THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 264, No. 35, Issue of December 15. pp. 21031-21037,1989 0 1989 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U. S A .

Purification of a DNA Replication Terminus ( ter) Site-binding Protein in Escherichia coli and Identification of the Structural Gene*

(Received for publication, July 19, 1989)

Masumi HidakaS, Takehiko KobayashiS, Shigeori TakenakaB, Hiroyuki Takeyaq, and Takashi HoriuchiS(1 From the $Department of Molecular Biology, Graduate School of Medical Science, the $Department of Organic Synthesis, Faculty of Engineering, and the TDepartment of Biology, Faculty of Science, Kyushu University, Fukuoka 812, Japan

In Escherichia coli cells, there is a protein that spe- cifically binds to DNA replication terminus (ter) sites on the host and plasmid genome and then blocks pro- gress of the DNA replication fork. We reported that extract of the cells carrying the plasmid with the tau gene, which was identified to be an essential gene for the termination reaction at the ter site, contained about an 8-fold increase in ter-binding activity of the plas- mid-free cells. With improvement of the promoter re- gion of the tau gene on the plasmid by site-directed mutagenesis, the host cells produced the ter-binding protein (Ter protein) over 2000-fold. Using these over- producing cells as the enzyme source, the Ter protein was purified to apparent homogeneity. Molecular mass 36,000, amino-terminal amino acid sequence (45 resi- dues) and composition of the protein were in good agreement with those deduced from DNA sequence of the tau gene. Footprinting using the purified Ter pro- tein revealed a specific binding to the ter sequence.

A DNA replication terminus (ter) site on replicons is the position at which progress of the DNA replication fork is either arrested or is severely impeded. The ter sites required for termination of DNA replication are present on the plasmid R6K genome and also on the bacterial chromosome of Esch- erichia coli and Bacillus subtilis (Lovett et al., 1975; Crosa et al., 1976; Weiss and Wake, 1983; Iismaa et al., 1984; Monteiro et al., 1984; Kuempel et al., 1977; Louarn et al., 1979). Similar sites have been found in yeast and plant cells (Brewer and Fangman, 1988; Hernandez et al., 1988). Thus, the ter site may play an important physiological role(s).

To block the progress of the DNA replication fork, two factors are required, one of which is the ter sequence on the DNA molecule. Properties of the ter site present in the E. coli system are as follows. (i) All ter sequences are essentially the same, and their consensus 22-bp‘ sequence is 5’-(A/T)(G/

* This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Science, and Culture, Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequencefs) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number($ J05139.

I( TO whom correspondence should be sent: Dept. of Molecular Biology, Graduate School of Medical Science, Kyushu University, Maidashi, Fukuoka 812, Japan. Tel.: 092-641-1151 (ext. 3477); Fax:

’ The abbreviations used are: bp, base pair(s); SDS, sodium dodecyl 092-631-2794.

sulfate.

T)TAGTTACAACAPy(A/T/C)C(A/T)(A/T)(A/T)(A/T)(A/ T)(A/T)-3’. The sequence was represented by ( ) (Hori- uchi and Hidaka, 1988; Hidaka et al., 1988; Hill et al., 1988b). (ii) The sequence has activity that inhibits travel of the replication fork in a specific direction (Horiuchi and Hidaka, 1988; Hidaka et al., 1988; Hill et ai., 1988b). In the above orientation, only the fork, traveling from right but not left, is inhibited. (iii) A pair of the two ter sites is arranged in an inverted position. In the R6K plasmid, a pair of two terR sites (terR1 and terR2) is arranged in an inverted position ( ”++) 73 bp apart (Horiuchi and Hidaka, 1988; Hill et al., 1988b); in the E. coli chromosome, four terC sites (terC1,2,3, and 4 ) are located at the opposite region of the unique replication origin (oriC) and are arranged as (”++I-) 275 kilobases apart between the nearest pair of the terC sites (Hidaka et al., 1988). (iv) When the terC site is cloned into the ColEl derivative vector in the orientation in which the unidirectional replication fork starting from vector’s origin is blocked at the terC site, presence of the site reduces the copy number of the hybrid plasmid because the site prevents the plasmid from completing DNA replication (Hidaka et al., 1988).

The ter-binding protein (Ter protein) is another factor essential for termination reaction. The ter-binding activity of the protein is controlled by a gene that we named tau (Ko- bayashi et al., 1989) or tus by Hill et al. (1988a, 1989); in cells carrying the plasmid on which the tau gene was located, the ter-binding activity was enhanced about 8-fold compared with the plasmid-free cells. On the other hand, in the tau-defective cells, which showed the termination-less phenotype, no ter- binding activity was evident, thereby suggesting that tau might be the structural gene for the Ter protein.

Hill et al. (1989) determined the nucleotide sequence of the tus gene, the expected molecular mass of the product of which was about 36 kDa. Complementarily, Sista et al. (1989) puri- fied ter-binding protein, the molecular mass of which was somewhat less than 40 kDa. From footprint experiments, they determined the sequence of the ter site covered by the protein. Although these data suggested that tau (tus) might be the structural gene for the Ter protein, conclusive evidence was not obtained.

We report here the Ter protein-overproducing system, pu- rification of the Ter protein, and identification of the struc- tural gene (tau) for the protein. We confirmed in DNase I footprinting experiments that the Ter protein does specifi- cally bind to the ter sequence.

MATERIALS AND METHODS

Procedures-Restriction endonucleases, T4 ligase, T4 polynucleo- tide kinase, and DNA polymerase large fragment (Klenow) were purchased from Takara Shuzo Co., Ltd. (Kyoto, Japan). DNA ligation

21031

21032 DNA Replication Terminus Site-binding Protein in E. coli was done according to procedures outlined by the manufacturer. The composition of media used was as described (Miller, 1972). Synthesis of oligonucleotides was as described (Hidaka et al., 1988).

Bacterial Strains, Plasmids, and Phages-E. coli strains JM83 ara, A(luc-proA), rspL (=strA), &3O(lacZAM13) (Vieira and Messing, 1982) and JM109 recAI, endA1, gyrA96, thi, hsdR17, supE44, relA1, A(1ac-proAB)/F' traD36, proAB, lacIqZAM13 (Yanish-Perron et al., 1985) used for host for plasmid and phage were taken from our laboratory stock. Plasmid pUC9 (Vieira and Messing, 1982) and phage Ml3mplO (Messing, 1983) used were also from our laboratory stock. pUC9-carrying AluI-HaeIII fragment (plasmid 134), on which a plas- mid R6K terminus site, terR1, was located, were as described (Hori- uchi and Hidaka, 1988).

DNA Preparation-Plasmid and M13 replicative form DNA were isolated by the alkaline lysis procedure of Ish-Horowicz and Burke (1981). Some plasmid DNA were purified by equilibrium banding in CsCl gradients in the presence of ethidium bromide. Cells were transformed by the method of Kushner (1978). DNA fragments used for gel retardation assay were purified electrophoretically on acryl- amide gels. The appropriate fragment was cut from the gel with ethidium bromide and obtained by the method using DEAE-paper from the gel (Dretzen et al., 1981). Single-stranded M13 templates were prepared by the procedure of Nakamaye and Eckstein (1986).

Gel Retardation Assay-Procedures used were essentially the same as described by Wang et al. (1987) and by our group (Kobayashi et al., 1989). As the DNA substrate for the assay, we used the 141-base pair AluI-HaeIII fragment, on which was located one of a pair of two terminus sites, terRl. The fragment was end-labeled with T4 poly- nucleotide kinase according to in Maniatis et al. (1982).

Construction of Ter Protein-overproducing Plasmid-pUC9-5.0(-) was the parental plasmid used (Hidaka et al., 1988). The plasmid is a pUC9 derivative in the EcoRI site of which the 5.0-kilobase EcoRI fragment carrying terC2 site and the tau gene was inserted. A 2.7- kilobase HindIII-EcoRI subfragment of the 5.0-kilobase fragment was recloned into M13mplO replicative form DNA, and the recombinant phage was used for the oligonucleotide-directed in vitro mutagenesis system (version), supplied by Amersham International plc. The mu- tagenesis procedures are based on the method of Eckstein and co- workers (Sayers et al., 1988). For first and second mutagenesis, the oligonucleotides 5'-AAATAAGTATGTT@TAACTAAA-3'(22 mer) and 5'-TAACTAAAC@GGTTAATATT-3' (20-mer) were used, re- spectively. The nucleotide circled indicates each mutation point. Identification of the mutant progeny was screened in hybridization experiments with the mutant oligonucleotide, the procedures of which were according to the method given by the supplier. Introduction of the first mutation was confirmed by DNA sequencing of the target site and surrounding areas. The replicative form DNA of the two mutant progeny phages was prepared, digested with Hind111 and EcoRI, and recloned into the corresponding site of the pUC9 vector. The resulting two plasmids carrying single and double mutations (pKHG300) were used as the Ter protein overproducers.

Overproduction and Purification of Ter Protein-The Ter protein overproducer plasmid, pKHG300, was introduced into the JM83 host strain, and an ampicillin-resistant transformant was isolated. The method used for cell lysate preparation was essentially the same as described in Wickner et al. (1974). A fresh colony of the strain was inoculated into 50 ml of LB-ampicillin broth and shaken slowly at 30 "C to reach an optical density of about 0.7 at 660 nm. The cells were collected at low speed centrifugation at 5,000 rpm for 10 min, resuspended in 0.1 ml of Buffer B (50 mM Tris-HC1 (pH 7.51, 10% sucrose (total = 380 pl)), placed in liquid nitrogen, and kept in a -80 "C deep freezer. The cells were thawed in an ice bath to which 12 pl of Buffer B containing 4 mg/ml lysozyme and then 6 pl of 5 M NaCl were added. The mixture was left to stand for 30 min in the ice bath, for 90 s at 37 "C, and then centrifuged at 4 "C at 15,000 rpm. The supernatant (fraction I, 150 pl) was transferred to a different microcentrifuge tube, the volume adjusted to 500 pl with Buffer B, and ammonium sulfate powder was added to reach a concentration that would achieve a 50% saturation. After standing in an ice bath for 1 h, the centrifuged and precipitated fractions were dissolved in 500 pl of Buffer A (50 mM Tris-HC1 (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol, 20% glycerol) and dialyzed overnight at 4 "C with Buffer A containing 20 mM NaCl (fraction 11, 530 PI). Fraction 11 (500 p l ) was applied to a DEAE-Sephacel (Pharmacia LKB Biotech- nology Inc.) column (1 ml), and the flow-through fraction at 0.1 M NaCl (fraction 111, 3 ml) was directly applied to a heparin-Sepharose CL-GB column (1 ml) (Pharmacia). The column was then washed with 4.5 column volumes of Buffer A containing 0.3 M NaCl and

eluted sequentially with Buffer A containing 0.4, 0.5, 0.6, and 1.0 NaCI. Ter protein was eluted at 0.5-0.6 M NaCl (fraction IV, 3 ml).

Protein Concentration Determination-Protein concentration was determined using a BCA protein assay (Pierce) according to the method of Smith et al. (1985). Bovine serum albumin was used as the standard. Standards were prepared with the same concentration of enzyme buffer ingredients present in the sample.

DNA Sequence Analysis-DNA sequences were carried out on a single-stranded M13 using the dideoxy chain termination method (Sanger et al., 1977). DNA sequence kits were obtained from United States Biochemical Corp. Appropriate 20-mer synthetic oligonucleo- tides were synthesized as additional primers for further sequencing along the same template.

DNase I Footprinting Assay-The assay was performed according to the method of Galas and Schmitz (1978). The reaction mixture (100 pl) contained 10 pl of 10 X reaction buffer (100 mM Tris-HC1 (pH 7.5), 500 mM NaCI, 10 mM dithiothreitol, 5 mM EDTA, 25 mM MgCIZ, 50% glycerol); 2 p l of 32P end-labeled Ah1 (216-base pair) DNA fragment (-5.3 ng; 38 fmol); 10 pl (0-32 pmol) of Ter protein solution in dilution buffer (10 mM Tris-HC1 (pH 7.5), 50 mM NaCI, 1 mM dithiothreitol, 1 mM EDTA, 5% glycerol); 78 pl of distilled water was incubated a t 25 "C for 30 min. Two pl of lo-' diluted solution (5 mM CaClz, 10 mM MgCl,) of DNase I (1 mg/ml in 0.15 M NaC1, 50% glycerol, 1950 units/ml; Sigma type 11) was then added, a partial digestion of the DNA fragment was carried out at 25 "C for 5 min, and the action was terminated by adding 25 pl of stop solution (1.5 M sodium acetate (pH 5.2), 20 mM EDTA, 100 pg/ml sonicated calf thymus DNA). One hundred pl of phenol saturated with 100 mM Tris-HC1 (pH 8.0) was added, Vortex mixed for 30 s, then centrifuged for 5 min at 15,000 rpm. To the aqueous phase thus obtained we added 300 p1 of ethanol, left the preparation to stand at -70 "C for 30 min, and the pellet was collected by centrifugation for 30 min at 15,000 rpm at 4 "C and then dissolved with 100 p1 of 0.3 M sodium acetate. After adding 250 p1 of ethanol, the precipitation was repeated, the pellet was washed once with 200 p1 of 70% ethanol and dried. Four pl of loading buffer (80% (v/v) deionized formamide, 50 mM Tris-HC1 (pH 8.3), 0.1% (w/v) xylene cyanol, 0.1% (w/v) bromphenol blue, 1 mM EDTA) was added, 2 pl of the sample was applied to a polyacrylamide sequence gel and electrophoresed. As control samples, the same DNA fragment was used for base-specific cleavage reactions, as described by Maxam and Gilbert (19801, and electrophoresed. The gel was then dried and exposed to x-ray film (Kodak, X-Omat).

Amino Acid and Amino-terminal Sequence Analysis-Samples were hydrolyzed in tubes sealed under reduced pressure with 5.7 M HCI for 24,48, and 72 h at 110 "C and with 3 M mercaptoethanesulfonic acid for 24 h at 110 "C. After evaporation, the hydrolysates were analyzed on a Hitachi model L8500 high speed amino acid analyzer (Spackman et al., 1958). Half-cystine was determined as cysteic acid after per- formic acid oxidation. Amino acid sequences were determined using an Applied Biosystems 47719 gas-phase sequenator.

RESULTS

Nucleotide Sequence of the tau Gene-We had already iden- tified the tau gene, defective mutants of which showed ter- mination-less phenotype (Kobayashi et ai., 1989). This gene was located on a 2.7-kilobase HindIII-EcoRI fragment situ- ated at 35.5 min of the standard E. coli map (Bachmann, 1972; Kohara et al., 1987). Within or near the end of the tau gene was the terC2 site, one of the four DNA replication terminus (terC) sites on E. coli genome (Hidaka et al., 1988; Hill et ai., 198813). The tau gene was localized within the 0.75- 1.0-kilobase region from the terC2 site by insertional muta- genesis. The 2.7-kilobase HindIII-EcoRI fragment and its subfragment were cloned into the M13 family of vectors. Subsequent dideoxy sequencing of these clones revealed a single unique open reading frame in the region predicted to contain the tau gene, as shown in Fig. 1. In the promoter region of the gene, -35, -10, and ribosome-binding (Shine- Dalgarno) sequences were also present (Rosenberg and Court, 1979). Interestingly, the -10 region and ribosome-binding site overlapped with the terC2 sequence. The molecular weight of the open reading frame product was about 35,700. The se- quence of the gene is exactly the same as that of the tus gene

DNA Replication Terminus Site-binding Protein in E. coli 21033

(a) ~ " " - + ~ = " - - ~ "--+

4 " ~ ~ ~ ~ ~ ~ ~

5' , v l " tau gene I I , 3' I

Hindlll Bgll B g l l PUVll Puvll EcoRl

r I 1 0 1000 2000 bp

FIG. 1. Restriction map, sequenc- ing strategy, and nucleotide and amino acid sequence of the tau gene.

sites for EcoRI, HindIII, PuuII, and BglI. a, restriction map shows only relevant

Ready-made oligonucleotides or syn- thetic oligonucleotides with the sequence at start site of the arrows shown were used as was the dideoxynucleotide chain- terminator method (Sanger et al., 1977). b, the underlined amino acids (without m e t ) represent the amino-terminal se- quence determined for the purified 36- kDa protein, -35, -10, and ribosomal- binding (Shine-Dalgarno) sites are underlined. The terC2 sequence is rep- resented by bold letters. Two mutation changes, which convert the original tau plasmid to the Ter-overproducing plas- mid, are shown.

5.- TGGCATAACATCCCGCAATTTACCTCTGCCTGACACTACGC

GCACGA-GTCACCACGACTGTGCTA-GTATGTTGTUCT-TMTATT T A Bgl 1

ATG GCG CGT TAC GAT CTC GTA GAC CGA CTC AAC ACT ACC TTT CGC CAG ATG

GAA CAA GAG CTG GCT ATA TTT GCC GCT CAT CTT GAG CAA CAC AAG CTA TTG GTT l e u a-hfs -S Ipk! k&

GCC CGC GTG TTC TCT TTG CCG GAG GTA AAA AAA GAG GAT GAG CAT AAT CCG CTT v a l whe ser o l u v a l l y s l y s - g l u a s p g l u h is a s n p r o l e u

AAT CGT ATT GAG GTA AAA CAA CAT CTC GGC AAC GAC GCG CAG TCG CTG GCG TTG

CGT CAT TTC CGC CAT TTA TTT ATT CAA CAA CAG TCC GAA AAT CGC AGC AGC AAG a s n a r g i l e g l u v a l l y s g l n h is l e u g l y a s n a s p a l a g l n ser l e u a l a l e u

a r g h i s p h e a r g h i s l e u p h e i l e g l n g l n g l n ser g l u a s n a r g s e r ser l y s GCC GCT GTC CGT CTG CCT GGC GTG TTG TGT TAC CAG GTC GAT AAC CTT TCG CAA

GCA GCG TTG GTC AGT CAT ATT CAG CAC ATC AAT AAA CTC AAG ACC ACG TTC GAG a l a a l a v a l a r g l e u p r o g l y v a l l e u c y s tyr g l n v a l a s p a s n l e u s e r g 1 n

a l a a l a l e u v a l ser h i s i l e g l n h i s i l e a s n l y s l e u l y s t h r t h r p h e g l u CAT ATC GTC ACG GTT GAA TCA GAA CTC CCC ACC GCG GCA CGT TTT GAA TGG GTG

CAT CGT CAT TTG CCG GGG CTG ATC ACC CTT AAT GCT TAC CGC ACG CTC ACC GTT h i s i l e v a l t h r v a l g l u ser g l u l e u p r o t h r a l a a l a a r g p h e g l u t r p v a l

CTG CAC GAC CCC GCC ACT TTA CGC TTT GGT TGG GCT AAT AAA CAT ATC ATT AAG h i s a r g h i s l e u p r o g l y l e u ile t h r l e u a s n a l a t y r a r g t h r l e u t h r v a l

l e u h i s a s p p r o a l a t h r l e u a r g p h e g l y t r p a l a a s n l y s h i s i l e i l e lys AAT TTA CAT CGT GAT GAR GTC CTG GCA CAG CTG GAA AAA AGC CTG AAA TCA CCA

CGC AGT GTC GCA CCG TGG ACG CGC GAG GAG TGG CAA AGA AAA CTG GAG CGA GAG a s n l e u h i s a r g a s p g l u v a l l e u a l a g l n l e u g l u lys ser l e u l y s s e r p r o

a r g ser v a l a l a pro t r p t h r a r g g l u g l u t r p g l n a r g l y s l e u g l u a r g g l u TAT CAG GAT ATC GCT GCC CTG CCA CAG AAC GCG AAG TTA AAA ATC AAA CGT CCG t y r g l n a s p l l e a l a a l a l e u pro g l n a s n a l a l y s l e u l y s l l e l y s a r g p r o GTG AAG GTG CAG CCG ATT GCC CGC GTC TGG TAC AAA GGA GAT CAA AAA CAA GTC v a l l y s v a l g l n p r o i l e a l a a r g v a l t r p t y r l y s g l y a s p g l n l y s g l n v a l

g l n h i s a l a c y s p r o t h r p r o l e u i l e a l a l e u i l e a s n a r g a s p a s n g l y a l a GGC GTG CCG GAC GTT GGT GAG TTG TTA AAT TAC GAT GCC GAC AAT GTG CAG CAC

CGT TAT AAA CCT CAG GCG CAG CCG CTT CGT TTG ATC ATT CCA CGG CTG CAC CTG g l y v a l p r o a s p v a l g l y g l u l e u l e u a s n t y r a s p a l a a s p a s n v a l g l n h i s

a r g t y r l y s p r o g l n a l a g l n pro l e u a r g l e u i l e i l e p r o a r g l e u h i s l e u TAT GTT GCA GAT

-35 -10 SD

f m e t nLa ,-ru tJrrasp la v a l a s p a r o l e u a s n t h r thr

CAA CAC GCC TGC CCT ACA CCA CTG ATT GCA CTG ATT AAT CGG GAT AAT GGC GCG

41

108

159

213

267

321

375

429

483

537

591

645

699

753

807

861

915

969

1023

1038 t y r v a l a l a a s p o c h r e CGCCCGGCTTTCATACTGCCGACCATCTGTTCTGGCCGTACCCAGCTGTCAAACTCGGCTTCGCTAAGATAC 1110 CCCAGCGCAAGGGCCGCAGCTTTTAAGGTCAGCCCTTCTTTATGCGCTTTTTTGGCGATCTCGGCGGCTTTG 1182

C G A T T C G G T T C A A T A C C C A C T G C G C A G T G T T T G T T R A R A C T 1326 TCATAACCAATGTGGGTGTTAAGCGCAGTCACCAGCATCAGCGATTCATTGAGTAATTGATTGATTCGCTCA 1254

TGCAGGAAATTGTGGATCACCATTGGACGGAAGACGTTCAGTTCAAAGTTACCGGAAGCGCCCCCCATGTTG 1398 ATCGCCACGTCGTTCCCCATCACCTGACAGCAGAGCATGGTTAATGCCTCACACTGTGTTGGGTTCACTTTC 1470 CCCGGCATGATTGAGCTGCCCGGCTCATTTTCCGGGATTGAGATTTCACCAATTCGCAGCGCGGCCAGAGGC 1542 CAGCCAGCGGACATCATTGGCGATTTTCATCAGTGACGCAGCCAACCCTTTCAACCGCCGTGCGCCTGAACC 1614 AGGGCATCACAGGTCGCCAGCGCTTCF~TTTGTTCGGCGCGGT~CAAACGGTGCACAGGTAATGACTGCC 1686 AGTTCATCTGCTACGCGACGCGCATACTCCGGATGGGTATTTAGTCCAGTACCCACCGCTGTACCGCCAAGA 1758 GCCAGTTCCGCTACGTGAGGCAGGCTGTATTCGATATGTTTGAGATTATGCTCGAGCATCGCTACCCAGCCG 1830 GAARTCTCCTGCCCCAGCGTTAACGTGGCATCCTGGCATCCTGCAAGTGAGTACGACCAATTTTGACGATATCGCAA 1902 AAGCACGGGATTTCTCATTCAGTGTCTGTGTCAGGGTTTTAAGCTGAGGAATGAGTTGCTTGCGCAGCGCCA 1974 GCAGCGCCGCAACGAGCATCGCCGTCGGAAAGACATCGTTGGAACTTTGGCTTTTGTTCACGTCGTCGTTAG 2046 GTGAACTTTACGTTCCATCCCGCGCACACCGCC-3' 2079

reported by Hill et al. (1989) although there are differences in the region downstream of the tau gene.

Overproduction of the Ter Protein-We observed that crude extracts of cells with the plasmid-carrying tau gene had about an 8-fold higher ter-binding activity than that seen in the plasmid-free cells (Kobayashi et al., 1989). To overproduce the protein, we introduced two mutations in vitro at the promoter site of the tau gene on the plasmid, as shown in Fig. 2. The first mutation was introduced within the terC2 se- quence. A low copy number of the pUC9-terC2 plasmid (a common property found in all Ter-active pUC-terC plasmids) reached a normal level (data not shown). The second mutation was made within the ribosome-binding sequence. Resulting plasmids were introduced into the JM83 host, and binding activity of the crude extract was measured. A plasmid with single and double mutations enables host cells to overproduce

500 and over 2000-fold the ter-binding activity of the plasmid- free control strain, respectively (data not shown). These re- sults suggest that the terC2 area might be an operator site, at which Ter protein binds tightly and inhibits the expression of the tau gene as well as progress in the DNA replication fork; that is to say, the tau gene may be autoregulated. Using the overproducer strain as the enzyme source, we purified the Ter protein.

Purification of Ter Protein-In the overproducing cells, a unique protein with a molecular mass of 36 kDa was overpro- duced (Fig. 3). Densitometric scanning of the gel led to an estimation of about 14% of the total protein. The correspond- ing protein band was not present in the sample of cells carrying only the vector (data not shown). This estimated molecular mass is close to the 40 kDa already reported (Sista et al., 1989). We attempted to purify the Ter protein by

21034 DNA Replication Terminus Site-binding Protein in E. coli two site-directed mutations

A

FIG. 2. Schematic structure of the Ter protein-overproduc- ing plasmid (pKHC3OO). The 2.7-kilobase EcoRI-Hind111 DNA fragment, on which the tau gene and terC2 site were located, was cloned into a polylinker site of the pUC9 vector plasmid. T o overpro- duce Ter protein, two site-directed mutations, one within the terCZ sequence ( K ) and the other within the ribosomal-binding site of the tau gene, were introduced at the promoter site of the gene shown by the closed ellipse. Nucleotide changes of these mutations are shown in Fig. 1. This plasmid, named pKHG300, enabled the host cells to produce Ter protein over 2000-fold of the plasmid-free cells, even in the presence of higher amounts of lactose repressor. The long gray arrow indicates the coding region of the tau gene, and the short black arrow on the ori site represents direction of the replication fork beginning from the vector origin.

TABLE I Purification of Ter protein

PR units unit.s/p# I. Lysate supernatant 4912.5 145.5 X lo' 296.2 (1.0)

11. Ammonium sulfate 2033.6 142.0 X 10' 698.3 (2.4) 111. DEAE-Sephacel 708.0 50.4 X IO' 711.9 (2.4) IV. Heparin Sepharose 352.5 53.4 X lo' 1514.9 (5.1)

CI,-6R

FIG. 3. SDS-polyacrylamide gel electrophoresis of 36-kDa Ter protein at different stages. Fraction I , crude extract, 9.83 pg; /raction I I , ammonium sulfate precipitation, 3.85 pg;fraction III, after DEAE-Sephacel column chromatography, 1.42 pg; fraction IV , after heparin-Sepharose column chromatography, 0.82 pg; lane M, molec- ular standards (Pharmacia): phosphorylase b (94 kDa), albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (20 kDa), and n-lactalbumin (14 kDa).

following the 36-kDa protein band through SDS-polyacryl- amide gel electrophoresis analysis. Purification of the protein was attained by the procedures shown in Table I. The 36-kDa protein behaved as a basic protein; it did not bind to DEAE- Sephacel but did bind tightly to heparin-Sepharose, even in

Fraction Total Tots1 Specific Drotein activity activity

-

I I I I 1 I I I I I I I Frac. No. 27 30 35 38

Fraction M I I1 111 IV

(b) kD M 27 30

94.0 - - 67.0 - - 43.0 - -

""- 30.0 - - 20.1 - I

14.4 -

35 38

VYYY- - DNA-protein complex

- DNA substrate

FIG. 4. Co-purification of ter-binding activity with the 36- kDa Ter protein through gel filtration. Sample (200 pl) of fraction IV was dialyzed with buffer (50 mM Tris-HCI (pH 9.0), 1 mM dithiothreitol, 1 mM EDTA, 5% (v/v) glycerol, 300 mM NaCI) overnight, applied to Superose 12HR 10/30 (Pharmacia), and eluted with the same buffer. Absorbance a t 280 nm was measured with a UV detector, and a sample of the fraction (0.5 ml) was analyzed by SDS-polyacrylamide gel electrophoresis and gel retardation assay to measure the ter-binding activity. a, absorbance a t 280 nm; b, SDS- polyacrylamide gel electrophoresis analysis; c, ter-binding activity. DNA substrate and DNA-protein complex indicate the positions cor- responding to the substrate DNA fragment (141 base pairs) and DNA-protein complex, respectively.

the presence of 0.1 M NaCl. Here we defined 1 unit of the ter- binding activity as that which could shift half of the terR1- containing DNA substrate (9.6 fmol) added to the band po- sition corresponding to the DNA-protein complex, through the gel retardation assay, as shown in Fig. 4c. Using this enzyme unit, we determined the specific activity of the protein

DNA Replication Terminus Site-binding Protein in E. coli 21035

TABLE I 1 Amino acid composition of ter-binding protein

Amino acid composition predicted from

Amino acid Amino acid DNA

analysis" sequence

Ala 27.8 28 '4% 23.7 24 Asx 29.2 Asp Asn (I!, Glx 40.7 Glu Gln (14, GlY 8.5 8 His 15.6 17 Ile 15.3' 16 Leu 39.3 39

Met 1.2 1 Phe 8.5 8 Pro 16.2 17 Ser 11.Od 11 Thr l lAd 12 Trp 4.3 5 Ty r 7.9 8 Val 22.5' 23

No. of residues 308 Calculated mass 35,65 1

cys 1.8b 2

LYS 19.1 19

Average values obtained from 24-, 48-, and 72-h hydrolysis with

Determined as cysteic acid. Taken from 72-h values. Extrapolated values to zero time.

5.7 N HCI.

fraction obtained a t each stage of purification. Table I shows that the specific activity of ter-binding protein in the initial step was raised to 5-fold at the final step. This is near the expected level (7.14-fold). The 36-kDa protein in fraction IV, eluted from the heparin-Sepharose with 0.5-0.6 M NaCl, was further purified through gel filtration, and the ter-binding activities in each fraction were measured. As shown in Fig. 4, three different parameters (absorbance a t 280 nm, a protein band of 36-kDa, and ter-binding activity) completely matched. We concluded that the 36-kDa protein is a Ter protein.

The amino-terminal amino acid sequence was determined for the purified 36-kDa protein in step IV using automated Edman degradation. Amino-terminal 45 residues, albeit with the interruption of 3 unidentified amino acids (including m e t ) , is in perfect agreement with that deduced from the DNA sequence of the tau gene (Fig. 1). The amino acid composition (Table 11) as well as the total molecular mass further supported the conclusion that the open reading frame, that is tau gene, encodes the Ter protein with a molecular mass of 36 kDa.

DNA-binding Site of the Ter Protein-To determine the binding site of the Ter protein, a DNase I footprinting exper- iment using purified Ter protein was done. Terminus sites (terRI and terR2) of the plasmid R6K, essential for termi- nation reaction, were located on 216 bp of AluI fragment (Horiuchi et al., 1987; Horiuchi and Hidaka, 1988). One end, closer to the terR2 site of the fragment, was labeled with '"P, mixed with the Ter protein, and partial DNase I digestion followed by polyacrylamide gel electrophoresis was performed. Fig. 5 shows that the Ter protein binds to the two sites that correspond exactly to terR1 and terR2. Since the sequences are highly homologous and placed in an inverted arrangement, two regions covered by the protein can be regarded as regions

FIG. 5. DNase I footprinting experiment using purified Ter protein. AluI 216-base pair DNA fragment (38 fmol), one end (near terR2 site) of which was labeled with [y-"PIATP, was mixed with the purified Ter protein (fraction IV) and incubated and digested with DNase I, as described under "Materials and Methods." Samples were analyzed on a 6% (w/v) polyacrylamide sequence gel and exposed to x-ray film. Amounts of Ter protein used were: lane I , 0 pmol; lane 2, 0.32 pmol; lane 3, 1.06 pmol; lane 4, 3.17 pmol; lane 5, 9.50 pmol; lane 6, 31.7 pmol. Maxam-Gilbert sequencing reactions ( A / C and C / T) are shown in parallel lanes.

Rlul216 fragment

terR 1 terR2 - . .

, ..., ....., ..._.."' ......"

ICTAAATCAATGTTGTGTGTTCTCT] [ A G A T A A C T C A C A A C h T T G n T d p T C GAT~TAGTTACAACACACAAGAGA~ ~CTATTGAGTGTTGTAACTACTAG~

.....

FIG. 6. Ter protein-binding sites on the A h 1 216-base pair DNA fragment. Upper open bar indicates AluI 216-bp DNA frag- ment on which two terminus sites, terR1 and terR2, shown by ( K ) and ( Y ) , are located. The 24 base pairs of each terR sequence are expanded, nnd thc Ter protein-binding sitcs nrc cnclosed by the four boxes. Binding regions enclosed by the lower two boxes are deduced from the experiments of Fig. 5, and the upper ones are deduced from the structural homology. Two arrows represent inverted 20-base pair repeats, identical except for 2 base pairs.

21036 DNA Replication Terminus Site-binding Protein in E. coli

of both DNA strands of either of the terR sites covered by the protein as shown in Fig. 6. The terR site was first identified as the 2L"bp sequence required for the termination reaction in vivo and to which Ter protein binds.

DISCUSSION

We obtained convincing evidence that the tau gene encodes the ter-binding protein (Ter protein). This Ter protein rec- ognized and bound to all ter sites (at least two terR and four terC sites), and the resulting Ter protein-ter sequence complex can block the DNA replication fork on the DNA molecule.

The sequence analysis of the tau gene suggested that there might be a site (terC2) at the promoter region of its own gene, to which Ter protein binds tightly. Since Ter protein overpro- duction was attained by a mutational destruction of the termination activity of the terC2 sequence, it is most probable that Ter protein might be a repressor for expression of its own gene; that is to say the tau gene is under autoregulatory control. The terC2 and -10 sequence apparently overlap, as shown in Fig. 1, and the overlapped sequence is covered by the Ter protein (Fig. 6). Thus, the binding of Ter protein to the terC2 site prevents RNA polymerase from interacting with the promoter site. This possibility was suggested by Hill et al. (1989). This autoregulatory control might maintain constant the quantity of the Ter protein. If such is indeed the case, then the Ter protein is exceptional; the protein plays two roles at the same site, terC2, one is a replication blocker, and the other is the repressor for its own gene expression.

However, with regard to Ter protein overproduction by the mutant plasmid, another explanation would have to be con- sidered. As shown in Fig. 2, orientation of the replication fork starting from the pUC vector replication origin is that blocked by the terC2 site; the copy number of the parental plasmid is low. Mutational inactivation of the terC2 sequence resulted in reversion of its low copy number to normal level.' Further- more, orientation of the tau gene transcription is the same as that of lac2 gene on the vector plasmid. Thus, a high dosage of the tau gene and its high expression under lacZ control would make the gene product overproduce on the mutant plasmid. Evidence nonsupportive of this idea is that while the overproducing plasmid was introduced into JM109 ( ladq: lactose repressor-overproducing gene), the high level expres- sion of the Ter protein as in the JM83 host was maintained: thereby suggesting that tau gene expression is out of lac2 control. Another reason is that the nonmutant tau gene on the pUC plasmid and with normal copy number was able to overproduce its product only &fold (Kobayashi et al., 1989). Thus, autoregulation seems to be a more tenable explanation. Hill et al. (1989) reported that the primary promoter of the tus (tau) gene is located at least 1200 base pairs upstream of the tus gene and that the weak promoter was identified immediately upstream of the tus gene. However, their results did not exclude the existence of the autoregulatory circuit.

In B. subtilis, a similar ter system seems to be operative. Wake and co-workers found that the terC site of B. subtilis, a t which at least a clockwise replication fork was blocked, was located at the region opposite that of the origin of replication (Weiss and Wake, 1983,1984). Sequence analysis of the region revealed that at the terC site, there is a long inverted repeat sequence homologous to the E. coli terC sequence (Carrigan et al., 1987). Adjacent to the terC site, there is an open reading frame capable of coding a basic protein with 122 amino acids, the defective mutant of which showed a termination-less phenotype (Iismaa and Wake, 1987; Smith and Wake, 1988;

S. Takenaka and T. Horiuchi, unpublished data. '' M. Hidaka, unpublished data.

Lewis and Wake, 1989). Recently this protein, like the E. coli tau product, was found to have terC-binding activity (Lewis et al., 1989), although they apparently share no homologous region (Hill et al., 1989).

Sista et al. (1989) purified the terR-binding protein of E. coli and determined the binding site of the purified protein. This protein may be the same as the one purified in our present study; however, the region covered by their protein is narrower than that shown in our Fig. 6, although both pat- terns are essentially the same. The different techniques used may account for the discrepancies; we used DNase I and they used copper-phenanthroline (Kuwabara and Sigman, 1987) for the footprinting experiment.

The molecular structure of the Ter protein-ter sequence complex seems to be unique since the Ter protein is the first example of a DNA-binding protein that can block movement of the DNA replication fork. Particulars regarding this block and the molecular mechanisms involved in progress of the replication fork at the replication point are now being inves- tigated.

Acknowledgments-We thank Drs. K. Sakumi and M. Sekiguchi for guidance on the DNase I footprinting experiments, Dr. H. Maki for technical advice, Dr. S. Iwanaga for supporting determinations of amino acid sequences and compositions, and M. Ohara for comments. We also thank Dr. M. Takagi for giving S. T. the opportunity to study in our laboratory.

REFERENCES Bachmann, B. J. (1972) Bacteriol. Reu. 36, 525-557 Brewer, B. J., and Fangman, W. L. (1988) Cell 55, 637-643 Carrigan, C. M., Haarsma, J. A., Smith, M. T., and Wake, R. G.

Crosa, J. H., Luttropp, L. K., and Falkow, S. (1976) J. Bacteriol. 126 ,

Dretzen, G., Bellard, M., Sassone-Corsi, P., and Chambon, P. (1981)

Galas, D. J., and Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170 Hernandez, P., Lamm, S. S., Bjerknes, C. A., and Van't Hof, J. (1988)

Hidaka, M., Akiyama, M., and Horiuchi, T. (1988) Cell 55,467-475 Hill, T. M., Kopp, B. J., and Kuempel, P. L. (1988a) J. Bacteriol.

Hill, T. M., Pelletier, A. J., Tecklenburg, M. L., and Kuempel, P. L. (1988b) Cell 55,459-466

Hill, T. M., Tecklenburg, M. L., Pelletier, A. J., and Kuempel, P. L. (1989) Proc. Natl. Acad. Sci. U. S. A. 8 6 , 1593-1597

Horiuchi, T., and Hidaka, M. (1988) Cell 54,515-523 Horiuchi, T., Hidaka, M., Akiyama, M., Nishitani, H., and Sekiguchi,

Iismaa, T. P., and Wake, R. G. (1987) J. Mol. Biol. 195, 299-310 Iismaa, T. P., Smith, M. T., and Wake, R. G. (1984) Gene (Amst.)

Ish-Horowicz, D., and Burke, J. F. (1981) Nucleic Acids Res. 9,2989-

Kobavashi. T.. Hidaka. M.. and Horiuchi. T. (1989) EMBO J. 8 ,

(1987) Nucleic Acids Res. 15, 8501-8509

454-466

Anal. Biochern. 112, 295-298

EMBO J. 7,303-308

170,662-668

M. (1987) Mol. Gen. Genet. 210,394-398

32,171-180

2998

24i5-2441 '

, ,

Kohara. Y.. Akivama. K.. and Isono. K. (1987) Cell 50. 495-508 < I

Kuempel, P. L., Duerr, S. A,, and Seeley, N. R. (1977) Proc. Natl.

Kushner, S. R. (1978) Genetic Engineering, p. 17, Elsevier/North-

Kuwabara, M. D., and Sigman, D. S. (1987) Biochemistry 26, 7234-

Lewis, P. J., and Wake, R. G. (1989) J. Bacteriol. 171, 1402-1408 Lewis, P. J., Smith, M. T., and Wake, R. G. (1989) J. Bacteriol. 171,

Louarn, J., Patte, J., and Louarn, J.-M. (1979) Mol. Gen. Genet. 172,

Lovett, M. A., Sparks, R. B., and Helinski, D. R. (1975) Proc. Natl. Acad. Sci. U. S. A. 72, 2905-2909

Maniatis, T., Fritsch, E. F., and Sambrook, J . (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

. .

Acad. Sci. U. S. A. 74, 3927-3931

Holland, Amsterdam

7238

3563-3567

7-11

DNA Replication Terminus Site-binding Protein in E. coli 21037

Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65, 499- Smith, M. T., and Wake, R. G. (1988) J. Bacteriol. 170,4083-4090 560 Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner,

Messing, J. (1983) Methods Enzymol. 101, 20-78 F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring B. J., and Klenk, D. C. (1985) Anal. Biochem. 150 , 76-85

Harbor Laboratory, Cold Spring Harbor, NY Spackman, D. H., Stein, W. H., and Moore, S. (1958) Anal. Chem. Monteiro, M. J., Sargent, M. G., and Piggot, P. J. (1984) J. Gen. 30, 1190-1206

Microbiol. 130, 2403-2414 Vieira, J., and Messing, J. (1982) Gene (Amst.) 19, 259-268 Nakamaye, K. L., and Eckstein, F. (1986) Nucleic Acids Res. 14, Wang, J., Nishiyama, K., Araki, K., Kitamura, D., and Watanabe, T.

Rosenberg, M., and Court, D. (1979) Annu. Rev. Genet. 13,19-53 Weiss, A. S., and Wake, R. G. (1983) J. Mol. Biol. 171 , 119-137 Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Weiss, A. S., and Wake, R. G. (1984) Cell 39,683-689

Sci. U. S. A. 7 4 , 5463-5467 Wickner, S., Wright, M., Berkower, I., and Hurwitz, J. (1974) in Sayers, J. R., Schmidt, W., and Eckstein, F. (1988) Nucleic Acids Res. Methods in Molecular Biology: D N A Replication (Wickner, R. B.,

Sista, P. R., Mukherjee, S., Patel, P., Khari, G. S., and Bastia, D. Yanish-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst . )

9679-9698 (1987) Nucleic Acids Res. 15 , 10105-10116

16,791-802 ed) Vol. 7, p. 195, Marcel Dekker, New York

(1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3026-3030 33,103-119