Proc. Natl. Acad. Sci. USAVol. 93, pp. 10440-10445, September 1996Neurobiology

Rat hippocampal neurons express genes for both rod retinal andolfactory cyclic nucleotide-gated channels: Novel targets forcAMP/cGMP function

(in situ hybridization/protein kinases/calcium/long-term potentiation/nitric oxide)

PAUL A. KINGSTON*t, FRANK ZUFALLt, AND COLIN J. BARNSTABLE*tt*Department of Ophthalmology and Visual Science and tSection of Neurobiology, Yale University School of Medicine, New Haven, CT 06520

Communicated by Torsten N. Wiesel, The Rockefeller University, New York NY, June 4, 1996 (received for review January 2, 1996)

ABSTRACT Cyclic nucleotide-gated (CNG) channels areCa2+-permeable, nonspecific cation channels that can beactivated through direct interaction with cAMP and/orcGMP. Recent electrophysiological evidence for these chan-nels in cultured hippocampal neurons prompted us to inves-tigate the expression of CNG channel genes in hippocampus.PCR amplification detected the expression of transcripts forsubunit 1 of both the rod photoreceptor (RCNGC1) and theolfactory receptor cell (OCNGC1) subtype ofCNG channel inadult rat hippocampus. In situ hybridization detected expres-sion of both channel subtypes in most principal neurons,including pyramidal cells of the CAl through CA3 regions andgranule cells of the dentate gyrus. From the hybridizationpatterns, we conclude that the two genes are colocalized inindividual neurons. Comparison of the patterns of expressionof type 1 cGMP-dependent protein kinase and the CNGchannels suggests that hippocampal neurons can respond tochanges in cGMP levels with both rapid changes in CNGchannel activity and slower changes induced by phosphory-lation. Future models of hippocampal function should includeCNG channels and their effects on both electrical responsesand intracellular Ca2+ levels.

cAMP and cGMP regulate the activity of neurons throughoutthe central nervous system (CNS), controlling metabolic pro-cesses, electrical signaling, and synaptic physiology (1-3). Inthe hippocampus, both neurotransmitters and diffusible mes-sengers have been shown to modulate cAMP and cGMP levels(2, 4-6). Both nucleotides may have roles in certain forms ofuse-dependent alteration of synaptic strength which arethought to underlie information storage, such as long-termpotentiation (for reviews, see refs. 7-9). It has been generallyassumed that cAMP and cGMP act at hippocampal synapsesby activating specific protein kinases. Although abundantevidence supports a role for these kinases (10), recent findingshave suggested an additional pathway by which cAMP andcGMP can influence neuronal activity, namely through thedirect gating of a class of Ca2+-permeable, nonselective cationchannels.

Cyclic nucleotide-gated (CNG) channels were originallydetected in rod and cone photoreceptors (11, 12) and olfactoryreceptor cells (13), where they mediate the transduction ofsensory stimuli into neuronal activity. The principal subunit(subunit 1 or a) of each subtype of CNG channel is encodedby a separate gene (14-18). Native CNG channels are likely tobe heterooligomers and additional subunits (subunit 2 or f3)have been discovered that are incapable of forming functionalCNG channels by themselves but do alter the kinetics ofchannel opening and the selectivity of cyclic nucleotide re-sponsiveness when coexpressed with subunit 1 (19-23). The

three subtypes of CNG channels clearly form a gene family,and the predicted amino acid sequences of subunit 1 showextensive homology over the C-terminal 75% of the molecules(for review, see ref. 24). This region contains the proposed sixtransmembrane spans, the pore-forming loop, and the C-terminal cytoplasmic region containing the cyclic nucleotidebinding domain. In contrast, the N-terminal 25% of themolecules shows extensive sequence variation with both sub-stitutions and large deletions and insertions.CNG channel subtypes differ in their sensitivity to cAMP

and cGMP in that the olfactory channel can be activated byphysiological concentrations of both nucleotides (13, 25)whereas the photoreceptor channels are activated only bycGMP (11, 26). The channel subtypes also differ in theirrelative permeability to physiological concentrations of Ca21such that the fractional current carried by Ca2+ in the olfactorychannel is greater than that in the rod channel (27).

It is only recently that CNG channels have been detected inneurons other than sensory receptor cells. Within the retina,graded electrical responses in ON-bipolar cells are generatedby CNG channels controlled by a pathway linked to a metabo-tropic glutamate receptor (28, 29). A cGMP-gated conduc-tance that was activated by NO-releasing agents has beendetected in cultured retinal ganglion cells (30). These findingsled us to propose that CNG channels may play a more generalrole in cAMP and cGMP signaling, and may mediate many ofthe actions of diffusible messengers, such as NO, that canstimulate cGMP production in the CNS. In a preliminary testof this hypothesis, we recently described a membrane conduc-tance activated by cGMP in cultured rat hippocampal neuronsthat showed many of the properties characteristic of CNGchannels (31). These include nonselective permeability tocations, block by divalent cations such as Cd2I and Ca2 , lackof voltage sensitivity, and a Ca2+ permeability whose proper-ties fit a quantitative model developed specifically for Ca2+fluxes through CNG channels.We have examined expression of CNG channel RNAs in rat

hippocampus. Using probes for the rod photoreceptor (RC-NGC1) and olfactory receptor cell (OCNGC1) subtypes ofCNG channel, we show that hippocampal neurons expressRNA for both channels. Because individual hippocampalneurons can express both subtypes of channel, it would appear

Abbreviations: CNS, central nervous system; CNG, cyclic nucleotide-gated; RT, reverse transcription; RCNGC1, rod cyclic nucleotidegated channel subunit 1; OCNGC1, olfactory cyclic nuleotide gatedchannel subunit 1; part GC-A, atrial natriuretic factor-receptor par-ticulate guanylyl cyclase; sol GC-70, 70-kDa subunit of soluble guanylylcyclase; PKG1, type I cGMP-dependent protein kinase; CaM-PDE 61,61-kDa Ca2+-calmodulin-dependent phosphodiesterase.ITo whom reprint requests should be addressed at: Department ofOphthalmology and Visual Science, Yale University School of Med-icine. P.O. Box 208061, 333 Cedar Street, New Haven, CT 06520-8061.

10440

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 93 (1996) 10441

that both cAMP and cGMP may exert some of their effectsthrough the activation of CNG channels.

MATERIALS AND METHODSReverse Transcription (RT)-PCR Amplification. cDNA was

reverse-transcribed in 50-,ul volumes from 10 ,ug of total RNAas described (32). Aliquots (5 j,l) were taken for PCR ampli-fication using previously described conditions (30). All CNGchannel primers (Table 1) were chosen to minimize crossre-action with other members of the gene family. Primers for the70-kDa soluble guanylyl cyclase 13-subunit (sol GC-70) and theatrial natriuretic factor-receptor particulate guanylyl cyclase(part GC-A) have been described previously (32).Probe Preparation. The identity and orientation of inserts in

all plasmids used for probe preparation were verified bysequencing using the dideoxy method (35). Plasmids werelinearized and used as templates for in vitro transcription ofsense and antisense digoxigenin-labeled RNA probes. Digoxi-genin-labeled UTP (Boehringer Mannheim) was used accord-ing to the manufacturer's recommendations. Purity and spe-cific activity were estimated by immunological detection ofelectrophoresed and blotted samples of probes.

Southern and Northern Blot Procedures. PCR productswere electrophoresed and blotted using standard methods(36). For Northern blots, full-length RCNGC1 cRNA gener-ated by in vitro transcription (33) was electrophoresed in a 2%formaldehyde denaturing gel. Southern and Northern blotshybridizations were performed in 50% formamide/5X stan-dard saline citrate (SSC)/0.1% Ficoll/0.1% polyvinylpyrroli-done/10-50 ngml-' digoxigenin-labeled RNA probe over-night at 50°C. Post-hybridization washes were carried out at50°C. An alkaline phosphatase-conjugated sheep anti-digoxigenin antibody was used for immunological detection.

In Situ Hybridization Procedures. Sections were prepared asdescribed (33). Slides were briefly thawed, rehydrated in 2xSSC, treated with 0.3% (vol/vol) Triton X-100 in 1 x PBS for30 min, treated with 0.1 M triethanolamine/0.25% aceticanhydride (vol/vol) for 10 min to reduce background signal,submerged for 15 sec in cold acetic acid, and rinsed three timesin 2x SSC. Sections were prehybridized for at least 2 hr in 100j,l of hybridization solution and then hybridized with dena-tured RNA probe (250-2500 ng/ml hybridization solution)overnight at 55°C.

After washing in 5 x SSC for 5 min at room temperature,0.2x SSC for 60 min at 55-65°C, and 0.2x SSC for 5 min atroom temperature, slides were treated with RNase (50 ,ug/mlin 0.2x SSC) for 30 min at 37°C to destroy any remainingunhybridized probe. Slides then underwent immunologicaldetection procedures similar to those used for blots. Thelabeling reactions were performed in darkness, and develop-ment was halted simultaneously for each sense/antisense pairof probes. Slides were then washed in distilled water, mountedin Mowiol aqueous medium (Aldrich), and coverslipped formicroscopy. Microscopic and photographic images were cap-

Rl 5'

5' _

RI 3'L- --I. ..

1I'DI 11 3'

rRCNGC 1

015' 013'

hll El -- .... a

rOCNGC 1

FIG. 1. Schematic illustrating the PCR primer pairs used to amplifyportions of the rat rod photoreceptor (rRCNGC1; ref. 33) andolfactory epithelial CNG channel (rOCNGC1; ref. 15) transcripts.Shown for each transcript are the coding region (large open rectangle),putative transmembrane segments (filled boxes), pore region (openbox), and cyclic nucleotide binding domain (hatched box).

tured using digital scanners and assembled into compositefigures using Adobe PHOTOSHOP.

RESULTS

Detection of CNG Channel RNAs in Rat Hippocampus.Both RCNGC1 and OCNGC1 RNAs were detected by RT-PCR amplification of hippocampal cDNA using multiple setsof primers as indicated in Fig. 1. Primer sets designed toamplify the less homologous 5' regions, from -15 to +801 ofRCNGC1 and +345 to + 1038 of OCNGC1 resulted in bandsof the predicted length and of the same size as those fromretina and olfactory epithelium, respectively (Fig. 2). Primersets corresponding to the 3' regions of RCNGC1 and OC-NGC1 also gave bands of the expected size using cDNA fromhippocampus and control tissues (not shown). No bands were

M Rt Hc 0 oR DO M

C

lop i.._

__. 4 44

M OE Hc 0 pO pR M

D

.4...I" -.-44i

14

Table 1. Primer pairs used for PCR amplification

Gene Sequence Ref.

RCNGC1 5' fwd GATATTAAACTAACCATGAAGAC 335' rev TAACAGCCGGTTCAACCTGAT

RCNGC1 3' fwd GCCACCATTGTCGGTAACATAGG 333' rev TCATACTCAGCCAAGATTCGGGCA

OCNGC1 5' fwd GACCGAAAAATCCAATGGTGTG 155' rev AGTGGGAATGATAGAAGCCACATC

OCNGC1 3' fwd GTCATCATCCACTGGAATGCTTG 153' rev ATCAGCTACCACTGCCAACTTGCCC

PKGI fwd ATCCTTGACAATGACTTTATGAA 34rev CTGCAAGGCTTTCTCTCCAAACCA

FIG. 2. RT-PCR fragments amplified from rod (A and C) andolfactory CNG channel (B and D) transcripts. Electrophoresis of PCRproducts amplified from adult rat hippocampal (Hc), retinal (Rt), andolfactory epithelial (OE) cDNA yielded visible bands of predictedmass, whereas samples lacking cDNA (0) did not. Southern blots ofthe PCR products tested with digoxigenin-labeled probe for the rod(C) and olfactory channels (D) confirmed the identity of amplifiedfragments (double arrowheads); furthermore, each probe bound frag-ments digested from plasmids containing the cloned rod (pR) orolfactory (pO) fragments, while failing to cross-hybridize with frag-ments of the other sequence. Hybridization to the larger plasmid bandsin these lanes is due to the presence of short plasmid sequences at the5' end of the transcribed RNA probes. Size markers correspond toHaeIII-digested FX174 DNA fragments (single arrowheads) as shownin A and B.

Neurobiology: Kingston et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

10442 Neurobiology: Kingston et al.

RCNGC1 5'

_

OCNGCI 5'

FIG. 3. Rat hippocampal sections labeled by digoxigenin-labeled RNA probes for the 5' portions of the subunits 1 of the rod (A, C, and D)and olfactory (B, E, and F) CNG channels. (A and B) Antisense-probed sections show CNG channel expression in CA1-3 pyramidal neurons, dentategranule cells, and scattered cells in the strata flanking CA1-3 and the dentate hilus. Sense-probed sections (Insets) are relatively blank. White framesenclose portions of each section magnified in C-F. High-magnification views of CAl of Ammon's horn (C and E) and the dentate gyrus (D andF), where virtually every visible pyramidal and dentate granule neuron is labeled. (Bars: A and B, 500 ,um; C-F, 100 ,um.)

detected when reactions were carried out without cDNA (Fig.2, lanes 0), or when reverse transcriptase was omitted from thecDNA synthesis reactions. In addition, the 5' RCNGC1 prim-ers, and most probably the 5' OCNGC1 primers, correspondto sequences in different exons and would give much largerbands by amplification of genomic DNA.To eliminate the possibility of chance contamination from

existing cDNA clones, we carried out one further control usingthe 3' sets of primers. Using the same reagent stocks, weamplified cDNA prepared from mouse hippocampus andderived partial sequences of the product by cycle sequencing(data not shown). Over the 332-bp region of the 3' RCNGC1channel fragment sequenced, each of the 21 nucleotides thatdiffer between mouse (37) and rat (33) corresponded to themouse sequence. Similarly, the 3' OCNGC1 fragment differed

from the known rat sequence at multiple positions (the mouseOCNGC1 sequence is not yet available). Together, thesecontrols confirm that our results were due to amplification ofRNAs derived from the appropriate starting tissues.On Southern blots of the PCR amplifications, the RCNGC1

probe detected the 816-bp band from hippocampus and retinaas well as the control plasmid. In addition, a band of approx-imately 700 bp was detected on the Southern blot of the PCRproducts amplified from hippocampal and retinal cDNAs andthe control rod CNG channel plasmid. Because of its presencein the control plasmid and its lack of labeling by ethidiumbromide, this band probably represents single-stranded prod-uct from the PCR reactions. The RCNGC1 probe did not reactwith a cloned olfactory CNG channel cDNA. Similarly, theOCNGC1 probe detected the 693-bp band from hippocampus,

Proc. Natl. Acad. Sci. USA 93 (1996)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 93 (1996) 10443

olfactory epithelium, and the control plasmid but not thecloned RCNGC1 fragment. Thus, the bands amplified by PCRcorrespond to RCNGC1 and OCNGC1, respectively, and theprobes do not cross-hybridize under the conditions used.

In Situ Hybridization and Northern Blot Controls. Hybrid-ization of antisense-RNA probes for the 5' CNG channelregions to cryostat sections of adult rat hippocampus revealedexpression of RCNGC1 and OCNGC1 RNAs in virtually everyvisible cell body (Fig. 3). Labeling was detected in pyramidalcells and in granule cells of the dentate gyrus, as well as inscattered interneurons in the stratum oriens, stratum radiatum,dentate molecular layer, and dentate hilus. Sections probedwith similar concentrations of sense strand probes showedvirtually no detectable labeling (Fig. 3 A and B Insets).Pretreatment of sections with RNase eliminated labeling bythe antisense probes, thus confirming that they were hybrid-izing to RNA targets.

Northern blots of full-length cRNA encoding RCNGC1were hybridized with the 5' retinal and olfactory RNA probes(Fig. 4) under conditions less stringent than those employedduring in situ hybridization. The antisense RCNGC1 5' probebound the retinal transcript, whereas the antisense OCNGC15' probe did not, demonstrating that the probes are specific fortheir intended targets.

R1 5' 01 51M R R pO

FIG. 4. Northern blot of rod CNG channel RNA hybridized withantisense RNA probes for the 5' regions of the rod and olfactory CNGchannels. The rod 5' probe (Ri 5') binds a full-length retinal cRNAtranscript (lane R) generated by in vitro transcription, whereas theolatry 'prb fails toN deetit, bi,ndi-ngonl %1aplasnmiDA

control (lane pO). Lower marker bands (lane M) correspond to RNALadder (GIBCO/BRL) fragments of 2.37, 1.35, and 0.24 kb but do notapply to the plasmid DNA control.

M Hc Cb 0 Hc Rt 0 Hc Rt 0 M

D E F

14.44

44

FIG. 5. PCR products generated with primers for PKG1 (A and D),sol GC-70 (B and E), and part GC-A (C and F) and analyzed by gelelectrophoresis (A-C) and Southern blotting (D-F). Fragments wereamplified from adult rat hippocampus (Hc) and from control cere-bellum (Cb), and retina (Rt). Negative controls (0) are blank. Sizemarkers correspond to HaeIII-digested FX174 DNA fragments (singlearrowheads).

Expression of Type I cGMP-Dependent Protein Kinase(PKG1) and Guanylyl Cyclases in Rat Hippocampus. PKG1was detected by RT-PCR, although we did not attempt todetermine whether both the a and ,3 subunits are expressed(Fig. 5 A and D). Both the soluble, nitric oxide-activatedguanylyl cyclase and the transmembrane part GC-A were alsodetected by RT-PCR (Fig. 5 B, C, E, and F).

In situ hybridization using cloned PKG1, sol GC-70, and partGC-A antisense probes all showed labeling of both pyramidaland granule cells as well as scattered cells in other layers, apattern very similar to that of the CNG channel probes (Fig.6). Virtually no cell bodies were unlabeled with these probes.In contrast, a probe for CaM-PDE 61 labeled the pyramidalcell layer but not the granule cells of the dentate gyrus, apattern that is consistent with previously described results (38).In all cases, sense strand probes gave no detectable labeling(not shown).

It is clear from these results that hippocampal neurons cansynthesize cGMP by at least two guanylyl cyclases. Further-more, the expression patterns of PKG1 and the CNG channelsare so inclusive that they must overlap in some, if not all, cells,and at least some cells must therefore coexpress them. Thecolocalization of PKG1 and CNG channels suggests thatincreased cGMP levels within hippocampal neurons will leadto a cascade of direct and indirect actions on cell responses.

DISCUSSIONThere are two major findings of this study. First, neurons inadult rat hippocampus express transcripts for at least twosubtypes of CNG channel. Using PCR amplification, we havedetected subunit 1 of both the rod photoreceptor (RCNGC1)and the olfactory receptor cell (OCNGC1) subtypes of CNGchannel. Second, using in situ hybridization, we have shownthat many hippocampal neurons express both subtypes. Pre-viously, we used whole-cell patch-clamp recording from cul-tured rat hippocampal neurons to detect a cGMP-activatedconductance whose properties were consistent with those of

Neurobiology: Kingston et al.

110.10.III.

Ploo.

0*

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

10444 Neurobiology: Kingston et al.

FIG. 6. In situ hybridization with probes for PKG1, the 61-kDa Ca2+-calmodulin-dependent phosphodiesterase (CaM-PDE 61), sol GC-70, andpart GC-A. Low-magnification micrograph of a PKG1 antisense-probed section reveals a labeling pattern similar to that of the CNG channel probes(see Figs. 2 and 3), whereas the CaM-PDE 61 probe selectively labels the pyramidal neurons in CAl through CA3 regions. A sense-probed sectionwas essentially unlabeled (not shown). Higher-power views of the dentate gyrus probed for sol GC-70 and part GC-A demonstrate expression inboth pyramidal and granule neurons. High-power views of the PKG1-probed sections (not shown) reveal the same patterns. (Bars: PKG1 andCaM-PDE 61, 500 ,um; sol GC-70 and part GC-A, 200 ,um.)

CNG channels (31). This conductance was nonselectivelypermeable to cations and completely but reversibly blocked byexternal Cd2+. The conductance also showed no inactivationover time in the absence of ATP or GTP and Mg2+ from thepipet solution, arguing against a contribution of protein ki-nases. These physiological results strongly suggest that theCNG channel RNA we have detected is translated into func-tional channels in hippocampal neurons.The products amplified in our PCR experiments were clearly

derived from fully processed mRNA, and other controlsprovided further evidence against the possibility of any reagentcontamination. As a further verification of our PCR results, weseparately amplified both 5' and 3' segments from eachchannel subtype and confirmed the identity of all bands bySouthern analysis. We also tested the 5' probes for crossreac-tivity against full-length cRNA transcripts on Northern blotsand found none. Our in situ hybridization probes were, there-fore, detecting transcripts for two separate genes rather thancrossreacting with a single channel subtype. Because most, ifnot all, neurons in hippocampus were labeled by probes forboth CNG channels, we carried out several experiments toensure that we were detecting specific labeling. In no case didwe detect any significant reactivity using sense strand probes.In addition, we used a probe for CaM-PDE 61 that labeled thepyramidal neurons but not the granule neurons of the dentategyrus. More extensive analysis of in situ hybridization of CNGchannel probes to adult rat CNS has also indicated regions thatdo not label (unpublished observations).Taken together, our results show conclusively that adult rat

hippocampus expresses RNA for at least two members of theCNG channel family. The need for extensive PCR amplifica-tion and long development times for the in situ hybridizationsuggests that the levels of CNG channel RNA in hippocampusare low. This could account for the variable results in CNGchannel RNA detection by PCR amplification of cDNA de-rived from various CNS regions in earlier studies (22, 39, 40).

Previous work has shown that two isoforms of cAMP-dependent protein kinase are expressed in mouse hippocam-pus (41), but the distribution of cGMP-dependent protein

kinases is less well understood. Early studies failed to detectsoluble or PKG1 in most brain regions by immunocytochem-istry (42). We have detected this form of PKG by RT-PCR inrat hippocampus, but the levels of protein could well be belowthose necessary for immunocytochemistry. Recently, low lev-els of RNA for a type II or membrane-bound form of PKGhave been detected in rat hippocampus using in situ hybrid-ization (43). Our results, together with previous findings,suggest that both cAMP and cGMP can activate both CNGchannels and several protein kinases. Because theKm values ofthe cyclic nucleotides for the various effectors differ by morethan one order of magnitude, it is possible that effectorpathways may be selectively activated according to the changesin cyclic nucleotide concentrations.The expression of RCNGC1 and OCNGC1 in hippocampal

neurons, and the presence of a cGMP-activated cationicconductance (31) in the same cells, is of particular interestbecause a series of studies suggested critical roles for bothcAMP and cGMP in mechanisms of activity-dependentchanges of synaptic strength in hippocampus. For example,there is evidence for involvement of cAMP in the early phaseof long-term potentiation in the mossy fiber pathway (44, 45).Although more controversial, there is also abundant evidencefor a significant role of cGMP in long-term potentiation, atleast in CAl pyramidal neurons (see ref. 6 for review), as wellas LTD (46).The mechanisms by which cyclic nucleotides affect long-

term potentiation and other forms of hippocampal plasticityare poorly understood. Recent studies have shown that in-creased cGMP levels in hippocampal neurons can lead toincreased transmitter release (47), and that Ca2+ entry intopresynaptic terminals plays a critical role (9). Although someof these effects may be mediated by protein kinases (10), wepropose that CNG channels may also contribute to some of theactions ofcAMP and cGMP in hippocampus and other regionsof the CNS. Indeed, some of the characteristic properties ofCNG channels make them exceptionally well-suited candidatesfor synaptic signal modulation. For example, there is a growingbody of evidence that CNG channels are an important down-

Proc. Natl. Acad. Sci. USA 93 (1996)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 93 (1996) 10445

stream mediator for the effects of the diffusible messengersNO and carbon monoxide CO (29, 30, 48), agents known tostimulate the activity of soluble guanylyl cyclase and thusincrease cGMP levels. It has also been established that CNGchannels display an unusually high permeability for Ca2+ andcan provide a pathway for the entry of extracellular Ca2+ thatis regulated by cyclic nucleotide concentrations and not bymembrane voltage (30, 31, 49). In at least one example,activation of presynaptic CNG channels by cGMP or NO wassufficient to increase vesicular neurotransmitter release (50).Because gaseous messengers can act in an anterograde or

lateral manner as well as retrogradely, these molecules couldalso affect CNG channel activity at postsynaptic sites. Atpresent, we do not know the subcellular localization of CNGchannels in hippocampus. It is possible that they exert theireffects at both postsynaptic and presynaptic sites. Because wehave shown that hippocampal neurons can express more thanone type of CNG channel subunit, it is conceivable that thedifferent channel subtypes are localized on different regions ofthe neuron, which would lead to spatially selective actions ofcGMP and cAMP. We also cannot exclude the possibility thatthe CNG channel subunits we have detected are combinedwith other yet unknown polypeptides to create channels withnovel properties.Our results require that future models of the roles of cyclic

nucleotides in hippocampal function include the activity ofCNG channels. Pharmacological or genetic manipulation ofCNG channel activity will be essential to fully understand therole of these molecules in synaptic interactions and otherfeatures of hippocampal function and development.

We thank A. LaRue and S. Viviano for excellent technical assis-tance; Dr. I. Ahmad for participation in preliminary experiments thatprecipitated the present study; Dr. J.-Y. Wei for the RCNGC1 cRNAtranscript; D. Samanta-Roy for the CaM-PDE 61 probe; and Drs. T.Hughes, G. Shepherd, and A. Williamson for comments on themanuscript. This work was supported by grants from the NationalInstitutes of Health (F.Z. and C.J.B.) and a National Science Foun-dation predoctoral fellowship (P.A.K.), as well as by the ZieglerFoundation and a gift from Mr. James Kemper. C.J.B. is a Jules andDoris Stein Research to Prevent Blindness Professor.

1. Greengard, P. & Costa, E. (1970) Adv. Biochem. Psychopharna-col. 3, 1-385.

2. Bloom, F. E. (1975) Rev. Physiol. Biochem. Pharmacol. 74, 1-103.3. Nathanson, J. A. (1977) Physiol. Rev. 57, 157-256.4. East, S. J. & Garthwaite, J. (1991) Neurosci. Lett. 123, 17-19.5. Chetkovich, D. M., Klann, E. & Sweatt, J. D. (1993) Neuroreport

4, 919-922.6. Hawkins, R. D., Zhuo, M. & Arancio, 0. (1994) J. Neurobiol. 25,

652-665.7. Bliss, T. V. B. & Collingridge, G. L. (1993) Nature (London) 361,

31-39.8. Hawkins, R. D., Kandel, E. R. & Siegelbaum, S. A. (1993)Annu.

Rev. Neurosci. 16, 625-665.9. Nicoll, R. A. & Malenka, R. C. (1995) Nature (London) 377,

115-118.10. Schulman, H. (1995) Curr. Opin. Neurobiol. 5, 375-381.11. Fesenko, E. E., Kolesnikov, S. S. & Lyubarsky, A. L. (1985)

Nature (London) 313, 310-313.12. Haynes, L. W. & Yau, K.-W. (1985) Nature (London) 317,61-64.13. Nakamura, T. & Gold, G. H. (1987) Nature (London) 325,

442-444.

14. Kaupp, U. B., Niidome, T., Tanabe, T., Terada, S., Bonigk, W.,Stuhmer, W., Cook, N. J., Kangwaw, K., Matsuo, H., Hirose, T.,Miyata, T. & Numa, S. (1989) Nature (London) 342, 762-766.

15. Dhallan, R. S., Yau, K.-W., Schrader, K. A. & Reed, R. R. (1990)Nature (London) 347, 184-187.

16. Ludwig, J., Margalit, T., Eismann, E., Lancet, D. & Kaupp, U. B.(1990) FEBS Lett. 270, 24-29.

17. Goulding, E., Ngai, J., Kramer, R., Colicos, S., Axel, R.,Siegelbaum, S. A. & Chess, A. (1992) Neuron 8, 45-58.

18. Bonigk, W., Altenhofen, W., Muller, F., Dose, A., Illing, M.,Moldav, R. S., & Kaupp, U. B. (1993) Neuron 10, 865-877.

19. Chen, T.-Y., Peng, Y.-W., Dhallan, R. S., Ahamed, B., Reed,R. R. & Yau, K.-W. (1993) Nature (London) 362, 764-767.

20. Chen, T.-Y., Illing, M., Molday, L. L., Hsu, Y.-T., Yau, K.-W. &Molday, R. S. (1994) Proc. Natl.Acad. Sci. USA 91,11757-11761.

21. Liman, E. R. & Buck, L. B. (1994) Neuron 13, 611-621.22. Bradley, J., Li, J., Davidson, N., Lester, H. A. & Zinn, K. (1994)

Proc. Natl. Acad. Sci. USA 91, 8890-8894.23. Korschen, H. G., Illing, M., Seifert, R., Sesti, F., Williams A.,

Gotzes S., Colville, C., Muller, F., Dose, A., Godde, M., Molday,L., Kaupp, U. B. & Molday, R. S. (1995) Neuron 15, 627-636.

24. Kaupp, U. B. (1995) Curr. Opin. Neurobiol. 5, 434-442.25. Zufall, F., Firestein, S. & Shepherd, G. M. (1994) Annu. Rev.

Biophys. Biomol. Struct. 23, 577-607.26. Yau, K.-W. & Baylor, D. A. (1989) Annu. Rev. Neurosci. 12,

289-327.27. Frings, S., Seifert, R., Godde, M. & Kaupp, U. B. (1995) Neuron

15, 169-179.28. Nawy, S. & Jahr, C. (1990) Nature (London) 346, 269-271.29. Shiells, R. A. & Falk, G. (1990) Proc. R. Soc. London B 242,

91-94.30. Ahmad, I., Leinders-Zufall, T., Kocsis, J. D., Shepherd, G. M.,

Zufall, F. & Barnstable, C. J. (1994) Neuron 12, 155-165.31. Leinders-Zufall, T., Rosenboom, H., Barnstable, C. J., Shepherd,

G. M. & Zufall, F. (1995) Neuroreport 6, 1761-1765.32. Ahmad, I. & Barnstable, C. J. (1993) Exp. Eye Res. 56, 51-62.33. Barnstable, C. J. & Wei, J. Y. (1995)J. Mol. Neurosci. 6, 289-302.34. Wernet, W., Flockerzi, V. & Hofmann, F. (1989) FEBS Lett. 251,

191-196.35. Sanger, F. S., Nicklen, S. & Coulson, A. R. (1977) Proc. Nat.

Acad. Sci. USA 74, 5463-5467.36. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press,Plainview, NY), 2nd Ed.

37. Pittler, S. J., Lee, A. K., Altherr, M. R., Howard, T. A., Seldin,M. F., Hurwitz, R. L., Wasmuth, J. J. & Baehr, W. (1992)J. Biol. Chem. 267, 6257-6262.

38. Yan, C., Bentley, J. K., Sonnenburg, W. K. & Beavo, J. A. (1994)J. Neurosci. 14, 973-984.

39. El-Husseini, A. E.-D., Bladen, C. & Vincent, S. R. (1995) Neu-roreport 6, 1459-1463.

40. Distler, M., Biel, M., Flockerzi, V. & Hofmann, F. (1994)Neuropharmacology 33, 1275-1282.

41. Cadd, G. & McKnight, G. S. (1989) Neuron 3, 71-79.42. Lohmann, S. M., Walter, U., Miller, P. E., Greengard, P. &

DeCamilli, P. (1981) Proc. Natl. Acad. Sci. USA 78, 653-657.43. El-Husseini, A. E.-D., Bladen, C. & Vincent, S. R. (1995) J. Neu-

rochem. 64, 2814-2817.44. Weisskopf, M. G., Castillo, P. E., Zalutsky, R. A. & Nicoll, R. A.

(1994) Science 265, 1878-1882.45. Huang, Y. Y., Li, X. C. & Kandel, E. R. (1994) Cell 79, 69-79.46. Zhuo, M., Kandel, E. R. & Hawkins, R. D. (1994) Neuroreport 5,

1033-1036.47. Arancio, O., Kandel, E. R. & Hawkins, R. D. (1995) Nature

(London) 376, 74-80.48. Leinders-Zufall, T., Shepherd, G. M. & Zufall, F. (1995) J. Neu-

rophysiol. 74, 1498-1508.49. Shiells, R. & Falk, G. (1992) Neuroreport 3, 845-848.50. Rieke, F. & Schwartz, E. A. (1994) Neuron 13, 863-873.

Neurobiology: Kingston et aL

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0