M:Fo

odMi

crobio

logy

&Sa

fety

Prolonging Storage Time of Baby Ginger by Usinga Sand-Based Storage Medium and EssentialOil TreatmentJi Liu, Guoliang Sui, Yongzhou He, Dongjie Liu, Jing Yan, Shuxiang Liu, and Wen Qin

Abstract: Wilt and rot occur readily during storage of baby ginger because of its tender skin and high moisture content(MC). A storage medium, which consisted of sand, 20% water, and 3.75% super absorbent polymers delayed weightloss and loss of firmness at 12 C and 90% relative humidity. Microorganisms were isolated and purified from decayedrhizomes; among these, 3 fungi were identified as pathogens. The results of 18S rDNA sequence analysis showed that thesefungi belonged to Penicillium, Fusarium, and Mortierella genera. The use of essential oil for controlling these pathogenswas then investigated in vitro. Essential oils extracted from Cinnamomum zeylanicum (cinnamon) and Thymus vulgaris(thyme) completely inhibited the growth of all of the above pathogens at a concentration of 2000 ppm. Cinnamon oilshowed higher antifungal activity in the drug sensitivity test with minimal fungicidal concentration (

M:FoodMicrobiology&

Safety

Storage of baby ginger . . .

Materials and Methods

MaterialsBaby ginger obtained from Beichuan (Mianyang City, Sichuan

Province, China) was transported at 12 to 15 C to the laboratoryfor medium storage, pathogen tests, and in vivo antifungal experi-ment, and treatments were carried out on the same day. Rhizomesof uniform length, maturity, and color, with minimum mechan-ical damage and without fungal decay were selected and washedin water at 4 C prior to storage. All essential oils were obtainedfrom Jian Shengda Fragrances Co., Ltd (Jian City, Jiangxi Province,China). Polyethylene (PE) bags (20 cm 30 cm) were perforatedwith 0.5-mm dia holes at a density of 100 holes/m2. River sandwas washed in water, dried at 100 C, and screened through a325 m mesh. SAP with a capacity of 200 g/g was obtainedfrom Shandong Polymer Bio-chemicals Co., Ltd (Dongying City,Shandong Province, China).

Medium storageThe experimental storage media were composed of SAP, water,

and sand in different proportions by weight. SAP to sand ratios of2.5%, 3.75%, and 5% and water to sand ratios of 10%, 20%, and30% were used. Weighed rhizomes were placed into perforated PEbags filled with the storage media. Rhizomes were divided into9 groups, with 3 replicates for each treatment and 36 rhizomesin each replicate distributed among 9 bags (4 rhizomes per bag).The initial data were measured on the same day. Moisture content(MC) of the storage media, weight loss, and firmness of rhizomeswere measured every 7 d for 12 rhizomes.

Microorganism isolationRhizomes were storedwithout surface sterilization in the above-

mentioned media with varying concentrations of SAP for 30 d.Microorganisms were isolated from the leading edge of rottenrhizomes by crushing the tissue in sterile distilled water and platestreaking in Sabourands agar and nutrient agar media. Individualcolonies were purified using the same respective media.

Pathogen testThe pathogen test followed the method of Vero and others

(2002). The concentration of the spore suspension was 2 106spores/mL. The storage media and rhizomes inoculated withthe same microorganism were placed into perforated PE bags.Three replicates were used for each microorganism and eachreplicate had 16 rhizomes distributed among 4 bags. Infectionrates were recorded after 10-d incubation at 12 C. The microor-ganisms were isolated again using the above-mentioned method,and the morphology and pigmentation traits of purified colonieswere compared with those of the microorganism inoculated onrhizomes.

18S rDNA sequence analysis18S rDNA sequence analysis was performed to determine the

genus of each pathogen. The essential oils were chosen depend-ing on the results of this analysis. Mycelia were collected after5-d incubation. DNA was extracted and identified following themethod of Bargues and Mas-Coma (1997). The 18S rDNA se-quences were amplified by polymerase chain reaction (PCR) usingthe following primers:

Figure 1Growth ofMortierella sp. (2 d afterinoculation). The plates with cinnamon oil(500 ppm) were inoculated with 50 L (2 106 spores/mL) ofMortierella sp. After 4 dincubation, each plate was washed with 1 mLof sterile water, and the liquid was transferredto fresh culture media without essential oil(MFC groupbottom 2 rows). Then, as acontrol, part of the plates with fresh culturemedia and the liquid were inoculated with 50L (2 106 spores/mL) ofMortierella sp. (top2 rows). Ten replicates were used for each ofthe 2 conditions.

M594 Journal of Food Science Vol. 79, Nr. 4, 2014

M:Fo

odMi

crobio

logy

&Sa

fety

Storage of baby ginger . . .

NS1 (5 GTAGTCATATGCTTGTCTC 3)NS6 (5 GCATCACAGACCTGTTATTGCCTC 3)

Primers were obtained from Sangon Biotech Co. Ltd (Shanghai,China). PCR was performed as previously described (Zhao andothers 2009). Fragments of 18S rDNA were sequenced using anABI PRISM 3730 DNA Sequencer produced by Applied Biosys-tems (Norwalk, Conn., U.S.A.) according to the manufacturersinstructions. The sequences obtained were submitted to GenBankfor homology search with the Basic Local Alignment Search Tool(BLAST).

In vitro antifungal activity testEssential oils from Illicium verum (star anise), Thymus vulgaris

(thyme), Syzygium aromaticum (clove), Cymbopogon citratus (lemon-grass), Cinnamomum zeylanicum (cinnamon), Litsea cubeba (litsea),Melaleuca alternifolia (tea tree), Herba Menthae (geraniol), Pelargo-nium graveolens (peppermint), and Ocimum basilicum (basil) arethought to have inhibitory effects on 1 or more pathogens andwere chosen for the inhibition tests (Bakkali and others 2008).The antifungal activity of each essential oil was tested against thepathogens following the poisoned food technique (Singh and oth-ers 2005) at concentrations of 2000 ppm. All tests were performedin triplicates. The efficacy of each treatment was evaluated bymeasuring the average perpendicular diameter of 2 colonies, usingdigital calipers (Absolute Digimatic-Mitutoyo Corp., Japan). Therate of radial growth inhibition for fungi by each oil, in compar-ison with the control (without essential oils), was calculated onthe 5th d, using the following formula (Albuquerque and others2006):

Inhibition rate= [(dc dt ) /dc ] 100

where dc represents colony diameter for the control sets and dtrepresents colony diameter for the treatment sets.

Drug sensitivity testTo determine the minimum inhibitory concentration (MIC) of

the essential oils that showed absolute antifungal effect, tests were

Figure 2The trends ofmoisture content change at 10 Cand90%RHover21 d. Nine treatments consisting of different ratios of water and SAP wereset. Error bars represent the standard error. IMC, initial moisture content;3 levels (10%, 20%, and 30%)were established; MC-7D, moisture contentof each media on day 7; MC-14D, moisture content of each media on day14; MC-21D, moisture content of each media on day 21.

carried out in duplicates using the poisoned food technique, withconcentrations of 2000 to 16 ppm by half dilution method. Thecontrol and treated plates were spot inoculated with 50 L (2 106 spores/mL) of each fungus. All culture dishes were incu-bated at 30 C for 4 d. The MIC value was determined as thelowest concentration of the essential oil at which fungal growthwas absent.Each culture dish containing a concentration greater than the

MIC was washed with 1 mL of sterile water, and the liquid wastransferred to fresh culture media without essential oil. As a con-trol, some of the plates containing fresh culture media and theliquid were inoculated again with 50 L (2 106 spores/mL) ofeach fungus.The treatment and control groups were observed and recorded

after 4 d in culture at 30 C. The essential oil concentrationcorresponding to

M:FoodMicrobiology&

Safety

Storage of baby ginger . . .

Table 1Moisture content of media and firmness and weight loss of rhizomes after 21 d.

Medium

Initial moisture Super absorbent Moisture content Firmness Weight losscontent (IMC) (%) polymer content (%) (%) (Kgf/cm2) (%)

10 2.5 13.5 f 5.6 def 13.1 a3.75 15.2 ef 4.6 fg 11.3 ab5 16.5 de 4.2 g 10.7 b

20 2.5 17.8 d 7.0 bc 7.9 c3.75 21.0 c 8.3 a 5.3 d5 24.4 b 7.4 ab 5.5 cd

30 2.5 21.0 c 6.3 bcd 5.2 d3.75 24.5 b 5.9 cde 5.5 d5 30.2 a 5.0 efg 4.9 d

Moisture content of media on day 21.Different letters (a to f) indicate significant differences according to ANOVA test (P 0.05). n = 6 (moisture content); n = 10 (firmness and weight loss). In each column, valuesfollowed by the same letter do not differ significantly according to Duncans multiple range test.

Table 2Identification of the microbial species by sequencing of the PCR-purified 18S rDNA gene of the pathogens.

IMC of medium Closest match(days of storage) Sequence ID Closest match Identity (%) (accession no.)

30% IMC (14 d) KC833482.1 Penicillium sp. 99 JX134614.120% IMC (21 d)30% IMC (14 d) KC833483.1 Mortierella sp. 98 EU428773.120% IMC (14 d)All IMC (7 d) KC833484.1 Fusarium sp. 99 AF548073.1

storage media maintained appropriate moisture balance in thesetreatments. MC of 10% IMC medium continued to increase over21 d (Figure 2). The MC of the 5% SAP medium was significantlyhigher than that of the 2.5% SAP medium after 21 d (Table 1).The weight loss rates of rhizomes stored in all media in this groupwere >10%, and their firmness decreased because of wilting.Among the 30% IMC groups, the MC change in the 5% SAP

medium was

M:Fo

odMi

crobio

logy

&Sa

fety

Storage of baby ginger . . .

Table 3Inhibition rates of toxic media Sabourands agar (SDA) on mycelial growth of pathogenic fungi after 4 d of incubation at30 C.

Essential oils % Inhibition of target fungi

Penicillium sp. Fusarium sp. Mortierella sp.

1 Illicium verum (star anise) 17.76 kl 7.94 o 10.25 n(0.37) (0.26) (0.30)

2 Thymus vulgaris (thyme) 100.0 a 100.0 a 100.0 a(0.00) (0.00) (0.00)

3 Syzygium aromaticum (clove) 100.0 a 100.0 a 54.80 d(0.00) (0.00) (0.94)

4 Cymbopogon citratus (lemongrass) 36.93 f 27.76 h 21.57 ij(2.15) (1.95) (0.28)

5 Cinnamomum zeylanicum (cinnamon) 100.0 a 100.0 a 100.0 a(0.00) (0.00) (0.00)

6 Litsea cubeba (litsea) 10.89 n 87.93 b 18.61 kl(1.21) (0.63) (0.43)

7 Melaleuca alternifolia (tea tree) 13.23 m 51.58 e 36.79 f(0.44) (0.22) (0.14)

8 Herba Menthae (geraniol) 6.53 o 19.69 jk 23.25 i(0.15) (0.16) (0.81)

9 Pelargonium graveolens (peppermint) 17.16 l 33.39 g 33.23 g(0.44) (0.39) (0.61)

10 Ocimum basilicum (basil) 100.0 a 100.0 a 59.12 c(0.00) (0.00) (0.24)

The concentration of each essential oil was 2000 ppm.Different letters indicate significant differences between both generals and essential oils according to ANOVA tests (P 0.05). n = 3.

Fumigation with essential oil resulted in differing morphology ofpathogenic fungi compared with that of the controls. The myceliaof controls had smooth cell walls, intact cellular membranes, anduniform cytoplasm (Figure 4A, 4D, and 4G). After fumigation, thecell walls of Penicillium and Fusarium showed distinct morphologi-cal changes; they became swollen and then ruptured. Some of thesections showed uneven and fluffy walls (Figure 4B, 4C, and 4E);other sections were devoid of cell wall, with the plasma membranestill intact but exposed to the medium or ruptured and releasingcytoplasmic remnants into the medium (Figure 4C and 4F). Themicrostructural changes in Mortierella were different from those ofother fungi. Few swollen cell walls were observed in Mortierella;most of the mycelia showed disorganized inner structures(Figure 4H) and dissolved intracellular membranes (Figure 4I).The improvement of storage media over traditional methods is

physiologically feasible, but will increase transportation costs. Itmay be applied to storage system in the region of origin or inthe market because of the low precision required for temperaturecontrol and treatments. However, the lack of sunlight in the storagemedium could help prevent rhizomes from oxidizing and turninggreen. The SAP used for storage media costs 40 cents per kg babyginger.Although a closed environment, higher temperature, and higher

RH are generally used in pathogen tests, these conditions areimproper for baby ginger storage. Because of its physical prop-erties, the rhizomes of baby ginger would rot in high RH andclosed packaging conditions or wilt at high temperatures. In

Table 4Minimum inhibitory concentration (MIC) and minimalfungicidal concentration (MFC) of thyme and cinnamon essen-tial oil on pathogenic fungi.

Pathogenic fungus MIC (ppm) MFC (ppm)

Thyme Cinnamon Thyme Cinnamon

Penicillium sp. 500 125 2000 500Fusarium sp. 62.5 62.5 250 250Mortierella sp. 250 32 2000 500

such conditions, the decay could be caused by pathogens or byphysiological reactions. Therefore, all rhizomes used in the ex-periments described above were stored in the respective mediaat 12 C.

Fusarium was found on the surface of rhizomes in all media onthe 7th d; thus, Fusarium is the dominant fungal pathogen amongthe 3 pathogens present during storage (Stirling 2004). Moreover,diseases caused by Fusarium may not be geographically restricted.Our results for Penicillium and Fusarium are consistent with stud-ies on Chinese yam, and taro (Overy and Frosvad 2005; Fatima

Figure 3Effects of cinnamon essential oil on development of natural in-fection in unwounded baby ginger. The concentrations of cinnamon oil aredetermined by the MFC test. Fungal species were represented by Penicil-lium, Fusarium, andMortierella sp. Different letters (A to F) above the errorbars indicate significant differences (P 0.01) between various speciesand concentrations by ANOVA. n = 6. Values with the same letter do notdiffer significantly according to Duncans multiple range test.

Vol. 79, Nr. 4, 2014 Journal of Food Science M597

M:FoodMicrobiology&

Safety

Storage of baby ginger . . .

and others 2009). Very few studies have shown that Mortierella ispathogenic. Most studies on Mortierella have focused on the pro-duction of fatty acids (Zeng and others 2012). However, in ourstudy, baby ginger was infected by Mortierella, rotting occurred,and the natural infection rate approached 70% in the in vivo test.This evidence demonstrated that Mortierella is pathogenic to babyginger.Cinnamon oil has been shown to have good inhibitory ef-

fect on Penicillium, Mucor dimorphosporus (Zygomycetes), Rhizopussp.(Zygomycetes), and Fusarium moniliforme (Matan and others 2006,2011). These reports are in agreement with our finding that cin-namon oil could cause complete inhibition of the 3 pathogensidentified. Thyme oil can totally inhibit Penicillium and Fusarium(Kumar and others 2008; Perez-Alfonso and others 2012). Ourresults for tea tree and lemongrass oil on Penicillium and Fusar-ium are not inconsistent with findings reported by Hammer andothers (2003) and Velluti (2004). Contradictory findings may bebecause of the different pathogens and the concentrations of oilsused. Clove and basil oils were not chosen for further experimentsbecause we did not observe significant effects of these oils onMortierella.TheMIC test was performed to choose the most efficient essen-

tial oil. Ten different essential oils were used in the tests described

here of which cinnamon oil as a fungicide was most efficient(MIC < 62.5 ppm). In fungal cultures treated with cinnamon oilat MIC, growth could have resumed if the cultures were transferredto growth favorable conditions.The MFC was different from the MIC. MFC was the concen-

tration of essential oil at which absolute and irreversible death ofpathogens occurred. The MFC test was performed to determinethe concentration of essential oil to be used in the in vivo testor for actual storage. The cost of fumigation was 4 cents per kgwhen fumigant concentration was 500 ppm (MFC 500 ppm).There may be other essential oils that have good antifungal effecton these pathogens.

In vivo studies on cinnamon oil confirmed its potential as aneffective antifungal agent against various pathogens. Our resultsdemonstrate that cinnamon oil significantly reduced decay inunwounded baby ginger. However, it could not completely in-hibit pathogens even at 500 ppm concentration. This is in accordwith early research by Farbood and others (1976) who suggestedthat higher concentrations of plant essential oils are required infoods than in laboratory media. The duration of fumigation andconcentration of oil are also important reasons for incomplete inhi-bition. Browning occurs when the concentration and processingtime are inappropriate. In recent years, numerous reports have

Figure 4Changes in cell wall morphologyinduced by fumigation treatments. Bar = 1m. The figures (A) to (C), (D) to (F), and (G)to (I) are transmission electron microscopyimages of treated mycelia of Penicillium sp.,Fusarium sp., andMortierella sp. respectively.(A), (D), and (G) TEM of untreated mycelia ofthe 3 fungal genera showing the relativelysmooth contour and uniform thickness of theouter cell wall. (B) and (E) Swollen cell wallswith irregular thickness. (C) and (F)Plasmolysis and leakage of cytoplasm aftercell wall ruptured. (H) The beginning ofdisorganization in cytoplasm. (I) Destructionof endomembrane.

M598 Journal of Food Science Vol. 79, Nr. 4, 2014

M:Fo

odMi

crobio

logy

&Sa

fety

Storage of baby ginger . . .

described the antimicrobial activities of essential oils, but very fewhave mentioned their damaging effects on fruits and vegetables.Moreover, essential oils have been historically used as herbicides.Some essential oils have shown cytotoxicity to maize and corn (Leeand others 1997; Ibrahim and others 2001). In addition, the tenderskin, unavoidable mechanical damage, and high polyphenol con-tent could be important reasons for browning. The mechanismsof browning are thus unclear, and further research is warranted onthe antifungal effects and cytotoxicity of constituents of cinnamonoil. In this study, we did not test whether cinnamon oil fumiga-tion affects the sensory characteristics of ginger. Detailed sensoryevaluation will need to be performed to confirm that cinnamonoil does not adversely affect the sensory characteristics of gingerduring storage.TEM revealed blurring of intracellular structures with swollen

and broken cell walls; this could be because essential oils can alterthe permeability and fluidity of biological membranes (Armstrong2006). We thought that all of the symptoms caused by the essentialoil began with membrane damage. However, molecular studiessuggest that essential oil can modulate gene expression. Terpinene,the active constituent of cinnamon oil, has been shown to affectthe expression of genes involved in lipid metabolism, maintenanceof cell wall structure and function, detoxification, and cellulartransport (Parveen and others 2004). Damage to the cell walland membrane can lead to leakage of macromolecules and lysis(Lambert and others 2001; Oussalah and others 2006), consistentwith the results obtained for Penicillium and Fusarium. However,the cell walls and membranes of Mortierella appeared normal. Lowconcentrations of cinnamon oil inhibited the growth of Mortierella,but did not kill it. This indicates that Mortierella is sensitive tocinnamon oil, but probably has protective mechanisms that aredifferent from those of Penicillium and Fusarium. Some Mortierellaspp. can produce unsaturated fatty acids; thus, species belonging tothis genus may have higher levels of unsaturated fatty acids on theircell membranes. Further research is needed to reveal whether thecomposition of membrane lipids in pathogens is related to toxinresistance.

ConclusionsWe identified optimal storage media for baby ginger that could

maintain the rhizomes with relatively small variations in firmnessand weight at 12 C. This method can be employed for storage offresh fruits and vegetables with high MC and tender skin. New,environmentally benign, light granular materials that can replacesand in the storage medium and be used for transportation needto be identified.Cinnamon oil seems to be a promising potential fumigant;

however, very long processing times and high oil concentra-tions will cause damage to ginger. Detailed sensory evaluationwill be required to study the effect of fumigation on sensorycharacteristics of baby ginger. We prolonged the storage time to30 d; this period of storage could be extended in future studies.We are currently investigating the effects of variation in nutri-ent composition and aromatic components. A proper methodfor preventing baby ginger from browning also needs to beidentified.

AcknowledgmentsThe research was supported by Foundation for the Author of

Doctoral Dissertation of Sichuan Agriculture Univ.

Author ContributionsJi Liu designed the study, drafted themanuscript, and interpreted

the results. Guoliang Sui, Yongzhou He, Jing Yan, Shuxiang Liu,and Dongjie Liu collected test data.

ReferencesAlbuquerque CC, Camara TR, Willadino RDR, Marcelino LC, Ulisses C. 2006. Antimicrobial

action of the essential oil of Lippia gracilis Schauer. Braz Arch Biol Technol 49:52735.Armstrong JS. 2006. Mitochondrial membrane permeabilization: the sine qua non for cell death.

BioEssays 28:25360.Bakass M, Mokhlisse A, Lallemant M. 2001. Absorption and desorption of liquid water by a

superabsorbent polymer: effect of polymer in the drying of the soil and the quality of certainplants. J Appl Polym Sci 83:23443.

Bakkali F, Averbeck S, Averbeck D, Idaomar M. 2008. Biological effects of essential oilsareview. Food Chem Toxicol 46:44675.

Bargues MD, Mas-Coma S. 1997. Phylogenetic analysis of lymnaeid snails based on 18S rDNAsequences. Mol Biol Evol 14:56977.

Burt S. 2004. Essential oils: their antibacterial properties and potential applications in foodsareview. Intl J Food Microbiol 94:22353.

Carman T. 2011. Growing baby ginger: farmers find its worth the fuss.The Washington Post. Available from: . Accessed 2011 October 18.

Farbood ML, MacNeil JH, Ostovar K. 1976. Effect of rosemary spice extract on growth ofmicroorganisms in meats. J Milk Food Technol 39:6759.

Fatima NF, Batool H, Sultana V, Ara J, Ehteshamul S. 2009. Prevalence of post-harvest rot ofvegetables and fruits in Karachi, Pakistan. Pak J Bot 41:318590.

Hammer KA, Carson CF, Riley TV. 2003. Antifungal activity of the components of Melaleucaalternifolia (tea tree) oil. J Appl Microbiol 95:85360.

Ibrahim MA, Kainulainen P, Aflatyni A. 2001. Insecticidal, repellent, antimicrobial activity andphytotoxicity of essential oils: with special reference to limonene and its suitability for controlof insect pests. Agric Food Sci 10:24359.

Kumar A, Shukla R, Singh P, Prasad CS, Dubey NK. 2008. Assessment of Thymus vulgarisL. essential oil as a safe botanical preservative against postharvest fungal infestation of foodcommodities. Innov Food Sci Emerg 9:57580.

Lambert RJW, Skandamis PN, Coote P, Nychas GJE. 2001. A study of the minimum inhibitoryconcentration and mode of action of oregano essential oil, thymol and carvacrol. J ApplMicrobiol 91:45362.

Lee S, Tsao R, Peterson C, Coats JR. 1997. Insecticidal activity of monoterpenoids to westernCorn rootworm (Coleoptera: Chrysomelidae), Twospotted Spider Mite (Acari: Tetranychi-dae), and House Fly (Diptera: Muscidae). Entomol Soc Am 90:88392.

Medina MS, Tudela JA, Marn A, Allende A, Gil, MI. 2012. Short postharvest storage under lowrelative humidity improves quality and shelf life of minimally processed baby spinach (Spinaciaoleracea L.). Postharvest Biol Technol 67:19.

Matan N, Rimkeeree H, Mawson AJ, Chompreeda PH, Aruthaithanasan V, Parker M. 2006.Antimicrobial activity of cinnamon and clove oils under modified atmosphere conditions. IntlJ Food Microbiol 107:1805.

Matan N, Saengkrajanga W, Matanb N. 2011. Antifungal activities of essential oils applied bydip-treatment on areca palm (Areca catechu) leaf sheath and persistence of their potency uponstorage. Intl Biodeter Biodegr 65:2126.

Oussalah M, Caillet S, Lacroix M. 2006. Mechanism of action of Spanish oregano, Chinesecinnamon, and savory essential oils against cell membranes and walls of Escherichia coli O157:H7and Listeria monocytogenes. J Food Prot 5:10461055.

Overy DP, Frisvad JC. 2005. Mycotoxin production and postharvest storage rot of ginger(Zingiber officinale) by penicillium brevicompactum. Intl Assoc Food Protection 68:6079.

Park MJ, Gwak KS, Yang I, Choi WS, Jo HJ, Chang JW, Jeung EB, Choi IG. 2007. Antifungalactivities of the essential oils in Syzygium aromaticum (L.) Merr. Et Perry and Leptospermumpetersonii Bailey and their constituents against various dermatophytes. Microbiol Soc Korea45:4605.

Parveen M, Hasan MK, Takahash J, Murata Y, Kitagawa E, Kodama O, Iwahashi H. 2004.Response of Saccharomyces cerevisiae to a monoterpene: evaluation of antifungal potential byDNA microarray analysis. J Antimicrob Chemother 54:4655.

Perez-Alfonso CO, Martnez-Romero D, Zapata PJ, Serrano M, Valero D, Castillo S. 2012.The effects of essential oils carvacrol and thymol on growth of Penicillium digitatum and P.italicum involved in lemon decay. Intl J Food Microbiol 158:1016.

Policegoudra RS, Aradhya SM. 2007. Biochemical changes and antioxidant activity of mangoginger (Curcuma amada Roxb.) rhizomes during postharvest storage at different temperatures.Postharvest Biol Technol 46:18994.

Singh G, Maurya S, De Lampasona MP, Catalan C. 2005. Chemical constituents, antimicrobialinvestigations, and antioxidative potentials of Anethum graveolens L. essential oil and acetoneextract. J Food Sci 70:20815.

Stirling AM. 2002. Erwinia chrysanthemi, the cause of soft rot in ginger (Zingiber officinale) inAustralia. Australas Plant Path 31:41920.

Stirling AM. 2004. The causes of poor establishment of ginger (Zingiber officinale) in Queensland,Australia. Australas Plant Path 33:20310.

Velluti A, Sanchis V, Ramos AJ. 2004. Effect of essential oils of cinnamon, clove, lemon grass,oregano and palmarosa on growth of and fumonisin B1 production by Fusarium verticillioidesin maize. J Sci Food Agric 84:11416.

Vero S, Mondino P, Burgueno J, Soubes M,Wisniewski M. 2002. Characterization of biocontrolactivity of two yeast strains from Uruguay blue mould of apple. Postharvest Biol Technol26:919.

Zeng Y, Ji XJ, Chang SM, Nie ZK, Huang H. 2012. Improving arachidonic acid accumulation inMortierella alpina through B-group vitamin addition. Bioprocess Biosystems Engr 35:6838.

Zhao K, Ping W, Li Q, Hao S, Zhao L, Gao T, Zhou D. 2009. Aspergillus niger var. taxi, anew species variant of taxol-producing fungus isolated from Taxus cuspidata in China. J ApplMicrobiol 107:12027.

Vol. 79, Nr. 4, 2014 Journal of Food Science M599