rapid and iterative genome editing in the malaria parasite

*For correspondence:

[email protected]

Competing interests: The

authors declare that no

competing interests exist.

Funding: See page 23

Received: 06 February 2019

Accepted: 28 May 2019

Published: 17 June 2019

Reviewing editor: Dominique

Soldati-Favre, University of

Geneva, Switzerland

Copyright Mohring et al. This

article is distributed under the

terms of the Creative Commons

Attribution License, which

permits unrestricted use and

redistribution provided that the

original author and source are

credited.

Rapid and iterative genome editing in themalaria parasite Plasmodium knowlesiprovides new tools for P. vivax researchFranziska Mohring1, Melissa Natalie Hart1, Thomas A Rawlinson2, Ryan Henrici1,James A Charleston1, Ernest Diez Benavente1, Avnish Patel1, Joanna Hall3,Neil Almond3, Susana Campino1, Taane G Clark1, Colin J Sutherland1,David A Baker1, Simon J Draper2, Robert William Moon1*

1Faculty of Infectious and Tropical Diseases, London School of Hygiene & TropicalMedicine, London, United Kingdom; 2The Jenner Institute, University of Oxford,Oxford, United Kingdom; 3Division of Infectious Disease Diagnostics, NationalInstitute for Biological Standards and Control, Health Protection Agency,Hertfordshire, United Kingdom

Abstract Tackling relapsing Plasmodium vivax and zoonotic Plasmodium knowlesi infections is

critical to reducing malaria incidence and mortality worldwide. Understanding the biology of these

important and related parasites was previously constrained by the lack of robust molecular and

genetic approaches. Here, we establish CRISPR-Cas9 genome editing in a culture-adapted P.

knowlesi strain and define parameters for optimal homology-driven repair. We establish a scalable

protocol for the production of repair templates by PCR and demonstrate the flexibility of the

system by tagging proteins with distinct cellular localisations. Using iterative rounds of genome-

editing we generate a transgenic line expressing P. vivax Duffy binding protein (PvDBP), a lead

vaccine candidate. We demonstrate that PvDBP plays no role in reticulocyte restriction but can

alter the macaque/human host cell tropism of P. knowlesi. Critically, antibodies raised against the

P. vivax antigen potently inhibit proliferation of this strain, providing an invaluable tool to support

vaccine development.

DOI: https://doi.org/10.7554/eLife.45829.001

IntroductionMalaria remains a serious health burden globally, with over 216 million cases annually (WHO, 2018).

Plasmodium falciparum is responsible for 99% of estimated malaria cases in sub-Saharan Africa. Out-

side Africa, P. vivax is the predominant parasite and causes ~ 7.4 million clinical cases annually.

Despite extensive efforts, in 2016 the number of malaria cases were on the rise again for the first

time in several years (WHO, 2018). Achieving global malaria eradication requires new tools and

approaches for addressing emerging drug resistance, relapsing P. vivax infections, and emerging

zoonotic P. knowlesi infections, which represent significant causes of severe disease and death

(Singh and Daneshvar, 2013; Hanboonkunupakarn and White, 2016; Menard and Dondorp,

2017).

Although P. vivax displays some distinctive features to P. knowlesi, including the formation of

latent hypnozoites stages in the liver and restriction to reticulocytes in the blood, the two parasites

are closely related, occupying a separate simian parasite clade to P. falciparum (Pacheco et al.,

2018). Host cell invasion by P. vivax and P. knowlesi relies on the Duffy binding proteins (DBP)

PvDBP and PkDBPa, respectively, both ligands for human red blood cell (RBC) Duffy antigen/recep-

tor for chemokines (DARC) (Adams et al., 1990; Horuk et al., 1993; Singh et al., 2005;

Mohring et al. eLife 2019;8:e45829. DOI: https://doi.org/10.7554/eLife.45829 1 of 29

TOOLS AND RESOURCES

http://creativecommons.org/licenses/by/4.0/

http://creativecommons.org/licenses/by/4.0/

https://doi.org/10.7554/eLife.45829.001

https://doi.org/10.7554/eLife.45829

https://creativecommons.org/

https://creativecommons.org/

http://elifesciences.org/

http://elifesciences.org/

http://en.wikipedia.org/wiki/Open_access

http://en.wikipedia.org/wiki/Open_access

Miller et al., 1975). The critical binding motif of the ligands is the cysteine-rich region 2 (DBP-RII)

(Chitnis and Miller, 1994), with ~70% identity between PkDBPa and PvDBP (Ranjan and Chitnis,

1999). Despite their similarity, PvDBP has also been implicated in both P. vivax reticulocyte restric-

tion (Ovchynnikova et al., 2017) and as a host tropism factor preventing P. vivax from infecting

macaques (Tachibana et al., 2015). PvDBP-RII is also the leading blood stage vaccine candidate for

P. vivax (Ntumngia et al., 2012; Payne et al., 2017a; Singh et al., 2018), with antibodies targeting

PvDBP-RII blocking parasite invasion in ex vivo P. vivax assays (Russell et al., 2011). P. knowlesi

additionally contains two PkDBPa paralogues, namely DBPb and DBPg which share high levels of

amino acid identity (68–88%) to PkDBPa but bind to distinct receptors via N-glycolylneuraminic acid

- a sialic acid found on the surface of macaque RBCs, but absent from human RBCs (Dankwa et al.,

2016).

Due to the lack of a long-term in vitro culture system for P. vivax, vaccine development currently

relies on recombinant protein assays, or low throughput ex vivo studies, primate infections or con-

trolled human malaria infections (Russell et al., 2011; Arevalo-Herrera et al., 2005; Shakri et al.,

2012; Payne et al., 2017b). Thus, higher throughput parasitological assays to assess antisera and

antigens, prior to escalation to in vivo work, are desperately needed. The evolutionary similarity

between P. vivax and P. knowlesi means the adaptation of P. knowlesi to long-term culture in human

RBCs (Moon et al., 2013; Lim et al., 2013) provides unique opportunities to study DARC-depen-

dent invasion processes in both species. While adaptation of the CRISPR-Cas9 genome editing sys-

tem to the most prevalent malaria parasite, P. falciparum (Ghorbal et al., 2014), provided a

powerful tool for studying parasite biology, scalable approaches for P. falciparum remain con-

strained by inefficient transfection and very high genome AT-content (averaging 80.6%)

(Gardner et al., 2002). P. knowlesi offers significant experimental advantages over P. falciparum

including a more balanced genome AT-content of 62.5% and orders-of-magnitude-more-efficient

transgenesis (Moon et al., 2013; Gruring et al., 2014; Kocken et al., 2002).

Here, we establish CRISPR-Cas9 genome editing in P. knowlesi. Using an optimised and scalable

PCR-based approach for generating targeting constructs we define critical parameters determining

effective genome editing and apply the technique to introduce epitope/fluorescent protein tags to a

variety of proteins with distinct cellular locations. We then use these tools to replace the P. knowlesi

PkDBPa gene with its PvDBP orthologue, and delete the P. knowlesi DBP paralogues to create a

transgenic P. knowlesi line reliant on the PvDBP protein for invasion of RBCs. The additional deletion

of the PkDBP paralogues not only excludes interference through antibody cross-reactivity during

growth inhibition assays, but also allows us to demonstrate that, in contrast to previous findings

(Ovchynnikova et al., 2017), PvDBP plays no role in reticulocyte restriction, but has an effect on

macaque/human host cell preference. Finally, we show that antibodies raised against the P. vivax

antigen are potent inhibitors of P. knowlesi/PvDBP transgenic parasites, providing an invaluable tool

to support P. vivax vaccine development. Thus, we have developed a robust and flexible system for

genome editing in an important human malaria parasite and generated essential new tools to accel-

erate both basic and applied malaria research.

Results

Homology mediated CRISPR-Cas9 genome editing is highly efficient inP. knowlesiPlasmodium parasites lack a canonical non-homologous end joining pathway, instead relying almost

exclusively on homology-directed repair of double-stranded breaks (DSBs), such as those introduced

by the Cas9 endonuclease. Effective CRISPR-Cas9 genome editing of malaria parasites therefore

requires expression cassettes for the guide RNA and the Cas9 nuclease, and a DSB repair template

(donor DNA) containing the desired change, flanked by two regions of homology to the genomic

target.

Whilst a variety of approaches have been used in P. falciparum, many of the earlier methods

embed these elements into two plasmids, each expressing a different drug-selectable marker

(Ghorbal et al., 2014; Crawford et al., 2017; Mogollon et al., 2016). This allows for selection of

very rare events, but complicates construct design and is not ideal for multiple modifications of a

given line – as both selectable markers must then be recycled. As transfection efficiency is


Tools and resources Genetics and Genomics Microbiology and Infectious Disease


significantly higher in P. knowlesi than P. falciparum (Gruring et al., 2014), we reasoned that we

may be able to use a single positive drug selectable marker to cover all the required components for

editing. Pairing the guide and Cas9 cassette on a single ‘suicide’ plasmid (Lu et al., 2016) with posi-

tive and negative selection cassettes would allow for indirect selection of a separate plasmid con-

taining the repair template, as only parasites that took up the repair template as well as the Cas9

plasmid would be able to repair the DSB. A similar approach to this has been used successfully in P.

falciparum and has allowed the generation of lines entirely free of resistant cassettes after dilution

cloning (Knuepfer et al., 2017). Supporting this approach, co-transfection of plasmids expressing

eGFP or mCherry revealed that ~30% of P. knowlesi transgenic parasites took up both plasmids,

although the proportion expressing both declined rapidly in the following days (Figure 1—figure

supplement 1A). Our two-plasmid CRISPR-Cas9 system comprises one plasmid (pCas9/sg) that pro-

vides Cas9, sgRNA (driven by the PkU6 promoter) and a hDHFR-yFCU fusion product for positive/

negative selection, and a second plasmid (pDonor) providing the donor DNA with homology regions

(HRs) flanking the DSB for repair by homologous recombination. To test this system, we designed

constructs to integrate an eGFP expression cassette into the non-essential p230p locus (Figure 1A

and Figure 1—figure supplement 1C). A 20 bp guide sequence targeting a seed sequence

upstream of a protospacer adjacent motif (PAM) within the p230p gene was cloned into pCas9/sg

(pCas9/sg_p230p), and a repair template plasmid was synthesized by including an eGFP expression

cassette flanked by 400 bp HRs targeting either side of the PAM sequence (pDonor_p230p). Both

plasmids (each 20 mg) were combined and introduced into P. knowlesi schizonts via electroporation

(Moon et al., 2013) along with control transfections (pCas9/sg without guide sequence and repair

template). To simplify synchronisation of parasites, the transfection procedure was altered to addi-

tionally include a 2 hr incubation of purified schizonts with 1 mM of the schizont egress inhibitor com-

pound 2, immediately prior to transfection. This compound reversibly inhibits the cGMP-dependent

protein kinase (PKG) (Collins et al., 2013) and facilitates accumulation of the fully segmented forms

required for transfection. Parasites were placed under selection with pyrimethamine for 5 days after

transfection and successful integration monitored by PCR. Correct integration at the p230p locus

was detectable by PCR within 3 days of transfection and only low levels of wild type DNA was

detectable after day 11 (Figure 1B). Expression of eGFP was confirmed by live microscopy

(Figure 1C). The eGFP positivity rate was calculated the day after transfection (day 1), to evaluate

transfection efficiency (8.4%±2.1 SD). In P. knowlesi, expression of GFP can be detected in any para-

sites that take up the eGFP cassette after transfection, regardless of whether on an episomal or line-

arised construct. This indicates that 8.4% of parasites successfully take up the construct, but only a

very small fraction of these are likely to be integrated at this stage. Only the plasmid pCas9/sg is

selected for with pyrimethamine, and so the number of parasites with non-integrated linear donor

DNA decreases rapidly over time. The eGFP positivity was assessed again once parasites reached

0.5% parasitemia (day 12), indicating 83.3% (±1.8 SD) of the parasites had integrated the construct

(Figure 1D); Figure 1—source data 1. Parasites transfected with pCas9/sg_p230p without providing

pDonor_p230p were visible in culture several days after the integrated lines. An intact guide and

PAM site was detected in these parasites, suggesting that a small population of parasites did not

form DSB. Parasites transfected with pCas9/sg without a cloned sgRNA appeared in culture within a

few days after transfection, with comparable growth rates to the eGFP plasmid, suggesting the Cas9

expression without a targeting sgRNA is not toxic (Figure 1E); Figure 1—source data 1. Integrated

lines were grown for one week before negative selection with 5-Fluorocytosine and subsequent limit-

ing dilution cloning. Clones were identified using a plaque-based assay (Figure 1—figure supple-

ment 1B) previously used for P. falciparum (Thomas et al., 2016), and 10/10 genotyped clone’s

harboured correctly integrated, markerless eGFP (Figure 1F).

A three-step PCR method enables rapid, cloning-free generation ofdonor constructsP. knowlesi readily accepts linearised plasmids for homologous recombination (Moon et al., 2013;

Kocken et al., 2002; Moon et al., 2016), so we next tested whether we could use a PCR-based

approach for scalable generation of repair templates. As no selectable marker is used within the

repair template, this could be easily produced by using PCR to fuse 5’ and 3’ HRs with the region

containing the desired insertion, dispensing with the need for a plasmid back-bone. Modifying a

method used for homologous recombination in P. berghei (Ecker et al., 2006), we developed a




three-step PCR scheme which first amplified the eGFP cassette and 400 bp HRs with eGFP cassette

adaptors separately, with the second and third reactions fusing each HR to the eGFP cassette in turn

(Figure 2A). The addition of nested primers for the second and third PCR step removed background

bands and improved robustness. The final PCR construct (HR1-eGFPcassette-HR2) was transfected

along with the pCas9/sg_p230p plasmid (Figure 2—figure supplement 1A), and resultant parasite

lines demonstrated integration by PCR (Figure 2B), and an eGFP positivity rate of 74% (±8 SD),

�

�

�

�

� �

��

�

�

�

�

��

��

��

��

��

��

��

��

��

� ��

��

��

�

��

��

��

��

��

�� !��

Figure 1. CRISPR-Cas9 genome editing in P.knowlesi. (A) Schematic of CRISPR-Cas9 strategy. Integration of the eGFP expression cassette into the

target p230p locus via homologous recombination. Arrows indicating oligo positions for diagnostic PCRs. (B) Parasites transfected with pCas9/

sg_p230p and pDonor_p230p plasmids were analysed with diagnostic PCRs on consecutive days after transfection. PCR reactions detecting the wild

type locus (ol49 +ol50), integration locus (ol01 +ol50) and a control PCR targeting an unrelated locus (ol75 +ol76) using approximately 3 ng/ml genomic

DNA. For each day, three transfections are shown. (C) Representative live microscopy image of eGFP positive schizont transfected with pCas9/

sg_p230p and pDonor_p230p plasmids. Scale bar represents 5 mm. (D) Proportion of eGFP positive parasites (%) counted after transfection with pCas9/

sg_p230p and pDonor_p230p plasmids to show transfection efficiency on day one and integration efficiency after culture reached 0.5% parasitemia (day

12) (n = 3). Error bars denote ±1 SD. (E) Graph shows change in parasitemia (%) over time for parasite lines transfected with the dual plasmid Cas9

targeting vectors (pCas9/sg_p230p and pDonor_p230p), controls without an sgRNA (pCas9/sg), without homology repair template DNA (pCas9/

sg_p230p) or with no DNA. A fifth control reaction shows outgrowth of an episomal control plasmid (pkconGFPep) (n = 3). Parasites were placed under

drug selection on day 1. Error bars denote ±1 SD (F) Parasites transfected with pCas9/sg_p230p and pDonor_p230p plasmids were cloned by limiting

dilution and four clones analysed by diagnostic PCR.


The following source data and figure supplement are available for figure 1:

Source data 1. Source data for graphs.


Figure supplement 1. P.knowlesi dual plasmid uptake and plasmid map of pCas9/sg.








similar to that seen for the pDonor_p230p plasmid (Figure 2C); Figure 2—source data 1. The use

of a high-fidelity, high-processivity polymerase for the construct production allowed each reaction to

be completed in 40–90 min, thus providing a rapid method for generating repair templates.

��

�

�

� �

�

��

��

��

��

��

��

��

�� !�"�#�

��

��

��

�

�

�

�

��

��

��

��

�

��

� � � � � �

�

�

��

�

��

�� !�"��#��

$�!��

��

�"�

��

��

��

��

� � � � � �

�

�

�

�

�� !�"��#��

��

��

��

��

�

��

��

��

%�� %�� %&� ��

�

�

�

�

��

��

��

��

�

��

��

��

��

$��'�� "��$()��*#��

�#� %� �� %�� %&� ��

�

�

��

�

��

$��'�� "��$()��*#��

$�!��

��

�"�

��

��

�#�

��

Figure 2. Fusion PCR based approach enables cloning-free production of homology repair templates and evaluation of key parameters for efficient

homology-driven repair. (A) Schematic of the nested PCR method to generate linear donor constructs for transfection. First, homology regions (HRs),

with eGFP adaptors in primers ol36 and ol37 and eGFP cassette were amplified by PCR with small overhangs (OH) and gel extracted. In a second

nested step 5’HR and eGFP cassette were fused and again in the third step the 5’HR-eGFP product was fused with 3’HR. (B) Parasites transfected with

pCas9/sg_p230p and PCR repair template (PCR donor), comprised of an eGFP cassette and 400 bp HRs, were analysed with diagnostic PCRs

amplifying the wild type p230p locus (ol49 +ol50), integration locus (ol01 +ol50) and a control targeting an unrelated locus (ol75 +ol76). (C) After

selection for integration, the proportion of eGFP positive parasites (%) was determined by fluorescent microscopy and compared between Cas9

transfections made with 400 bp HR plasmid (pDonor_p230p) or 400 bp HR PCR donor DNA. Data points represent the mean and error bars indicate ±1

SD of two biological independent experiments (n = 2). (D) The p230p locus was targeted using PCR donor DNA constructs using HRs with 50–1600 bp

length. The bar chart shows, for each of the constructs with HRs of 50 to 1600 bp length, (E) the number of days for transfections to reach 1%

parasitemia and (F) proportion of eGFP positive parasites (%) after selection. All transfections were carried out in two biological independent

experiments (n = 2). (G) The p230p locus was targeted using PCR donor DNA constructs with HRs placed at varying distance from the Cas9 induced

double strand break (DSB). For each construct based on distance to the DSB, the bar chart shows, (H) the number of days for transfections to reach 1%

parasitemia and (I) proportion of eGFP positive parasites (%) after selection. Data points represent the mean and error bars denote ±1 SD of two

biological independent experiments (n = 2). Results were all compared to the 400 bp HR construct at 0 kb from DSB as the control using a one-way

ANOVA with Dunnett’s multiple comparison of means. ns p>0.05, *<0.05, **<0.01, ***<0.001.


The following source data and figure supplement are available for figure 2:



Source data 2. Primer pairs for p230p repair template generation and diagnostic PCRs.


Figure supplement 1. Schematic and genotypic analysis of fusion PCR repair template integration into p230p locus.









Longer HRs increase the integration efficiency and offsets DSB distanceefficiency lossWe next used this PCR approach to investigate the optimal parameters and limits of the Cas9 sys-

tem in P. knowlesi. Varying the length of HRs targeting the same p230p locus (Figure 2D), allowed

us to determine the effect on integration efficiency as well as the size limits of the PCR approach.

The largest construct generated in this way was 6.1 kb in length (2 � 1.6 kb HRs flanking the 2.9 kb

eGFP expression cassette). Attempts to generate a larger 9.3 kb construct (2 � 3.2 kb HRs) failed

during the final PCR step. PCR yields were lower for larger constructs, with the 6.1 kb construct

yielding half that of the 3.7 kb construct. PCR repair templates with HRs ranging from 50 to 1600 bp

generated single specific bands with exception of the 400 bp HRs which contained an additional

lower band, due to a primer additionally annealing to a repeat region in HR1 (Figure 2—figure sup-

plement 1B). The PCR constructs were transfected together with the pCas9/sg_p230p plasmid and

integration efficiency monitored. All 6 HR lengths produced evidence of integration by PCR, but the

efficiency rapidly declined with HRs shorter than 400 bp (Figure 2—figure supplement 1D).

Parasites transfected with 800 and 1600 bp HR constructs were the fastest to reach 1% parasite-

mia on day 12 and 9 post transfection, respectively (Figure 2E); Figure 2—source data 1. For the

50 and 100 bp HR constructs no eGFP positive parasites were detected by fluorescence microscopy

suggesting very low targeting efficiencies. Constructs with HRs > 400 bp provided GFP positivity

ranging from 79% and 81% (Figure 2F); Figure 2—source data 1, which taken together with PCR

yields and transfection recovery time suggest an optimal HR length of at least ~800 bp.

To undertake large gene deletion or replacement experiments, HRs may need to be placed at a

distance from the Cas9-induced DSB, and it is well known in other systems that efficiency rapidly

declines with distance to DSB (Byrne et al., 2015). To determine how distance from DSB affected

efficiency of integration, we used the same p230p PAM site and moved our 400 bp HRs varying dis-

tances away from the DSB, ranging from 0 to 5 kb (Figure 2G). PCR repair templates with HRs

showed good yields, but again contained an additional lower band for the HRs furthest away from

the double strand break (5 kb) (Figure 2—figure supplement 1C).

Whilst all transfections were PCR positive for integration and reached 1% parasitemia at similar

times (14–20 days) (Figure 2—figure supplement 1E, Figure 2H and Figure 2—source data 1), the

integration efficiency declined with distance from DSB. This decline was surprisingly small, with HRs

placed even 5 kb away from either side of the DSB yielding a 14% (±18 SD) integration efficiency

(Figure 2I). Interestingly, we found that extending HR length to 800 bp restored integration efficien-

cies to 54.8% (±8.7 SD) at a 5 kb distance from DSB (Figure 2I); Figure 2—source data 1. Thus, HR

length can directly offset efficiency losses due to distance from DSB and this system can readily

remove genes at least as large as 10 kb in size from a single PAM site, accounting for ~98% of genes

in the P. knowlesi genome (Pain et al., 2008). All primer pairs for template generation and diagnos-

tic PCRs are shown in Figure 2—source data 2 and primer sequences are listed in Figure 5—source

data 2.

Cas9-based PCR constructs enable rapid and flexible gene tagging in P.knowlesiHaving demonstrated consistent performance of an sgRNA sequence in the sgRNA/Cas9 suicide

vector and PCR constructs for targeting a single control locus, we next sought to determine how

robust the system is for targeting a range of loci. We therefore used the PCR-based approach for

fusion of fluorescent or epitope tags to proteins of interest (Figure 3A). For C-terminal tags, the

PCR repair templates were generated by creating fusions of the tag with HRs targeting the 3’end of

the gene and the 3’UTR. Similarly, N-terminal tag repair templates were created by flanking the tag

with HRs targeting the 5’UTR and 5’end of the coding region. In each case a PAM site was selected

so that the 20 bp guide sequence crossed the stop codon (for C-terminal) or start codon (for N-ter-

minal) such that integration of the tag alone, with no other exogenous sequence, was sufficient to

disrupt the guide sequence. For genes, such as the Chloroquine Resistance Transporter (CRT), where

the PAM site preceded the stop codon, intervening sequences were recodonised when generating

the 5’HR to disrupt the PAM site using silent mutations. We selected five genes with disparate sub-

cellular locations and functions to test this approach: the micronemal protein apical membrane anti-

gen 1 (AMA1) (Bannister et al., 2003), rhoptry neck protein 2 (RON2) (Cao et al., 2009), inner




membrane complex protein myosin A (MyoA) (Baum et al., 2006), digestive vacuole membrane pro-

tein involved in drug resistance CRT (Ehlgen et al., 2012), and a protein involved in artemisinin resis-

tance in cytoplasmic foci Kelch13 (K13) (Birnbaum et al., 2017). A single sgRNA was selected for

each, and repair templates were generated by fusion PCR to incorporate an eGFP, mCherry (both

with 24 bp glycine linker) or a hemagglutinin (HA) tag (Figure 3—figure supplement 1A–E). An

N-terminal tag was used for K13, as previous work in P. falciparum suggested that C-terminal tag-

ging affected parasite growth (Birnbaum et al., 2017), and C-terminal tags used for all the other tar-

gets. All lines grew up quickly after transfection, reaching 1% after between 8 and 15 days, and PCR

�

�

�

Figure 3. CRISPR Cas9 PCR repair templates enable rapid and flexible tagging of parasite proteins. (A) Schematic of CRISPR-Cas9 system for

C-terminal tagging. pCas9/sg plasmid with gene of interest (GOI) specific sgRNA, is combined with repair template generated by fusion PCR. Lightning

bolt indicates Cas9 induced double strand break, which is repaired by insertion of the desired tag. (B) Diagnostic PCRs specific to each GOI locus were

carried out to amplify the wild type locus (schematic positions olFwd1 +olRev2), integration locus (schematic positions olFwd1 +olRev3) and a control

targeting an unrelated locus (ol75 +ol76). Specific primers used for each GOI is shown in Figure 3—figure supplements 1A–E, 2. As no DNA is

removed in this process, the wild type specific locus primers also generate slightly larger amplicons in tagged lines, which can be seen as double bands

for both the Myosin A and K13 PCRs. (C) Representative immunofluorescence images of HA-tagged Apical membrane antigen-1 (AMA1-HA) and

Rhoptry neck protein 2 (RON2-HA) parasite lines, and live cell imaging of Chloroquine Resistance Transporter-eGFP (CRT-eGFP), Myosin A-eGFP

(MyoA-eGFP) and mCherry-Kelch13 (K13). Panel shows brightfield (BF), DNA stain (blue) and anti-tag antibodies/live fluorescence (green or red) of

schizont stage parasites from each line. Scale bars represent 2 mm.


The following source data and figure supplements are available for figure 3:

Source data 1. Primer pairs and guide sequences for generation and analysis of tagged parasite lines.


Figure supplement 1. CRISPR-Cas9 tagging of P.knowlesi proteins.


Figure supplement 2. Comparison of P. knowlesi and P. falciparum 3D7 genes.









analysis indicated that correct integration had occurred (Figure 3B). All primers used for generating

repair templates and for diagnostic PCRs are shown in Figure 3—source data 1 and Figure 5—

source data 2.

Whilst it is, to our knowledge, the first time each of these proteins have been tagged in P. knowl-

esi, all demonstrated localisation patterns were consistent with previous reports for P. falciparum

(Figure 3C). AMA1, MyoA and K13 showed clear bands at the expected size on western blots. The

CRT-eGFP fusion protein showed a band at ~50 kDa, in line with work in P. falciparum which showed

CRT-eGFP migrates faster than its predicted size of 76 kDa (Figure 3—figure supplement 1F)

(Ehlgen et al., 2012). We were unable to visualise a band for RON2-HA most likely due to poor blot-

ting transfer of this 240 kDa protein. Together, these results demonstrate that the fusion PCR

approach can be used to tag P. knowlesi genes rapidly and robustly at a variety of loci. Analysis of

equivalent P. falciparum loci revealed only 2/5 had suitably positioned PAM sites, and equivalent

UTR regions had an average GC-content of only 11.8% (36% for P. knowlesi), suggesting a similar

approach would have been more challenging in P. falciparum (Figure 3—figure supplement 2). All

sgRNA sequences with predicted on- and off-target scores that successfully targeted a gene of

interest in this study are shown in Figure 3—source data 1.

Transgenic P. knowlesi orthologue replacement lines providesurrogates for P. vivax vaccine development and DBP tropism studiesHaving demonstrated the utility of this technique for rapidly manipulating genes of interest, we next

sought to use this system to study P. vivax biology. The orthologous RBC ligands PkDBPa and

PvDBP, mediate host cell invasion by binding to the DARC receptor on human RBCs in P. knowlesi

and P. vivax, respectively (Adams et al., 1990; Horuk et al., 1993; Singh et al., 2005; Miller et al.,

1975). PvDBP is currently the lead candidate for a P. vivax blood stage vaccine (Ntumngia et al.,

2012; Payne et al., 2017a; Singh et al., 2018), thus P. knowlesi could provide an ideal surrogate for

vaccine testing in the absence of a robust in vitro culture system for P. vivax. Whilst likely functionally

equivalent, the DBP orthologues are antigenically distinct (~70% amino acid identity in binding

region II) so we used genome-editing to generate transgenic P. knowlesi parasites in which DARC

binding is provided solely by PvDBP. The donor DNA constructs required to fully reconstitute the

DBP coding regions were large and UTR and coding sequences for each of the three PkDBP

paralogues highly similar at the nucleotide level. Therefore, HRs were amplified from genomic DNA

and cloned into a plasmid vector containing the recodonized PkDBPa or PvDBP genes rather than

using the 3-step PCR to generate repair templates (Figure 4—source data 2). This allowed us to

verify amplification of the correct DBP locus and avoid any chance of mutations within the 4.3 kb

sized template DNA. We first carried out an orthologue replacement (OR) of the full-length PkDBPa

with PvDBP in the P. knowlesi A1-H.1 line (PvDBPOR) – using a recodonised synthetic PvDBP gene

flanked by HRs targeting the 5’ and 3’UTRs of the PkDBPa gene (Figure 4—figure supplement 1A).

Once integrated, this deletes the PkDBPa gene and places the PvDBP gene under control of the

PkDBPa regulatory sequences, enabling a precisely matched expression profile. As a control we also

exchanged PkDBPa with a recodonised PkDBPa gene (PkDBPaOR) using the same sgRNA. Success-

ful integration was readily achieved and limiting dilution cloning resulted in 100% integrated clones

for PkDBPaOR and 40% for PvDBPOR (Figure 4A). The PkA1-H.1 line relies on the DARC receptor for

invasion of human RBCs (Moon et al., 2013) and PkDBPa is required to mediate this interaction

(Singh et al., 2005), thus the successful replacement indicates that the Pv orthologue can comple-

ment its role in DARC binding sufficiently well to maintain growth.

P. knowlesi contains two DBPa paralogues, DBPb and DBPg, which are highly homologous at the

nucleotide (91–93% identity) and amino acid (68–88% identity) levels, but are thought to bind to dis-

tinct sialic acid-modified receptors unique to macaque RBCs (Dankwa et al., 2016). The PkDBPa

sgRNA was carefully designed to be distinct to equivalent DBPb and DBPg target sequences (85%

identical to DBPg and 47.8% to DBPb), because, as in other systems, off-target Cas9-induced DSBs

are a major issue (Figure 4—figure supplement 1D) (Zischewski et al., 2017; Wagner et al.,

2014). We therefore sequenced the four most similar target sequences, including one in DBPg, in

the PvDBPOR lines (Figure 4—figure supplement 2) and did not detect any off-target mutations,

suggesting that as for other malaria parasites (Ghorbal et al., 2014) the absence of non-homolo-

gous end joining ameliorates the potential for off-target mutations. However, diagnostic PCRs for

DBPb failed, as well as PCRs in genes flanking the DBPb locus. Whole genome sequencing and




� � �

� � �

�

��

�

��

��

��

��

��

��

��

�

��

��

��

��

��

��

��

�

��

��

��

��

��

!� ��

��

��

� ��

!� ��

� ��

�

�

��

��

��

��

��

��

��

��

�

!� ��

�

��

� ��

!� ��

� ��

��

��

�

!� ��

�

��

� ��

!� ��

� ��

�

�

��

��

��

��

��

��

"

��

��

��

��

��

��

��

��

�� ""

Figure 4. PvDBP expressing P. knowlesi line demonstrates preference for growth in human RBCs but no preference for different Duffy haplotypes. (A)

The P. knowlesi Duffy binding protein a (DBPa) gene was targeted for replacement with either a recodonised PkDBPa or P. vivax DBP repair template.

Sequencing revealed a loss of ~44 kb in chromosome 14, including loss of PkDBPb (PkDBPaOR/D14 and PvDBPOR/D14). These lines were then

subsequently modified to knockout PkDBPg (PkDBPaOR/D14Dg and PvDBPOR/D14Dg ). Parasite lines were analysed using PCR reactions detecting the

wild type (WT) locus PkDBPa (ol186 +ol188), orthologue replacement (OR) locus of PkDBPaOR (ol186 +ol189) or PvDBPOR (ol186 +ol187), WT PkDBPb

locus (ol480 +481), WT locus of PkDBPg (ol483 +ol484), KO locus of PkDBPg (ol483 +ol258) and a control PCR targeting an unrelated locus (ol75 +ol76).

(B) The PkDBPaOR line was modified to knockout PkDBPb (PkDBPaOR/Db). Parasite lines including the transfection line (TF) and three clones were

analysed using PCR reactions detecting WT locus of PkDBPb (ol480 +ol481), KO locus of PkDBPb (ol284 +ol481) and a control PCR targeting an

unrelated locus (ol75 +ol76). (C) Bar chart showing mean fold replication of parasites lines in FACS-based multiplication assays over one growth cycle

(24 hr). Assays were carried out in eight biological independent experiments for human blood (hRBC) and three biological independent experiments for

Macaca fascicularis blood (mRBC). Data points represent mean growth rates and error bars denote ±1 SD. Replication rates of the parasite lines were

compared by using one-way ANOVA with Tukey’s multiple comparisons test of means. There are significant differences in fold multiplication rates of

WT against PkDBPaOR/D14Dg in hRBCs (p<0.05) and significant differences in fold multiplication rates of PkDBPaOR/D14Dg against PvDBP OR/D14Dg in

mRBCs (p<0.01). (D) Graph showing fold multiplication of WT, PkDBPaOR/D14Dg and PvDBP OR/D14Dg P. knowlesi parasites in RBC over one

intraerythrocytic growth cycle (24 hr). Assays were carried out in technical duplicates in Duffy positive RBC from 21 volunteers with three independent

schizont purifications. Data points represent the mean multiplication rate and error bars denote ±1 SD, and were compared by using one-way ANOVA

with Tukey’s multiple comparisons test of means. There are significant differences in fold multiplication rates of WT against PkDBPaOR/D14Dg (p<0.001)

and PkDBPaOR/D14Dg against PvDBPOR/D14Dg (p<0.001). (E) Graph showing fold multiplication of WT (F) PkDBPaOR/D14Dg and (G) PvDBP OR/D14Dg P.

knowlesi parasites in RBC from 21 volunteer blood donors over one intraerythrocytic growth cycle (24 hr). Mean average of fold multiplication rates are

plotted against Duffy phenotype [Fya, Fyb, and Fy(a+b+)]. Black bars indicate mean multiplication rate in each blood type. Data points represent the

mean and error bars denote ±1 SD of three biological independent experiments (n = 3); Figure 4—source data 1. .ns p>0.05, *<0.05, **<0.01,

***<0.001.


The following source data and figure supplements are available for figure 4:



Source data 2. Primer pairs and vector design for DBP constructs.

Figure 4 continued on next page






mapping against the A1-H.1 reference genome revealed that the PkDBPaOR and PvDBPOR line have

a ~ 44 kb truncation at one end of chromosome 14 (Figure 4—figure supplement 3), which also har-

bours DBPb, therefore we renamed the lines PkDBPaOR/D14 and PvDBPOR/D14. The loss of the ~44

kb of chromosome 14 is also present in parasites that have been transfected simultaneously with

pCas/sg_p230p, suggesting that the 44 kb deletion occurred in the A1-H.1 parental parasite line

(wt/D14) prior to transfection and was not an artefact caused by targeting DBPa. Similar spontane-

ous deletions have been reported previously, including ~66 kb loss at the other end of chromosome

14 in the P. knowlesi A1-C line maintained in cynomolgus macaque blood that included the invasion

ligand NBPXa (Moon et al., 2016), and a deletion of DBPg in the PkYH1 line at the end of chromo-

some 13 (Dankwa et al., 2016). Furthermore, the PAM site of the DBPa targeting guide sequence

is absent in DBPb (Figure 4—figure supplement 1D) which makes it unlikely that the disruption of

DBPb was induced by Cas9 during DBPa targeting. To confirm this, another PkDBPaOR clonal line

was generated in an independent transfection using the A1-H.1 parental parasite line with intact

DBPb locus.

Having established accurate targeting of the PkDBPa locus, we investigated the role of the

paralogues in human and macaque red cell invasion and whether they could interfere with inhibitory

effects of test antibodies. Reasoning that as the D14 truncation may have provided a selective advan-

tage to the parasites and thus may well reoccur, we took advantage of the spontaneous DBPb loss

(PkDBPaOR/D14 or PvDBPOR/D14) and then used pCas9/sg plasmid recycling to additionally delete

the DBPg locus (Figure 4—figure supplement 1B), generating PkDBPaOR/D14Dg and PvDBPOR/

D14Dg. An overview of all generated DBP lines is depicted in Figure 4—figure supplement 1E).

The final PvDBPOR/D14Dg clonal line was subjected to whole genome sequencing to verify

changes at all three loci, and this confirmed precise targeting of the PvDBP allele swap into the

PkDBPa locus, and complete deletion of the DBPg open reading frame in the PkDBP g locus (Fig-

ure 4—figure supplement 3). Using the PkDBPaOR clonal line with the start of chromosome 14

intact, we were able to generate a Cas9 mediated DBPb knockout (PkDBPaOR/Db) (Figure 4B and

Figure 4—figure supplement 1C). FACS-based multiplication assays showed no growth effects of

PkDBPb knockout in human blood (Figure 4—figure supplement 1F).

Analysis of the wild type line, and the four transgenic lines (PkDBPaOR/D14, PvDBPOR/D14,

PkDBPaOR/D14Dg and PvDBPOR/D14Dg) revealed no difference in growth rate in human RBCs for all

lines except the PkDBPaOR/D14Dg which demonstrated significantly increased growth rate compared

to wild type (Figure 4C and Figure 4—source data 1). This confirmed that the P. vivax protein was

able to complement the role of its P. knowlesi orthologue. It also demonstrated, that not only are

PkDBPb and g proteins dispensable for multiplication in humans RBCs (Dankwa et al., 2016), but as

their loss leads to increased multiplication rate, they may actually impede invasion in human RBCs. A

further experiment comparing multiplication rates in 21 Duffy positive blood donations revealed sig-

nificant higher growth rates of the PkDBPaOR/D14Dg line (8.9 fold) compared to the 6.9 fold multipli-

cation of the wild type line and PvDBPOR/D14Dg line (p<0.001) (Figure 4D and Figure 4—source

data 1), confirming that knockout of the two paralogues increases multiplication rate in human RBCs

but also revealing a minor growth reduction in the PvDBPOR/D14Dg line compared to its control line.

To investigate how these modifications affect host preference we compared the growth rates in

human RBCs with growth rates in RBCs from the natural host of P. knowlesi, the long tailed macaque

(Macaca fascicularis). Even human culture-adapted P. knowlesi retains a strong preference for

macaque cells (Moon et al., 2013; Lim et al., 2013; Moon et al., 2016) and it has been

Figure 4 continued


Figure supplement 1. Transgenic P. knowlesi DBP orthologue replacement, knockout design and genotypic analysis.


Figure supplement 1—source data 1. Source data for graphs.


Figure supplement 2. Off-target guide sequences for PkDBPa sgRNA.


Figure supplement 3. Sequencing of PvDBPOR/D14Dg parasite line.










hypothesized that the additional invasion pathways provided by DBPb and DBPg are in part respon-

sible for the increased invasion efficiency in macaque RBCs (Dankwa et al., 2016). Interestingly, loss

of DBPb and DBPg in the PkDBPaOR/D14Dg line did not reduce the parasite multiplication rate in

macaque RBC but rather slightly increased it (Figure 4C), with the lines retaining a macaque prefer-

ence ratio (macaque fold growth/human fold growth) of 1.43, similar to both the wild type (1.26)

and PkDBPaOR/D14 (1.33). This demonstrates that both PkDBPb and PkDBPg are dispensable for

invasion of macaque RBCs, and PkDBPa is sufficient to retain full growth rate in macaque cells.

Unlike P. knowlesi, P. vivax is unable to infect macaques, and sequence differences between the

DARC receptor in the two hosts have been suggested to underlie this restriction (Tachibana et al.,

2015). Whilst in macaque RBCs the multiplication rates and host preference ratio (1.16) were unaf-

fected for the PvDBPOR/D14 line, the additional deletion of DBPg in the PvDBPOR/D14Dg line

resulted in a 40% reduction in macaque multiplication rates (Figure 4B) which caused a shift to

human RBC preference with a ratio of 0.75. This suggests that in the absence of redundant DBP

pathways, PvDBP is less effective at facilitating invasion of macaque cells than of human cells, but

nevertheless can support invasion of both host cell types.

The Duffy gene exists as three distinct alleles, Fya, Fyb and Fynull. Whilst the Fy null phenotype

has long been established to protect individuals from P. vivax/P. knowlesi infection (Miller et al.,

1975; Miller et al., 1976), previous studies have also shown stronger binding of recombinant

PvDBPRII to Fy(a�b+) and Fy(a+b+) human RBCs compared to Fy(a+b�) as well as higher risks of clinical

episodes of P. vivax malaria in Fy(a�b+). This suggests that P. vivax may invade to Fy(a+b�) RBCs less

efficiently (King et al., 2011; Fong et al., 2018; Kano et al., 2018). Whilst we have previously been

unable to detect any Fy subtype preference in P. knowlesi A1-H.1 (22), the PvDBPOR lines provided

an opportunity to see if multiplication rate was sensitive to the Duffy subtype when the parasites

used PvDBP for invasion. Schizonts of the wild type, PkDBPaOR/D14Dg and PvDBPOR/D14Dg lines

were added in duplicate to washed RBC from 21 volunteers of the three Duffy-positive phenotypes

(7x Fya, 9x Fyb, and 5x Fy(a+b+)) at 0.5% parasitaemia. Parasites were maintained in 96-well microtiter

plates for 24 hr and the parasitaemia monitored by FACS. For all three lines the average growth

rates in each of the three Fy subtypes were similar and there was no significant difference between

growth in Fya and Fyb RBCs (Figure 4E–G; Figure 4—source data 1).

Growth inhibition activity (GIA) assays revealed that all lines remained equally susceptible to inva-

sion inhibition by both an anti-DARC camelid nanobody CA111 and a polyclonal aPkMSP119 anti-

body (Figure 5A). In contrast, purified IgGs from polyclonal rabbit sera raised against PvDBP_RII,

demonstrated low-level GIA activity for wild type and PkDBPaOR/DbDg lines (~30% inhibition at 10

mg/ml) but a significantly stronger GIA activity against the PvDBPOR/D14 and PvDBPOR/DbDg lines,

reaching a maximum inhibition of ~75% at 10 mg/ml and around 50% at 4 mg/ml (Figure 5B and C).

At 2.5 mg/ml IgG the GIA activity against the PvDBP OR/D14 and PvDBPOR/DbDg lines were

29.6 ± 3.3 and 24.6 ± 2.6% and significantly higher compared to wild type and PkDBPaOR/DbDg lines

(p<0.001) (Figure 5D and E). The PvDBPOR parasite lines could thus be readily inhibited by antibod-

ies against the P. vivax protein and the PkDBPa orthologues PkDBPg and b appeared to play no

interactive role.

We thus have created a transgenic P. knowlesi model, modified at two separate loci which reca-

pitulates the P. vivax DBP invasion pathway. This parasite line is a vital new tool in PvDBP vaccine

development.

DiscussionIn this work, we adapt CRISPR-Cas9 genome editing to the zoonotic malaria parasite P. knowlesi.

Whilst various approaches for CRISPR-Cas9 have been used for other malaria parasites, here we

combine a plasmid containing a single recyclable positive selection marker with a fusion PCR-based

approach for generation of repair templates. This allows for seamless insertion or deletion at any

location within a gene and unlimited iterative modifications of the genome. Genome-wide reverse

genetics screens have been applied with great success to the rodent malaria parasite, P. berghei,

but they have remained challenging for P. falciparum, and impossible for P. vivax. The tools pre-

sented here will enable scalable construct assembly and genome-wide systematic knockout or tag-

ging screens in an alternative human infective species, thus providing a complementary tool to

address both shared and species-specific biology. The analysis of lines with multiple tagged or




A

CB

ED

0

20

40

60

80

100

GIA

(%

)

anti-DARC [3

mg/m

L]

anti-DARC [1

.5mg

/mL]

anti-PkM

SP1 19 Ig

G [2

.5 m

g/mL]

anti-PkM

SP1 19 Ig

G [5

mg/m

L]

PkDBPaOR

/D14

PvDBPOR

/D14

PkDBPaOR

/D14Dg

PvDBPOR

/D14Dg

Contr

ol

anti-

PvD

BP_R

II

Contr

ol

anti-

PvDBP_R

II0

10

20

30

40

50

2.5 mg/mL IgG

GIA

(%

)

WT

PvDBPOR

/D14

****

****

****

Contr

ol

anti-

PvD

BP_R

II

Contr

ol

anti-

PvDBP_R

II0

10

20

30

40

50

2.5 mg/mL IgG

GIA

(%

)

PkDBPaOR

/D14Dg

PvDBPOR

/D14Dg

****

****

****

0.1110

0

20

40

60

80

100

IgG (mg/mL)

GIA

(%

) Control IgGAnti-PvDBP_RII IgG

Anti-PvDBP_RII IgGControl IgG

PvDBPOR

/D14

WT

0.1110

0

20

40

60

80

100

IgG (mg/mL)

GIA

(%

) Control IgGAnti-PvDBP_RII IgG

Anti-PvDBP_RII IgGControl IgG

PvDBPOR

/D14Dg

PkDBPaOR

/D14Dg

Figure 5. Transgenic P. knowlesi orthologue replacement lines provide surrogates for P. vivax vaccine development. (A) Graph showing growth

inhibition activity (GIA, %) of anti-DARC nanobody at 1.5 and 3 mg/ml and anti-MSP119 purified total rabbit IgG at 2.5 and 5 mg/ml on the parasite lines.

Data points represent the mean and error bars denote ±1 SD of triplicate test wells (n = 3). GIAs of each antibody were compared across the parasite

lines by using unpaired one-way ANOVA with Tukey’s multiple comparisons test of means. No significant changes were observed. (B) Graph shows the

Figure 5 continued on next page




deleted genes is particularly valuable for multigene families with highly redundant functions, as

exemplified by our modification of all three P. knowlesi DBP genes.

Here we investigate key parameters associated with successful genome editing and show that the

process is also highly robust; targeting of the p230p locus demonstrated successful editing for 25/25

transfections and only 1/10 sgRNAs targeting different loci failed to generate an edited line. The fail-

ure of an sgRNA guide (AGAAAATAGTGAAAACCCAT) designed to target the DBPb locus, a non-

essential gene, suggests that multiple guides may need to be tested for some loci. All sgRNA guides

used are shown in Figure 3—source data 1. We did not detect any off-target effects, consistent

with other reports of CRISPR-Cas9 use in malaria parasites (Ghorbal et al., 2014; Lu et al., 2016;

Wagner et al., 2014; Zhang et al., 2017). Negative selection of the pCas9/sg plasmid then enables

generation of markerless lines allowing unlimited iterative modifications of the genome, with each

round requiring only ~30 days (including dilution cloning). Whilst the generation of markerless Cas9

modifications in the genome of P. falciparum has been possible for some time, initial systems con-

tained multiple different selectable markers and relied on passive loss of episomes to recycle at least

one marker (Ghorbal et al., 2014; Mogollon et al., 2016; Lu et al., 2016; Wagner et al., 2014).

Whilst this is possible in some cases, it can create difficulties particularly if long selection protocols

are necessary which may result in stabilisation/integration of episomes. Our format is similar to a

more recent system developed in P. falciparum (Knuepfer et al., 2017), which by using only one

bifunctional positive/negative selection cassette enables complete recycling of selectable markers.

This has critically enabled generation of important base lines such as marker-free dimerisable Cre

recombinase lines used for conditional knockouts in P. falciparum (Knuepfer et al., 2017). More

extensive modifications using Cas9, such as the three sequential genetic modifications undertaken

for P. yoelli (Zhang et al., 2017), remains relatively uncommon suggesting that the timescales

involved in generation of these lines is still a challenge.

One clear disadvantage of this system is that we do still see a background remnant of wild type

parasites for many of the modifications that are made. This may mean that modifications resulting in

slow growing phenotypes could create a challenge for generating clonal lines. In our subsequent

experience this is largely mitigated by the relatively fast grow out times and in extreme instances

may be combated by immediately cloning after transfection. The selection-linked integration (SLI)

method used in P. falciparum and P. knowlesi rapidly selects for genomic integration by using an

additional selectable marker that is only expressed when correctly integrated, resulting in transgenic

lines that do not require cloning (Birnbaum et al., 2017; Lyth et al., 2018). The disadvantage of this

approach is that multiple selectable markers are required and at least one of them cannot be

recycled in the final transgenic line, limiting scope for subsequent modifications. In our experience,

the ability to extensively and iteratively modify parasites has been perhaps the most transformative

aspect of this method and was integral to our work to modify all members of the PkDBP family.

Importantly, as Cas9 modified lines are markerless, the two systems are entirely compatible, such

that a baseline containing a range of Cas9 induced modifications could then be modified again using

a SLI-based approach to enable access to more challenging slow growing mutants.

Parasites with integration of eGFP into the p230p locus reached 1% parasitaemia in 8 to 14 days

after transfection. However for the most efficient transfections we were able to observe parasites

Figure 5 continued

% GIA of a dilution series of IgG purified from sera of PvDBP_RII (SalI)-immunized rabbits as well as control IgG from the pre-immunisation sera of the

same rabbits against wild type (WT) and PvDBPOR/D14 transgenic P. knowlesi lines and (C) against PkDBPaOR/D14Dg and PvDBPOR/D14Dg lines. Data

points represent the mean and error bars denote ±1 SD of five or six replicates. (D) Bar chart showing % GIA of 2.5 mg/ml IgG purified from sera of

PvDBPRII (SalI)-immunized rabbits as well as control IgG from the pre-immunisation sera of the same rabbits against wild type (WT) and PvDBPOR/D14

transgenic P. knowlesi lines and (E) against PkDBPaOR/D14Dg and PvDBPOR/D14Dg lines. Bars represent the mean and error bars denote ±1 SD of five or

six replicates and were compared by using one-way ANOVA with Tukey’s multiple comparisons test of means. ns p>0.05, *<0.05, **<0.01, ***<0.001.


The following source data is available for figure 5:



Source data 2. Full primer list for entire study.








reaching 1% at only 5 to 6 days suggesting significant differences in targeting efficiency at different

loci and with different gRNAs. Whilst P. knowlesi grows slightly faster (with 3–4 fold per cycle equat-

ing to around 9-fold in 48 hr) than P. falciparum, this still indicates orders of magnitude greater mod-

ification rates than achieved for P. falciparum - which can take 2–6 weeks for transgenic parasites to

be detected in culture depending on the transfection system used (Ghorbal et al., 2014;

Mogollon et al., 2016; Lu et al., 2016; Knuepfer et al., 2017; Wagner et al., 2014). Despite the

relatively fast recovery time it is also clear that as more than 8% of parasites are able to take up

donor DNA during transfection it still takes more than a week for integrated parasites to grow out,

indicating that efficiency of homology mediated repair is still the major bottleneck and the majority

of Cas9 induced DSBs are not successfully repaired.

We systematically tested key parameters associated with successful genome editing and found

increasing HR length enhanced integration efficiency proportionately, a trend seen in both P. falcipa-

rum and P. berghei (Collins et al., 2013; Wagner et al., 2014; MacPherson and Scherf, 2015).

Whilst integration was detected with HRs as short as 50 bp, efficient editing was achieved with HRs

between 200–800 bp. We were also able to examine how distance from the DSB affected editing

efficiency. Whilst in other systems editing efficiency decreases rapidly as the DSB distance increases,

we saw only a steady decline with distance, an effect which could be ameliorated by simply increas-

ing HR length. The use of PCR products as repair templates is particularly well adapted for tagging

and knockout approaches which tend to be relatively short. For relatively large or complex con-

structs, such as those for gene replacement, or those targeting multigenic families conventional clon-

ing may be preferable, as shown here for the PkDBP family.

By applying these techniques to the P. knowlesi and P. vivax DBP family we have been able to

examine the role of these genes in host and reticulocyte preference of the two species. Even after

long-term adaptation to culture with human RBCs, P. knowlesi parasites can retain a strong prefer-

ence for invasion of macaque RBCs (Dankwa et al., 2016; Moon et al., 2016). Both DBPg and DBPb

have been shown to bind to proteins with a distinct sialic acid residue found in non-human primates,

but absent in humans (Dankwa et al., 2016). Deletion of these genes led to a significant increase in

growth rates in human RBCs, and interestingly also a similar, but non-significant, increase in growth

rates in macaque RBCs. This suggests that PkDBPa alone is sufficient to retain the multiplication

capacity and that the PkDBP paralogues are not responsible for the macaque cell preference

retained in the A1-H.1 human adapted line. Whilst likely non-functional for invasion of human RBCs,

both PkDBPg and DBPb would still compete for surface space and potentially some of the same

interacting proteins as DBPa, which may account for the increased growth rate when they are

deleted. The increased growth rate in macaque cells, would suggest that even here, where DBPg

and DBPb are functional, PkDBPa is the preferred and more efficient pathway for invasion in

macaque cells. In vivo, this advantage would be countered by the significant benefits provided by

redundancy both to combat host blood cell polymorphisms and antibody responses. Importantly,

this data suggests that loss of DBPg and DBPb could provide an adaptation route to increased

growth/virulence within human infections. However, to do so the parasites would need to sacrifice

redundancy within its primary macaque hosts – a situation only likely to occur with prolonged human

to human transmission. Further work to analyse the effect of these mutations through long-term par-

asite competition assays will enable us to determine the precise extent of this advantage and deter-

mine how quickly such mutations could move to fixation within a parasite population.

Despite being closely related to P. knowlesi and other macaque infecting species such as P. cyno-

molgi, P. vivax cannot infect macaques and the PvDBP protein has been suggested to play a role in

enforcing this tropism, as key interacting residues are missing within the macaque DARC protein

(Tachibana et al., 2015). P. knowlesi parasites expressing PvDBP in the absence of DBP paralogues

demonstrate a significant reduction in growth in macaque cells, resulting in an overall shift towards

preference for human cells consistent with PvDBP binding macaque DARC less efficiently. Neverthe-

less as the multiplication rate remained quite close to that seen for human RBCs it seems unlikely

that the PvDBP protein alone represents a significant barrier to P. vivax infection of macaques.

Previous work has shown that PvDBP_RII binds more strongly to RBCs expressing the Fyb allele of

the Duffy antigen than Fya, with studies using recombinant protein demonstrating that the binding

efficiency is 50% lower for Fya (Kano et al., 2018). This effect was shown to correlate with a 30–80%

reduced risk of clinical vivax malaria amongst patients with the FyA phenotype (King et al., 2011). A

similar effect of reduced DBP-FyA binding has also been demonstrated using recombinant PkDBPa




(Fong et al., 2018) but experiments to examine this with human RBC culture adapted P. knowlesi

parasites failed to demonstrate any difference in multiplication rates in either Fyb+ or Fya+ RBC

(Moon et al., 2013). Here, we also did not observe a significant association between growth of the

PvDBPOR/D14Dg line and Duffy haplotype. Whilst the size of our dataset cannot rule out relatively

subtle effects on parasite growth rate, which over the course of an infection could become clinically

relevant, it does rule out major growth differences and demonstrates that the invasion process is

very tolerant of even quite large changes in receptor-ligand affinity. Notably, the study first identify-

ing a role for Duffy polymorphisms in P. vivax clinical susceptibility also demonstrated that the Fya+

RBCs demonstrate increased sensitivity to invasion-blocking antibodies, so protective effects may

stem from this rather than a direct effect on invasion efficiency (King et al., 2011; Moon et al.,

2013). Subsequent experiments using these lines could readily test this hypothesis.

Another key difference between the two species is that unlike P. knowlesi, P. vivax has a strict

restriction to invasion of reticulocytes. A second family of RBC binding proteins, known as the reticu-

locyte binding-like proteins (RBPs) have previously been implicated in this tropism. More recently,

the PvDBP protein itself has been implicated with work using recombinant PvDBP_RII suggesting

that whilst DARC is present on both reticulocytes and mature normocytes, changes during red cell

maturation mean that DARC is only accessible to PvDBP binding in young reticulocytes

(Ovchynnikova et al., 2017; Haynes et al., 1988). Here we show that transgenic P. knowlesi para-

sites using PvDBP for invasion have no such restriction, invading human RBCs (which typically contain

less than 0.5% reticulocytes) with the same efficiency as those expressing PkDBPa – thus providing

compelling evidence that PvDBP plays no role in the reticulocyte tropism. Further, recent work

determining that PvRBP2b, which lacks an orthologue in P. knowlesi, binds to the reticulocyte spe-

cific marker CD71 further asserts the RBPs as the key to reticulocyte tropism. Importantly, the ability

to compare and contrast activity of Pk/Pv DBP family members in parasitological assays will provide

a vital new tool to test hypotheses and models arising from studies that have until now relied on

assays using recombinant protein fragments.

Using a combination of binding assays, mutagenesis and structural studies with recombinant

PvDBP_RII, previous work has identified residues involved in DBP-DARC interactions (Choe et al.,

2005; Hans et al., 2005; VanBuskirk et al., 2004), as well as a DBP dimerization domain thought to

drive the stepwise engagement with DARC (Batchelor et al., 2014; Batchelor et al., 2011). Efforts

to develop a P. vivax vaccine to elicit antibodies against the lead candidate PvDBP have predomi-

nantly relied on using ELISA-based assays, which assess the ability of antibodies to block recombi-

nant PvDBP_RII binding to DARC (Shakri et al., 2012). This has successfully identified a range of

binding inhibitory antibodies mapped to residues involved in DARC binding, dimerization as well as

subdomain 3, which is distant from the DARC binding site, demonstrating that multiple mechanisms

of inhibition may be important (Chen et al., 2016; Chootong et al., 2010). However, validation of

these findings in a parasitological assay is critical. Some epitopes identified in recombinant protein

assays may be inaccessible in the context of invasion and it is also possible that not all inhibitory anti-

bodies block receptor binding. DARC-DBP binding is only one step in the multi-step invasion pro-

cess, with subsequent conformational changes and potential downstream signalling roles for the

protein (Batchelor et al., 2011). The full-length DBP antigen is 140 kDa which contains a C-terminal

transmembrane domain and as such structural and biochemical analysis of the protein has almost

exclusively focused on the PvDBP_RII fragment alone. Whilst efforts to standardise ex vivo P. vivax

assays have been successful (Russell et al., 2011), they remain hugely challenging, low throughput

and rely on genetically diverse P. vivax clinical isolates, that are maintained in culture for a only a sin-

gle cycle of RBC invasion. The P. knowlesi PvDBPOR line thus provides an opportunity to interrogate

the function of the full-length protein in an accessible and scalable manner.

Whilst the relationship between in vitro GIA and in vivo protection against malaria challenge has

not always been clear, previous studies have shown that there is a strong correlative link between

activity in the in vitro assay of GIA and in vivo protection from challenge of two different species of

human malaria (P. falciparum and P. knowlesi) in two different non-human primate models (Aotus

monkeys and rhesus macaques) targeting three different merozoite proteins (PfAMA1, PfRH5,

PfMSP1) (Douglas et al., 2015; Mahdi Abdel Hamid et al., 2011; Singh et al., 2006). Importantly,

Douglas et al. in 2015 determined a threshold value for in vitro GIA assay which must be reached

before protection from malaria challenge is afforded (Douglas et al., 2015). Thus, the ability to




readily assess P. vivax candidates in an in vitro GIA offers an important mechanism to determine

whether candidates are appropriate for moving on to challenge studies.

A vaccine against P. vivax must ultimately elicit antibodies with strain-transcending inhibitory

activity, but the ability to test on a defined genetic background can provide a significant advantage

when it comes to benchmarking and prioritising target epitopes and characterising sera raised

against them. Here we use the PvDBP sequence from the SalI reference strain, but multiple lines

expressing distinct PvDBP variants could be generated in future, as has already been used for

recombinant ELISA based assays (Ntumngia et al., 2012), to systematically examine inhibition in

heterologous strains. Isolates refractory to a given test antibody in ex vivo assays can then be

sequenced and direct the generation of new transgenic P. knowlesi PvDBPOR variant lines to support

rational vaccine development. These assays in turn can provide vital triaging for non-human primate

models, and controlled human challenge infections (Payne et al., 2017a; Russell et al., 2011; Are-

valo-Herrera et al., 2005; Payne et al., 2017b) – both of which carry the imperative to ensure that

only highly optimised antigens are tested. The transgenic P. knowlesi OR lines developed here rep-

resent the ideal platform for scalable testing of polyclonal and monoclonal sera from vaccine trials

and natural P. vivax infections. This will enable detailed investigation of epitopes providing invasion

inhibitory activity and a means for systematic development of a strain-transcending vaccine. Our

work also revealed low-level cross-reactivity of PvDBP_RII antibodies against P. knowlesi and sug-

gests cross-immunity between the two species could exist in the field, which may have a significant

impact on disease outcome. Understanding the precise epitopes involved could facilitate develop-

ment of a dual species vaccine, and epitopes conserved across species are also more likely to be

conserved across polymorphic strains of P. vivax. The same approach could readily be applied to

other potential vaccine candidates, novel drug targets or to investigate mechanisms of drug resis-

tance, which are also thought to differ between P. falciparum and P. vivax (Price et al., 2014).

In conclusion, we demonstrate that adaptation of CRISPR-Cas9 genome editing to P. knowlesi

provides a powerful system for scalable genome editing of malaria parasites and can provide critical

new tools for studying both shared and species-specific biology.

Materials and methods

Key resources table

Reagenttype (species)or resource Designation

Source orreference Identifiers Additional information

Cell line(Plasmodiumknowlesi)

A1-H.1 wild type (WT) (Moon et al., 2013),Mike Blackman, FrancisCrick Institute London


p230p eGFP cassette this paper Can be obtainedfrom Rob Moon,LSHTM


AMA1-HA this paper Can be obtainedfrom Rob Moon,LSHTM


RON2-HA this paper Can be obtainedfrom Rob Moon,LSHTM


Myosin A-eGFP this paper Can be obtainedfrom Rob Moon,LSHTM


CRT-eGFP this paper Can be obtainedfrom Rob Moon,LSHTM


mCherry-K13 this paper Can be obtainedfrom Rob Moon,LSHTM

Continued on next page




Continued




PkDBPaOR/D14 this paper Can be obtainedfrom Rob Moon,LSHTM


PvDBPOR/D14 this paper Can be obtainedfrom Rob Moon,LSHTM


PkDBPaOR/D14Dg this paper Can be obtainedfrom Rob Moon,LSHTM


PvDBPOR/D14Dg this paper Can be obtainedfrom Rob Moon,LSHTM


PkDBPaOR this paper Can be obtainedfrom Rob Moon,LSHTM


PkDBPaOR/Db this paper Can be obtainedfrom Rob Moon,LSHTM

Transfectedconstruct (plasmid)

pCas9/sg_p230p this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_PkDBPa this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_DBPb this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_DBPg this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_AMA1 this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_RON2 this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_Myosin A this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_K13 this paper Can be obtainedfrom Rob Moon,LSHTM


pCas9/sg_CRT this paper Can be obtainedfrom Rob Moon,LSHTM


pDonor_p230p this paper Can be obtainedfrom Rob Moon,LSHTM


pDonor_PkDBPaOR this paper Can be obtainedfrom Rob Moon,LSHTM


pDonor_PvDBPOR this paper Can be obtainedfrom Rob Moon,LSHTM





Continued




pDonor_PkDBPb this paper Can be obtainedfrom Rob Moon,LSHTM


pDonor_PkDBPg this paper Can be obtainedfrom Rob Moon,LSHTM

Antibody aPkMSP119(rabbit polyclonal)

Ellen Knuepfer,Francis Crick InstituteLondon

2.5 and 5 mg/ml

Antibody anti-DARC nanobodyCA111(camel)

Olivier Bertrand,INSERM, France

(Smolarek et al., 2010)

1.5 and 3 mg/ml

Antibody PvDBP_RII (rabbitpolyclonal)

Simon Draper,Jenner InstituteOxford,(de Cassan et al., 2015)

Antibody Alexa Fluor(TM) 594Goat Anti-Rabbit IgG(H + L) highlycross-adsorbed(goat polyclonal)

Invitrogen Cat. #: A-11037 dilution 1:5000

Antibody anti-HA high affinity(3F10), 50 UG(rat monoclonal)

Sigma Cat. #: 11867423001 dilution 1:5000

Antibody anti-mCherry(rabbit polyclonal)

Abcam Cat. #: ab183628 dilution 1:5000

Antibody anti-GFP(mouse monoclonal)

Sigma Cat. #: 11814460001 dilution 1:5000

Antibody mouseHRP-conjugatedsecondary antibody(goat)

Bio-Rad Cat. #: 1706516 dilution 1:5000

Antibody Duoclone Monoclonal Lorne Cat. #: 740010

Antibody Anti-Human IgG(clear)

Lorne Cat. #: 401010

Antibody Anti-FyB Monoclonal Lorne Cat. #: 317002

Antibody Anti-FyA Monoclonal Lorne Cat. #: 774002

Antibody Anti-B Monoclonal Lorne Cat. #: 610010

Antibody Anti-A Monoclonal Lorne Cat. #: 600010

Chemicalcompound, drug

4-[7-[(dimethylamino)methyl]�2-(4-fluorphenyl)imidazo[1,2-a]pyridin-3-yl]pyrimidin-2-amine(compound 2)

Michael Blackman,Francis Crick InstituteLondon

Software,algorithm

Protospacer software http://www.protospacer.com/

Software,algorithm

GraphPad Prism GraphPad Prism(http://graphpad.com)

RRID:SCR_015807 Version 7

Software,algorithm

Nikon Elements AdvancedResearch software package

https://www.microscope.healthcare.nikon.com/products/software/nis-elements

Software,algorithm

Benchling Software https://www.benchling.com/ RRID:SCR_013955




http://www.protospacer.com/


http://graphpad.com

https://scicrunch.org/resolver/SCR_015807





https://www.benchling.com/



Continued



Software,algorithm

FACSDiva 6.1.3 software http://www.bdbiosciences.com/ca/instruments/clinical/software/flow-cytometry-acquisition/bd-facsdiva-software/bd-facsdiva-software-v-613/p/643629

RRID:SCR_001456

Software,algorithm

FlowJo_V10 https://www.flowjo.com/ RRID:SCR_008520 version 10

Software,algorithm

sambamba software https://github.com/biod/sambamba

Software,algorithm

R https://www.r-project.org/ RRID: SCR_001905

Commercialassay or kit

QIAseq FX DNA Library Kit Quiagen Cat. #: 180473


Pierce Protein A IgGPurification Kit

ThermoFisherScientific

Cat. #: 44667


Recombinant ProteinG Agarose

ThermoFisherScientific

Cat. #: 15920010

Macaque and human RBCsMacaca fascicularis blood was collected by venous puncture. Animal work was reviewed and

approved by the local National Institute for Biological Standards and Control Animal Welfare and

Ethical Review Body (the Institutional Review Board) and by the United Kingdom Home Office as

governed by United Kingdom law under the Animals (Scientific Procedures) Act 1986. Animals were

handled in strict accordance with the ‘Code of Practice Part one for the housing and care of animals

(21/03/05)’ available at https://www.gov.uk/research-and-testing-using-animals. The work also met

the National Centre for the Replacement Refinement and Reduction of Animals in Research (NC3Rs)

guidelines on primate accommodation, care, and use (https://www.nc3rs.org.uk/non-human-pri-

mate-accommodation-care-and-use), which exceed the legal minimum standards required by the

United Kingdom Animals (Scientific Procedures) Act 1986, associated Codes of Practice, and the US

Institute for Laboratory Animal Research Guide. For most experiments and routine parasite mainte-

nance, human blood (Duffy (FY) positive) was obtained from the United Kingdom National Blood

Transfusion Service under a research agreement. For the Duffy subtype experiment, venous blood

(~10 mL) from 21 healthy volunteers blood donors was collected into EDTA Vacutainer (SLS), after

donors had provided informed consent. Blood samples were anonymized, and then RBCs washed

with RPMI 1640 and stored at 4˚C. All. The project, consent and protocol were approved by the

LSHTM Observational Research Ethics Committee under project reference 5520–1.

Parasite maintenance, transfection and dilution cloningParasites were maintained in complete media, comprising RPMI 1640 (Invitrogen) with the following

additions: 2.3 g/L sodium bicarbonate, 4 g/L dextrose, 5.957 g/L HEPES, 0.05 g/L hypoxanthine, 5 g

/L Albumax II, 0.025 g/L gentamycin sulfate, 0.292 g/L L-glutamine, and 10% (vol/vol) horse serum

as described previously (Moon et al., 2016). Parasites were synchronized by using gradient centrifu-

gation with 55% nycodenz (Progen) in RPMI to enrich schizonts, followed by a two-hour incubation

with 4-[7-[(dimethylamino)methyl]�2-(4-fluorphenyl)imidazo[1,2-a]pyridin-3-yl]pyrimidin-2-amine

(compound 2) which inhibits parasite egress (Collins et al., 2013). Incubations in compound 2 longer

than 2 hr led to degeneration of schizonts and reduction in invasive capacity.

Tightly synchronized mature schizonts were transfected as described previously using the Amaxa

4D electroporator (Lonza) and the P3 Primary cell 4D Nucleofector X Kit L (Lonza)(Moon et al.,

2013). 10 ml DNA including at 20 mg repair template pDonor_p230p and 20 mg pCas9/sg_p230p

plasmid was used for transfections to generate eGFP expressing lines. 10 ml DNA including 15 mg

repair template and 7 mg pCas9/sg_p230p plasmid was used for transfections to integrate the eGFP

expression cassette into the p230p locus with PCR repair templates. For generating tagged lines 10



http://www.bdbiosciences.com/ca/instruments/clinical/software/flow-cytometry-acquisition/bd-facsdiva-software/bd-facsdiva-software-v-613/p/643629







https://www.flowjo.com/


https://github.com/biod/sambamba

https://github.com/biod/sambamba

https://www.r-project.org/


https://www.gov.uk/research-and-testing-using-animals.

https://www.nc3rs.org.uk/non-human-primate-accommodation-care-and-use

https://www.nc3rs.org.uk/non-human-primate-accommodation-care-and-use


mg pCas/sg_GOI plasmid and 20 mg PCR repair templates were used. After 24 hr, and at daily inter-

vals for 5 days, the medium was replaced with fresh medium containing 100 nM pyrimethamine

(Sigma). Parasites were cloned out by limiting dilution. Parasites were diluted to 0.3 parasites/100 ml

and 100 ml of 2% haematocrit culture was transferred to 96 flat-bottom plates in culture medium

containing 200 mM L-glutamax (Sigma). After 7 days the media was changed and 0.2% fresh blood

added. On day 11 the plate was screened for plaques, in an assay modified from P. falciparum

(Thomas et al., 2016). Plaque positive cultures were transferred to 24 well plates containing 1 ml

media with 2% haematocrit and used for genotyping.

DNA constructs and PCRsPreparative DNA for plasmid cloning and PCR fusion constructs was amplified with CloneAmp

(Takara) using the following cycle conditions: 32 cycles of 5 s at 98˚C, 20 s at 55˚C, and 5 s/kb at 72˚

C. Genomic DNA was prepared using DNeasy blood and tissue kit (Qiagen).

Cloning of pkcon_mCherry plasmidThe plasmid pkconGFP (Moon et al., 2013) was modified to replace the GFP coding sequence with

mCherry using XmaI and SacII restriction sites. The mCherry sequence was amplified with primers

fwd-ATATCCCGGGATGGTGAGCAAGGGCGAGGAG and rev-ATATCCGCGGTTACTTGTACAGC

TCGTCCATGCC.

Cloning of pCas9/sgThe pUF1 plasmid (Ghorbal et al., 2014) was modified by replacing the yDHODH expression cas-

sette with hDHFR-yFCU fusion with PkEF1a 5’UTR and Pbdhfr 3’UTR using EcoRI and SacII. The PfU6

promoter for gRNA expression of the pL6 plasmid (Ghorbal et al., 2014) was replaced with the

PkU6 5’ regulatable region of 1244 bp (amplified with primers fwd-ATATCCATGGGGCCAGGGAA-

GAACGGTTAGAG and rev-atattcgcgagcgatgagttcctaggAATAATATACTGTAAC) using NruI and

NcoI and the entire cassette inserted into the pCas9 plasmid with PvuI and ApaI restriction sites.

Each target specific 20 bp guide sequence was chosen with the Protospacer software (http://www.

protospacer.com/), with off-target score <0.03. On-target scores were retrieved from Benchling

Software (Benchling, 2018). All guide sequences are listed in Figure 4—source data 2. Subse-

quently each guide was inserted into the BtgZI linearized pCas9/sg plasmid by In-Fusion cloning

(Takara) using primers fwd-TTACAGTATATTATT(N20)GTTTTAGAGCTAGAA and rev-TTCTAGCTC

TAAAAC(N20)AATAATATACTGTAA. Briefly, 50 bp primer pairs containing the 20 bp guide

sequence flanked by 15 bp overhangs homologous to the 5’ and 3’ ends of pCas9/sg were dena-

tured by incubation at 95˚C for 10 min and annealed by slow cooling. 0.5 mM annealed primers and

50 ng BtgZI linearized pCas/sg vector were incubated with In-fusion Premix (Takarta) at 50˚C for 15

min. The resulting plasmid was transformed into XL10 gold competent E. coli cells (Agilent). Plas-

mids for transfection were prepared by Midi-preps (QIAGEN) and ethanol precipitated. The DNA

pellet was washed twice with 70% ethanol and resuspended in sterile TE buffer.

Cloning of pDonor_p230pA plasmid containing a multiple cloning site with SacII, SpeI, NotI, BlpI and NcoI was designed (sub-

sequently called pDonor) and obtained from Geneart (Thermo Fisher Scientific). Homology region 1

(HR1) was amplified from A1-H.1 wild type genomic DNA with primers olFM007 and olFM008 and

added with SacII and SpeI restriction sites. HR2 was amplified with primers olFM005 and olFM006

and was added with BlpI and NcoI sites. The eGFP cassette was amplified from the pkconGFPp230p

plasmid with primers olFM151and olFM152 and inserted into the plasmid with SpeI and BlpI sites.

The final vector was linearised with PvuI restriction enzyme and ethanol precipitated as described

above.

Cloning of pDonor_pkdbpaPlasmid pDonor was modified by restriction cloning to include two 500 bp HRs from PkDBPa 5’ and

3’UTRs using primers olFM062 and olFM063 (adding SacII/SpeI sites) and primers olFM064 and

olFM065 (adding NotI/NcoI sites) respectively. Recodonised sequences of PkDBPa and PvDBP of

the P. vivax Salvador I strain flanked with SpeI and NcoI restriction sites were obtained from Geneart






(Thermo Fisher Scientific) and subsequently cloned between both HRs of the modified pDonor plas-

mid using SpeI and NcoI sites. The resulting plasmid was linearised with PvuI restriction enzyme and

ethanol precipitated as described above. Primer pairs are shown in Figure 4—source data 2 and

primer sequences in Figure 5—source data 2.

Cloning of pDonor_ pkdbpgPlasmid pDonor was modified by restriction cloning to include two HRs from PkDBPg 5’ and 3’UTRs

using primers olFM245 and olFM0246 (adding SacII/SpeI sites) and primers olFM0247 and olFM248

(adding NotI/NcoI sites) respectively. A spacer sequence, to aid in subsequent diagnostic PCRs was

generated by polymerase cycling assembly (PCA). Briefly, the spacer sequence was synthesised by

using primers of 60 bp length with 20 bp homologous sequence to the adjacent primers on each

side. Final concentrations of 0.6 mM for outer primers (ol488 and ol492) and 0.03 mM of inner primers

(ol489, ol490, ol491 and ol503 were used for PCA with the same cycle conditions as described for

PCR. The final product was inserted with SpeI and NcoI restriction sites between the HRs as

described for pDonor_ pkdbpa cloning, to replace the deleted DBPg genes. Primer pairs are shown

in Figure 4—source data 2 andprimer sequences in Figure 5—source data 2.

Three-step nested PCRGeneration of each PCR repair template was carried out by a three-step nested PCR method to fuse

together HRs with the insert DNA (eGFP expression cassette, eGFP with N-terminal linker or

mCherry with C-terminal linker). In a first set of PCRs, the DNA insert (eGFP expression cassette or

tag) and the HRs for integration into the region of interest were individually amplified in duplicate.

The HRs included at least 50 bp overhangs (OH) so that nested PCRs could be carried out in the

next PCR step, without shortening the final size of HRs. Nested PCRs were carried out to increase

the yield of PCR product. The HRs contained at least 20 bp and 58˚C Tm overhangs with homology

to the insert DNA (HR1 with C-term overhang homologous to the N-term of insert DNA and HR2

with N-term overhang homologous to the C-term of the insert DNA). All duplicates were pooled

and products were extracted from agarose gel (Qiagen) to remove primers and background ampli-

cons. In a second nested PCR HR1 was fused to the donor amplicon in duplicate with double the

amount of time allowed for the elongation step (10 s/kb) and again the product was gel extracted.

In the final step the HR1-insert and HR2 were fused together resulting in the final product HR1-

insert-HR2 (Figure 2A). PCR repair templates for HA tagging were generated in a two-step PCR

method. First the HRs were individually amplified with addition of 27 bp HA sequence overhangs on

the 3’end of HR1 and the 5’end of HR2. In the second nested PCR HR1 and HR2 were fused.

All primers are listed in Figure 5—source data 2 and all primer combinations for each contruct

are listed in Figure 2—source data 2. Six to eight 50 ml reactions of the final construct PCRs were

pooled (300 to 400 ml final volume and 20 mg DNA), ethanol precipitated and resuspended into ster-

ile TE buffer for transfection. DNA concentrations were determined using Nano-Drop and band

intensity measurement with BioRad Image lab software.

DNA analysisGenomic DNA from transfected parasite lines was extracted (QIAGEN) and analysed by PCR with

GoTaq Master Mix (Promega) using the following conditions: 3 min at 96˚C, then 30 cycles of 25 s at

96˚C, 25 s at 52˚C, and 1 min/kb at 64˚C.

Western blottingTo detect tagged proteins of interest, soluble cell extracts were prepared by lysing Nycodenz-

enriched schizonts in 0.15% saponin. Parasite pellets were washed several times with cold PBS and

centrifugation at 13,000 rpm for 3 min at 4˚C to remove haemoglobin and red cell debris. Pellets

were lysed in five pellet volumes of RIPA buffer (25 mM Tris, 150 mM NaCl, 1% Triton X-100, 0.5%

Sodium deoxycholate, 0.1% SDS, pH 7.5, 1x Roche Protease Inhibitors) supplemented with 50 units

BaseMuncher (Expedeon) on ice for 20 min. This whole cell lysate was clarified by centrifugation at

13,000 rpm for 30 min at 4˚C. Soluble extracts were separated on Mini-Protean 4–20% TGX gels

(Bio-Rad) and transferred to nitrocellulose using the Trans-blot Turbo system (Bio-Rad). Equivalent

uninfected red cell lysate or wild type P. knowlesi schizont lysates were analysed alongside lysates




containing tagged proteins of interest. Membranes were blocked overnight, and tagged proteins

were detected with mouse anti-GFP (Sigma, 1:5,000), rat anti-HA (Sigma 3F10 clone, 1:5,000), or

rabbit anti-mCherry (Abcam, 1:5,000). Primary antibodies were detected using HRP-conjugated sec-

ondary antibodies (Bio-Rad, 1:5,000) and ECL (ThermoFisher Pierce). Chemiluminescence was cap-

tured using the Azure c600 system.

Immunofluorescence assays and live cell imagingImmunofluorescence assays were performed using blood smears fixed with 4% paraformaldehyde

for 30 min followed by washing in PBS and permeabilisation in 0.1% Triton-X100 for 10 min. Slides

of HA-tagged parasite lines were blocked overnight at 4˚C in 3% bovine serum albumin/PBS and

then labelled with rabbit anti-HA high affinity (1:250) and Alexa Fluor 488-conjugated a-rabbit IgG

(1:5,000) (Thermo Fisher Scientific). The smears were mounted in ProLong Antifade mountant with

DAPI (Thermo Fisher Scientific). For live cell imaging parasites were stained with Hoechst 33342

(New England Biolabs), transferred to poly-L-lysine-coated m-slides VI (Ibidi, Martinsried, Germany).

Both live and fixed preparations were viewed with a Nikon Ti E inverted microscope using a 100x oil

immersion objective and imaged with an ORCA Flash 4.0 CMOS camera (Hamamatsu). Images were

acquired and processed using the Nikon Elements Advanced Research software package.

Parasite multiplication rate assaysIn this flow cytometry-based assay the fold increase in parasitemia following one round of asexual

growth is measured. Purified schizonts were set up in technical duplicate cultures with human RBCs,

at a 2% hematocrit and ~0.5% parasitemia in 24 well plates. Parasitemia was measured with a flow

cytometry (FACS)-based assay before and after incubation at 37˚C in a gassed chamber for 24 hr.

Samples were fixed with 2% paraformaldehyde (Sigma) and 0.2% glutaraldehyde (Sigma) in PBS for

1 hr at 4˚C, washed, permeabilized with 0.3% Triton X-100, and then washed again before 1 hr

RNase (MP Biomedicals) treatment, staining with SYBR Green I (Life Technologies), and FACS analy-

sis. The samples were analyzed on a Becton Dickenson LSR-II. Data were acquired using FACSDiva

6.1.3 software and analyzed using FlowJo_V10.

Data was normalised to a 1% starting parasitemia to enable comparison of fold multiplication

between lines. For comparison of growth in human and macaque blood, three biological indepen-

dent experiments were carried out in Macaca fascicularis blood and eight biological independent

experiments were carried out in human blood. Biological independent experiments include set up of

experiments on different days with different parasite preparations and blood samples. Each biologi-

cal replicate includes two technical replicates. For statistical analysis one-way ANOVA with Tukey’s

with multiple comparisons test of unpaired data was used. For investigation of the association

between Duffy phenotype and growth rates, blood samples were collected from 21 volunteers,

washed and then set up in technical dublicate cultures at a 2% haematrocrit and with ~0.5% parasite-

mia in 96 well plates. Parasites were maintained in 96-well microtiter plates for 24 hr and the parasi-

taemia monitored by FACS. Data of three independent schizont preparations were analysed for

each blood sample.

Blood typingVenous blood (~10 mL) collected into EDTA Vacutainer (SLS) was anonymized, and then RBCs

washed with RPMI 1640 and stored at 4˚C. Blood Grouping Reagents for ABO, Rhesus D, and Duffy

antigen (FyA, FyB) were used according to the manufacturer’s instructions (Lorne Laboratories).

Growth inhibition activity assaysAssays of growth inhibition activity (GIA), in the presence of anti-PvDBP_RII antibodies, were carried

out using total IgG purified from rabbit sera using protein G columns (Pierce). Immunisation of rab-

bits against PvDBP_RII (SalI) has been described previously (de Cassan et al., 2015). Purified IgG

was buffer-exchanged into RPMI 1640 medium, concentrated using ultra centrifugal devices (Milli-

pore) and filter sterilized through a 0.22 mm filter (Millipore) prior to being aliquoted and frozen at

�20˚C until use.

P. knowlesi parasites were synchronized by magnetic separation (MACS LS columns, Miltenyi Bio-

tech). Synchronized trophozoites were adjusted to 1.5% parasitemia, and 20 mL aliquots were




pipetted into 96-well flat/half area tissue culture cluster plates (Appleton Woods). 20 mL purified IgG

were added to triplicate test wells at eight final concentrations (10, 5, 2.5, 1.25, 0.625, 0.312, 0.15

and 0.075 mg/mL) and incubated for one cycle (26–30 hr). Parasitemia was measured using the lac-

tate dehydrogenase (pLDH) activity assay following standard protocols (Kennedy et al., 2002). An

anti-DARC Fy6 VHH nanobody, a kind gift from Dr Olivier Bertrand (INSERM, France), was included

in the test plate as a positive control in every assay (final concentration 1.5 or 3 mg/mL) and purified

control IgG from the pre-immunisation sera of matched rabbits were used as the negative control.

Anti-PkMSP119 rabbit sera, a kind gift from Ellen Knuepfer (Crick Institute, UK), was also tested in a

similar manner. GIA of the purified IgG was expressed as percent inhibition calculated as follows:

100 � [(OD650 of infected erythrocytes with test IgG � OD650 of normal erythrocytes only) /

(OD650 of infected erythrocytes without any IgG � OD650 of normal erythrocytes only) x 100%].

Whole genome sequencingGenomic DNA was prepared for the PvDBPOR/D14Dg using the DNeasy Blood and Tissue Kit (Qia-

gen). DNA libraries were prepared using the QIAseq FX DNA Library Kit (Qiagen) as per manufac-

turer’s instructions. A 20 min fragmentation step was optimized for Plasmodium samples. Whole

genome sequencing was performed using Illumina MiSeq technology with 150-base paired end frag-

ment sizes. Raw sequence data for the A1-H.1 parental line was extracted from the European Nucle-

otide Archive as per (Moon et al., 2016; Benavente et al., 2018). The raw sequence data

(accession number ERS3042513) was processed as previously described (Campino et al., 2016). In

brief, the raw sequence data was aligned onto the A1-H.1 reference genome using the bwa-mem

short read alignment algorithm, and coverage statistics were obtained using the sambamba software

to be plotted using R.

AcknowledgementsThis work is supported by an MRC Career Development Award (MR/M021157/1) jointly funded by

the UK Medical Research Council and Department for International Development (RWM, FM). MNH

is supported by a Bloomsbury Colleges research studentship. JAC is supported by a BBSRC LIDO

studentship. TAR held a Wellcome Trust Research Training Fellowship [108734/Z/15/Z]; TGC is

funded by the Medical Research Council UK [ref. MR/M01360X/1, MR/N010469/1, MR/R025576/1,

and MR/R020973/1] and BBSRC [ref. BB/R013063/1]. SC is funded by Medical Research Council UK

grants [ref. MR/M01360X/1, MR/R025576/1, and MR/R020973/1]. SJD is a Jenner Investigator, a

Lister Institute Research Prize Fellow and a Wellcome Trust Senior Fellow [106917/Z/15/Z]. We are

grateful to the Wellcome Trust for a Senior Investigator Award to DAB (ref. 106240/Z/14/Z). RCH is

supported by a Marshall Scholarship granted by Her Majesty’s Government. CJS is supported by

Public Health England. We thank Jose-Juan Lopez-Rubio for providing the pUF and pl6 plasmid, and

also David Llewellyn, Jennifer Marshall and Doris Quinkert (University of Oxford) for assistance with

rabbit immunisations, parasite culturing and the assays of GIA. We thank Michael Blackman (Francis

Crick Institute) for providing Compound 2. We also thank Carolynne Stanley for recruiting volunteers

and drawing of blood samples.

Additional information

Funding

Funder Grant reference number Author

Medical Research Council MRC Career DevelopmentAward MR/M021157/1)

Franziska MohringRobert William Moon

University of London Bloomsbury CollegesResearch Studentship

Melissa Natalie Hart

Wellcome Trust Research TrainingFellowship, 108734/Z/15/Z

Thomas A Rawlinson

Marshall Aid CommemorationCommission

Marshall Scholarship Ryan Henrici




Biotechnology and BiologicalSciences Research Council

London InterdiscpinaryDoctoral ProgrammeStudentship

James A Charleston

Wellcome Trust Senior Investigator Award,106240/Z/14/Z

Avnish PatelDavid A Baker

Medical Research Council MR/M01360X/1 Susana CampinoTaane G Clark

Biotechnology and BiologicalSciences Research Council

BB/R013063/1 Taane G Clark

Medical Research Council MR/R025576/1 Taane G Clark

Medical Research Council MR/R020973/1 Taane G Clark

Medical Research Council MR/N010469/1 Taane G Clark

Public Health England Colin J Sutherland

Lister Institute of PreventiveMedicine

Research Prize Fellow Simon J Draper

Wellcome Trust Wellcome Trust SeniorFellowship, 106917/Z/15/Z

Simon J Draper

The funders had no role in study design, data collection and interpretation, or the

decision to submit the work for publication.

Author contributions

Franziska Mohring, Conceptualization, Formal analysis, Validation, Investigation, Visualization,

Methodology, Writing—original draft, Writing—review and editing; Melissa Natalie Hart, Data

curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—review and

editing; Thomas A Rawlinson, Formal analysis, Validation, Investigation, Visualization, Methodology,

Writing—original draft, Writing—review and editing; Ryan Henrici, Investigation, Visualization,

Methodology, Writing—original draft, Writing—review and editing; James A Charleston, Data

curation, Formal analysis, Validation, Investigation, Methodology, Writing—review and editing;

Ernest Diez Benavente, Data curation, Formal analysis, Investigation, Methodology, Writing—review

and editing; Avnish Patel, Resources, Investigation, Methodology, Writing—review and editing;

Joanna Hall, Resources, Investigation, Writing—review and editing; Neil Almond, Resources,

Supervision, Writing—review and editing; Susana Campino, Resources, Supervision, Funding

acquisition, Investigation, Writing—review and editing; Taane G Clark, Colin J Sutherland,

Supervision, Funding acquisition, Writing—review and editing; David A Baker, Resources,

Supervision, Funding acquisition, Writing—review and editing; Simon J Draper, Conceptualization,

Resources, Supervision, Funding acquisition, Methodology, Project administration, Writing—review

and editing; Robert William Moon, Conceptualization, Resources, Data curation, Formal analysis,

Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing—original draft,

Project administration, Writing—review and editing

Author ORCIDs

Franziska Mohring https://orcid.org/0000-0003-4726-6693

Taane G Clark http://orcid.org/0000-0001-8985-9265

Colin J Sutherland http://orcid.org/0000-0003-1592-6407

Simon J Draper http://orcid.org/0000-0002-9415-1357

Robert William Moon https://orcid.org/0000-0002-9070-4292

Ethics

Human subjects: For most experiments and routine parasite maintenance, human blood (Duffy (FY)

positive) was obtained from the United Kingdom National Blood Transfusion Service under a

research agreement. For the Duffy subtype experiment, venous blood (~10 mL) from 21 healthy vol-

unteers blood donors was collected after donors had provided informed consent. Blood samples

were then anonymized. The project, consent and protocol were approved by the LSHTM Observa-

tional Research Ethics Committee under project reference 5520-1.



https://orcid.org/0000-0003-4726-6693

http://orcid.org/0000-0001-8985-9265

http://orcid.org/0000-0003-1592-6407

http://orcid.org/0000-0002-9415-1357

https://orcid.org/0000-0002-9070-4292


Animal experimentation: Animal work was reviewed and approved by the local National Institute for

Biological Standards and Control Animal Welfare and Ethical Review Body (the Institutional Review

Board) and by the United Kingdom Home Office as governed by United Kingdom law under the Ani-

mals (Scientific Procedures) Act 1986. Animals were handled in strict accordance with the "Code of

Practice Part 1 for the housing and care of animals (21/03/05)" available at https://www.gov.uk/

research-and-testing-using-animals. The work also met the National Centre for the Replacement

Refinement and Reduction of Animals in Research (NC3Rs) guidelines on primate accommodation,

care, and use (https://www.nc3rs.org.uk/non-human-primate-accommodation-care-and-use), which

exceed the legal minimum standards required by the United Kingdom Animals (Scientific Proce-

dures) Act 1986, associated Codes of Practice, and the US Institute for Laboratory Animal Research

Guide.

Decision letter and Author response

Decision letter https://doi.org/10.7554/eLife.45829.027

Author response https://doi.org/10.7554/eLife.45829.028

Additional filesSupplementary files. Transparent reporting form


Data availability

Raw whole genome sequencing data has been deposited to the European Nucleotide Archive under

accession number ERS3042513. All other data generated or analysed during this study are included

in the manuscript and supporting files. Source data files for all figures has been provided.

The following dataset was generated:

Author(s) Year Dataset title Dataset URLDatabase andIdentifier

Mohring F, HartMN, Rawlinson TA,Henrici R, Charles-ton JA, BenaventeED, Patel A, Hall J,Almond N, Campi-no S, Clark TG,Sutherland CJ, Ba-ker DA, Draper SJ,Moo RW

2019 Genome editing in the zoonoticmalaria parasite Plasmodiumknowlesi provides new tools for P.vivax research

http://www.ebi.ac.uk/ena/data/view/ERS3042513

European NucleotideArchive, ERS3042513

ReferencesAdams JH, Hudson DE, Torii M, Ward GE, Wellems TE, Aikawa M, Miller LH. 1990. The Duffy receptor family ofPlasmodium knowlesi is located within the micronemes of invasive malaria merozoites. Cell 63:141–153.DOI: https://doi.org/10.1016/0092-8674(90)90295-P, PMID: 2170017

Arevalo-Herrera M, Castellanos A, Yazdani SS, Shakri AR, Chitnis CE, Dominik R, Herrera S. 2005.Immunogenicity and protective efficacy of recombinant vaccine based on the receptor-binding domain of thePlasmodium vivax Duffy binding protein in Aotus monkeys. The American Journal of Tropical Medicine andHygiene 73:25–31. DOI: https://doi.org/10.4269/ajtmh.2005.73.5_suppl.0730025, PMID: 16291763

Bannister LH, Hopkins JM, Dluzewski AR, Margos G, Williams IT, Blackman MJ, Kocken CH, Thomas AW,Mitchell GH. 2003. Plasmodium falciparum apical membrane antigen 1 (PfAMA-1) is translocated withinmicronemes along subpellicular microtubules during merozoite development. Journal of Cell Science 116:3825–3834. DOI: https://doi.org/10.1242/jcs.00665, PMID: 12902400

Batchelor JD, Zahm JA, Tolia NH. 2011. Dimerization of Plasmodium vivax DBP is induced upon receptorbinding and drives recognition of DARC. Nature Structural & Molecular Biology 18:908–914. DOI: https://doi.org/10.1038/nsmb.2088, PMID: 21743458

Batchelor JD, Malpede BM, Omattage NS, DeKoster GT, Henzler-Wildman KA, Tolia NH. 2014. Red blood cellinvasion by Plasmodium vivax: structural basis for DBP engagement of DARC. PLOS Pathogens 10:e1003869.DOI: https://doi.org/10.1371/journal.ppat.1003869, PMID: 24415938









https://doi.org/10.1016/0092-8674(90)90295-P

http://www.ncbi.nlm.nih.gov/pubmed/2170017

https://doi.org/10.4269/ajtmh.2005.73.5_suppl.0730025


https://doi.org/10.1242/jcs.00665


https://doi.org/10.1038/nsmb.2088

https://doi.org/10.1038/nsmb.2088


https://doi.org/10.1371/journal.ppat.1003869



Baum J, Richard D, Healer J, Rug M, Krnajski Z, Gilberger TW, Green JL, Holder AA, Cowman AF. 2006. Aconserved molecular motor drives cell invasion and gliding motility across malaria life cycle stages and otherapicomplexan parasites. Journal of Biological Chemistry 281:5197–5208. DOI: https://doi.org/10.1074/jbc.M509807200, PMID: 16321976

Benavente ED, de Sessions PF, Moon RW, Grainger M, Holder AA, Blackman MJ, Roper C, Drakeley CJ, Pain A,Sutherland CJ, Hibberd ML, Campino S, Clark TG. 2018. A reference genome and methylome for thePlasmodium knowlesi A1-H.1 line. International Journal for Parasitology 48:191–196. DOI: https://doi.org/10.1016/j.ijpara.2017.09.008, PMID: 29258833

Benchling. 2018. Benchling [Biology Software]. http://benchling.comBirnbaum J, Flemming S, Reichard N, Soares AB, Mesen-Ramırez P, Jonscher E, Bergmann B, Spielmann T. 2017.A genetic system to study Plasmodium falciparum protein function. Nature Methods 14:450–456. DOI: https://doi.org/10.1038/nmeth.4223, PMID: 28288121

Byrne SM, Ortiz L, Mali P, Aach J, Church GM. 2015. Multi-kilobase homozygous targeted gene replacement inhuman induced pluripotent stem cells. Nucleic Acids Research 43:e21. DOI: https://doi.org/10.1093/nar/gku1246, PMID: 25414332

Campino S, Benavente ED, Assefa S, Thompson E, Drought LG, Taylor CJ, Gorvett Z, Carret CK, Flueck C, IvensAC, Kwiatkowski DP, Alano P, Baker DA, Clark TG. 2016. Genomic variation in two gametocyte non-producingPlasmodium falciparum clonal lines. Malaria Journal 15:229. DOI: https://doi.org/10.1186/s12936-016-1254-1,PMID: 27098483

Cao J, Kaneko O, Thongkukiatkul A, Tachibana M, Otsuki H, Gao Q, Tsuboi T, Torii M. 2009. Rhoptry neckprotein RON2 forms a complex with microneme protein AMA1 in Plasmodium falciparum merozoites.Parasitology International 58:29–35. DOI: https://doi.org/10.1016/j.parint.2008.09.005, PMID: 18952195

Chen E, Salinas ND, Huang Y, Ntumngia F, Plasencia MD, Gross ML, Adams JH, Tolia NH. 2016. Broadlyneutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein. PNAS 113:6277–6282.DOI: https://doi.org/10.1073/pnas.1600488113, PMID: 27194724

Chitnis CE, Miller LH. 1994. Identification of the erythrocyte binding domains of Plasmodium vivax andPlasmodium knowlesi proteins involved in erythrocyte invasion. Journal of Experimental Medicine 180:497–506.DOI: https://doi.org/10.1084/jem.180.2.497, PMID: 8046329

Choe H, Moore MJ, Owens CM, Wright PL, Vasilieva N, Li W, Singh AP, Shakri R, Chitnis CE, Farzan M. 2005.Sulphated tyrosines mediate association of chemokines and plasmodium vivax duffy binding protein with theduffy antigen/receptor for chemokines (DARC). Molecular Microbiology 55:1413–1422. DOI: https://doi.org/10.1111/j.1365-2958.2004.04478.x, PMID: 15720550

Chootong P, Ntumngia FB, VanBuskirk KM, Xainli J, Cole-Tobian JL, Campbell CO, Fraser TS, King CL, AdamsJH. 2010. Mapping epitopes of the plasmodium vivax duffy binding protein with naturally acquired inhibitoryantibodies. Infection and Immunity 78:1089–1095. DOI: https://doi.org/10.1128/IAI.01036-09, PMID: 20008533

Collins CR, Hackett F, Strath M, Penzo M, Withers-Martinez C, Baker DA, Blackman MJ. 2013. Malaria parasitecGMP-dependent protein kinase regulates blood stage merozoite secretory organelle discharge and egress.PLOS Pathogens 9:e1003344. DOI: https://doi.org/10.1371/journal.ppat.1003344, PMID: 23675297

Crawford ED, Quan J, Horst JA, Ebert D, Wu W, DeRisi JL. 2017. Plasmid-free CRISPR/Cas9 genome editing inPlasmodium falciparum confirms mutations conferring resistance to the dihydroisoquinolone clinical candidateSJ733. PLOS ONE 12:e0178163. DOI: https://doi.org/10.1371/journal.pone.0178163, PMID: 28542423

Dankwa S, Lim C, Bei AK, Jiang RH, Abshire JR, Patel SD, Goldberg JM, Moreno Y, Kono M, Niles JC,Duraisingh MT. 2016. Ancient human sialic acid variant restricts an emerging zoonotic malaria parasite. NatureCommunications 7:11187. DOI: https://doi.org/10.1038/ncomms11187, PMID: 27041489

de Cassan SC, Shakri AR, Llewellyn D, Elias SC, Cho JS, Goodman AL, Jin J, Douglas AD, Suwanarusk R, NostenFH, Renia L, Russell B, Chitnis CE, Draper SJ. 2015. Preclinical assessment of viral vectored and proteinvaccines targeting the Duffy-Binding protein region II of Plasmodium Vivax. Frontiers in Immunology 6:348.DOI: https://doi.org/10.3389/fimmu.2015.00348, PMID: 26217340

Douglas AD, Baldeviano GC, Lucas CM, Lugo-Roman LA, Crosnier C, Bartholdson SJ, Diouf A, Miura K, LambertLE, Ventocilla JA, Leiva KP, Milne KH, Illingworth JJ, Spencer AJ, Hjerrild KA, Alanine DG, Turner AV,Moorhead JT, Edgel KA, Wu Y, et al. 2015. A PfRH5-based vaccine is efficacious against heterologous strainblood-stage Plasmodium falciparum infection in aotus monkeys. Cell Host & Microbe 17:130–139. DOI: https://doi.org/10.1016/j.chom.2014.11.017, PMID: 25590760

Ecker A, Moon R, Sinden RE, Billker O. 2006. Generation of gene targeting constructs for Plasmodium bergheiby a PCR-based method amenable to high throughput applications. Molecular and Biochemical Parasitology145:265–268. DOI: https://doi.org/10.1016/j.molbiopara.2005.10.006, PMID: 16290088

Ehlgen F, Pham JS, de Koning-Ward T, Cowman AF, Ralph SA. 2012. Investigation of the Plasmodium falciparumfood vacuole through inducible expression of the chloroquine resistance transporter (PfCRT). PLOS ONE 7:e38781. DOI: https://doi.org/10.1371/journal.pone.0038781, PMID: 22719945

Fong MY, Cheong FW, Lau YL. 2018. Erythrocyte-binding assays reveal higher binding of Plasmodium knowlesiDuffy binding protein to human Fya+/b+ erythrocytes than to Fya+/b- erythrocytes. Parasites & Vectors 11:527.DOI: https://doi.org/10.1186/s13071-018-3118-8, PMID: 30257710

Gardner MJ, Hall N, Fung E, White O, Berriman M, Hyman RW, Carlton JM, Pain A, Nelson KE, Bowman S,Paulsen IT, James K, Eisen JA, Rutherford K, Salzberg SL, Craig A, Kyes S, Chan MS, Nene V, Shallom SJ, et al.2002. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419:498–511.DOI: https://doi.org/10.1038/nature01097, PMID: 12368864



https://doi.org/10.1074/jbc.M509807200

https://doi.org/10.1074/jbc.M509807200


https://doi.org/10.1016/j.ijpara.2017.09.008

https://doi.org/10.1016/j.ijpara.2017.09.008


http://benchling.com

https://doi.org/10.1038/nmeth.4223



https://doi.org/10.1093/nar/gku1246

https://doi.org/10.1093/nar/gku1246


https://doi.org/10.1186/s12936-016-1254-1


https://doi.org/10.1016/j.parint.2008.09.005


https://doi.org/10.1073/pnas.1600488113


https://doi.org/10.1084/jem.180.2.497


https://doi.org/10.1111/j.1365-2958.2004.04478.x

https://doi.org/10.1111/j.1365-2958.2004.04478.x


https://doi.org/10.1128/IAI.01036-09


https://doi.org/10.1371/journal.ppat.1003344


https://doi.org/10.1371/journal.pone.0178163


https://doi.org/10.1038/ncomms11187


https://doi.org/10.3389/fimmu.2015.00348


https://doi.org/10.1016/j.chom.2014.11.017

https://doi.org/10.1016/j.chom.2014.11.017


https://doi.org/10.1016/j.molbiopara.2005.10.006




https://doi.org/10.1186/s13071-018-3118-8


https://doi.org/10.1038/nature01097



Ghorbal M, Gorman M, Macpherson CR, Martins RM, Scherf A, Lopez-Rubio JJ. 2014. Genome editing in thehuman malaria parasite Plasmodium falciparum using the CRISPR-Cas9 system. Nature Biotechnology 32:819–821. DOI: https://doi.org/10.1038/nbt.2925, PMID: 24880488

Gruring C, Moon RW, Lim C, Holder AA, Blackman MJ, Duraisingh MT. 2014. Human red blood cell-adaptedPlasmodium knowlesi parasites: a new model system for malaria research. Cellular Microbiology 16:612–620.DOI: https://doi.org/10.1111/cmi.12275, PMID: 24506567

Hanboonkunupakarn B, White NJ. 2016. The threat of antimalarial drug resistance. Tropical Diseases, TravelMedicine and Vaccines 2:10. DOI: https://doi.org/10.1186/s40794-016-0027-8, PMID: 28883954

Hans D, Pattnaik P, Bhattacharyya A, Shakri AR, Yazdani SS, Sharma M, Choe H, Farzan M, Chitnis CE. 2005.Mapping binding residues in the Plasmodium vivax domain that binds Duffy antigen during red cell invasion.Molecular Microbiology 55:1423–1434. DOI: https://doi.org/10.1111/j.1365-2958.2005.04484.x,PMID: 15720551

Haynes JD, Dalton JP, Klotz FW, McGinniss MH, Hadley TJ, Hudson DE, Miller LH. 1988. Receptor-like specificityof a Plasmodium knowlesi malarial protein that binds to Duffy antigen ligands on erythrocytes. Journal ofExperimental Medicine 167:1873–1881. DOI: https://doi.org/10.1084/jem.167.6.1873, PMID: 2838562

Horuk R, Chitnis CE, Darbonne WC, Colby TJ, Rybicki A, Hadley TJ, Miller LH. 1993. A receptor for the malarialparasite Plasmodium vivax: the erythrocyte chemokine receptor. Science 261:1182–1184. DOI: https://doi.org/10.1126/science.7689250, PMID: 7689250

Kano FS, de Souza AM, de Menezes Torres L, Costa MA, Souza-Silva FA, Sanchez BAM, Fontes CJF, Soares IS,de Brito CFA, Carvalho LH, Sousa TN. 2018. Susceptibility to Plasmodium vivax malaria associated with DARC(Duffy antigen) polymorphisms is influenced by the time of exposure to malaria. Scientific Reports 8:13851.DOI: https://doi.org/10.1038/s41598-018-32254-z, PMID: 30218021

Kennedy MC, Wang J, Zhang Y, Miles AP, Chitsaz F, Saul A, Long CA, Miller LH, Stowers AW. 2002. In vitrostudies with recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1): production and activityof an AMA1 vaccine and generation of a multiallelic response. Infection and Immunity 70:6948–6960.DOI: https://doi.org/10.1128/IAI.70.12.6948-6960.2002, PMID: 12438374

King CL, Adams JH, Xianli J, Grimberg BT, McHenry AM, Greenberg LJ, Siddiqui A, Howes RE, da Silva-NunesM, Ferreira MU, Zimmerman PA. 2011. Fy(a)/Fy(b) antigen polymorphism in human erythrocyte duffy antigenaffects susceptibility to Plasmodium vivax malaria. PNAS 108:20113–20118. DOI: https://doi.org/10.1073/pnas.1109621108, PMID: 22123959

Knuepfer E, Napiorkowska M, van Ooij C, Holder AA. 2017. Generating conditional gene knockouts inPlasmodium - a toolkit to produce stable DiCre recombinase-expressing parasite lines using CRISPR/Cas9.Scientific Reports 7:3881. DOI: https://doi.org/10.1038/s41598-017-03984-3, PMID: 28634346

Kocken CH, Ozwara H, van der Wel A, Beetsma AL, Mwenda JM, Thomas AW. 2002. Plasmodium knowlesiprovides a rapid in vitro and in vivo transfection system that enables double-crossover gene knockout studies.Infection and Immunity 70:655–660. DOI: https://doi.org/10.1128/IAI.70.2.655-660.2002, PMID: 11796595

Lim C, Hansen E, DeSimone TM, Moreno Y, Junker K, Bei A, Brugnara C, Buckee CO, Duraisingh MT. 2013.Expansion of host cellular niche can drive adaptation of a zoonotic malaria parasite to humans. NatureCommunications 4. DOI: https://doi.org/10.1038/ncomms2612

Lu J, Tong Y, Pan J, Yang Y, Liu Q, Tan X, Zhao S, Qin L, Chen X. 2016. A redesigned CRISPR/Cas9 system formarker-free genome editing in Plasmodium falciparum. Parasites & Vectors 9:198. DOI: https://doi.org/10.1186/s13071-016-1487-4, PMID: 27066899

Lyth O, Vizcay-Barrena G, Wright KE, Haase S, Mohring F, Najer A, Henshall IG, Ashdown GW, Bannister LH,Drew DR, Beeson JG, Fleck RA, Moon RW, Wilson DW, Baum J. 2018. Cellular dissection of malaria parasiteinvasion of human erythrocytes using viable plasmodium knowlesi merozoites. Scientific Reports 8:10165.DOI: https://doi.org/10.1038/s41598-018-28457-z, PMID: 29976932

MacPherson CR, Scherf A. 2015. Flexible guide-RNA design for CRISPR applications using ProtospacerWorkbench. Nature Biotechnology 33:805–806. DOI: https://doi.org/10.1038/nbt.3291, PMID: 26121414

Mahdi Abdel Hamid M, Remarque EJ, van Duivenvoorde LM, van der Werff N, Walraven V, Faber BW, KockenCH, Thomas AW. 2011. Vaccination with plasmodium knowlesi AMA1 formulated in the novel adjuvant co-vaccine HT protects against blood-stage challenge in rhesus macaques. PLOS ONE 6:e20547. DOI: https://doi.org/10.1371/journal.pone.0020547, PMID: 21655233

Menard D, Dondorp A. 2017. Antimalarial drug resistance: a threat to malaria elimination. Cold Spring HarborPerspectives in Medicine 7:a025619. DOI: https://doi.org/10.1101/cshperspect.a025619, PMID: 28289248

Miller LH, Mason SJ, Dvorak JA, McGinniss MH, Rothman IK. 1975. Erythrocyte receptors for (Plasmodiumknowlesi) malaria: Duffy blood group determinants. Science 189:561–563. DOI: https://doi.org/10.1126/science.1145213, PMID: 1145213

Miller LH, Mason SJ, Clyde DF, McGinniss MH. 1976. The resistance factor to Plasmodium vivax in blacks. TheDuffy-blood-group genotype, FyFy. The New England Journal of Medicine 295:302–304. DOI: https://doi.org/10.1056/NEJM197608052950602, PMID: 778616

Mogollon CM, van Pul FJ, Imai T, Ramesar J, Chevalley-Maurel S, de Roo GM, Veld SA, Kroeze H, Franke-FayardBM, Janse CJ, Khan SM. 2016. Rapid generation of Marker-Free P. falciparum fluorescent reporter lines usingmodified CRISPR/Cas9 constructs and selection protocol. PLOS ONE 11:e0168362. DOI: https://doi.org/10.1371/journal.pone.0168362, PMID: 27997583

Moon RW, Hall J, Rangkuti F, Ho YS, Almond N, Mitchell GH, Pain A, Holder AA, Blackman MJ. 2013.Adaptation of the genetically tractable malaria pathogen Plasmodium knowlesi to continuous culture in humanerythrocytes. PNAS 110:531–536. DOI: https://doi.org/10.1073/pnas.1216457110, PMID: 23267069



https://doi.org/10.1038/nbt.2925


https://doi.org/10.1111/cmi.12275


https://doi.org/10.1186/s40794-016-0027-8


https://doi.org/10.1111/j.1365-2958.2005.04484.x


https://doi.org/10.1084/jem.167.6.1873


https://doi.org/10.1126/science.7689250



https://doi.org/10.1038/s41598-018-32254-z


https://doi.org/10.1128/IAI.70.12.6948-6960.2002





https://doi.org/10.1038/s41598-017-03984-3


https://doi.org/10.1128/IAI.70.2.655-660.2002


https://doi.org/10.1038/ncomms2612

https://doi.org/10.1186/s13071-016-1487-4

https://doi.org/10.1186/s13071-016-1487-4


https://doi.org/10.1038/s41598-018-28457-z


https://doi.org/10.1038/nbt.3291





https://doi.org/10.1101/cshperspect.a025619





https://doi.org/10.1056/NEJM197608052950602

https://doi.org/10.1056/NEJM197608052950602








Moon RW, Sharaf H, Hastings CH, Ho YS, Nair MB, Rchiad Z, Knuepfer E, Ramaprasad A, Mohring F, Amir A,Yusuf NA, Hall J, Almond N, Lau YL, Pain A, Blackman MJ, Holder AA. 2016. Normocyte-binding proteinrequired for human erythrocyte invasion by the zoonotic malaria parasite Plasmodium knowlesi. PNAS 113:7231–7236. DOI: https://doi.org/10.1073/pnas.1522469113, PMID: 27303038

Ntumngia FB, Schloegel J, Barnes SJ, McHenry AM, Singh S, King CL, Adams JH. 2012. Conserved and variantepitopes of Plasmodium vivax Duffy binding protein as targets of inhibitory monoclonal antibodies. Infectionand Immunity 80:1203–1208. DOI: https://doi.org/10.1128/IAI.05924-11, PMID: 22215740

Ovchynnikova E, Aglialoro F, Bentlage AEH, Vidarsson G, Salinas ND, von Lindern M, Tolia NH, van den AkkerE. 2017. DARC extracellular domain remodeling in maturating reticulocytes explains Plasmodium vivax tropism.Blood 130:1441–1444. DOI: https://doi.org/10.1182/blood-2017-03-774364, PMID: 28754683

Pacheco MA, Matta NE, Valkiunas G, Parker PG, Mello B, Stanley CE, Lentino M, Garcia-Amado MA, CranfieldM, Kosakovsky Pond SL, Escalante AA. 2018. Mode and rate of evolution of haemosporidian mitochondrialgenomes: timing the radiation of avian parasites. Molecular Biology and Evolution 35:383–403. DOI: https://doi.org/10.1093/molbev/msx285, PMID: 29126122

Pain A, Bohme U, Berry AE, Mungall K, Finn RD, Jackson AP, Mourier T, Mistry J, Pasini EM, Aslett MA,Balasubrammaniam S, Borgwardt K, Brooks K, Carret C, Carver TJ, Cherevach I, Chillingworth T, Clark TG,Galinski MR, Hall N, et al. 2008. The genome of the simian and human malaria parasite Plasmodium knowlesi.Nature 455:799–803. DOI: https://doi.org/10.1038/nature07306, PMID: 18843368

Payne RO, Silk SE, Elias SC, Milne KH, Rawlinson TA, Llewellyn D, Shakri AR, Jin J, Labbe GM, Edwards NJ,Poulton ID, Roberts R, Farid R, Jørgensen T, Alanine DG, de Cassan SC, Higgins MK, Otto TD, McCarthy JS, deJongh WA, et al. 2017a. Human vaccination against Plasmodium vivax Duffy-binding protein induces strain-transcending antibodies. JCI Insight 2. DOI: https://doi.org/10.1172/jci.insight.93683, PMID: 28614791

Payne RO, Griffin PM, McCarthy JS, Draper SJ. 2017b. Plasmodium vivax controlled human malaria infection –Progress and Prospects. Trends in Parasitology 33:141–150. DOI: https://doi.org/10.1016/j.pt.2016.11.001

Price RN, von Seidlein L, Valecha N, Nosten F, Baird JK, White NJ. 2014. Global extent of chloroquine-resistantPlasmodium vivax: a systematic review and meta-analysis. The Lancet Infectious Diseases 14:982–991.DOI: https://doi.org/10.1016/S1473-3099(14)70855-2, PMID: 25213732

Ranjan A, Chitnis CE. 1999. Mapping regions containing binding residues within functional domains ofPlasmodium vivax and Plasmodium knowlesi erythrocyte-binding proteins. PNAS 96:14067–14072.DOI: https://doi.org/10.1073/pnas.96.24.14067, PMID: 10570199

Russell B, Suwanarusk R, Borlon C, Costa FT, Chu CS, Rijken MJ, Sriprawat K, Warter L, Koh EG, Malleret B,Colin Y, Bertrand O, Adams JH, D’Alessandro U, Snounou G, Nosten F, Renia L. 2011. A reliable ex vivoinvasion assay of human reticulocytes by Plasmodium vivax. Blood 118:e74–e81. DOI: https://doi.org/10.1182/blood-2011-04-348748, PMID: 21768300

Shakri AR, Rizvi MM, Chitnis CE. 2012. Development of quantitative receptor-ligand binding assay for use as atool to estimate immune responses against Plasmodium vivax Duffy binding protein Region II. Journal ofImmunoassay and Immunochemistry 33:403–413. DOI: https://doi.org/10.1080/15321819.2012.659781,PMID: 22963489

Singh AP, Ozwara H, Kocken CH, Puri SK, Thomas AW, Chitnis CE. 2005. Targeted deletion of Plasmodiumknowlesi Duffy binding protein confirms its role in junction formation during invasion. Molecular Microbiology55:1925–1934. DOI: https://doi.org/10.1111/j.1365-2958.2005.04523.x, PMID: 15752210

Singh S, Miura K, Zhou H, Muratova O, Keegan B, Miles A, Martin LB, Saul AJ, Miller LH, Long CA. 2006.Immunity to recombinant Plasmodium falciparum merozoite surface protein 1 (MSP1): protection in Aotusnancymai monkeys strongly correlates with anti-MSP1 antibody titer and in vitro parasite-inhibitory activity.Infection and Immunity 74:4573–4580. DOI: https://doi.org/10.1128/IAI.01679-05, PMID: 16861644

Singh K, Mukherjee P, Shakri AR, Singh A, Pandey G, Bakshi M, Uppal G, Jena R, Rawat A, Kumar P, Bhardwaj R,Yazdani SS, Hans D, Mehta S, Srinivasan A, Anil K, Madhusudhan RL, Patel J, Singh A, Rao R, et al. 2018.Malaria vaccine candidate based on Duffy-binding protein elicits strain transcending functional antibodies in aPhase I trial. npj Vaccines 3. DOI: https://doi.org/10.1038/s41541-018-0083-3, PMID: 30302285

Singh B, Daneshvar C. 2013. Human infections and detection of Plasmodium knowlesi. Clinical MicrobiologyReviews 26:165–184. DOI: https://doi.org/10.1128/CMR.00079-12, PMID: 23554413

Smolarek D, Hattab C, Hassanzadeh-Ghassabeh G, Cochet S, Gutierrez C, de Brevern AG, Udomsangpetch R,Picot J, Grodecka M, Wasniowska K, Muyldermans S, Colin Y, Le Van Kim C, Czerwinski M, Bertrand O. 2010. Arecombinant dromedary antibody fragment (VHH or nanobody) directed against human Duffy antigen receptorfor chemokines. Cellular and Molecular Life Sciences 67:3371–3387. DOI: https://doi.org/10.1007/s00018-010-0387-6, PMID: 20458517

Tachibana S, Kawai S, Katakai Y, Takahashi H, Nakade T, Yasutomi Y, Horii T, Tanabe K. 2015. Contrastinginfection susceptibility of the Japanese macaques and cynomolgus macaques to closely related malariaparasites, Plasmodium vivax and Plasmodium cynomolgi. Parasitology International 64:274–281. DOI: https://doi.org/10.1016/j.parint.2014.10.004, PMID: 25316604

Thomas JA, Collins CR, Das S, Hackett F, Graindorge A, Bell D, Deu E, Blackman MJ. 2016. Development andapplication of a simple plaque assay for the human malaria parasite Plasmodium falciparum. PLOS ONE 11:e0157873. DOI: https://doi.org/10.1371/journal.pone.0157873, PMID: 27332706

VanBuskirk KM, Sevova E, Adams JH. 2004. Conserved residues in the Plasmodium vivax Duffy-binding proteinligand domain are critical for erythrocyte receptor recognition. PNAS 101:15754–15759. DOI: https://doi.org/10.1073/pnas.0405421101, PMID: 15498870





https://doi.org/10.1128/IAI.05924-11


https://doi.org/10.1182/blood-2017-03-774364


https://doi.org/10.1093/molbev/msx285

https://doi.org/10.1093/molbev/msx285


https://doi.org/10.1038/nature07306


https://doi.org/10.1172/jci.insight.93683


https://doi.org/10.1016/j.pt.2016.11.001

https://doi.org/10.1016/S1473-3099(14)70855-2


https://doi.org/10.1073/pnas.96.24.14067





https://doi.org/10.1080/15321819.2012.659781


https://doi.org/10.1111/j.1365-2958.2005.04523.x


https://doi.org/10.1128/IAI.01679-05


https://doi.org/10.1038/s41541-018-0083-3


https://doi.org/10.1128/CMR.00079-12


https://doi.org/10.1007/s00018-010-0387-6

https://doi.org/10.1007/s00018-010-0387-6











Wagner JC, Platt RJ, Goldfless SJ, Zhang F, Niles JC. 2014. Efficient CRISPR-Cas9-mediated genome editing inPlasmodium falciparum. Nature Methods 11:915–918. DOI: https://doi.org/10.1038/nmeth.3063, PMID: 25108687

WHO. 2018. World Malaria Report: World Health Organization. https://www.who.int/malaria/publications/world-malaria-report-2018/en/.

Zhang C, Gao H, Yang Z, Jiang Y, Li Z, Wang X, Xiao B, Su XZ, Cui H, Yuan J. 2017. CRISPR/Cas9 mediatedsequential editing of genes critical for ookinete motility in Plasmodium yoelii. Molecular and BiochemicalParasitology 212:1–8. DOI: https://doi.org/10.1016/j.molbiopara.2016.12.010, PMID: 28034675

Zischewski J, Fischer R, Bortesi L. 2017. Detection of on-target and off-target mutations generated by CRISPR/Cas9 and other sequence-specific nucleases. Biotechnology Advances 35:95–104. DOI: https://doi.org/10.1016/j.biotechadv.2016.12.003, PMID: 28011075






https://www.who.int/malaria/publications/world-malaria-report-2018/en/

https://www.who.int/malaria/publications/world-malaria-report-2018/en/

https://doi.org/10.1016/j.molbiopara.2016.12.010


https://doi.org/10.1016/j.biotechadv.2016.12.003

https://doi.org/10.1016/j.biotechadv.2016.12.003



rapid and iterative genome editing in the malaria parasite

Documents