1

Proinflammatory Effects of Interferon Gamma in Mouse Adenovirus Type 1 Myocarditis 1

2

3

Mary K. McCarthy2, Megan C. Procario1, Nele Twisselmann1*, J. Erby Wilkinson3,4, Ashley J. 4

Archambeau5, Daniel E. Michele5, Sharlene M. Day6, and Jason B. Weinberg1,2, # 5

6

1Department of Pediatrics and Communicable Diseases, University of Michigan, Ann Arbor, 7

Michigan 8

2Department of Microbiology and Immunology, University of Michigan, Ann Arbor, Michigan 9

3Unit for Laboratory Animal Research, University of Michigan, Ann Arbor, Michigan 10

4Department of Pathology, University of Michigan, Ann Arbor, Michigan 11

5Department of Molecular and Integrative Physiology, University of Michigan, Ann Arbor, 12

Michigan 13

6Division of Cardiovascular Medicine, University of Michigan, Ann Arbor, Michigan 14

15

16

Running Head: Interferon Gamma in Adenovirus Myocarditis 17

18

# Corresponding author: Jason B. Weinberg, University of Michigan, 7510A Medical Science 19

Research Building I, 1150 West Medical Center Drive, Ann Arbor, Michigan, 48109, 20

jbwein@umich.edu; Phone: (734) 764-6265; Fax (734) 936-7083 21

*Present address: University of Lübeck, Lübeck, Germany 22

23

Abstract Word Count: 166 24

Text Word Count: 5606 25

JVI Accepts, published online ahead of print on 15 October 2014J. Virol. doi:10.1128/JVI.02077-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

2

Abstract 26

Adenoviruses are frequent causes of pediatric myocarditis. Little is known about the 27

pathogenesis of adenovirus myocarditis, and the species-specificity of human adenoviruses has 28

limited the development of animal models, which is a significant barrier to strategies for 29

prevention or treatment. We have developed a mouse model of myocarditis following mouse 30

adenovirus type 1 (MAV-1) infection to study the pathogenic mechanisms of this important 31

cause of pediatric myocarditis. Following intranasal infection of neonatal C57BL/6 mice, we 32

detected viral replication and induction of interferon-gamma (IFN-γ) in the hearts of infected 33

mice. MAV-1 caused myocyte necrosis and induced substantial cellular inflammation that was 34

predominantly composed of CD3+ T lymphocytes. Depletion of IFN-γ during acute infection 35

reduced cardiac inflammation in MAV-1-infected mice without affecting viral replication. We 36

observed decreased contractility during acute infection of neonatal mice, and persistent viral 37

infection in the heart was associated with cardiac remodeling and hypertrophy in adulthood. 38

IFN-γ is a proinflammatory mediator during adenovirus-induced myocarditis, and persistent 39

adenovirus infection may contribute to ongoing cardiac dysfunction. 40

41

Importance 42

Studying the pathogenesis of myocarditis caused by different viruses is essential in order to 43

characterize both virus-specific and generalized factors that contribute to disease. Very little is 44

known about the pathogenesis of adenovirus myocarditis, which is a significant impediment to 45

the development of treatment or prevention strategies. We used MAV-1 to establish a mouse 46

model of human adenovirus myocarditis, providing the means to study host and pathogen 47

factors contributing to adenovirus-induced cardiac disease during acute and persistent infection. 48

The MAV-1 model will enable fundamental studies of viral myocarditis, including IFN-γ 49

modulation, as a therapeutic strategy. 50

3

Introduction 51

Acute myocarditis is a significant cause of morbidity and mortality in childhood. 52

Myocarditis has been identified in 16 to 21% of sudden deaths in children (1). The course of 53

viral myocarditis is often more severe in neonates and infants than in older patients, with up to 54

67% mortality in newborns and 55% in infants less than 1 year of age compared to 20 to 25% in 55

older children and 38% in adults (2, 3). Associations between myocarditis and adenovirus 56

infection are well established (3-5). Persistent human adenovirus (HAdV) infections of the 57

myocardium have been implicated in the development of dilated cardiomyopathy and cardiac 58

dysfunction (6-8). Detection of HAdV genomes in myocardial biopsies of pediatric heart 59

transplant recipients is predictive of coronary artery vasculopathy and transplant loss (9). The 60

histopathology of hearts in patients with HAdV myocarditis can be milder than that in patients 61

with myocarditis caused by other viruses (3), suggesting that mechanisms underlying HAdV-62

mediated disease may differ from those involved in myocarditis caused by other viruses. 63

Much of what is known about viral myocarditis has come from the study of myocarditis 64

resulting from coxsackievirus B3 (CVB3) and reovirus. The pathogenesis of viral myocarditis 65

involves many interrelated processes. Direct damage to cardiac myocytes can occur by viral 66

lysis, inhibition of host protein synthesis, or cleavage of host proteins such as dystrophin by viral 67

proteases (10). Immune responses to acute infection contribute to the clearance of virus but can 68

also cause further damage, either directly or due to cross-reaction between viral and cardiac 69

antigens that leads to autoimmune myocardial injury (11). Interferon (IFN)-α and IFN-β, the type 70

I IFNs, are essential for limiting viral replication in cardiac myocytes and are protective in a 71

neonatal mouse model of reovirus myocarditis (12). IFN-γ, the type II IFN, is upregulated and is 72

often protective in models of viral myocarditis (12-14), although other reports suggest that it can 73

promote myocarditis associated with CVB3 (15, 16), and prolonged expression of IFN-γ may 74

lead to a chronic inflammatory cardiomyopathy (17). Myocyte apoptosis induced by viral 75

4

infection and virus-induced inflammation can also contribute to progressive cardiac damage 76

(18). Ongoing injury can lead to myocardial remodeling and fibrosis accompanied by ventricular 77

dilation and cardiac dysfunction. 78

We have previously established intranasal MAV-1 infection of C57BL/6 and BALB/c mice 79

as a model to study the pathogenesis of adenovirus respiratory infection (19). One previous 80

report demonstrated that intraperitoneal (i.p.) MAV-1 infection of neonatal outbred Swiss 81

Webster mice led to cardiac inflammation, myocardial fibrosis, and calcification (20), and a 82

related virus (MAV-3) was detected in the heart following intravenous infection of adult 83

C57BL/6N mice (21). However, MAV-1 and MAV-3 have yet to be used in detailed studies of 84

myocarditis pathogenesis. Here, we demonstrate that intranasal MAV-1 infection of neonatal 85

mice led to viral replication and induction of IFN-γ expression in the heart that correlated with 86

cellular inflammation and acute myocyte necrosis. Depletion of IFN-γ during acute infection 87

reduced cardiac inflammation in MAV-1-infected mice without affecting viral replication. Long-88

term persistence of viral DNA was associated with increased heart mass and cellular 89

hypertrophy. 90

91

Methods 92

Cardiac myocyte primary culture and infection 93

Cardiac myocytes were isolated as previously described (22), plated on laminin-coated 94

coverslips, cultured in presence of the contraction inhibitor 25 μM S-(-)-blebbistatin (Toronto 95

Research Chemicals), and infected at a multiplicity of infection (MOI) of 5. At 24 or 48 hr, 96

supernatant was collected and the cells were incubated in 0.5 mL of TRIzol® (Invitrogen) for 5 97

min. RNA and DNA were isolated according to the manufacturer’s protocol and resuspended in 98

HPLC-grade water. Infectious virus in supernatant was quantified by plaque assay as previously 99

described (23). 100

5

101

Mice 102

All work was approved by the University of Michigan Committee on Use and Care of Animals. 103

C57BL/6 mothers with litters of neonatal mice and male C57BL/6 mice (4-6 weeks of age) were 104

obtained from The Jackson Laboratory. All mice were maintained under specific pathogen-free 105

conditions. 106

107

Virus and infections 108

MAV-1 was grown and titered on NIH 3T6 fibroblasts as previously described (23). 109

Neonates (7 days old) were manually restrained and infected intranasally (i.n.) with 105 plaque-110

forming units (pfu) in 10 μl of sterile phosphate-buffered saline (PBS). Adult mice were 111

anesthetized with ketamine and xylazine and infected i.n. with 105 pfu of MAV-1 in 40 μl of 112

sterile PBS. Control mice were mock infected i.n. with conditioned media at an equivalent 113

dilution in sterile PBS. Mice were euthanized by pentobarbital overdose at the indicated time 114

points. Blood was collected from the posterior vena cava of euthanized animals and incubated 115

on ice for 15-30 min. Samples were centrifuged in a tabletop microcentrifuge at 17,000 x g for 116

10 min at 4°C. Serum was transferred to a new microcentrifuge tube and stored at -80°C until 117

assayed. After blood collection, hearts were harvested, snap frozen in dry ice, and stored at -118

80°C until processed further. One third to one half of each heart (~20 mg) was homogenized in 119

1 mL of TRIzol® (Invitrogen) using sterile glass beads in a mini Beadbeater (Biospec Products) 120

for 30 seconds. RNA and DNA were isolated from the homogenates according to the 121

manufacturer’s protocol. 122

123

Analysis of Viral Loads by PCR 124

6

MAV-1 viral loads were measured in organs and in cardiac myocytes infected ex vivo 125

using quantitative real-time polymerase chain reaction (qPCR) as previously described (24). 126

Primers and probe used to detect a 59-bp region of the MAV-1 E1A gene are listed in Table 1. 127

Five μl of extracted DNA were added to reactions containing TaqMan II Universal PCR Mix with 128

UNG (Applied Biosystems), forward and reverse primers (each at 200 nM final concentration), 129

and probe (20 nM final concentration) in a 25 µl reaction volume. Analysis on an ABI Prism 130

7300 machine (Applied Biosystems) consisted of 40 cycles of 15 s at 90°C and 60 s at 60°C. 131

Standard curves generated using known amounts of plasmid containing the MAV-1 EIA gene 132

were used to convert threshold cycle values for experimental samples to copy numbers of EIA 133

DNA. Results were standardized to the nanogram (ng) amount of input DNA. Each sample was 134

assayed in triplicate. 135

136

Nested PCR Detection of Viral DNA 137

Primers used in nested PCR to detect a final 246-bp region of MAV-1 E1A are listed in 138

Table 2. Five hundred ng of extracted DNA were added to reactions containing 10X Standard 139

Taq Buffer (New England BioLabs), 4 mM MgCl2, 0.8 mM deoxynucleoside triphosphate 140

(Promega), Taq polymerase (New England BioLabs), and 100 nM forward and reverse primers 141

in a 100 µl reaction volume. The first PCR amplification was carried out with 1 cycle at 94°C for 142

10 min, 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, followed by 1 cycle at 72°C 143

for 7 min on an Eppendorf thermocycler. After the initial round of PCR, 20 µl of primary PCR 144

product was added to fresh PCR mixture and amplified in a second round of PCR. The second 145

PCR round was conducted under the same conditions with the exception of 200 nM primer 146

concentrations instead of 100 nM, and 30 cycles instead of 35. 147

148

Real-time PCR Analysis of Gene Expression 149

7

Cytokine gene expression was quantified using reverse transcriptase (RT)-qPCR as 150

previously described (25, 26). First, 2.5 μg of RNA were reverse transcribed using MMLV 151

reverse transcriptase (Invitrogen) in 20 µl reactions according to the manufacturer’s instructions. 152

Water was added to the cDNA product to bring the total volume to 50 µl. cDNA was amplified 153

using duplexed gene expression assays for mouse CCL5 and GAPDH (Applied Biosystems). 154

Five µl of cDNA were added to reactions containing TaqMan Universal PCR Mix and 1.25 µl 155

each of 20X gene expression assays for the target cytokine and GAPDH. Primers used to 156

detect IFN-γ, tumor necrosis factor alpha (TNF-α), GAPDH, early region 1A (E1A), and hexon 157

are listed in Table 1. For these measurements, 5 µl of cDNA were added to reactions containing 158

Power SYBR Green PCR Mix (Applied Biosystems) and forward and reverse primers (each at 159

200 nM final concentration) in a 25 µl reaction volume. In all cases, RT-qPCR analysis 160

consisted of 40 cycles of 15 s at 90°C and 60 s at 60°C. Quantification of target gene mRNA 161

was normalized to GAPDH and expressed in arbitrary units as 2-ΔCt, where Ct is the threshold 162

cycle and ΔCt = Ct(target) – Ct(GAPDH). 163

164

IFN-γ Neutralization 165

Rabbit anti-mouse IFN-γ (α-IFN-γ) polyclonal antibody (27) and nonimmune rabbit serum 166

were generously provided by Dr. Steven Kunkel (University of Michigan) and purified using 167

protein A column purification (Thermo Scientific). Beginning on the first day post infection, mice 168

were treated with 50 μg of α-IFN-γ antibody or nonimmune rabbit IgG given i.p. every other day 169

beginning at 1 dpi. Neutralizing activity of α-IFN-γ was confirmed by its capacity to block 170

IFN-γ-mediated repression of MAV-1 replication in vitro (data not shown). 171

172

Measurement of IFN-γ Protein 173

8

In some experiments, heart tissue (approximately half of a neonatal heart) was 174

homogenized in PBS containing protease inhibitor (complete, Mini, EDTA-free tablets; Roche 175

Applied Science) and 1% Triton X-100 (Fisher Scientific) at a concentration of 50 mg lung tissue 176

per 1 mL homogenization buffer. Tissue was homogenized using sterile glass beads in a mini 177

Beadbeater (Biospec Products) for 2 x 30 s cycles, resting on ice between cycles. After 178

homogenization, tissue was spun twice at 17,000 x g for 15 min at 4°C and supernatant was 179

stored at -80°C until assayed. IFN-γ protein concentrations in heart homogenates were 180

determined by ELISA (Duoset Kits, R&D Systems) according to the manufacturer's protocol. 181

182

Histology 183

Hearts were fixed in 10% formalin and embedded in paraffin. Five μm sections were 184

stained with hematoxylin and eosin to evaluate cellular infiltrates. Separate sections were 185

stained with anti-CD3 antibody (Thermo Scientific). CD3+ cells were quantified at 40X 186

magnification, using the average of at least three independent fields per sample. Results are 187

expressed as the number of CD3+ cells per high power field (HPF). In some experiments, 188

hearts were removed and immediately frozen in Tissue-Tek OCT Compound (Sakura Finetek), 189

and 5 μm sections were strained with antibodies to CD4 and CD8 (Serotec and BD Pharmingen, 190

respectively). Sectioning and immunohistochemical staining were performed by the University of 191

Michigan Unit for Laboratory Animal Medicine Pathology Cores for Animal Research. Heart 192

sections were viewed through a Laborlux 12 microscope (Leitz). Digital images were obtained 193

with an EC3 digital imaging system (Leica Microsystems) using Leica Acquisition Suite software 194

(Leica Microsystems). Images were assembled using Adobe Illustrator (Adobe Systems). To 195

quantify cellular inflammation in the hearts, slides were examined in a blinded fashion to 196

determine a pathology index score for the size/intensity of cellular infiltrate and the extent of 197

involvement in the heart (Table 3). 198

9

To visualize cardiomyocyte cell membranes, paraffin-free left ventricular heart sections 199

were incubated with 100 μg/ml FITC-conjugated wheat germ agglutinin (Sigma) in PBS for 2 200

hours and then washed 3 times with PBS. Slides were mounted using Prolong Gold Antifade 201

reagent with DAPI (4,6-diamidine-2-phenylindole; Invitrogen). Fluorescent images were viewed 202

through an Olympus BX41 microscope and digital images were processed using Olympus DP 203

Manager software. Cross-sectional areas were calculated from fluorescent images using NIH 204

ImageJ software (28). 205

206

Determination of Serum Cardiac Troponin Levels 207

Cardiac troponin I (cTnI) concentrations were measured using the Ultra Sensitive Mouse 208

Cardiac Troponin-I ELISA Kit (Life Diagnostics) according to the manufacturer’s instructions. 209

Samples were assayed in duplicate. 210

211

Echocardiography 212

In vivo echocardiography was performed as previously described (29), consistent with 213

guidelines of the American Society of Echocardiography. Mice were anesthetized by inhaled 214

isoflurane, chest hair was removed with NairTM (Church & Dwight), and imaging was performed 215

using Vevo770 Ultrasound system (Visual Sonics Inc). Transducers used were an RMV707B 216

(15-45Mhz) for adult mice or an RMV706 (20-60Mhz) for neonatal mice. Imaging and analysis 217

were performed by a single blinded sonographer. Left ventricular (LV) mass was calculated by 218

measuring the LV internal diameter (LVID), the LV posterior wall thickness (LVPW), and 219

interventricular septal thickness (IVS) in diastole (d), using the following formula: LV 220

mass=1.053*[(LVIDd+LVPWd+IVSd)3-LVIDd3. LV end systolic and end diastolic dimensions 221

(LVs and LVd), as well as systolic and diastolic wall thickness were measured from M-mode 222

tracings to calculate fractional shortening and ejection fraction assuming a spherical LV 223

geometry [(LVd3-LVs3)/LV d3x100)], 224

10

225

Statistics 226

Analysis for statistical significance was conducted using Prism 6 for Macintosh 227

(GraphPad Software, Incorporated). Differences between more than two groups at a single time 228

point were analyzed using one-way analysis of variance (ANOVA). Differences between groups 229

at multiple time points were analyzed using two-way analysis of variance (ANOVA) followed by 230

Bonferroni's multiple comparison tests. For viral load data, differences between groups at a 231

given time point in log-transformed viral loads were analyzed using the Mann-Whitney test. 232

Survival analysis was performed using the log-rank (Mantel-Cox) test. P values less than 0.05 233

were considered statistically significant. 234

235

Results 236

MAV-1 infects primary cardiac myocytes ex vivo and hearts in vivo. 237

To determine whether MAV-1 can productively infect cardiac myocytes, we isolated 238

cardiac myocytes from adult mice and inoculated them with MAV-1. We used RT-qPCR to 239

quantify the expression of the MAV-1 E1A and hexon genes and qPCR to quantify viral DNA in 240

infected myocytes. Expression of E1A, a nonstructural gene expressed early in infection, and 241

hexon, a virion structural protein expressed late, increased between 24 and 48 hpi (Fig. 1A). 242

Likewise, viral DNA increased between 24 and 48 hpi (Fig. 1B), further suggesting productive 243

viral replication in these cells. To confirm that infectious progeny were produced from cardiac 244

myocytes, we performed plaque assays with supernatants of infected cardiac myocyte cultures. 245

Viral titers in the supernatants of infected cells increased slightly over time (Fig. 1C), further 246

indicating that cardiac myocytes were productively infected by MAV-1. 247

To verify that MAV-1 replicates in hearts in vivo, we infected 7-day old C57BL/6 mice i.n. 248

with MAV-1. We harvested hearts at multiple time points and used qPCR to quantify DNA viral 249

loads. MAV-1 DNA was readily detectable at 4 dpi (Fig. 1D). Viral loads in the heart increased to 250

11

peak levels between 7 and 10 dpi and were reduced at 21 dpi. We also detected expression of 251

MAV-1 E1A and hexon genes in the hearts of infected mice using RT-qPCR (Fig. 1E and 1F). 252

Expression of both E1A and hexon peaked at 7 and 10 dpi and then decreased over time, 253

although we detected persistent expression at 21 dpi. The presence of viral gene expression 254

and the logarithmic increases and subsequent decreases in heart viral loads over the time 255

course suggest that MAV-1 replicates in the hearts of mice following i.n. infection. 256

257

MAV-1 induces cellular inflammation in the heart. 258

Cardiac inflammation was reported following i.p. MAV-1 infection of neonatal outbred 259

Swiss Webster mice (20), but this inflammatory response was not characterized in detail. We 260

evaluated the histologic appearance of hearts obtained from inbred mice at various times post 261

infection. We observed no differences between hearts of mock-infected and infected mice at 4 262

dpi (data not shown) or at 7 dpi (Fig. 2A). By 10 dpi, numerous focal accumulations of 263

inflammatory cells were present, scattered throughout the myocardium (Fig. 2A). In many areas, 264

these foci were associated with necrotic cardiac myocytes. Cellular inflammation was less 265

severe at 14 and 21 dpi, although hearts of infected mice contained scattered focal 266

accumulations of mononuclear inflammatory cells and necrotic cardiac myocytes (Fig. 2A and 267

data not shown). 268

We used immunohistochemistry to evaluate and quantify recruitment of inflammatory 269

cells to hearts following MAV-1 infection. Increased numbers of CD3+ T lymphocytes were first 270

detected in hearts of infected mice at 7 dpi (Fig. 2B). By 10 dpi, we observed further increases 271

in the number of CD3+ cells. At this time, recruited CD3+ cells were clustered around blood 272

vessels and distributed throughout the myocardium (Fig. 2A and 2B). Fewer CD3+ cells were 273

detected at later times, but they were still present in greater numbers in the hearts of infected 274

mice than mock infected mice at 14 and 21 dpi (Fig. 2B). Both CD4+ and CD8+ cells were 275

detected in the hearts of infected mice at 10 dpi, although CD8+ cells were more abundant than 276

12

CD4+ cells (Fig. 2C). We also observed recruitment of F4/80+ macrophages to the heart after 277

MAV-1 infection (data not shown). 278

Histological evaluation suggested that MAV-1 infection and/or MAV-1-induced cardiac 279

inflammation induces myocyte necrosis. To determine whether the histological findings 280

described above correlated with other markers of cardiac injury during acute infection, we 281

measured cTnI in the serum of mice after infection. We detected increased concentrations of 282

cTnI in the serum of infected mice at 10 dpi (Fig. 2D) but not at other times or in mock infected 283

mice. 284

285

IFN-γ and other proinflammatory cytokines are upregulated in hearts of infected neonatal mice. 286

Because we observed recruitment of T cells to the heart following MAV-1 infection, we 287

used RT-qPCR to measure expression of proinflammatory chemokines and cytokines in the 288

heart. We detected increased expression of IFN-γ in the hearts of infected mice beginning at 7 289

dpi (Fig. 3A). IFN-γ upregulation peaked at 10 dpi and decreased in magnitude, but persisted in 290

infected mice at 21 dpi. We observed no significant changes in expression of IFN-β, IL-4 or 291

IL-17 (data not shown). We detected increased expression of the chemokine CCL5 starting at 292

10 dpi that persisted in infected mice until 21 dpi (Fig. 3B). Expression of TNF-α (Fig. 3C) and 293

IL-1β (Fig. 3D) was also increased in infected mice, whereas we detected no significant 294

changes in expression of IL-6 (data not shown). 295

296

MAV-1-induced cardiac disease is less pronounced in adult mice. 297

We have previously described increased susceptibility to MAV-1 respiratory infection 298

and blunted lung IFN-γ responses in neonatal mice compared to adults (26). To determine 299

whether this is also the case in the heart, we compared viral loads and inflammatory responses 300

in the hearts of neonates and adult mice. We detected peak viral loads in the hearts of adults at 301

13

10 dpi (Fig. 4A). There were no statistically significant differences between heart viral loads in 302

neonates and adults at any time point. There was substantially less cellular inflammation and 303

evidence of myocyte necrosis (data not shown) and fewer CD3+ cells in adult hearts (Fig. 4B). 304

cTnI was not detected in the serum of infected adult mice at any time point (data not shown). 305

IFN-γ (Fig. 4C), CCL5 (Fig. 4D), and TNF-α (Fig. 4E) were upregulated in the hearts of infected 306

adult mice, but the magnitudes of these responses were substantially lower and the kinetics 307

were delayed compared to those in neonates, in contrast to our previous findings in the lungs 308

(26). We detected marked increases in the expression of both IL-1β (Fig. 4F) and IL-6 (Fig. 4G) 309

in adult mice at 14 dpi, but expression of both had decreased to baseline levels by 21 dpi. Peak 310

levels of IL-1β and IL-6 were greater in adults than in neonates at 14 dpi. However, there was 311

minimal difference between neonates and adults when comparing the fold change in mRNA 312

levels relative to mock infected animals at 14 dpi for IL-1β (neonates, 1.83 ± 0.29; adults, 4.64 ± 313

2.26; P=0.44) or IL-6 (neonates, 1.56 ± 0.67; adults, 4.92 ± 2.67; P=0.34). 314

315

MAV-1 infection is associated with cardiac dysfunction in neonatal mice. 316

Acute viral myocarditis often results in decreased cardiac function (30, 31). To determine 317

whether our histological observations correlated with measurements of cardiac function, we 318

assessed heart function by echocardiography. In mice infected as neonates, there were no 319

differences in left ventricular ejection fraction or cardiac output between mock- and MAV-1-320

infected mice at 5 dpi (Figs. 5A and 5B). However, left ventricular ejection fraction and cardiac 321

output were significantly lower in infected neonates compared to mock-infected controls at 10 322

dpi. MAV-1 infection of neonatal mice did not cause left ventricle dilation (Fig. 5C), and heart 323

rate did not differ between groups (Fig. 5D). MAV-1 infection of adult mice had no effect on left 324

ventricular ejection fraction, cardiac output, left ventricle dilation, or heart rate at 10 dpi (Figs. 325

5E-H). 326

14

327

IFN-γ is proinflammatory during MAV-1 myocarditis. 328

Type I IFN (IFN-α and IFN-β) and type II IFN (IFN-γ) are upregulated and are often 329

protective in other models of viral myocarditis (12-14). Although we did not observe virus-330

induced changes in IFN-β expression (data not shown), we did detect significant upregulation of 331

IFN-γ in hearts after MAV-1 infection (Fig. 3). To further define the role of IFN-γ during MAV-1 332

myocarditis, we depleted IFN-γ beginning on the day after infection. Due to accelerated mortality 333

in the infected IFN-γ -depleted mice beginning at 9 days after infection (Fig. 6A), mice were 334

euthanized at 9 dpi. Heart viral loads did not differ between IFN-γ-depleted and control mice at 9 335

dpi (Fig. 6B). The severity of myocarditis was quantified by blinded scoring of histological 336

sections of hearts. As before, substantial cellular inflammation was present in the hearts of 337

control mice infected with MAV-1. In contrast, virus-induced cardiac inflammation was 338

significantly lower in IFN-γ-depleted mice, equivalent to that in mock-infected animals (Fig. 6C). 339

Likewise, IFN-γ depletion reduced virus-induced CCL5, TNF-α, and IL-1β upregulation (Figs. 340

6D-F). We confirmed IFN-γ depletion using ELISA to measure IFN-γ protein in heart 341

homogenate (Fig. 6G) 342

343

Persistent MAV-1 infection is associated with cardiac hypertrophy. 344

Both HAdV and MAV-1 establish persistent infections (32, 33). To determine whether 345

MAV-1 persists in the heart, we infected mice at 7 days of age and harvested hearts from 346

surviving mice at approximately 9 weeks post infection, when the mice had grown into 347

adulthood. We detected viral genome in all infected mice by both nested PCR (Fig. 7A) and 348

qPCR (data not shown). To determine whether persistent MAV-1 infection affects cardiac 349

function, we performed echocardiography at 9 weeks post infection. Although there was a trend 350

toward lower left ventricle ejection fraction in mice that were infected as neonates compared to 351

15

mock-infected mice (data not shown), the difference was not statistically significant, suggesting 352

that the acute functional deficits of MAV-1 infection were at least partially recovered. We 353

observed a significant increase in the left ventricle mass (as measured by echocardiography) to 354

tibia length ratio in MAV-1-infected mice compared to mock-infected mice (Fig. 7B). There were 355

no statistically significant differences between groups in tibia length (data not shown). To further 356

assess long-term effects of infection, we quantified cardiomyocyte cross-sectional area in 357

cardiac sections stained with wheat germ agglutinin. Mice that were infected as neonates 358

displayed a significant increase in cardiomyocyte size, consistent with cellular hypertrophy (Fig. 359

7C). 360

361

Discussion 362

HAdV are common causes of viral myocarditis (3, 4). They are implicated in the 363

development of dilated cardiomyopathy (34) and cardiac dysfunction (35, 36). The present study 364

is the first to examine the pathogenesis of adenovirus myocarditis in detail, using MAV-1 to 365

study an adenovirus in its natural host. We demonstrated that i.n. MAV-1 infection of neonatal 366

C57BL/6 mice caused myocardial inflammation and tissue damage. Maximal viral loads, 367

induction of IFN-γ, and recruitment of CD3+ T cells correlated with markers of cardiomyocyte 368

damage and cardiac dysfunction. Neutralization of IFN-γ during acute MAV-1 infection reduced 369

cardiac inflammation without affecting viral replication. Long-term persistence of MAV-1 in 370

hearts was associated with increased LV mass and cellular hypertrophy. 371

Although it is possible that virus present in residual blood in hearts harvested from mice 372

contributed to measured viral loads in our study, increases in viral gene expression and 373

logarithmic increases in viral loads between 4 and 7 dpi strongly suggest that MAV-1 replicates 374

in hearts of mice after infection. Further, our in vitro data showing MAV-1 replication in primary 375

cardiac myocytes suggest that cardiac myocytes are a likely cellular target of the virus in vivo, 376

16

consistent with a previous report demonstrating the presence of MAV-1 in cardiac myocytes 377

using electron microscopy (20). In that study, virions appeared to be present in other cell types 378

as well, including cardiac fibroblasts and endothelial cells. Cardiac fibroblasts may serve as 379

another target of MAV-1 replication in vivo, and we are currently investigating this possibility. 380

HAdV DNA is often detected at high levels in lymphocytes of human tonsillar and adenoid tissue 381

(37), and MAV-1 has been reported to replicate in macrophages (38), raising the possibility that 382

MAV-1 could also infect resident or recruited immune cells in the heart. 383

CD3+ T cells and F4/80+ macrophages were recruited to the hearts of neonatal mice 384

after MAV-1 infection. This is consistent with observations that hearts of patients with HAdV 385

myocarditis are infiltrated with T cells and macrophages (35, 39). The T cell infiltrates following 386

MAV-1 infection were mainly CD8+ T cells, although CD4+ T cells were also present. Following 387

i.p. MAV-1 infection of adult mice, either CD4+ or CD8+ T cells are required for viral clearance 388

from brain, and perforin (Pfn) contributes to signs of acute encephalomyelitis (40). A previous 389

study demonstrated a role for both CD4+ and CD8+ T cells in the development of CVB3 390

myocarditis (41), and Pfn is a major contributor to severe tissue damage during CVB3 391

myocarditis (42). T cells likely contribute to both tissue damage and control of viral replication in 392

the heart during acute MAV-1 infection. Specific mechanisms regulating the effects of T cells in 393

the heart during MAV-1 myocarditis have not yet been defined. 394

CD8+ T cells may play both inflammatory and cytolytic roles during infection, either by 395

secretion of cytokines, such as IFN-γ or TNF-α, or through release of cytolytic granules such as 396

Pfn (43). Both type I and type II IFN can play protective roles in other models of viral myocarditis 397

(12-14). IFN-γ and Pfn play antagonistic roles during chronic myocarditis caused by 398

Trypanosoma cruzi, with Pfn+CD8+ T cells implicated in causing tissue damage and IFN-γ +CD8+ 399

T cells preventing tissue damage (43). In the current study, we identified robust induction of 400

IFN-γ in the heart after MAV-1 infection, consistent with previous studies showing induction of 401

17

IFN-γ in MAV-1-infected lungs (25, 26). During acute MAV-1 respiratory infection of adult mice, 402

CD4+ and CD8+ T cells are the primary producers of IFN-γ in the lung (24). IFN-γ induced during 403

MAV-1 myocarditis is likely produced by infiltrating CD4+ and/or CD8+ T cells, because the 404

robust IFN-γ induction that we observe correlates closely with recruitment of these cells to the 405

myocardium. Cells not evaluated in this study, such as natural killer cells, may also contribute to 406

early IFN-γ production in the heart during MAV-1 myocarditis. 407

Although IFN-γ is induced in the lung during MAV-1 respiratory infection, it is not 408

essential for control of MAV-1 replication in the lungs or for survival of adult mice following i.n. 409

inoculation (26). Similarly, IFN-γ does not appear to be critical for control of MAV-1 replication in 410

the hearts of neonatal mice, since IFN-γ depletion did not lead to increased viral replication in 411

the heart. IFN-γ-depleted mice developed significantly less cardiac inflammation after MAV-1 412

infection, suggesting that IFN-γ plays a proinflammatory role in the heart as it does in some 413

reports of CVB3 myocarditis (15, 16). At the same time, IFN-γ-depleted mice became moribund 414

sooner than controls following infection. In addition, we detected equivalent viral loads in 415

neonates and adults despite substantially greater IFN-γ induction in neonates. MAV-1 can be 416

detected in many different organs following both i.n. and i.p. inoculation (44). We speculate that 417

IFN-γ has organ-specific effects on MAV-1 pathogenesis. IFN-γ depletion might lead to 418

increased viral loads and/or increased immunopathology in other organs, in particular the lungs, 419

due to the inoculation route used in this study, and brain, as central nervous system disease is a 420

cause of mortality in susceptible mouse strains following i.p. inoculation (45, 46). Our findings 421

indicate that IFN-γ exerts an important proinflammatory effect in the heart during MAV-1 422

myocarditis in neonatal mice, and that inflammation induced by IFN-γ signaling rather than direct 423

antiviral effects of IFN-γ may be important for survival. Similarly, IFN-γ overexpression (13) or 424

administration (47) ameliorates myocarditis in CVB3 and encephalomyocarditis virus models, 425

18

respectively. However, this effect is likely due to the direct suppression of viral replication by 426

IFN-γ or IFN-γ-mediated activation of natural killer cells (48). 427

Acute MAV-1 infection caused cardiac dysfunction in neonatal mice, similar to 428

decreased cardiac function seen after infection with influenza A or CVB3 (30, 31). The 429

significantly decreased cardiac function in MAV-1-infected mice that we observed at 10 dpi 430

correlated with the greatest degree of virus-induced IFN-γ expression and also with peak levels 431

of viral replication and cellular inflammation. It may be that cardiac dysfunction observed during 432

MAV-1 myocarditis is due to direct cardiomyocyte damage caused by MAV-1 infection itself or 433

by cytotoxic effects of virus-induced immune responses. However, because viral replication in 434

hearts of adult mice was not associated with substantial inflammation, evidence of cardiac 435

myocyte damage, or echocardiographic changes, it seems likely that host responses to viral 436

infection are the most important contributors to cardiac dysfunction following MAV-1 infection. 437

For instance, IFN-γ itself contributes to contractile dysfunction in immune-mediated myocarditis 438

(49). Given its pronounced upregulation during MAV-1 myocarditis, it seems possible that IFN-γ 439

contributes to the physiological abnormalities that we detected in infected mice. Other cytokines 440

induced in the heart by MAV-1 infection, including TNF-α, IL-1β, and IL-6, have also been 441

reported to impair cardiac contractility (50-54) and may therefore also contribute to cardiac 442

dysfunction during MAV-1 infection. 443

Our results suggest that MAV-1 replicates equally well in hearts of neonatal and adult 444

mice, but only neonatal mice are susceptible to MAV-1-induced myocarditis. Immune responses 445

to many different pathogens differ between neonates and adults. Neonates are generally 446

thought to mount inefficient Th1 responses (55, 56), although there is evidence that neonatal T 447

cells can mount protective CD8+ T cell responses equivalent to that of adults (57). We have 448

recently observed susceptibility differences between neonatal and adult BALB/c mice to MAV-1 449

respiratory infection that correlated with less exuberant IFN-γ responses in neonatal lungs (26). 450

19

Our results in the present study using neonate and adult C57BL/6 mice, however, demonstrate 451

that neonatal mice have an exaggerated IFN-γ response in heart tissue compared to adult mice 452

after MAV-1 infection that correlates with infiltration of CD3+ T cells and cardiac myocyte 453

damage. This suggests that the response to acute MAV-1 infection is both age- and organ-454

specific. Supporting this possibility, a previous study demonstrated that susceptibility of mice to 455

group B coxsackieviruses differs by age of mice, organ, and virus type (58). 456

The exuberant immune response observed in the hearts of neonatal mice, but not adult 457

mice, after MAV-1 infection could be due to organ- and age-specific differences in cytokine 458

receptor expression levels or function of antigen presenting cells. Age-based differences in the 459

activity of intracellular signaling pathways could also lead to the age-specific outcomes we 460

observe during MAV-1 myocarditis. For instance, a previous study demonstrated high 461

expression of components of the IL-1R/TLR signaling pathway in the neonatal period that is 462

rapidly down-regulated by 12 months of age (59). Another study demonstrated hypersensitivity 463

of neonatal mice to TLR stimulation compared to adult mice, which may increase susceptibility 464

of neonates to infection (60). Interestingly, we detected a different pattern in overall levels of 465

IL-1β and IL-6 mRNA late during infection, both of which were higher in adults than in neonates 466

at 14 dpi (Fig. 4). Contributions of these cytokines to the control of MAV-1 replication and to 467

MAV-1-induced disease in the heart or in other organs have not yet been described. These 468

cytokines may serve to limit viral replication in adult mice, minimizing deleterious virus-induced 469

inflammation and subsequent cardiac dysfunction. Our data emphasize both the complicated 470

interplay of various immune responses that is likely to occur during MAV-1 myocarditis as well 471

as the changes in immune function that occur with age. 472

Persistent HAdV infections have been implicated in the development of dilated 473

cardiomyopathy (DCM) and cardiac dysfunction (8, 34-36). A wide range of viral genomes 474

(enterovirus, HAdV, parvovirus B19 or human herpesvirus 6) were detected in endomyocardial 475

20

biopsies from patients with clinically suspected myocarditis or dilated cardiomyopathy (36). We 476

demonstrated that MAV-1 DNA persisted to at least 9 weeks post infection in hearts of mice 477

infected with MAV-1 as neonates, and MAV-1 persistence was associated with cardiac 478

hypertrophy. It is unclear whether long-term persistent MAV-1 replication occurs in the heart and 479

in which cells MAV-1 persists. Using RT-qPCR, we were unable to detect viral gene expression 480

in hearts at 9 weeks post infection (data not shown), although it is possible that this technique is 481

not sensitive enough to detect isolated replication in a very small number of cells. Long-term 482

effects of MAV-1 infection on cardiac remodeling could be due to chronic inflammation induced 483

by persistence of virus in the absence of active replication. Long-term effects of infection on 484

cardiac function can be caused by an autoimmune process, as occurs with autoreactive T cells 485

that arise following CV3B infection (61). To our knowledge, no reports document this type of 486

response during HAdV or MAV-1 infection, but we are in the process of characterizing virus-487

specific and autoreactive T cells in the context of MAV-1 myocarditis. 488

In summary, our findings demonstrate that IFN-γ is a proinflammatory mediator during 489

adenovirus-induced myocarditis, and they suggest that persistent adenovirus infection may 490

contribute to ongoing cardiac dysfunction and cardiac remodeling. The MAV-1 model will enable 491

fundamental studies of adenovirus myocarditis and facilitate investigation of therapeutic 492

strategies such as modulation of IFN-γ and other host responses. 493

494

Acknowledgments 495

We thank Katherine Spindler and Michael Imperiale for helpful review of the manuscript. 496

We appreciate the assistance of Paula Arrowsmith with histology, which was performed in the 497

Pathology Cores for Animal Research in the University of Michigan Unit for Laboratory 498

Management. We thank Kimber Converso-Baran for assistance with echocardiography, which 499

was performed in the Physiology Phenotyping Core in the University of Michigan Department of 500

21

Molecular and Integrative Physiology. This work was supported by NIH R21 AI103452 (JBW), 501

R01 HL093338 (SMD), American Heart Association grant 13GRNT17110004 (JBW), and a 502

University of Michigan Department of Pediatrics Amendt-Heller Award for Newborn Research 503

(JBW). 504

22

References 505 506

1. Grist NR, Reid D. 1988. General pathogenicity and epidemiology, p. 241-252. In 507 Bendinelli M, Friedman H (ed.), Coxsackieviruses: a General Update. Plenum, New 508 York, NY. 509

2. Amabile N, Fraisse A, Bouvenot J, Chetaille P, Ovaert C. 2006. Outcome of acute 510 fulminant myocarditis in children. Heart 92:1269-1273. 511

3. Bowles NE, Ni J, Kearney DL, Pauschinger M, Schultheiss H-P, McCarthy R, Hare 512 J, Bricker JT, Bowles KR, Towbin JA. 2003. Detection of viruses in myocardial tissues 513 by polymerase chain reaction. evidence of adenovirus as a common cause of 514 myocarditis in children and adults. J Am Coll Cardiol 42:466-472. 515

4. Martin AB, Webber S, Fricker FJ, Jaffe R, Demmler G, Kearney D, Zhang YH, 516 Bodurtha J, Gelb B, Ni J. 1994. Acute myocarditis. Rapid diagnosis by PCR in children. 517 Circulation 90:330-339. 518

5. Feldman AM, McNamara D. 2000. Myocarditis. N Engl J Med 343:1388-1398. 519 6. Kuhl U, Pauschinger M, Seeberg B, Lassner D, Noutsias M, Poller W, Schultheiss 520

HP. 2005. Viral persistence in the myocardium is associated with progressive cardiac 521 dysfunction. Circulation 112:1965-1970. 522

7. Tatrai E, Hartyanszky I, Jr., Laszik A, Acsady G, Sotonyi P, Hubay M. 2011. The role 523 of viral infections in the development of dilated cardiomyopathy. Pathol Oncol Res 524 17:229-235. 525

8. Pauschinger M, Bowles NE, Fuentes-Garcia FJ, Pham V, Kühl U, Schwimmbeck 526 PL, Schultheiss HP, Towbin JA. 1999. Detection of adenoviral genome in the 527 myocardium of adult patients with idiopathic left ventricular dysfunction. Circulation 528 99:1348-1354. 529

9. Shirali GS, Ni J, Chinnock RE, Johnston JK, Rosenthal GL, Bowles NE, Towbin JA. 530 2001. Association of viral genome with graft loss in children after cardiac transplantation. 531 N Engl J Med 344:1498-1503. 532

10. Dennert R, Crijns HJ, Heymans S. 2008. Acute viral myocarditis. Eur Heart J 29:2073-533 2082. 534

11. Rose NR, Hill SL. 1996. The pathogenesis of postinfectious myocarditis. Clin Immunol 535 Immunopathol 80:S92-99. 536

12. Sherry B, Torres J, Blum MA. 1998. Reovirus induction of and sensitivity to beta 537 interferon in cardiac myocyte cultures correlate with induction of myocarditis and are 538 determined by viral core proteins. J Virol 72:1314-1323. 539

13. Henke A, Jarasch N, Martin U, Zell R, Wutzler P. 2008. Characterization of the 540 protective capability of a recombinant coxsackievirus B3 variant expressing interferon-541 gamma. Viral Immunology 21:38-48. 542

14. Irvin SC, Zurney J, Ooms LS, Chappell JD, Dermody TS, Sherry B. 2011. A Single 543 Amino Acid Polymorphism in Reovirus Protein μ2 Determines Repression of Interferon 544 Signaling and Modulates Myocarditis. J Virol. 545

15. Frisancho-Kiss S, Nyland JF, Davis SE, Frisancho JA, Barrett MA, Rose NR, 546 Fairweather D. 2006. Sex differences in coxsackievirus B3-induced myocarditis: IL-547 12Rbeta1 signaling and IFN-gamma increase inflammation in males independent from 548 STAT4. Brain research 1126:139-147. 549

16. Huber SA, Graveline D, Born WK, O'Brien RL. 2001. Cytokine production by 550 Vgamma(+)-T-cell subsets is an important factor determining CD4(+)-Th-cell phenotype 551 and susceptibility of BALB/c mice to coxsackievirus B3-induced myocarditis. Journal of 552 virology 75:5860-5869. 553

17. Torzewski M, Wenzel P, Kleinert H, Becker C, El-Masri J, Wiese E, Brandt M, Pautz 554 A, Twardowski L, Schmitt E, Münzel T, Reifenberg K. 2012. Chronic inflammatory 555

23

cardiomyopathy of interferon γ-overexpressing transgenic mice is mediated by tumor 556 necrosis factor-α. Am J Pathol 180:73-81. 557

18. DeBiasi RL, Robinson BA, Sherry B, Bouchard R, Brown RD, Rizeq M, Long C, 558 Tyler KL. 2004. Caspase inhibition protects against reovirus-induced myocardial injury 559 in vitro and in vivo. J Virol 78:11040-11050. 560

19. Weinberg JB, Stempfle GS, Wilkinson JE, Younger JG, Spindler KR. 2005. Acute 561 respiratory infection with mouse adenovirus type 1. Virology 340:245-254. 562

20. Blailock ZR, Rabin ER, Melnick JL. 1968. Adenovirus myocarditis in mice. An electron 563 microscopic study. Exp Mol Pathol 9:84-96. 564

21. Klempa B, Kruger DH, Auste B, Stanko M, Krawczyk A, Nickel KF, Uberla K, Stang 565 A. 2009. A novel cardiotropic murine adenovirus representing a distinct species of 566 mastadenoviruses. J Virol 83:5749-5759. 567

22. Kabaeva Z, Zhao M, Michele DE. 2008. Blebbistatin extends culture life of adult mouse 568 cardiac myocytes and allows efficient and stable transgene expression. Am J Physiol 569 Heart Circ Physiol 294:H1667-1674. 570

23. Cauthen A, Welton A, Spindler KR. 2007. Construction of mouse adenovirus type 1 571 mutants. Methods Mol Med 130:41-59. 572

24. McCarthy MK, Zhu L, Procario MC, Weinberg JB. 2014. IL-17 contributes to 573 neutrophil recruitment but not to control of viral replication during acute mouse 574 adenovirus type 1 respiratory infection. Virology 456-457:259-267. 575

25. McCarthy MK, Levine RE, Procario MC, McDonnell PJ, Zhu L, Mancuso P, Crofford 576 LJ, Aronoff DM, Weinberg JB. 2013. Prostaglandin E2 Induction during Mouse 577 Adenovirus Type 1 Respiratory Infection Regulates Inflammatory Mediator Generation 578 but Does Not Affect Viral Pathogenesis. PLoS ONE 8:e77628. 579

26. Procario MC, Levine RE, McCarthy MK, Kim E, Zhu L, Chang C-H, Hershenson MB, 580 Weinberg JB. 2012. Susceptibility to acute mouse adenovirus type 1 respiratory 581 infection and establishment of protective immunity in neonatal mice. J Virol 86:4194-582 4203. 583

27. Chensue SW, Ruth JH, Warmington K, Lincoln P, Kunkel SL. 1995. In vivo 584 regulation of macrophage IL-12 production during type 1 and type 2 cytokine-mediated 585 granuloma formation. J Immunol 155:3546-3551. 586

28. Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of 587 image analysis. Nature Methods 9:671-675. 588

29. Zolov SN, Bridges D, Zhang Y, Lee W-W, Riehle E, Verma R, Lenk GM, Converso-589 Baran K, Weide T, Albin RL, Saltiel AR, Meisler MH, Russell MW, Weisman LS. 590 2012. In vivo, Pikfyve generates PI(3,5)P2, which serves as both a signaling lipid and 591 the major precursor for PI5P. Proceedings of the National Academy of Sciences 592 109:17472-17477. 593

30. Pan H-Y, Yamada H, Chida J, Wang S, Yano M, Yao M, Zhu J, Kido H. 2011. Up-594 regulation of ectopic trypsins in the myocardium by influenza A virus infection triggers 595 acute myocarditis. Cardiovascular Research 89:595-603. 596

31. Cheung C, Marchant D, Walker EK-Y, Luo Z, Zhang J, Yanagawa B, Rahmani M, 597 Cox J, Overall C, Senior RM, Luo H, McManus BM. 2008. Ablation of matrix 598 metalloproteinase-9 increases severity of viral myocarditis in mice. Circulation 117:1574-599 1582. 600

32. Horwitz MS. 2001. Adenovirus immunoregulatory genes and their cellular targets. 601 Virology 279:1-8. 602

33. Smith K, Brown CC, Spindler KR. 1998. The role of mouse adenovirus type 1 early 603 region 1A in acute and persistent infections in mice. J Virol 72:5699-5706. 604

24

34. Tátrai E, Hartyánszky I, Lászik A, Acsády G, Sótonyi P, Hubay M. 2011. The role of 605 viral infections in the development of dilated cardiomyopathy. Pathol. Oncol. Res. 606 17:229-235. 607

35. Kühl U, Pauschinger M, Noutsias M, Seeberg B, Bock T, Lassner D, Poller W, 608 Kandolf R, Schultheiss H-P. 2005. High prevalence of viral genomes and multiple viral 609 infections in the myocardium of adults with "idiopathic" left ventricular dysfunction. 610 Circulation 111:887-893. 611

36. Kühl U, Pauschinger M, Seeberg B, Lassner D, Noutsias M, Poller W, Schultheiss 612 H-P. 2005. Viral persistence in the myocardium is associated with progressive cardiac 613 dysfunction. Circulation 112:1965-1970. 614

37. Garnett CT, Erdman D, Xu W, Gooding LR. 2002. Prevalence and quantitation of 615 species C adenovirus DNA in human mucosal lymphocytes. J Virol 76:10608-10616. 616

38. Ashley SL, Welton AR, Harwood KM, Rooijen NV, Spindler KR. 2009. Mouse 617 adenovirus type 1 infection of macrophages. Virology 390:307-314. 618

39. Treacy A, Carr MJ, Dunford L, Palacios G, Cannon GA, O'Grady A, Moran J, 619 Hassan J, Loy A, Connell J, Devaney D, Kelehan P, Hall WW. 2010. First report of 620 sudden death due to myocarditis caused by adenovirus serotype 3. Journal of Clinical 621 Microbiology 48:642-645. 622

40. Moore ML, Brown CC, Spindler KR. 2003. T cells cause acute immunopathology and 623 are required for long-term survival in mouse adenovirus type 1-induced 624 encephalomyelitis. J Virol 77:10060-10070. 625

41. Henke A, Huber S, Stelzner A, Whitton JL. 1995. The role of CD8+ T lymphocytes in 626 coxsackievirus B3-induced myocarditis. J Virol 69:6720-6728. 627

42. Gebhard JR, Perry CM, Harkins S, Lane T, Mena I, Asensio VC, Campbell IL, 628 Whitton JL. 1998. Coxsackievirus B3-induced myocarditis: perforin exacerbates 629 disease, but plays no detectable role in virus clearance. Am J Pathol 153:417-428. 630

43. Silverio JC, Pereira IR, Cipitelli MdC, Vinagre NF, Rodrigues MM, Gazzinelli RT, 631 Lannes-Vieira J. 2012. CD8(+) T-cells expressing interferon gamma or perforin play 632 antagonistic roles in heart injury in experimental trypanosoma cruzi-elicited 633 cardiomyopathy. PLoS Pathog 8:e1002645. 634

44. Kajon AE, Brown CC, Spindler KR. 1998. Distribution of mouse adenovirus type 1 in 635 intraperitoneally and intranasally infected adult outbred mice. J. Virol. 72:1219-1223. 636

45. Guida JD, Fejer G, Pirofski LA, Brosnan CF, Horwitz MS. 1995. Mouse adenovirus 637 type 1 causes a fatal hemorrhagic encephalomyelitis in adult C57BL/6 but not BALB/c 638 mice. J. Virol. 69:7674-7681. 639

46. Spindler KR, Fang L, Moore ML, Hirsch GN, Brown CC, Kajon A. 2001. SJL/J mice 640 are highly susceptible to infection by mouse adenovirus type 1. J. Virol. 75:12039-641 12046. 642

47. Yamamoto N, Shibamori M, Ogura M, Seko Y, Kikuchi M. 1998. Effects of intranasal 643 administration of recombinant murine interferon-gamma on murine acute myocarditis 644 caused by encephalomyocarditis virus. Circulation 97:1017-1023. 645

48. Godeny EK, Gauntt CJ. 1987. Murine natural killer cells limit coxsackievirus B3 646 replication. J Immunol 139:913-918. 647

49. Pérez Leirós C, Goren N, Sterin-Borda L, Borda ES. 1997. Myocardial dysfunction in 648 an experimental model of autoimmune myocarditis: role of IFN-gamma. 649 Neuroimmunomodulation 4:91-97. 650

50. Janssen SP, Gayan-Ramirez G, Van den Bergh A, Herijgers P, Maes K, Verbeken 651 E, Decramer M. 2005. Interleukin-6 causes myocardial failure and skeletal muscle 652 atrophy in rats. Circulation 111:996-1005. 653

25

51. Kapadia SR, Oral H, Lee J, Nakano M, Taffet GE, Mann DL. 1997. Hemodynamic 654 regulation of tumor necrosis factor-alpha gene and protein expression in adult feline 655 myocardium. Circulation research 81:187-195. 656

52. Okusawa S, Gelfand JA, Ikejima T, Connolly RJ, Dinarello CA. 1988. Interleukin 1 657 induces a shock-like state in rabbits. Synergism with tumor necrosis factor and the effect 658 of cyclooxygenase inhibition. The Journal of clinical investigation 81:1162-1172. 659

53. Van Tassell BW, Seropian IM, Toldo S, Mezzaroma E, Abbate A. 2013. Interleukin-660 1beta induces a reversible cardiomyopathy in the mouse. Inflammation research : official 661 journal of the European Histamine Research Society ... [et al.] 62:637-640. 662

54. Yokoyama T, Vaca L, Rossen RD, Durante W, Hazarika P, Mann DL. 1993. Cellular 663 basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult 664 mammalian heart. The Journal of clinical investigation 92:2303-2312. 665

55. Adkins B, Bu Y, Guevara P. 2002. Murine neonatal CD4+ lymph node cells are highly 666 deficient in the development of antigen-specific Th1 function in adoptive adult hosts. J 667 Immunol 169:4998-5004. 668

56. Adkins B, Leclerc C, Marshall-Clarke S. 2004. Neonatal adaptive immunity comes of 669 age. Nat Rev Immunol 4:553-564. 670

57. Zhang J, Silvestri N, Whitton JL, Hassett DE. 2002. Neonates mount robust and 671 protective adult-like CD8(+)-T-cell responses to DNA vaccines. J Virol 76:11911-11919. 672

58. Khatib R, Chason JL, Silberberg BK, Lerner AM. 1980. Age-dependent pathogenicity 673 of group B coxsackieviruses in Swiss-Webster mice: infectivity for myocardium and 674 pancreas. J Infect Dis 141:394-403. 675

59. Martino D, Holt P, Prescott S. 2012. A novel role for interleukin-1 receptor signaling in 676 the developmental regulation of immune responses to endotoxin. Pediatr Allergy 677 Immunol 23:567-572. 678

60. Zhao J, Kim KD, Yang X, Auh S, Fu Y-X, Tang H. 2008. Hyper innate responses in 679 neonates lead to increased morbidity and mortality after infection. Proc Natl Acad Sci 680 USA 105:7528-7533. 681

61. Gangaplara A, Massilamany C, Brown DM, Delhon G, Pattnaik AK, Chapman N, 682 Rose N, Steffen D, Reddy J. 2012. Coxsackievirus B3 infection leads to the generation 683 of cardiac myosin heavy chain-α-reactive CD4 T cells in A/J mice. Clin Immunol 684 144:237-249. 685

686

687

26

Table 1: Primers and probes used for real-time PCR analysis 688 689

Target Oligonucleotide Sequence (5′ to 3′)

MAV-1 E1A genomic Forward primer GCACTCCATGGCAGGATTCT

Reverse primer GGTCGAAGCAGACGGTTCTTC

Probe TACTGCCACTTCTGC

GAPDH Forward primer TGCACCACCAACTGCTTAG

Reverse primer GGATGCAGGGATGATGTTC

IFN-γ Forward primer AAAGAGATAATCTGGCTCTGC

Reverse primer GCTCTGAGACAATGAACGCT

TNF-α Forward primer CCACCACGCTCTTCTGTCTAC

Reverse primer AGGGTCTGGGCCATAGAACT

MAV-1 E1A Forward primer AATGGGTTTTGCAGTCTGTGTTAC

Reverse primer CGCCTGAGGCAGCAGATC

MAV-1 Hexon Forward primer GGCCAACACTACCGACACTT

Reverse primer TTTTGTCCTGTGGCATTTGA

690

27

Table 2: Primers and probes used for nested PCR analysis 691

692

Target Oligonucleotide Sequence (5′ to 3′)

MAV-1 E1A Round 1 Forward primer ATGTCGCGGCTCCTACG

Reverse primer CAACGAACCATAAAAAGACATCAT

MAV-1 E1A Round 2 Forward primer ATGGGATGGTTCGCCTACTT

Reverse primer CACCGCAGATCCATGTCCTCAA

Actin Forward primer CCTAAGGCCAACCGTGAAAAGATG

Reverse primer ACCGCTCGTTGCCAATAGTGATG

693

28

Table 3. Quantification of cellular inflammation in histologic specimens. 694

695

Severity Score*

Description Extent Score

Description

0 no inflammatory infiltrates

1 inflammatory cells present without discrete foci

1 mild (<25% of section involved)

2 larger foci of 10 to 100 inflammatory cells

2 moderate (~25-75% of section involved)

3 larger foci of >100 inflammatory cells

3 Severe (>75% of section involved)

696

*A score from 0 to 3 was given for the size/intensity of cellular infiltrates. The score was then 697

multiplied by a number reflecting the extent of involvement in the specimen to reach a single 698

final severity score, resulting in a total score that could range from 0 to 9. 699

29

Figure Legends 700

Figure 1. MAV-1 infects cardiac myocytes ex vivo and neonatal hearts in vivo. A) Primary 701

cardiac myocytes from adult C57BL/6 mice were infected with MAV-1 (MOI=5) and expression 702

of the viral E1A and hexon genes was measured by RT-qPCR, shown standardized to GAPDH 703

in arbitrary units (A.U.). B) DNA was extracted from primary cardiac myocytes and qPCR was 704

used to quantify copies of MAV-1 genome. C) Supernatants harvested from infected primary 705

cardiac myocytes and viral titers measured by plaque assay. Error bars represent means ± 706

S.E.M of three samples per time point. D) Neonatal mice were infected with MAV-1. qPCR was 707

used to quantify viral loads in hearts. DNA viral loads are expressed as copies of MAV-1 708

genome per 100 ng of input DNA. Individual circles represent values for individual mice and 709

horizontal bars represent means for each group. Expression of the viral genes E) E1A and F) 710

hexon were measured in the heart by RT-qPCR, shown in arbitrary units and standardized to 711

GAPDH. Combined data from 4 to 9 mice per group are presented as means ± S.E.M. 712

713

Figure 2. Cellular inflammation in hearts of infected neonatal mice. Mice were infected with 714

MAV-1 or mock infected with conditioned media. A) Hematoxylin and eosin-stained or CD3-715

stained sections were prepared from paraffin-embedded sections. Scale bars, 100 µm. B) CD3 716

staining was quantified by counting the number of CD3+ cells per high power field, averaging 717

three fields per individual mouse. Combined data from 3 to 5 mice per group are presented as 718

means ± S.E.M. C) CD4- and CD8-stained sections were prepared from hearts of infected 719

neonatal mice at 10 dpi. Scale bars, 100 µm. D) Serum cTnI levels were measured by ELISA. 720

Combined data from 4 to 6 mice per group are presented as means ± S.E.M. ***P<0.001, 721

comparing Mock to MAV-1. 722

723

Figure 3. Induction of cytokines in hearts. Mice were infected with MAV-1 or mock infected with 724

conditioned media. RT-qPCR was used to quantify A) IFN-γ, B) CCL5, and C) TNF-α, and D) 725

30

IL-1β expression, shown and standardized to GAPDH in arbitrary units (A.U.). Combined data 726

from 4 to 13 mice per group are presented as means ± S.E.M. ***P<0.001, **P<0.01 comparing 727

Mock to MAV-1 at a given time point. 728

729

Figure 4. Age-based differences in MAV-1 myocarditis. Adult and neonatal mice were infected 730

with MAV-1. A) qPCR was used to quantify MAV-1 genome copies in heart DNA. DNA viral 731

loads are expressed as copies of MAV-1 genome per 100 ng of input DNA. Individual circles 732

represent values for individual mice and horizontal bars represent means for each group. B) 733

CD3 staining was quantified by counting the number of CD3+ cells per high power field, 734

averaging three fields per individual mouse. Combined data from 2 to 5 mice per group are 735

presented as means ± S.E.M. ***P<0.001, **P<0.01 comparing neonate to adult at a given time 736

point. RT-qPCR was used to quantify expression of C) IFN-γ, D) CCL5, E) TNF-α, F) IL-1β, and 737

G) IL-6,, all shown standardized to GAPDH in arbitrary units (A.U.). Combined data from 4 to 13 738

mice per group are presented as means ± S.E.M. Neonatal data from Figures 1D, 2B, and 3A-D 739

are included in A, B, and C-F, respectively, for reference. 740

741

Figure 5. Cardiac dysfunction following MAV-1 infection. Neonatal and adult mice were infected 742

with MAV-1 and echocardiography was performed to measure A,E) ejection fraction, B,F) 743

cardiac output, C,G) left ventricle internal diameter, and D,H) heart rate. Combined data from 4 744

to 11 mice per group are presented as means ± S.E.M. *P<0.05 comparing Mock to MAV-1 at a 745

given time point. 746

31

747

Figure 6. Role of IFN-γ in MAV-1 myocarditis. Mice were infected with MAV-1 or mock infected 748

with conditioned media and treated every other day with control IgG or anti-IFN-γ antibody 749

beginning at 1 dpi. A) Survival of infected animals was compared using the log-rank (Mantel-750

Cox) test. B) qPCR was used to quantify MAV-1 genome copies in heart DNA. Viral loads are 751

expressed as copies of MAV-1 genome per 100 ng of input DNA. Individual circles represent 752

values for individual mice and horizontal bars represent means for each group. C) Pathology 753

index scores were generated to quantify cellular inflammation. RT-qPCR was used to quantify 754

D) CCL5, E) TNF-α, and F) IL-1β expression, shown standardized to GAPDH in arbitrary units 755

(A.U.). Combined data from 4 to 6 mice per group are presented as means ± S.E.M. G) ELISA 756

was used to measure IFN-γ protein in heart homogenate. IFN-γ data from 3 to 5 mice per group 757

are standardized to mg of heart tissue and presented as means ± S.E.M. ***P<0.001, **P<0.01, 758

and *P<0.05 comparing Mock to MAV-1 within a given condition. †††P<0.001, ††P<0.001, and 759

†P<0.05 comparing MAV-1-infected control IgG- to anti-IFN-γ-treated mice. 760

761

Figure 7. MAV-1 persistence and cardiac hypertrophy. Mice were infected with MAV-1 and 762

hearts harvested at 9 weeks post infection. A) Nested PCR was used to evaluate the presence 763

of MAV-1 DNA (top) and β-actin (bottom). B) Left ventricular mass (LV) was measured by 764

echocardiography and normalized to tibia length (TL). C) Heart sections were stained with FITC-765

conjugated wheat germ agglutinin to outline cell borders. Cardiomyocyte cross-sectional area 766

was measured from digital images using NIH ImageJ software. Combined data from >350 cells 767

for each condition are presented as means ± S.E.M. ***P<0.001, **P<0.01 comparing Mock to 768

MAV-1. 769

Viral Gene Expression

24 480.0

0.1

0.2

0.3

Hours Post Infection

mRNA (A.U.)

E1A

Hexon

Heart Viral Loads

4 7 10 14 21100

101

102

103

104

105

106

Days Post Infection

Viral Genome

(Copies per 100 ng)

DNA Viral Loads

24 48103

104

105

106

Hours Post Infection

Viral Genome

(Copies per 100 ng)

E1A

4 7 10 14 210.000

0.001

0.002

0.003

0.004

0.005

mRNA (A.U.)

Days Post Infection

Viral Titer

24 480

2000

4000

6000

8000

10000

Hours Post InfectionViral Titer (pfu/ml)

Hexon

4 7 10 14 210.000

0.002

0.004

0.006

0.008

0.010

mRNA (A.U.)

Days Post Infection

A B

D E

C

F

IFN-γ

4 7 10 14 210.000

0.002

0.004

0.006

Days Post Infection

mRNA (A.U.)

Mock

MAV-1

***

TNF-α

4 7 10 14 210.000

0.002

0.004

0.006

0.008

0.010

mRNA (A.U.)

Mock

MAV-1

Days Post Infection

**

CCL5

4 7 10 14 210.0

0.1

0.2

0.3

0.4

0.5mRNA (A.U.)

Mock

MAV-1

Days Post Infection

***

**

IL-1β

4 7 10 14 210.000

0.001

0.002

0.003

0.004

mRNA (A.U.)

Mock

MAV-1

Days Post Infection

***

**

A B

DC

Heart Viral Loads

4 7 10 14 21101

102

103

104

105

106

Days Post Infection

Viral Genome

(Copies per 100 ng)

Neonate Adult

IFN-γ

Mock 4 7 10 14 210.0000

0.0005

0.0010

0.004

0.005

0.006

mRNA (A.U.)

Neonate

Adult***

Days Post Infection

TNF-α

Mock 4 7 10 14 210.000

0.002

0.004

0.006

mRNA (A.U.)

***

Days Post Infection

Neonate

Adult

IL-6

Mock 4 7 10 14 210.00

0.05

0.10

0.15

mRNA (A.U.)

***

Days Post Infection

Neonate

Adult

CD3+ T Cells

Mock 7 10 14 210

50

100

150

CD3+ Cells per HPF Neonate

Adult

Days Post Infection

***

**

CCL5

Mock 4 7 10 14 210.0

0.1

0.2

0.3

0.4

mRNA (A.U.)

***

Days Post Infection

Neonate

Adult

***

IL-1β

Mock 4 7 10 14 210.000

0.005

0.010

0.015

0.020

mRNA (A.U.)

***

Days Post Infection

Neonate

Adult

A B

DC

E F

G

Ejection Fraction(Neonate)

5 100

20

40

60

80

Days Post Infection

EF (%)

*Mock

MAV-1

Cardiac Output(Neonate)

5 100

2

4

6

8

Days Post Infection

CO (ml/min)

*

Mock

MAV-1

LV Diameter (diastole)(Neonate)

5 100

1

2

3

4

5

Days Post Infection

LVDd (mm)

Mock

MAV-1

Heart Rate(Neonate)

5 100

100

200

300

400

500

Days Post Infection

HR (bpm)

Mock

MAV-1

Mock MAV-10

20

40

60

80

10 Days Postinfection

EF (%)

Ejection Fraction(Adult)

Mock

MAV-1

Mock MAV-10

5

10

15

20

10 Days Postinfection

CO (ml/min)

Cardiac Output(Adult)

Mock

MAV-1

Mock MAV-10

1

2

3

4

5

10 Days Postinfection

CO (ml/min)

LV Diameter (diastole)(Adult)

Mock

MAV-1

Mock MAV-10

100

200

300

400

500

10 Days Postinfection

FS (%)

Heart Rate(Adult)

Mock

MAV-1

A E

B F

C G

D H

Days Post Infection

Su

rviv

al (%

)

0 5 10 15 200

20

40

60

80

100

Control

α-IFN-γ

P=0.0021

Heart Viral Loads

IgG α-IFN-γ100

102

104

106

108V

ira

l G

en

om

e(C

op

ies p

er

10

0 n

g)

Heart Pathology

2

4

6

Pa

tho

log

y S

co

re

α-IFN-γ - + - +

Mock MAV-1

***

†††

CCL5

0.03

0.06

0.09

0.12

mR

NA

(A

.U.)

α-IFN-γ - + - +

Mock MAV-1

***

†††

TNF-α

0.003

0.006

0.009

0.012

mR

NA

(A

.U.)

α-IFN-γ - + - +

Mock MAV-1

***

†††

IL-1β

0.003

0.006

0.009

0.012

mR

NA

(A

.U.)

α-IFN-γ - + - +

Mock MAV-1

**

†

A B

D E

C

F

IFN-γ

0.5

1.0

1.5

2.0

pg

/mg

tis

su

e

α-IFN-γ - + - +

Mock MAV-1

**

††

G

Left Ventricle Mass

Mock MAV-10

2

4

6

8

LV/TL Ratio (mg/mm)

**

Cardiomyocyte Area

Mock MAV-10

100

200

300

400

Surface Area (µm2) ***

A

B C