G l n G l n Met

1 0 0

120 BamH I

I 40 Start FGF Ncol GGT CGG GAT CCG ATC GTG GAG GAT GAT TAA ATG GGT ACC ATG G G l y A r g Asp Pro I l e Val G l u Asp Asp EndMet G l y T h r Met

--- sequence through C-terminus some os in A .

FIG. 2. A, the fgf transcription-translation unit in plasmid pJU1004. The steps to construct this plasmid are described in the text. RES means ribosome binding site; OmpAL is the outer mem- brane protein leader sequence; EAMHI- is the position of a EamHI site in the cDNA clone offgfthat has been altered in this construction. The synthetic sequences in this construct are between EcoRI and NcoI sites (nucleotides 128-231) and BarnHI- and HindIII sites (nucleotides 640-705). E , the fgf transcription-translation unit in plasmid pJU1005. This plasmid is identical to pJU1004 except the OmpAL and translational coupler sequences have been replaced with a sequence that translationally couples T7 gene 10 to bFGF. New synthetic sequences in this construct are between BamHI and NcoI (nucleotides 121-154).

(Fig. 3A, lanes 3 and 4) , but when cells were grown at 37 "C, a substantial portion of the recombinant protein was found in the insoluble cell lysate fraction (data not shown).

The recombinant bFGF could be purified by a single-step affinity chromatography of the soluble E. coli cell lysate fraction on heparin-Sepharose (Fig. 3A, lane 5).

The electrophoretic mobility of the purified recombinant protein upon SDS-polyacrylamide gel electrophoresis was found to be identical to that of the native human placental bFGF (Fig. 3B). The silver-stained SDS gel of the purified recombinant protein preparation (Fig. 3B, lane 1 ) shows the presence of essentially a single band, and reverse-phase HPLC analysis of the same protein preparation (Fig. 4) reveals the presence of a single symmetrical peak on the chromatogram. These data indicate that the recombinant bFGF present in the E . coli cell lysate can be isolated with a very high degree of purity by single-step affinity chromatography on heparin- Sepharose. N-terminal amino acid sequencing of the recom-

16300

A

I 2 3

Human Basic Fibroblast Growth Factor from E. coli

MWX B

43

25.7

FIG. 3. Expression, purification, and characterization of human recombinant bFGF. Samples of E. coli cell lysates or purified bFGF protein were applied to a 15% SDS-polyacrylamide gel. The gel was stained with Coomassie Blue (panel A ) or silver (panel B ) . Panel A, total cell lysate obtained from E. coli containing the bFGF expression vector without (lane I ) or after IPTG induction (lane 2). The expressed recombinant bFGF accumulates in the soluble cell lysate fraction (lane 3 ) but could not be detected in the insoluble cell lysate fraction (lane 4 ) . After a single-step affinity chromatog- raphy of the soluble cell lysate fraction on heparin-Sepharose, the recombinant bFGF is eluted by 2 M NaCl in a highly purified form (lane 5). Panel R, purified recombinant bFGF (lane I ) and native human placental bFGF (lane 2) migrate identically upon SDS-poly- acrylamide gel electrophoresis.

0 5 L

FIG. 4. Reverse-phase HPLC analysis of purified recombi- nant human bFGF. 20 pg of heparin-Sepharose-purified recombi- nant bFGF was applied to a Synchrom RP-8 reverse-phase HPLC column equilibrated in water containing 0.1% trifluoroacetic acid. Protein was eluted with a linear gradient of acetonitrile containing 0.1% trifluoroacetic acid (1% acetonitrile/min; flow rate, 1 ml/min).

binant protein yielded no secondary sequences and revealed the essentially complete removal of the initiator methionine (data not shown). The purification procedure described allows for the recovery of approximately 80% of the recombinant bFGF present in the cell lysate. This was determined by comparison of quantitative Western analysis of bFGF present in soluble cell lysates and Bradford protein assays (47) on the bFGF purified by heparin-Sepharose chromatography from those lysates.

The purified recombinant bFGF was tested for its mitogenic activity on 3T3 fibroblasts (Fig. 5A) and plasminogen acti- vator synthesis-inducing activity on bovine capillary endothe- lial cells (Fig. 5B) . Half-maximal stimulation of both activities was achieved with recombinant bFGF concentrations of 1-3 ng/ml culture medium. For comparison, the native placental bFGF was also tested in parallel with the recombinant protein in the plasminogen activator synthesis assay (Fig. 5B), and the dose-response curves obtained indicate that the activity of the recombinant protein favorably compares with that of the native human placental bFGF. Finally, the recombinant

ng FGF/ml

0. I I 10 ng FGF/ rnl

FIG. 5. Induction of mitogenicity and plasminogen activa- tor synthesis by human recombinant bFGF. Panel A, quiescent 3T3 fibroblasts were exposed to increasing concentrations of recom- binant bFGF in the presence of ['Hlthymidine. The dose-response curve indicates that half-maximal stimulation of [3H]thymidine in- corporation is achieved at recombinant bFGF concentrations of 1-2 ng/ml culture medium. Panel B, plasminogen activator synthesis by bovine capillary endothelial cells was measured as a function of human recombinant bFGF in the culture medium (M). In a parallel assay, the potency of the native human placental bFGF was also tested (A-A). A comparison of the dose-response curves reveals that the activity of the human recombinant bFGF favorably compares with that of the human placental protein.

TABLE I Neovascular responses induced by varying concentrations of human

basic fibroblast growth factor Concentrations of test Proportion of positive

materials responses (%)

Recombinant bFGF 10 Pl? 515 (loo)* 1 Pg 616 (100)

100 ng 8/8 (100) 50 ng 617 (86) 10 ng 417 (57)

120 ng 515 (100) 60 ng 515 (100)

Native placental bFGF

6 ng 115 (20) PBS 016 (0)

'Recombinant and placental bFGF were diluted in PBS. The

bCorneal edema and inflammation were observed grossly in all concentration shown is the final concentration in Hydron.

corneas.

bFGF was tested for its ability to induce angiogenesis "in uiuo." All samples of recombinant bFGF that were tested elicited neovascular responses in a dose-dependent manner (Table I and Fig. 6, A-C). In general, bFGF a t concentrations >1 pg were potently angiogenic yet tended to induce an acute inflammatory response. Below this concentration, however, angiogenesis occurred in the absence of any gross histologic evidence of inflammation, with sustained neovascularization

Human Basic Fibroblast Growth Factor from E. coli 16301

r t.

FIG. 6. Colloidal carbon-perfused corneas showing nega- tive ( A ) and positive ( B and C) neovascular responses 7 days after implanting Hydron pellets containing PBS (A), 50 ng ( B ) , and 1 p g (C) of human recombinant bFGF. A gradation in neovascular responses induced by 50 ng ( B ) and 1 pg ( C ) of bFGF is shown. Note the directional in-growth of carbon-filled capillaries. This is in contrast to the PBS cornea ( A ) where no new capillary vessels are evident. Magnification, ~ 2 2 .

being elicited at concentrations as low as 10 ng. The potency of angiogenic responses induced by recombinant bFGF was comparable to those induced by native placental bFGF. Con- trol corneas containing PBS consistently failed to induce neovascularization.

DISCUSSION

Plasmid pJU1003 was constructed to facilitate cloning and expression of cDNAs via the bacteriophage T7 RNA polym- erase. This plasmid contains the highly expressed T7 gene 10 promoter sequence, the 5"untranslated sequence of that gene,

its translation initiation signal, and its first 11 codons. These sequences are followed by a synthetic polylinker containing many commonly used cloning sites that are unique to this plasmid. This polylinker makes it easy to clone protein coding sequences either in-frame with gene 10 to produce fusion proteins or to translationally couple (50) gene 10 to protein coding sequences by means of short synthetic adapters like those used here to make plasmids pJU1004 and pJU1005. Downstream of the polylinker is T@, the transcription ter- mination signal recognized by T7 RNA polymerase. This sequence is useful to prevent the wasteful transcription of the plasmid-borne blu gene which is located downstream of and in the same orientation as the T7 promoter. This transcript might compete for the translational apparatus with genes placed within the polylinker sequence.

The parent of pJU1003, pET-3b, contains the blu gene of plasmid pBR322 as its only selectable marker. This phenotype can be disadvantageous, especially if expression of plasmid- borne genes leads to slow cell growth. Cells of strain BL21(DE3) containing either plasmid pJU1004 or pJU1005 show a marked increase in doubling time following gene induction with IPTG. The rapid destruction of ampicillin by p-lactamase leads to plasmid-cured derivatives quickly over- growing a culture. This can result in difficulty in maintaining plasmids under ampicillin selection and to low plasmid copy number and therefore to low gene expression levels. To over- come these problems, we have reconstructed the tet gene of plasmid PET-3b with a modified version that lacks EcoRI, HindIII, and BamHI sites but still codes for resistance of up to 25 pg/ml tetracycline.

The fgf cDNA sequence has been cloned into plasmid pJU1003 in two distinct translational settings. In one, fgfwas coupled to the first 7 codons of the highly expressed E. coli ompA leader sequence (51). In the other, it was coupled directly to T7 gene 10. Different translational coupler se- quences were used between ompA leader or gene 10 sequences and fgf (Fig. 2, A and B ) . The difference in expression of fgf from these two clones was rather dramatic, approximately 40- fold.

There are several possible explanations for this observation: 1) for some reason transcription through the fgf gene or stability of the message is different from the plasmids pJU1004 and pJU1005; 2) the size of the spacer region be- tween the Shine-Dalgarno sequence and the initiation codon for fgf in pJU1004 is 5 bases, but in pJU1005 it is 8 bases (Fig. 2): this may affect translational coupling efficiency or the independent initiation of translation at the translational coupler site; 3) the fact that in the pJU1004 expression plasmid there is a nonproductive ribosome initiation site a t gene 10 that could compete with that for fgf. We have no experimental evidence to distinguish these possibilities, but the difference in expression levels from plasmids pJU1004 and pJU1005 is being investigated.

The observation that the bFGF expressed in E. coli grown at 30 "C remains largely soluble even at high expression levels (40 mg/ml/Am unit) has greatly simplified the procedure for purifying large quantities of this protein in a biologically active form. The in vivo biological functions of fibroblast growth factors, as well as many structural details of these multifunctional proteins, have not yet been established. The availability of large quantities of recombinant FGFs should greatly facilitate future studies aimed at elucidating the bio- logical function of FGFs and should allow for extensive clin- ical testing of these proteins as potential pharmaceuticals. The procedures described here for the expression and purifi- cation of human recombinant bFGF have been successfully

16302 Human Basic Fibroblast Growth Factor from E. coli

used for the generation of gram quantities of highly purified and active protein.

Iwane et al. (52) reported the expression and purification of a truncated form of human bFGF. These authors found that the major portion of the recombinant bFGF eluted from a heparin-Sepharose column at a NaCl concentration of 0.95 M. In our studies, very little bFGF eluted from the heparin- Sepharose column at 1 M NaC1. FGFs have traditionally been subdivided into two classes, at least in part based on the NaCl concentrations required to elute these proteins from heparin- Sepharose columns. aFGFs generally require approximately 1 M NaCl for their elution from heparin-Sepharose columns, while bFGFs, including truncated forms of the protein, elute at NaCl concentrations of 1.5-2 M NaCl (7). Thus, the differ- ence in the heparin-Sepharose chromatographic behavior of the bFGF described by Iwane et al. (52) and the bFGF de- scribed in this report remains unclear.

Acknowledgments-We would like to thank Debbie Abbott-Brown, Mary Masteller, Julie Wilson, Trish Heimdal, David Dripps, and Thomas Gleason for their excellent technical assistance and Anne Hill for preparation of the manuscript.

REFERENCES 1. Gospodarowicz, D., Neufeld, G., and Schweigerer, L. (1986) Mol.

Cell. Endocr. 4 6 , 187-204 2. Gospodarowicz, D., Ferrara, N., Schweigerer, L., and Neufeld, G.

(1987) Endocr. Reu. 8 , 95-114 3. Baird, A., Esch, F., Mormede, P., Ueno, N., Ling, N., Bohlen, P.,

Ying, S.-Y., Wehrenberg, W. B., and Guillemin, R. (1986) Recent Prog. Horrn. Res. 42,143-205

4. Maciag, T., and Burgess, W. H. (1986) in Cellular Endocrinology: Hormonal Control of Embryonic and Cellular Differentiation (Serrero, G., and Hayashi, J., eds) pp. 361-369, Alan R. Liss, Inc., New York

5. Shing, Y., Folkman, J., Sullivan, R., Butterfield, C., Murray, J., and Klagsbrun, M. (1984) Science 223, 1296-1299

6. Maciag, T., Mehlman, T., and Friesel, R. (1984) Science 225 ,

7. Lobb, R. R., Harper, J. W., and Fett, J. W. (1986) Anal. Biochem.

8. Jaye, M., Howk, R., Burgess, W., Ricca, G. A., Chiu, I."., Ravera, M. V., O'Brien, S. J., Modi, W. S., Maciag, T., and Drohan, W. N. (1986) Science 233 , 541-545

9. Abraham, J. A., Mergia, A., Whang, J. L., Tumolo, A., Friedman, J., Hjerrild, K. A., Gospodarovicz, D., and Fiddes, J . C. (1986) Science 233,545-548

10. Abraham, J. A., Whang, J. L., Tumolo, A., Mergia, A., Friedman, J., Gospodarovicz, D., and Fiddes, J. C. (1986) EMBO J. 5 , 2523-2528

11. Kurokawa, T., Sasada, R., Iwane, M., and Igarashi, K. (1987)

12. Sommer, A., Brewer, M. T., Thompson, R. C., Moscatelli, D., Presta, M., and Rifkin, D. B. (1987) Biochem. Biophys. Res. Commun. 144,543-550

13. Moscatelli, D,, Presta, M., and Rifkin, D. B. (1986) Proc. Natl. Acad. Sei. U. S. A. 83,2091-2095

14. Senior, R. M., Huang, S. S., Griffin, G. L., and Huang, J. S. (1986) Biochem. Biophys. Res. Commun. 141,67-72

15. Presta, M., Moscatelli, D., Joseph-Silverstein, J., and Rifkin, D. B. (1986) Mol. Cell. Biol. 6, 4060-4066

16. Gospodarowicz, D., Bialecki, H., and Thakral, T. K. (1979) Exp. Eye Res. 28,501-514

17. Thomas, K. A., Rios-Candelore, M., Gimenez-Gallego, G., Dis- alvo, J., Bennett, c., Rodkey, J., and Fitzpatrick, S. (1985) Proc. Natl. Acad. Sci. U. S. A. 8 2 , 6409-6413

932-935

154 , l -14

FEBS Lett. 213 , 189-194

18. Esch, F., Baird, A., Ling, N., Ueno, N., Hill, F., Denoroy, L., Klepper, R., Gospodarovicz, D., Bohlen, P., and Guillemin, R. (1985) Proc. Natl. Acad. Sci. U. S. A. 82,6507-6511

19. Lobb, R. R., Alderman, E. M., and Fett, J. W. (1985) Biochemistry 24,4969-4973

20. Fett, J. W., Bethune, J. L., and Vallee, B. L. (1987) Biochem. Biophys. Res. Commun. 146,1122-1131

21. Folkman, J., and Klagsbrun, M. (1987) Science 236,442-447 22. Morrison, R. S., Sharma, A., DeVellis, J., and Bradshaw, R. A.

(1986) Proc. Natl. Acad. Sci. U. S. A. 8 3 , 7537-7541 23. Unsicker, K., Reichert-Preibsch, H., Schmidt, R., Pettmann, B.,

Acad. Sci. U. S. A. 84,5459-5463 Labourdette, G., and Sensenbrenner, M. (1987) Proc. Natl.

24. Schubert, D., Ling, N., and Baird, A. (1987) J. Cell Biol. 104 ,

25. Davidaon, J. M., Klagsbrun, M., Hill, K. E., Buckley, A., Sullivan, R., Brewer, P. S., and Woodward, S. C. (1985) J. Cell Biol.

26. Woost, P. G., Brightwell, J., Eiferman, R. A., and Schultz, G. S. (1985) Exp. Eye Res. 40,47-60

27. Fourtanier, A. Y., Courty, D. P. J., Muller, E., Courtois, D. P. Y., Prunieras, M., and Barritault, D. (1986) J. Invest. Dermatol.

28. Canolis, E., Lorenzo, J., Burgess, W. H., and Maciag, T. (1987) J. Clin. Invest. 7 9 , 52-58

29. Griesler, H. P., Klosak, J. J., Dennis, J. W., Ellinger, J., Kim, D. U., Burgess, W., and Maciag, T. (1986) Trans. Am. SOC. Artif. Intern. Organs 3 2 , 346-349

30. Griesler, H. P., Klosak, J. J., Dennis, J. W., Kaareeh, S. M., Ellinger, J., and Kim, D. U. (1987) J. Vasc. Surg. 5,393-399

31. Yamada, T. (1982) in Cell Biology of the Eye (McDevitt, D. S., ed) pp. 193-234, Academic Press, New York

32. Cuny, R., Jeanny, J. C., and Courtois, Y. (1986) Differentiation

33. Gospodarovicz, D., and Mescher, A. L. (1981) in Advances in Neurology: Neurofibromatosis (Riccardi, V. M., and Mulvihill, J. J., eds) Vol. 29, p. 149, Raven Press, New York

635-643

100,1219-1227

87976-80

32,221-229

34. Dunn, J., and Studier, F. W. (1983) J. Mol. Biol. 1 6 6 , 477-535 35. Chamberlin, M., McGrath, J., and Waskell, L. (1970) Nature

36. Chamberlin, M., and Ring, J. (1973) J. Biol. Chem. 2 4 8 , 2235-

37. Golomb, M., and Chamberlin, M. (1974) J. Biol. Chem. 2 4 9 ,

38. Studier, F. W. (1972) Science 176,367-376 39. Holmes, M., Platt, T., and Rosenberg, M. (1983) Cell 3 2 , 1029-

40. Studier, F. W., and Moffat, B. (1986) J. Mol. Biol. 189,113-130 41. Yanisch-Perron. C.. Vieira. J., and Messing, J. (1985) Gene

228,227-231

2244

285&2863

1032

(Amst.) 33,163-i19 , . -.

42. Rosenberg, A., Lade, B., Chui, D., Lin, S., Dunn, J., and Studier, F. (1987) Gene (Amst.) 56,125-135

43. Miller, J. (1972) Experiments in Molecular Genetics, Cold Spring

44. Zagursky, R., Baumeister, N., Lomax, N., and Berman, M. (1985)

45. Chen, E., and Seeburg, P. H. (1985) DNA 4 , 165-170 46. Laemmli, U. K. (1970) Nature 227,680-685 47. Bradford, M. M. (1976) Anal. Biochem. 7 2 , 248-254 48. Polverini, P. J., and Leibovich, S. J. (1984) Lab. Invest. 61,635-

49. Langer, R., and Folkman, J. (1976) Nature 263,797-798 50. Schoner, B. E., Hsiung, H. M., Belagaje, R. M., Mayne, N. G.,

and Schoner, R. G. (1984) Proc. Natl. Acad. Sci. U. S. A. 8 1 ,

51. Mouva, N. R., Nakamura, K., and Inouye, M. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 3845-3849

52. Iwane, M., Kurokawa, T., Sasada, R., Seno, M., Nakagawa, S., and Igarashi, K. (1987) Biochern. Biophys. Res. Commun. 146,

Harbor Laboratory, Cold Spring Harbor, NY

Gene Anal. Tech. 2,89-94

642

5403-5407

470-477