prognostic and therapeutic impact of argininosuccinate ... · ass1 overexpression and knockdown...

Therapeutics, Targets, and Chemical Biology

Prognostic and Therapeutic Impact of ArgininosuccinateSynthetase 1 Control in Bladder Cancer as MonitoredLongitudinally by PET Imaging

Michael D. Allen1, Phuong Luong1, Chantelle Hudson1, Julius Leyton1, Barbara Delage1, Essam Ghazaly1,Rosalind Cutts1, Ming Yuan1, Nelofer Syed2, Cristiana Lo Nigro9, Laura Lattanzio9,Malgorzata Chmielewska-Kassassir10, Ian Tomlinson4, Rebecca Roylance1,3, Hayley C. Whitaker5,Anne Y. Warren5, David Neal5, Christian Frezza6, Luis Beltran3, Louise J. Jones1,3, Claude Chelala1,Bor-Wen Wu11, John S. Bomalaski11, Robert C. Jackson7, Yong-Jie Lu1, Tim Crook8, Nicholas R. Lemoine1,StephenMather1, Julie Foster1, JaneSosabowski1,Norbert Avril1, Chien-FengLi12,13,14, andPeterW.Szlosarek1,3

AbstractTargeted therapies have yet to have significant impact on the survival of patients with bladder cancer. In this

study, we focused on the urea cycle enzyme argininosuccinate synthetase 1 (ASS1) as a therapeutic target inbladder cancer, based on our discovery of the prognostic and functional import of ASS1 in this setting. ASS1expression status in bladder tumors from 183 Caucasian and 295 Asian patients was analyzed, along with itshypothesized prognostic impact and association with clinicopathologic features, including tumor size andinvasion. Furthermore, the genetics, biology, and therapeutic implications of ASS1 loss were investigated inurothelial cancer cells. We detected ASS1 negativity in 40% of bladder cancers, in which multivariate analysisindicated worse disease-specific and metastasis-free survival. ASS1 loss secondary to epigenetic silencing wasaccompanied by increased tumor cell proliferation and invasion, consistent with a tumor-suppressor role forASS1. In developing a treatment approach, we identified a novel targeted antimetabolite strategy to exploitarginine deprivation with pegylated arginine deiminase (ADI-PEG20) as a therapeutic. ADI-PEG20 was synthet-ically lethal in ASS1-methylated bladder cells and its exposure was associated with a marked reduction inintracellular levels of thymidine, due to suppression of both uptake and de novo synthesis. We found thatthymidine uptake correlated with thymidine kinase-1 protein levels and that thymidine levels were imageablewith [18F]-fluoro-L-thymidine (FLT)–positron emission tomography (PET). In contrast, inhibition of de novosynthesis was linked to decreased expression of thymidylate synthase and dihydrofolate reductase. Notably,inhibition of de novo synthesis was associated with potentiation of ADI-PEG20 activity by the antifolate drugpemetrexed. Taken together, our findings argue that arginine deprivation combined with antifolates warrantsclinical investigation in ASS1-negative urothelial and related cancers, using FLT-PET as an early surrogatemarkerof response. Cancer Res; 74(3); 896–907. �2013 AACR.

IntroductionUrothelial carcinoma is the fourth most common malig-

nancy diagnosed in men, and the seventh commonest cause ofsolid cancer-related death in the United States, accounting for15,000 deaths per annum (1). The 5-year overall survival rate of

40% to 60% for muscle invasive bladder cancer has plateauedover the past three decades, in part, due to the frequentcomorbidities in this patient group (2). Moreover, despite$4.0 billion spent each year on bladder cancer treatment inthe United States alone—one of the highest expenditures in

Authors' Affiliations: 1Barts Cancer Institute—a Cancer Research UKCenter of Excellence, John Vane Science Center, Queen Mary Universityof London; 2Department of Medicine, Imperial College, Charing CrossCampus; 3St Bartholomew's Hospital, Barts Health NHS Trust, WestSmithfield, London; 4Wellcome Trust Center for Human Genetics, Oxford;5Cancer Research UK Cambridge Research Institute, Li Ka Shing Center;6Hutchison/MRC Research Center, University of Cambridge, MedicalResearch Council Cancer Unit; 7Pharmacometrics Ltd., Cambridge; 8Dun-dee Cancer Center, University of Dundee, Ninewells Hospital, Dundee,United Kingdom; 9Laboratory of Cancer Genetics and Translational Oncol-ogy, S Croce General Hospital, Cuneo, Italy; 10Department of StructuralBiology, Medical University of Lodz, Lodz, Poland; 11Polaris Group, SanDiego, California; 12Department of Pathology, Chi-Mei Medical Center;13Department of Biotechnology, Southern Taiwan University of Scienceand Technology, Tainan, Taiwan; and 14National Institute of CancerResearch, National Health Research Institutes, Tainan, Taiwan

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

M. Allen and P. Luong contributed equally as joint first authors and C.-F. Liand P.W. Szlosarek as joint last authors.

Corresponding Author: Peter W. Szlosarek, Center for Molecular Oncol-ogy, Barts Cancer Institute, Queen Mary University of London, Barts andThe London School of Medicine and Dentistry, London EC1A 7BE, UnitedKingdom. Phone: 0044-207-882-3559; Fax: 0044-207-882-3884; E-mail:[email protected]

doi: 10.1158/0008-5472.CAN-13-1702

�2013 American Association for Cancer Research.

CancerResearch

Cancer Res; 74(3) February 1, 2014896

on January 12, 2021. © 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst November 27, 2013; DOI: 10.1158/0008-5472.CAN-13-1702

http://cancerres.aacrjournals.org/

oncology—targeted therapies have been ineffective to date inthis disease (3).Recently, arginine auxotrophy or the absolute requirement

for exogenous arginine for cellular growth has been detected inseveral chemoresistant solid cancers, including hepatocellularcarcinoma, melanoma, mesothelioma, and prostate cancer(4–6). Arginine fuels an array of biosynthetic reactions, includ-ing proteins, nitric oxide (NO), polyamines, agmatine, and theamino acids proline and glutamate, and therefore may mod-ulate tumorigenesis at multiple levels (7). Inactivation of thepleiotropic enzyme, argininosuccinate synthetase 1 (ASS1),with key roles in the urea cycle, citrulline–NO cycle, andarginine biosynthesis has emerged as a principal driver oftumoral arginine auxotrophy, with evidence for epigeneticsilencing and hypoxia-inducible factor-1a (HIF-1a)–mediatedtranscriptional repression of ASS1 (5, 8, 9). Significantly, ASS1loss has been associated with decreased overall survival inovarian cancer and myxofibrosarcoma, and reduced metasta-sis-free survival in osteosarcoma, implicating a tumor-sup-pressor function for this metabolic gene (10–12). Thus, argi-nine deprivation is being tested increasingly in the clinic,modeled on the successful introduction of another amino aciddepletor, namely asparaginase, in the management of acutelymphoblastic leukemia five decades ago (13). Specifically,several early-phase trials of the arginine-degrading mycoplas-mal enzyme, pegylated arginine deiminase (ADI-PEG20), haveled to phase II/III randomized studies in melanoma, hepato-cellular cancer, and mesothelioma (14–16).Here, we characterized ASS1 in bladder cancer based on the

fact that loss of chromosome 9, including q34, the locus ofASS1,is a known early event in urothelial tumorigenesis (17). Pre-viously, Linnenbach and colleagues provided evidence for atruncation mutation at the ASS1 locus in a ureteric carcinomasample, while searching for tumor suppressors at 9q34 (18).Here, we show that ASS1 negativity is a common event inbladder cancer detected in approximately 40% of tumors byimmunohistochemistry (IHC). Furthermore, to address a puta-tive tumor-suppressor role, we performed additional geneticand epigenetic studies of ASS1 using a panel of bladder cancercell lines. Finally, we studied the therapeutic consequences ofASS1 loss in bladder cancer, identifying a novel targetedantimetabolite strategy that combines arginine deprivationwith the antifolate, pemetrexed. These studies were reinforcedby metabolomic and positron emission tomography (PET)tracer analyses, which identify intracellular thymidine levelsas a novel biomarker of early treatment response.

Materials and MethodsPrimary tumor characteristicsTissuemicroarrays (TMA)were constructed using a training

set of biopsy samples, comprising 183 urothelial carcinomascollected at the Cancer Research UK Cambridge ResearchInstitute (19), and an independent test set of 295 urothelialcarcinomas, which were resected consecutively with curativeintent in Chi Mei Medical Center, Taiwan, between January1996 andMarch 2004. Institutional review boards in the UnitedKingdom (Cambridgeshire Local Research Ethics Committee)

and Taiwan (IRB971006) ratified the tissue procurement. Thediagnostic criteria were based on the updated American JointCommittee on Cancer Staging.

IHCASS1 IHC was performed using liver control sections as

described previously (5). The scoring of thymidylate synthase(TS; 1:100, Clone EPR4545; Epitomics) anddihydrofolate reduc-tase (DHFR;1:100, Clone EPR5285; Epitomics) was performedusing an H-score, determined by the percentage and intensityof positively stained tumor cells with cases stratified accordingto high (no less than the median score) or low expression (lessthan the median score; ref. 20).

Cell lines and cultureSix bladder cancer cell lines were grown in a humidified

atmosphereat37�Cand5%CO2 inendotoxin-freeRPMImediumwith10%FBS (RT112, 5637, SCaBER, 253J, andT24) orDulbecco'sModified Eagle Medium (DMEM) with 10% FBS (UMUC3). Thearginine concentration was approximately 10-fold higher in theculture medium than found in human serum (i.e., 1 mmol/L vs.0.06–0.1 mmol/L, respectively). Experiments were performedusing cells at 70% confluency, which were harvested for analysisof ASS1 promoter methylation, constitutive ASS1 mRNA, andprotein. Studies of corroborative cell lines in anonurothelial solidcancer (mesothelioma) were performed and all cell lines wereauthenticatedby short tandemrepeat profiling (LGCStandards).

Methylation-specific PCROnemicrogram of genomic DNA was modified with sodium

bisulphite using the EZDNAmethylation kit (Zymo) accordingto the manufacturer's instructions. Then, 50 ng of modifiedDNAwas amplified using the following primers designed usingthe ASS1 promoter sequence: UF (50 GTAGGAGGGAAG-GGGTTTTT); UR (50 ACAAAAAACAAATAACCCAAA); MF (50

GTAGGAGGGAAGGGGTTTTC); and MR (50 GCAAAAAACA-AATAACCCGAA), in which U ¼ unmethylated and M ¼methylated. Control CpGenome universal methylated andunmethylated DNA were obtained from Merck Millipore.

PyrosequencingMethylation in the -C-phosphate-G- (CpG) islands of the

ASS1 gene in the urothelial cell line panel was also analyzedusing pyrosequencing technology. For pyrosequencing of theparaffin primary bladder cancer samples, PCR amplificationand sequencing primers were optimized using the PyroMarkAssay Design Software 2.0. Details of PCR primers and condi-tions are available on request.

Sequencing analysisThe coding exons and flanking sequences of ASS1 were

analyzed by Sanger sequencing in forward and reverse in thepanel of bladder cancer cell lines. Details of PCR primers andconditions are available on request.

Quantitative real-time reverse transcriptase PCRTotal RNAwas extracted using the RNeasyMini Kit (Qiagen)

and reverse-transcribed with the High Capacity cDNA ReverseTranscription Kit (Applied Biosystems) according to the

Prognostic and Predictive Role of ASS1 Loss in Bladder Cancer

www.aacrjournals.org Cancer Res; 74(3) February 1, 2014 897




manufacturer's instructions. Multiplex PCR was performed onan ABI Prism 7500 Real-Time PCR Instrument (Applied Bio-systems). Primers and TaqMan probes for ASS1 (FAM) and 18S(VIC) were obtained from Applied Biosystems (TaqMan GeneExpression Assays).

ASS1 overexpression and knockdownASS1 overexpression was performed in 253J, UMUC-3, and

T24 bladder cancer cells using ASS1pIREShyg3 (or control)vector under hygromycin (200 mg/mL) selection, as describedpreviously (10). ASS1 knockdown in 5637 bladder cancer cellswas performed using the pSilencer 4.1-CMVpuro vector(Ambion) containing short hairpin RNA (shRNA) sequencestargeting ASS1 (SMARTpool; Dharmacon) or a nontargetingcontrol shRNA under puromycin (1 mg/mL) selection.

Proliferation assaysBriefly, 3� 104 cells were suspended in 200 mL of serum-free

DMEM, plated into a 96-well plate, and incubated for 48 hours.Subsequently, 40 mL of CellTitre Aqueous One solution (Pro-mega, G3580) was added to each well and the plate wasincubated for between 15 minutes to 1 hour before readingat 450 nm (Labtech, LT4000MS).

Invasion assaysBriefly, transwells (Corning, 3422) were coatedwithMatrigel

(BD Bioscience, 354234) diluted 1:3 with serum-free DMEMand allowed to set for 1 hour at 37�C. Transwells were placed inthe wells of a 24-well plate containing 500 mL of DMEM (PAA)with 10% serum. 3 � 104 cells in 200 mL of serum-free DMEMwere plated into the top of the transwell, and incubated at 37�Cfor 48 hours. Transwells were removed from the DMEMþ 10%FBS and placed into 500 mL of Trypsin/EDTA (PAA) for 1 hourat 37�C. The undersides of transwells were then washed withtrypsin and the cell suspension transferred to 9.5 mL of Isotonand the number of cells quantified on a CASY counter. Allexperiments were repeated at least three times using quintu-plicate readings.

ImmunoblottingWestern blot analysis for ASS1 (BD Biosciences) was per-

formed as described previously (5). Membranes were alsoprobed for TS (Sigma-Aldrich), DHFR, TK1 (Abcam), p53R2(Santa Cruz Biotechnology), PARP (Signal Transduction),b-actin, and Hsc70.

Drug treatmentsArginine depletion experiments were performed using ADI-

PEG20 (Polaris Group) and 2%dialyzed FBS (>10KDa, AutogenBioclear). Cell viability was measured using the MTT assayaccording to manufacturer's instructions (Roche Diagnostics).Pemetrexed (Eli Lilly and Company) was purchased from BartsChemopharmacy. Combination drug treatments of ADI-PEG20 and pemetrexed were studied using the Chou-Talalaymethodology and the effect on tumor cell apoptosis wasdetected using PARP cleavage (Cell Signaling Technology) andAnnexin V staining (21). Proteosome inhibition and demeth-ylation experiments were performed using MG132 (1 mmol/L;

Sigma-Aldrich) and 5-aza-20-deoxycytidine (5-Aza-dC, 0.1–1mmol/L; Sigma-Aldrich), respectively.

Liquid chromatography–mass spectrometryPBS control and ADI-PEG20 treated cells (3 � 106) were

washed twice with phosphate buffer saline and then harvestedby adding 10 mL of ice-cold 80% methanol containing 0.1%formic acid (all reagents from Fisher Scientific). Cell extractswere prepared using a standard protocol and injected into theliquid chromatography–mass spectrometry (LC-MS) system.LC was performed using the nanoACQUITY UltraPerformance(UP) LC system (Waters) and MS was executed using a WatersQ-ToF Premier operated in positive and negative electrosprayionization modes. Data acquisition and analysis were per-formed using theWaterMasslynx software (V 4.1) andMZminesoftware (version 2.2), respectively. Peak lists, including reten-tion, M/Z, and peak intensities, were exported from MZmineand imported into Microsoft Office Excel 2007, revealingvolcano plots and the fold change and P value for individualmetabolites. Subsequent targeted metabolomic analysis wasperformed in the positive ion mode.

In vitro tracer uptake assaysCells were plated at 1� 105 cells per well the evening before

the experiment. The next day cells were incubated with ADI-PEG20 (750 ng/mL). On the day of the assay, the drug mediawere removed and incubated in media supplemented with2% dialyzed FBS for 1 hour. [3H] thymidine was then added at 1mci/mL to each well and incubated for a further 1 hour. Cellswere then washed twice in ice-cold PBS, and harvested withtrypsin. The cell lysates were collected and added to tubescontaining 2mL of scintillation fluid and the cell-associated 3Hradioactivity was measured using the b scintillation counter(LKB Instruments). The radioactivity uptake in nmoles wasnormalized to the number of viable cells to give pmole uptakeper 10,000 live cells and expressed relative to untreated con-trols. All experiments were done in triplicate and repeated 3times.

In vivo experimentsUMUC-3 cells (1 � 107 in 0.1 mL) were implanted into the

flank of CD1 nu/nu mice and developed into visible tumors by11 days. For the in vivo [18F]-fluoro-L-thymidine (FLT)–PETstudies, animals (n¼ 5)were injected i.v. via the tail veinwith 15to 18MBq of [18F]-FLT and imaged using an InveonmicroPET/CT (Siemens) before and 24 hours after treatment with ADI-PEG20 (5 IU). Standardizeduptake values (SUV)were calculatedby dividing the activity concentration in each voxel by theinjected dose and dividing by the animal weight. For drugcombination studies, mice were separated into four intraper-itoneal (i.p.) treatment groups (n ¼ 11 per group): PBS control(days 1 and 8), ADI-PEG20 (5 IU on days 1 and 8), pemetrexed(PEM; 100 mg/kg on days 2–4 and 9–11); and ADI-PEG20 (5 IUon days 1 and 8) plus PEM (100 mg/kg on days 2–4 and 9–11).Tumor volume and animal weights were recorded and all micewere sacrificed on day 11; tumors were collected and stored forimmunohistochemical analyses. Additional 18F-FLTmicroPET/CT imaging was performed in female UMUC3 bladder cancer

Allen et al.

Cancer Res; 74(3) February 1, 2014 Cancer Research898




tumor-bearing CD1 nude mice (n ¼ 5 per group) assessing thedrug combination. Animals were imaged at baseline immedi-ately before i.p. treatment with 5 IU ADI (ADI and PEM þ ADItreatment groups) or PBS (PBS andPEM treatment groups) andimaged again 24 hours later. Immediately after the 24-hourimaging timepoint, the PEM and PEMþ ADI treatment groups

received 100 mg/kg PEM i.p. for 5 days whereas the othersreceived PBS, with 18F-FLT imaging carried out on day 7.

Statistical analysisGraphPad Prism version 5.0 and SPSS 14.0 were used to test

results for statistical significance. The associations of ASS1

Figure 1. ASS1 IHC and clinicalcorrelation in bladder cancer.Representative hematoxylin and eosinand ASS1 staining of normalurothelium (A and B), low-grade (C andD), and high-grade (E and F) urothelialcarcinomas (X400). ASS1 expression ispresent in normal urothelium and thelow-grade lesion but absent in thehigh-grade lesion, with vascularendothelial cells serving as the positiveinternal control. ASS1 deficiency ishighly predictive of worse disease-specific (G) and metastasis-freesurvival (H) by log-rank tests.






expression level with clinicopathologic factors were evaluatedusing the c2, Fisher exact, or Wilcoxon rank-sum test asappropriate. For all analyses, two-sided tests of significancewere used with P < 0.05 considered significant.

ResultsLoss of ASS1 confers poor survival in bladder cancer

First,we screened forASS1 expression ina training set bladdercancer TMA derived from a European population revealing that45% (83 of 183) of biopsies were ASS1-negative. The validationTMA (Fig. 1A–F) from an Asian population yielded similarresults with 37% of bladder cancer cases (108 of 295) beingASS1-negative. ASS1 negativity conferred a poor disease-specific(P ¼ 0.011) and metastasis-free survival (P ¼ 0.001) on multi-variate analysis (Fig. 1G and H and Table 1). Furthermore, ASS1loss was linked to several adverse clinicopathologic features,including increased tumor size and grade, lymph node involve-ment, and vascular invasion (Supplementary Tables S1 and S2).

Methylated ASS1 is linked to increased proliferation andinvasion of bladder cancer cells

To understand the regulation of ASS1 expression and its rolein urothelial malignancy, we screened six bladder carcinoma celllines for genomic and epigenetic alterations. FISH analysisconfirmed all lines were either triploid or tetraploid with theASS1 locus intact (data not shown). There were nomutations inASS1 and no loss of heterozygosity in the region immediatelysurrounding ASS1 (data not shown). Instead, the UMUC-3 and253J cell lines were fully methylated, whereas the T24 line waspartially methylated at the ASS1 promoter, with negligible ASS1mRNA and no ASS1 protein. In contrast, all the ASS1-unmethy-latedcell lines (SCaBER, RT112, and 5637) expressedASS1mRNAand protein (Fig. 2A). Notably, ASS1 promoter methylation wasgreatest in UMUC-3 and 253J compared with the T24 cell line by

pyrosequencing of six CpG islands within the ASS1 promoter. Incontrast, the ASS1-positive bladder cancer cell lines wereunmethylated by pyrosequencing validating the results obtainedwith MS-PCR (Fig. 2B). The demethylating agent decitabinereexpressed ASS1 protein in 253J, UMUC-3, and T24 cells, con-firmingepigenetic silencingas a keymechanism involved inASS1inactivation in bladder cancer cells (data not shown; ref. 22).

To determine the correlation between immunohistochemi-cal expression of ASS1 and methylation status, tissue blocks ofan independent set of 30 urothelial carcinomas with a hightumor cell content (>70%) were selected for pyrosequencing.Following optimization of primers for paraffin-embedded tis-sue, only one ASS1-positive tumor had an average methylationvalue of 45% that was greater than the threshold value of 40%(Supplementary Fig. S1). The remaining tumors with methyl-ation values>40%were all negative forASS1 immunoexpression(P < 0.001), validating the role of promoter methylation in ASS1silencing in primary bladder cancer (Supplementary Table S3).

Next, we addressed the significance of epigenetic loss ofASS1 in bladder cancer by manipulating ASS1 in our panel ofurothelial cancer cell lines. Although ASS1 overexpressiondecreased the proliferation of 253J and UMUC-3 cells, ASS1siRNA increased the proliferation of 5637 cells, consistent witha tumor-suppressor role for ASS1 in urothelium (Fig. 2C). Wealso observed a reciprocal relationship between ASS1 expres-sion and cell invasion by performing matrigel invasion assays,confirming thatASS1 loss increased the invasiveness of urothe-lial tumor cells in vitro (Fig. 2D).

ASS1-methylatedbladder cancer cell lines are sensitive toADI-PEG20

To test the effect of arginine deprivation on bladder cancercell line viability, we treated the panel of bladder cancer celllines with the arginine depletor, ADI-PEG20. All ASS1-negative

Table 1. Multivariate analysis for disease-specific and metastasis-free survival in bladder cancer

DSS MeFS

Parameter Category HR 95% CI P value HR 95% CI P value

Primary tumor (T) Ta 1 — <0.001a 1 — 0.003a

T1 3.546 1.60–7.874 5.965 1.671–21.301T2-4 28.571 3.07–250.00 7.821 2.169–28.200

Mitotic activity (10 HPF) <10 1 — 0.009a 1 — 0.004a

> ¼ 10 2.451 1.248–4.817 2.143 1.269–3.619ASS1 expression Positive 1 — 0.011a 1 — 0.001a

Deficient 2.233 1.201–4.153 2.336 1.419–3.847Nodal status (N) N0 1 — 0.994 1 — 0.257

N1-2 1.003 0.463–2.175 1.446 0.764–2.737Perineural invasion Absent 1 — 0.160 1 — 0.120

Present 1.974 0.764–5.105 1.815 0.856–3.850Vascular invasion Absent 1 — 0.481 1 — 0.957

Present 1.299 0.373–1.592 1.017 0.553–1.872Histologic grade Low grade 1 — 0.944 1 — 0.696

High grade 1.058 0.192–4.641 1.238 0.425–3.607

Abbreviations: CI, confidence interval; DSS, disease-specific survival; MeFS, metastasis-free survival.aStatistically significant.

Allen et al.





cell lines were sensitive to ADI-PEG20 with the highly meth-ylated lines 253J and UMUC-3 displaying the greatest sensi-tivity to arginine depletion; in contrast, the ASS1-positive celllines 5637, RT112, and SCaBER were resistant to ADI-PEG20(Fig. 3A). Moreover, forced ASS1 overexpression in ASS1-neg-ative cell lines reduced their sensitivity to ADI-PEG20, validat-ing the role of ASS1 loss in mediating the synthetic lethal effectto arginine deprivation (Fig. 3B).

ADI-PEG20 inhibits pyrimidine metabolism inASS1-negative tumor cellsWe proceeded to analyze the metabolic effects of ADI-PEG20

and confirmed a significant decrease in intracellular argininewith a corresponding increase in citrulline in ASS1-negativebladder cancer cells. Marked reductions in thymidine andincreases in thymine and glutamine were also detected by

LC/MS (Fig. 4A). In contrast, ADI-PEG20 reduced arginine levelsto a minor extent in the ASS1-positive RT112 control cell line,whereas intracellular levels of thymidine, thymine, and gluta-mine were unaffected, indicating a nonessential role for exog-enous arginine. Because of these differential effects on intracel-lular thymidine, we interrogated gene pathways modulated byADI-PEG20, identifying downregulation of the folate-dependentnucleotide synthesizing enzymes TS and DHFR specifically inASS1-negative tumor cells (data not shown). Marked suppres-sionofDHFRandTSmRNAandproteinwas detected inall threeADI-sensitive bladder cancer cell lines whereas no effect wasseen in theRT112 control cell line exposed toADI-PEG20 (Fig. 4Band C). We also analyzed the thymidine salvage pathway, as acompensatory source of cellular thymidine upon suppression ofde novo pyrimidine synthesis. Unexpectedly, ADI-PEG20 alsoreduced 3H-thymidine uptake in the arginine-auxotrophic cell

Figure 2. Epigenetic silencing of ASS1 in bladder cancer linked to increased tumor cell proliferation and invasion. A, ASS1 mRNA, protein, and methylationstatus of a panel of six bladder cancer cell lines. B, pyrosequencing revealed more ASS1 methylation in 253J and UMUC-3 cells than T24 cells, whereas5637, SCaBER, and RT112 cells were unmethylated, consistent with the MS-PCR data. C, overexpressing (O/E; inset) ASS1 in UMUC-3 and 253J celllines resulted in a significant (5%–20%) reduction in proliferation, respectively; in contrast, knockdown of endogenous ASS1 (inset) in 5637 cells caused asignificant 20% increase in proliferation. �, P < 0.0001 (three independent experiments). D, overexpression of ASS1 in 253J and UMUC-3 cell linescaused a significant (50%and75%, respectively) reduction of invasion, whereas knockdownof endogenousASS1 in 5637 cells resulted in a significant (75%)increase in invasion. �, P < 0.0001 (three independent experiments). Con, control empty vector cells.






lines associated with downregulation of thymidine kinase 1(TK1; ref. 23), with no effect in RT112 control cells (Fig. 4D andE). Notably, cotreatment with MG132, a proteosome inhibitorthat blocks protein degradation, abrogated the ADI-PEG20–induced suppression of TS and TK1 levels (Fig. 4F). Moregenerally, similar data on thymidine salvage and de novo syn-thesis pathways were obtained in a panel of ADI-treated ASS1-negative (methylated) mesothelioma cell lines (SupplementaryFig. S2). Finally, we assessed whether in vivo imaging of thymi-dine uptake could provide an early biomarker of response toADI-PEG20 therapy using UMUC-3 xenografts. Consistent withour in vitro studies, there was a 66% decrease in the maximumstandardized uptake value (SUVmax) on [18F]FLT-PET after 24hours of ADI-PEG20 therapy (Fig. 4G).

Enhanced effect of ADI-PEG20 and pemetrexed inbladder cancer

To exploit our findings in the clinic, we used the multi-targeted antifolate pemetrexed, which blocks enzymes, includ-ing TS and DHFR, and is reported to have modest activity inbladder cancer (24). High TS expression, in particular, has beenlinked to poor clinical outcome and resistance to antifolates incancers of the bladder, lung, mesothelium, and colon (25–29).Moreover, bladder TMA analysis revealed that ASS1 loss wasassociated with a reciprocal increase in TS and DHFR expres-sion—both linked to poor outcome for disease-specific andmetastasis-free survival—emphasizing the interdependence

between arginine auxotrophy and modulation of nucleotidebiosynthesis (Supplementary Fig. S3 and S4; and Supplemen-tary Table S1). Thus, we hypothesized that ADI-PEG20 maypotentiate the cytotoxicity of pemetrexed in ASS1-negativetumor cells via modulation of folate-dependent enzymes. First,we showed that pemetrexed and ADI-PEG20 enhanced apo-ptosis compared with either agent alone by increasing PARPcleavage and Annexin V binding in vitro in ASS1-methylatedtumor cell lines (Fig. 5A and B). Secondly, ADI-PEG20 signif-icantly reduced tumor growth of the UMUC-3 cell line (P <0.001) in xenografted nude mice. Although pemetrexed alonehad no effect, the combination was more effective than ADI-PEG20 alone (P < 0.05; Fig. 5C and D). Analysis of tumors fromthe xenograft studies confirmed reduced TS, DHFR, and TK1levels in ADI-PEG20–treated animals (Fig. 5E). Finally, tovalidate our results we executed an [18F]-FLT microPET/CTimaging study of the combination therapy in the UMUC-3xenograft tumor model. Our SUVmax data showing the super-ior efficacy of the ADI-PEG20 and pemetrexed drug combina-tion over that of ADI-PEG20 alone are consistent with ourearlier tumor volumetric measurements (Fig. 5F). Notably,there was a lack of effect on SUVmax of pemetrexed in animalsthat had not been pretreated with ADI-PEG20.

DiscussionProgress in the targeted therapy of advanced urothelial

carcinoma has lagged behind other urological malignancies,especially prostate and renal cancer. For the first time, we haveidentifiedASS1 as a novel bladder cancer biomarker withwiderimplications for the therapy andmonitoring of cancers depen-dent on exogenous arginine for survival. We show that despiteexhibiting a poorer prognosis, ASS1-negative bladder cancer isamenable to dual targeting with ADI-PEG20 and antifolateswith early treatment response monitoring by [18F]FLT-PET.

Our bladder cancer cell line studies reveal that unmethy-lated ASS1 functions as a bona fide tumor suppressor and isconsistent with recent studies in osteosarcomas and myxofi-brosarcomas (11, 12). Exactly how ASS1 promoter methylationleads to a requirement for exogenous arginine, which promotesincreased tumor cell proliferation and invasion is unclear.Interestingly, previous studies have associated exogenousarginine with DNA synthesis in Burkitt lymphoma cells andwith increased proliferation of caco-2 colon cancer cells via aglutamine-dependent effect (30, 31). Yamauchi and colleaguesproposed that under conditions of limited arginine supplyintracellular glutamine is diverted for arginine synthesis assupplying exogenous arginine was shown to promote nucle-otide synthesis. We found for the first time that upon depletionof arginine in ASS1-negative tumor cells, glutamine levelsincreased indicative of a block on nucleotide synthesis. Thus,our metabolomic experiments with ADI-PEG20 support thehypothesis that theASS1 epimutation reprograms extracellulararginine so that it is sparing for glutamine in nucleotidemetabolism. Additional metabolomic flux studies are underway to explore further the interdependence of arginine andglutamine in the context of tumoral ASS1-deficiency. Exoge-nous arginine has also been shown to stimulate intestinal cell

Figure 3. ADI-PEG20 is cytotoxic toASS1-methylated bladder cancer celllines. A, bladder cancer cell line viability following exposure to varyingdoses of ADI-PEG20 (0–20,000 ng/mL) was assessed byMTT assay at 6days. B, overexpression of ASS1 in ASS1-methylated cell lines inducedresistance to ADI-PEG20 by 6 days of ADI-PEG20 treatment, mostmarked in the T24 cell line, validating ASS1 loss as a biomarker ofsensitivity to arginine deprivation.

Allen et al.





Figure 4. ADI-PEG20 modulates pyrimidine metabolism in ASS1-methyated cancer cells. A, cell extracts from ASS1-negative bladder cancer lines and theRT112 control treated with ADI-PEG20 (750 ng/mL) for 24 hours were subjected to metabolomic analysis by LC/MS. Arginine decreased in all cell lines;however, the reduction was at least 1-log fold greater in the ASS1-negative tumor cells. Glutamine and thymine increased whereas thymidinedecreased specifically in the ADI-treated ASS1-negative bladder cell lines with no effect in RT112 control cells. Data, mean and SE (n ¼ 6). ADI-PEG20downregulated TS and DHFR mRNA (B) and protein (C) by 24 hours specifically in the ASS1-methylated cell lines. In contrast, the DNA syntheticenzyme ribonucleotide reductase subunit p53R2was unaltered, confirming the specific downregulatory effect of ADI-PEG20 on TS andDHFR proteins; b-actinwas used as the loading control (50). D, [3H]thymidine uptake in bladder cancer cells after treatment with ADI-PEG20 (750 ng/mL). The cells remaining afterADI treatment decreased their uptake of thymidine by 24 hours in all ASS1-negative cell lines except the T24 bladder cell line, which showed a reduction by72 hours (�, P < 0.05; ��, P < 0.005). In contrast, [3H] thymidine uptake was unchanged in the control RT112 cell line after ADI treatment. Data, mean andSE (n¼ 9). E, ADI-PEG20 reducedTK1protein levels by 24 hours specifically in ASS1-negative bladder cancer cell lines.b-actinwasusedas the loading control.F, ADI-PEG20–mediated loss of TS and TK1 can be abrogated by inhibiting the proteasome with MG132. UMUC-3 cells were plated and incubatedovernight; subsequently, cells were exposed to DMSO (Con), ADI-PEG20 (750 ng/mL), ADI-PEG20, and MG132 or MG132 (1 mmol/L) for 24 hours withimmunoblotting as shown. G, [18F]-FLT microPET/CT imaging in a UMUC-3 bladder tumor-bearing CD1 nude mouse (i) before treatment showing uptake intumor (red arrow), and increased tracer concentration in intestine (white arrow) and also gall bladder. Transverse views before (ii) and 24 hours after (iii) treatmentwith 5 IU ADI-PEG20 show a reduction in tumor SUVmax after treatment (3.2 vs. 1.1 after treatment), indicating a decrease in tumor cell proliferation.






motility via activation of NO and focal adhesion kinase sig-naling (32, 33). In particular, arginine is a dominant amino acidmodulator of mTOR, a nodal pathway that integrates cellgrowth, proliferation, invasion, and metastasis of variouscancers, including urothelial malignancy (34–36); moreover,arginine deprivation has been shown to repress mTOR and itsdownstream substrates p70 S6 kinase and 4E-BP1 in ASS1-negative cancer cells (6, 37). Indeed, it is becoming clear that

arginine deprivation has multiple effects on gene expressionand that this is likely to be determined not only by cell type butalso by the status of the ASS1 gene (38).

The ADI-PEG20–induced suppression of the folate-depen-dent enzymes TS andDHFR and sensitization of ASS1-negativetumor cells to the cytotoxic effects of pemetrexed provide anovel metabolic approach to retargeting cytotoxic chemother-apy (39). Our results also validate the work of Cheng and

Figure 5. ADI-PEG20 sensitizes ASS1-methylated cancer cells to pemetrexed. ASS1-negative bladder cancer cells (UMUC-3) and malignant mesotheliomacells (MSTO) were treated with fixed doses of ADI-PEG20 and pemetrexed (PEM; Supplementary Table S4) with enhanced cell killing in vitro and in vivo:increased PARP cleavage by Western blotting (A) and increased Annexin V (B) staining by FACS were observed in the combination drug treatmentcompared with either drug alone by 96 hours (n ¼ 6). C and D, xenograft experiment showing enhanced control of UMUC-3 cells with the combinationcomparedwith either drugalone (#,P<0.05). ADI-PEG20, but not pemetrexed, hadsignificant single agent activity comparedwith vehicle control (�,P<0.001).E, representative TS, DHFR, and TK1 IHC (X400) showing reduced expression of all three enzymes in ADI-treated UMUC-3 xenograft tumors; residualstrong DHFR staining in stromal cells compared with negative tumor cells with ADI-PEG20 treatment. Pemetrexed and ADI-PEG20 treatments reduce andrelocate TK1 expression from the nucleus to the cytoplasm; the drug combination further reduces TK1 expression compared with either drug alone.F, [18F]-FLT microPET/CT imaging response to treatment of ASS1-negative UMUC-3 tumors to ADI-PEG20 combined with pemetrexed. The ADI-treatedanimals showed a decrease in [18F]-FLT SUVmax compared with PBS as seen previously (P < 0.05; Fig. 4G). Imaging at 7 days showed a significantdecrease in SUVmax for the PEM þ ADI treatment group vs. PBS control (P < 0.01) as well as PEM þ ADI vs. ADI alone (P < 0.05).

Allen et al.





colleagues, who showed that the irreversible TS inhibitor 5-fluorouracil wasmore effective when combinedwith pegylatedhuman arginase in a hepatocellular carcinoma xenograft (40).It is noteworthy that the ADI-PEG20 and antifolate doublet hasa wide therapeutic window in the xenograft studies. Moreover,our experience from an ongoing clinical trial of argininedepletion in mesothelioma (NCT01279967) includes a patienttreated concurrently with ADI-PEG20 and the antifolate meth-otrexate for an unrelated condition; the combination was safeand led to a prolonged period of disease control (manuscript inpreparation) (51).Furthermore, the decreased uptake of thymidine following

ADI-PEG20 treatment as shown by the 3H-thymidine and FLTtracer studies may be exploited as an early therapeutic bio-marker for imaging ASS1-methylated tumors. This is in contrastto recent work with ADI-PEG20 in ASS1-negative melanomaxenografts in which there was no effect on TK1 expression andFLT-PETmetabolic responseswerenot detected (41). These andprevious results using 2[18F]fluoro-2-deoxy-D-glucose tracersmay be explained in part by the differential regulation of ASS1promoter withHIF-1a–mediated repression inmelanoma com-pared with epigenetic silencing identified in several otherarginine auxotrophic cancers (9, 16, 42).Thus, arginine deprivation with ADI-PEG20 suppresses both

the de novo and salvage pathways of nucleotide synthesis inASS1-negative bladder cancer cells, whichmay be exploited fortherapy and imaging, respectively (Fig. 6). In addition to ADI-PEG20 modulating protein turnover as indicated by theMG132-mediated recovery of TS and TK1 enzymes, severalother mechanisms may underlie the reduced levels of targetproteins, including chemical attack by peroxynitrite, a potentoxidant and nitrating species generated by arginine depriva-tion (43–45). More generally, the reciprocal relationshipbetween thymidine and glutamine in ASS1-negative tumorsreinforces several other preclinical approaches targeting ami-

no acid utilization in cancer, including methionine, glycine,and serine (46–49). Significantly, we observed that ASS1 down-regulation was linked to the reciprocal upregulation of theserine biosynthetic pathway enzymes, PHGDH, PSAT1, andPSPH, in bladder cancer (data not shown), and this warrantsfurther evaluation in view of the important roles of serine intumor cell proliferation and bioenergetics.

In conclusion, our studies linking the biology of arginineauxotrophic bladder cancer to adverse clinicopathologic vari-ables accentuate ASS1 loss as a novel biomarker for evaluationin patients with urothelial cancer. Specifically, targeted mod-ulation of pyrimidine synthesis—via suppression of the de novoand salvage nucleotide pathways—using arginine-depletingdrugs combined with antifolates has the potential to improvethe management of urothelial and related cancers with meth-ylated ASS1.

Disclosure of Potential Conflicts of InterestJ.S. Bomalaski is executive VP Medical Affairs with Polaris Pharmaceuticals,

Inc. R.C. Jackson is a consultant and advisory board member of Polaris Inc. N.R.Lemoine is the editor of Gene Therapy journal (self employed with honorariumpaid by publisher) with Nature Publishing Group. No potential conflicts ofinterest were disclosed by the other authors.

Authors' ContributionsConception and design: Y.-J. Lu, T. Crook, C.-F. Li, P.W. SzlosarekDevelopment of methodology: M. Allen, P. Luong, C. Hudson, E. Ghazaly, L.Lattanzio, D.Neal, C. Frezza, L.J. Jones, T. Crook, S.Mather, J. Sosabowski, N. Avril,P.W. SzlosarekAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): M. Allen, P. Luong, J. Leyton, E. Ghazaly, M. Yuan,N. Syed, I. Tomlinson, R. Roylance, H.C. Whitaker, A.Y. Warren, L.J. Jones, N.R.Lemoine, S. Mather, J. Foster, J. Sosabowski, N. Avril, P.W. SzlosarekAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): P. Luong, C. Hudson, J. Leyton, E. Ghazaly, R. Cutts,H.C. Whitaker, C. Frezza, L. Beltran, L.J. Jones, C. Chelala, J.S. Bomalaski, R.C.Jackson, Y.-J. Lu, T. Crook, S.Mather, J. Foster, J. Sosabowski, N. Avril, C.-F. Li, P.W.SzlosarekWriting, review, and/or revision of the manuscript: M. Allen, J. Leyton,E. Ghazaly, R. Roylance, H.C. Whitaker, J.S. Bomalaski, Y.-J. Lu, T. Crook,S. Mather, J. Sosabowski, N. Avril, C.-F. Li, P.W. Szlosarek

Figure6. Schematic of the inhibitoryeffects of ADI-PEG20 on de novothymidylate biosynthesis andsalvage pathways in bladdercancer. ADI-PEG20 suppresses TSand DHFR protein and sensitizesASS1-negative bladder cancercells to the cytotoxic effects ofpemetrexed. In addition,ADI-PEG20 blocks thymidineuptake linked to reduced TK1protein, which is detectable using[18F]FLT-PET. RFC, reduced folatecarrier; THF, tetrahydrofolate.






Administrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): P. Luong, B. Delage, M. Chmielewska-Kassassir, B.-W. Wu, Y.-J. Lu, C.-F. Li, P.W. SzlosarekStudy supervision: C. Lo Nigro, N.R. Lemoine, S. Mather, J. Sosabowski, C.-F. Li,P.W. Szlosarek

AcknowledgmentsThe authors thank Melissa Phillips, Patricia Gorman, Kimberly Howarth, and

Duncan Jodrell for technical assistance, and Daniel Berney, Jeremy Steele, SimonJoel, Lucyna Wozniak, Marco Merlano, and Simon Pacey for additional admin-istrative support.

Grant SupportThis work was funded by a Cancer Research UK Clinician Scientist

Fellowship (Dr. P.W. Szlosarek; C12522/A8632) and by Barts and The LondonCharity.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicate thisfact.

Received June 17, 2013; revised October 29, 2013; accepted November 3, 2013;published OnlineFirst November 27, 2013.

References1. Mitra AP, Datar RH, Cote RJ. Molecular pathways in invasive bladder

cancer: new insights into mechanisms, progression, and target iden-tification. J Clin Oncol 2006;24:5552–64.

2. Sonpavde G, Watson D, Tourtellott M, Cowey CL, Hellerstedt B,Hutson TE, et al. Administration of cisplatin-based chemotherapy foradvanced urothelial carcinoma in the community. Clin GenitourinCancer 2012;10:1–5.

3. DovediSJ,DaviesBR.Emerging targeted therapies for bladder cancer:a disease waiting for a drug. Cancer Metastasis Rev 2009;28:355–67.

4. Ensor CM, Holtsberg FW, Bomalaski JS, Clark MA. Pegylated argininedeiminase (ADI-SS PEG20,000 mw) inhibits human melanomas andhepatocellular carcinomas in vitro and in vivo. Cancer Res 2002;62:5443–50.

5. Szlosarek PW, Klabatsa A, Pallaska A, Sheaff M, Smith P, Crook T,et al. In vivo loss of expression of argininosuccinate synthetase inmalignant pleural mesothelioma is a biomarker for susceptibility toarginine depletion. Clin Cancer Res 2006;12:7126–31.

6. Kim RH, Coates JM, Bowles TL, McNerney GP, Sutcliffe J, Jung JU,et al. Arginine deiminaseasanovel therapy for prostate cancer inducesautophagy and caspase-independent apoptosis. Cancer Res 2009;69:700–8.

7. Delage B, Fennell DA, Nicholson L, McNeish I, Lemoine NR, Crook T,et al. Arginine deprivation and argininosuccinate synthetase expres-sion in the treatment of cancer. Int J Cancer 2010;126:2762–72.

8. Husson A, Brasse-Lagnel C, Fairand A, Renouf S, Lavoinne A. Argi-ninosuccinate synthetase from the urea cycle to the citrulline-NOcycle. Eur J Biochem 2003;270:1887–99.

9. Tsai WB, Aiba I, Lee SY, Feun L, Savaraj N, Kuo MT. Resistance toarginine deiminase treatment in melanoma cells is associated withinduced argininosuccinate synthetase expression involving c-Myc/HIF-1alpha/Sp4. Mol Cancer Ther 2009;8:3223–33.

10. Nicholson LJ, Smith PR, Hiller L, Szlosarek PW, Kimberley C,Sehouli J, et al. Epigenetic silencing of argininosuccinate synthe-tase confers resistance to platinum-induced cell death but collateralsensitivity to arginine auxotrophy in ovarian cancer. Int J Cancer2009;125:1454–63.

11. Kobayashi E, Masuda M, Nakayama R, Ichikawa H, Satow R, Shita-shige M, et al. Reduced argininosuccinate synthetase is a predictivebiomarker for the development of pulmonary metastasis in patientswith osteosarcoma. Mol Cancer Ther 2010;9:535–44.

12. HuangHY,WuWR,WangYH,WangJW,FangFM,Tsai JW, et al. ASS1as a novel tumor suppressor gene in myxofibrosarcomas: aberrantloss via epigenetic DNA methylation confers aggressive phenotypes,negative prognostic impact, and therapeutic relevance. Clin CancerRes 2013;19:2861–72.

13. Old LJ, Boyse EA, Campbell HA, Daria GM. Leukaemia-inhibitingproperties and L-asparaginase activity of sera from certain SouthAmerican rodents. Nature 1963;198:801.

14. Ascierto PA, Scala S, Castello G, Daponte A, Simeone E, Ottaiano A,et al. Pegylated arginine deiminase treatment of patients with meta-staticmelanoma: results from phase I and II studies. J Clin Oncol 2005;23:7660–8.

15. Glazer ES, Piccirillo M, Albino V, Di Giacomo R, Palaia R, Mastro AA,et al. Phase II study of pegylated arginine deiminase for nonresectableand metastatic hepatocellular carcinoma. J Clin Oncol 2010;28:2220–6.

16. Szlosarek PW, Luong P, Phillips MM, Baccarini M, Ellis S, Szyszko T,et al. Metabolic response to pegylated arginine deiminase in meso-thelioma with promoter methylation of argininosuccinate synthetase.J Clin Oncol 2013;31:e111–3.

17. Miyao N, Tsai YC, Lerner SP, Olumi AF, Spruck CH 3rd, Gonzalez-Zulueta M, et al. Role of chromosome 9 in human bladder cancer.Cancer Res 1993;53:4066–70.

18. Linnenbach AJ, Robbins SL, Seng BA, Tomaszewski JE, Pressler LB,Malkowicz SB. Urothelial carcinogenesis. Nature 1994;367:419–20.

19. Veerakumarasivam A, Goldstein LD, Saeb-Parsy K, Scott HE, WarrenA, Thorne NP, et al. AURKA overexpression accompanies dysregula-tion of DNA-damage response genes in invasive urothelial cell carci-noma. Cell Cycle 2008;7:3525–33.

20. Budwit-Novotny DA, McCarty KS, Cox EB, Soper JT, Mutch DG,Creasman WT, et al. Immunohistochemical analyses of estrogenreceptor in endometrial adenocarcinoma using a monoclonal anti-body. Cancer Res 1986;46:5419–25.

21. Chou TC. Drug combination studies and their synergy quantificationusing the Chou-Talalay method. Cancer Res 2010;70:440–6.

22. Delage B, Luong P, Maharaj L, O'Riain C, Syed N, Crook T, et al.Promoter methylation of argininosuccinate synthetase-1 sensitiseslymphomas to arginine deiminase treatment, autophagy and cas-pase-dependent apoptosis. Cell Death Dis 2012;3:e342.

23. Brockenbrough JS, Souquet T, Morihara JK, Stern JE, Hawes SE,Rasey JS, et al. Tumor 30-deoxy-30-(18)F-fluorothymidine ((18)F-FLT)uptake by PET correlates with thymidine kinase 1 expression: staticand kinetic analysis of (18)F-FLT PET studies in lung tumors. J NuclMed 2011;52:1181–8.

24. Galsky MD, Mironov S, Iasonos A, Scattergood J, Boyle MG, BajorinDF. Phase II trial of pemetrexed as second-line therapy in patients withmetastatic urothelial carcinoma. Invest New Drugs 2007;25:265–70.

25. Li Y, Li X, Dai H, Sun X, Li J, Yang F, et al. Thymidylate synthase wasassociated with patient prognosis and the response to adjuvanttherapy in bladder cancer. BJU Int 2009;103:547–52.

26. Takezawa K, Okamoto I, Okamoto W, Takeda M, Sakai K, Tsukioka S,et al. Thymidylate synthase as a determinant of pemetrexed sensitivityin non-small cell lung cancer. Br J Cancer 2011;104:1594–601.

27. Righi L, Papotti MG, Ceppi P, Bille A, Bacillo E, Molinaro L, et al.Thymidylate synthase but not excision repair cross-complementationgroup 1 tumor expression predicts outcome in patients with malignantpleural mesothelioma treated with pemetrexed-based chemotherapy.J Clin Oncol 2010;28:1534–9.

28. Sigmond J, Backus HH, Wouters D, Temmink OH, Jansen G, PetersGJ. Induction of resistance to the multitargeted antifolate Pemetrexed(ALIMTA) in WiDr human colon cancer cells is associated with thymi-dylate synthase overexpression. Biochem Pharmacol 2003;66:431–8.

29. Edler D, Kressner U, Ragnhammar P, Johnston PG, Magnusson I,Glimelius B, et al. Immunohistochemically detected thymidylatesynthase in colorectal cancer: an independent prognostic factor ofsurvival. Clin Cancer Res 2000;6:488–92.

30. Osunkoya BO, Adler WH, Smith RT. Effect of arginine deficiency onsynthesis of DNA and immunoglobulin receptor of Burkitt lymphomacells. Nature 1970;227:398–9.

31. Yamauchi K, Komatsu T, Kulkarni AD, Ohmori Y, Minami H, UshiyamaY, et al. Glutamine and arginine affect Caco-2 cell proliferation bypromotion of nucleotide synthesis. Nutrition 2002;18:329–33.

Allen et al.





32. Rhoads JM, Chen W, Gookin J, Wu GY, Fu Q, Blikslager AT, et al.Arginine stimulates intestinal cell migration through a focal adhesionkinase dependent mechanism. Gut 2004;53:514–22.

33. Rhoads JM, LiuY,Niu X, SurendranS,WuG.Arginine stimulates cdx2-transformed intestinal epithelial cell migration via a mechanism requir-ing both nitric oxide and phosphorylation of p70 S6 kinase. J Nutr2008;138:1652–7.

34. Hara K, Yonezawa K, Weng QP, Kozlowski MT, Belham C, Avruch J.Amino acid sufficiency and mTOR regulate p70 S6 kinase and eIF-4EBP1 through a common effector mechanism. J Biol Chem 1998;273:14484–94.

35. Hansel DE, Platt E, Orloff M, Harwalker J, Sethu S, Hicks JL, et al.Mammalian target of rapamycin (mTOR) regulates cellular proliferationand tumor growth in urothelial carcinoma. Am J Pathol 2010;176:3062–72.

36. Laplante M, Sabatini DM. mTOR signaling in growth control anddisease. Cell 2012;149:274–93.

37. Savaraj N, You M, Wu C, Wangpaichitr M, Kuo MT, Feun LG. Argininedeprivation, autophagy, apoptosis (AAA) for the treatment of melano-ma. Curr Mol Med 2010;10:405–12.

38. Brasse-Lagnel CG, Lavoinne AM, Husson AS. Amino acid regulationof mammalian gene expression in the intestine. Biochimie 2010;92:729–35.

39. Vander Heiden MG. Targeting cancer metabolism: a therapeutic win-dow opens. Nat Rev Drug Discov 2011;10:671–84.

40. Cheng PN, Lam TL, Lam WM, Tsui SM, Cheng AW, Lo WH, et al.Pegylated recombinant human arginase (rhArg-peg5,000mw) inhibitsthe in vitro and in vivo proliferation of human hepatocellular carcinomathrough arginine depletion. Cancer Res 2007;67:309–17.

41. Stelter L, Fuchs S, Jungbluth AA, Ritter G, Longo VA, Zanzonico P,et al. Evaluation of arginine deiminase treatment in melanoma xeno-grafts using F-FLT PET. Mol Imaging Biol 2013;15:768–75.

42. Stelter L, Evans MJ, Jungbluth AA, Zanzonico P, Ritter G, Ku T, et al.Novel mechanistic insights into arginine deiminase pharmacology

suggest 18F-FDG is not suitable to evaluate clinical response inmelanoma. J Nucl Med 2012;53:281–6.

43. Morrow K, Hernandez CP, Raber P, Del Valle L, Wilk AM, Majumdar S,et al. Anti-leukemic mechanisms of pegylated arginase I in acutelymphoblastic T-cell leukemia. Leukemia 2013;27:569–77.

44. Dabrowska-Mas E, Fraczyk T, Ruman T, Radziszewska K, Wilk P,Ciesla J, et al. Tyrosine nitration affects thymidylate synthase prop-erties. Org Biomol Chem 2012;10:323–31.

45. Noris M, Todeschini M, Cassis P, Pasta F, Cappellini A, Bonaz-zola S, et al. L-arginine depletion in preeclampsia orients nitricoxide synthase toward oxidant species. Hypertension 2004;43:614–22.

46. Kokkinakis DM, Liu X, Chada S, Ahmed MM, Shareef MM, Singha UK,et al. Modulation of gene expression in human central nervous systemtumors under methionine deprivation-induced stress. Cancer Res2004;64:7513–25.

47. Zhang WC, Shyh-Chang N, Yang H, Rai A, Umashankar S, Ma S,et al. Glycine decarboxylase activity drives non-small cell lungcancer tumor-initiating cells and tumorigenesis. Cell 2012;148:259–72.

48. Jain M, Nilsson R, Sharma S, Madhusudhan N, Kitami T, Souza AL,et al. Metabolite profiling identifies a key role for glycine in rapid cancercell proliferation. Science 2012;336:1040–4.

49. Possemato R, Marks KM, Shaul YD, Pacold ME, Kim D, Birsoy K, et al.Functional genomics reveal that the serine synthesis pathway isessential in breast cancer. Nature 2011;476:346–50.

50. Yamaguchi T, Matsuda K, Sagiya Y, Iwadate M, Fujino MA, NakamuraY, et al. p53R2-dependent pathway for DNA synthesis in a p53-regulated cell cycle checkpoint. Cancer Res 2001;61:8256–62.

51. SzlosarekPW,Steele JP, SheaffMT, Avril NE,SzyszkoT, Ellis S, et al. Arandomised phase II trial of pegylated arginine deiminase (ADI-PEG20)in patients withmalignant pleural mesothelioma (MPM). In: 2013WorldConference on Lung Cancer; 2013 Oct 27-30; Sydney. Abstr no.MO09.02.






2014;74:896-907. Published OnlineFirst November 27, 2013.Cancer Res Michael D. Allen, Phuong Luong, Chantelle Hudson, et al. Longitudinally by PET ImagingSynthetase 1 Control in Bladder Cancer as Monitored Prognostic and Therapeutic Impact of Argininosuccinate

Updated version

10.1158/0008-5472.CAN-13-1702doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2013/11/27/0008-5472.CAN-13-1702.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/74/3/896.full#ref-list-1

This article cites 50 articles, 24 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/74/3/896.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/74/3/896To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-13-1702

http://cancerres.aacrjournals.org/content/suppl/2013/11/27/0008-5472.CAN-13-1702.DC1

http://cancerres.aacrjournals.org/content/74/3/896.full#ref-list-1

http://cancerres.aacrjournals.org/content/74/3/896.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/74/3/896


prognostic and therapeutic impact of argininosuccinate ... · ass1 overexpression and knockdown...

Documents