regulation of dna replication machinery by mrc1 in fission
TRANSCRIPT
![Page 1: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/1.jpg)
1
Regulation of DNA Replication Machinery by Mrc1 in Fission Yeast
Naoki Nitani*, Ken-ichi Nakamura*§,
Chie Nakagawa*, Hisao Masukata*§ and Takuro Nakagawa*
Department of Biological Science, Graduate School of Science*,
Graduate School of Frontier Biosciences§, Osaka University
Toyonaka, Osaka 560-0043, Japan
Genetics: Published Articles Ahead of Print, published on July 18, 2006 as 10.1534/genetics.106.060053
![Page 2: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/2.jpg)
2
Running head:
Mrc1 negatively regulates Cdc45 and MCM
Key words:
DNA replication, Checkpoint, Fission yeast, Mrc1, Cdc45
Corresponding author:
Takuro Nakagawa
Department of Biological Science, Graduate School of Science, Osaka University
1-1 Machikaneyama, Toyonaka, Osaka 560-0043, Japan
Phone: +81-6-6850-5431
Fax: +81-6-6850-5440
Email: [email protected]
![Page 3: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/3.jpg)
3
ABSTRACT
Faithful replication of chromosomes is crucial to genome integrity. In yeast, ORC binds
replication origins throughout the cell cycle. However, Cdc45 binds these before S phase,
and during replication, it moves along the DNA with MCM helicase. When replication
progression is inhibited, checkpoint regulation is believed to stabilize the replication fork; the
detailed mechanism, however, remains unclear. To examine the relationship between
replication initiation and elongation defects and the response to replication elongation block,
we used fission yeast mutants of Orc1 and Cdc45—orp1-4 and sna41-928, respectively—at
their respective semipermissive temperatures with regard to BrdU incorporation. Both orp1
and sna41 cells exhibited HU hypersensitivity in the absence of Chk1, a DNA damage
checkpoint kinase, and were defective in full activation of Cds1, a replication checkpoint
kinase, indicating that normal replication is required for Cds1 activation. Mrc1 is required to
activate Cds1 and prevent the replication machinery uncoupling from DNA synthesis. We
observed that, while either the orp1 or sna41 mutation partially suppressed HU sensitivity of
cds1 cells, sna41 specifically suppressed that of mrc1 cells. Interestingly, sna41 alleviated
![Page 4: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/4.jpg)
4
the defect in recovery from HU arrest without increasing Cds1 activity. In addition to sna41,
specific mutations of MCM suppressed the HU sensitivity of mrc1 cells. Thus, during
elongation, Mrc1 may negatively regulate Cdc45 and MCM helicase to render stalled forks
capable of resuming replication.
![Page 5: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/5.jpg)
5
INTRODUCTION
During DNA replication, various kinds of intermediate DNA structures are formed,
including single-stranded, nicked, and Y-shaped DNA. These replication intermediates
appear to be unstable, especially when the progression of replication is hampered by dNTP
starvation, non-histone DNA-binding proteins, or DNA lesions (BRANZEI and FOIANI 2005;
IVESSA et al. 2003). The collapsed DNA structures resulting from stalled replication forks
are a great threat to genome integrity. Therefore, stalled replication forks must be processed
faithfully to prevent chromosomal aberrations that can cause cell death or cancer in
multicellular organisms.
DNA replication is initiated at specific chromosomal loci known as replication origins.
Origin recognition complexes (ORCs) bind the origin and serve as landing pads for other
replication factors (for reviews, see BELL and DUTTA 2002; LEI and TYE 2001; TYE 1999).
Prior to entry into the S phase, the minichromosome maintenance (MCM) complex is loaded
onto the origin via the function of Cdc18/Cdc6 and Cdt1. Several lines of evidence indicate
that the MCM complex is likely to be a replicative DNA helicase that functions with the aid
![Page 6: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/6.jpg)
6
of other factors and protein modifications (APARICIO et al. 1997; CHONG et al. 2000; ISHIMI
1997; KELMAN et al. 1999; LABIB et al. 2000; YOU et al. 1999). Cdc45 appears to be an
essential accessory factor for the MCM helicase since Cdc45 is associated with the MCM
helicase only during the S phase and since DNA unwinding by the MCM helicase is
stimulated by the presence of Cdc45 (MASUDA et al. 2003; TERCERO et al. 2000; WALTER
and NEWPORT 2000; ZOU and STILLMAN 1998). In addition, Cdc45 as well as MCM moves
along the DNA, and the destruction of these factors prevents further replication following
replication initiation (APARICIO et al. 1997; LABIB et al. 2000; TERCERO et al. 2000).
Therefore, in contrast to the ORC, Cdc45 participates in both the initiation and elongation
phases of replication.
The progression of DNA replication is monitored by the checkpoint mechanism to ensure
that stalled replication forks are stabilized and mitosis occurs only after all the chromosomes
have completely replicated (for reviews, see CARR 2002; HARTWELL and WEINERT 1989;
NYBERG et al. 2002; ZHOU and BARTEK 2004). Most factors involved in the checkpoint have
been conserved from yeast to humans. In the fission yeast Schizosaccharomyces pombe,
![Page 7: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/7.jpg)
7
Rad3 is the central player in the checkpoint mechanism and is required for the
phosphorylation and activation of the downstream kinases, Cds1 and Chk1 (LINDSAY et al.
1998; MURAKAMI and OKAYAMA 1995; WALWORTH and BERNARDS 1996). The
phosphorylation of Cds1 and Chk1 results in increased kinase activity (CAPASSO et al. 2002;
LINDSAY et al. 1998; LOPEZ-GIRONA et al. 2001). The activated kinases inhibit cell-cycle
dependent kinase (CDK) by phosphorylating CDK regulators (e.g., Wee1, Mik1, and Cdc25),
thus causing cell cycle arrest (FURNARI et al. 1999; RALEIGH and O'CONNELL 2000; RHIND et
al. 1997). In addition, Cds1 and Chk1 may contribute to DNA metabolism by regulating the
expression, localization and activity of a set of proteins that is involved in the repair of DNA
damage and/or in the processing of stalled replication forks (BODDY et al. 2000; BODDY et al.
2003; CASPARI et al. 2002; HUANG et al. 1998; KAI et al. 2005; SOGO et al. 2002). Although
Cds1 and Chk1 share many activation factors, including the Rad3-Rad26 complex (homolog
of the ATR-ATRIP complex in humans), they are activated in different situations (HARRIS et
al. 2003; LINDSAY et al. 1998; MARTINHO et al. 1998). Cds1 is activated when replication is
blocked during the S phase, while Chk1 is activated when DNA damage occurs either within
![Page 8: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/8.jpg)
8
or outside the S phase. The activation of Cds1 specifically depends on Mrc1, while that of
Chk1 depends on Crb2/Rhp9 (ALCASABAS et al. 2001; SAKA et al. 1997; TANAKA and
RUSSELL 2001). In addition to its function in Cds1 activation, Mrc1 has been shown to
prevent the extensive uncoupling of the Cdc45-containing replication machinery from DNA
synthesis when replication is hindered by dNTP depletion (KATOU et al. 2003). Mrc1
associates with the replication fork, and preferentially binds branched DNA structures in
vitro (CALZADA et al. 2005; KATOU et al. 2003; NEDELCHEVA et al. 2005; ZHAO and
RUSSELL 2004). However, its mechanism of action in preventing the uncoupling of the
replication machinery from DNA synthesis remains unclear.
In this study, we used the fission yeast mutants of Orc1 (a subunit of the ORC) and
Cdc45—orp1-4 and sna41-928, respectively—and demonstrated that these mutants are
hypersensitive to hydroxyurea (HU) in the absence of Chk1, and partially defective in Cds1
activation at their respective semipermissive temperatures with regard to the ability to
incorporate a nucleoside analog, 5-bromodeoxyuridine (BrdU). These results are consistent
with the concept that normal replication is required for full activation of the replication
![Page 9: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/9.jpg)
9
checkpoint. Interestingly, either the orp1 or sna41 mutation suppresses the HU sensitivity of
a cds1∆ mutant; however, only the sna41 mutation suppresses the HU sensitivity of an
mrc1∆ mutant. The sna41 mutation suppresses the defect in the recovery from HU arrest but
does not increase Cds1 activity in mrc1∆ cells. In addition to the sna41 mutation of Cdc45,
mutations of the MCM protein suppress the HU sensitivity of an mrc1∆ mutant in an
allele-dependent manner. These results suggest that Mrc1 negatively regulates Cdc45 and
MCM helicase to render the stalled replication forks capable of resuming replication.
![Page 10: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/10.jpg)
10
MATERIALS AND METHODS
Fission yeast strains and media: The yeast strains used in this study are listed in Table 1.
Yeast media were prepared and standard genetic procedures were carried out as described
elsewhere (ALFA et al. 1993). HU (Sigma) was dissolved in water to 1 M, sterilized by
filtration, stored at –20°, and used at the indicated final concentrations. mrc1::kanMX6 and
cds1::kanMX6 strains were generated by transforming yeast cells with the PCR product
obtained using the pFA6a-kanMX6 plasmid (BAHLER et al. 1998) as a template. The primer
pair used for mrc1::kanMX6 comprised
5’-CTAAGGAGGACTAAGAGATGTATCGCGGCAAAGCAACTACCATTACTCGTTCA
ATAAGAGCTTTGTGGTGCTTAAATCTCGGATCCCCGGGTTAATTAA and
5’-GTTATGTAAATTATCAATACCTCATTCAAAAAAAACAAGTTTGACAAGTCCAG
CTCGTCAAATCCCCTTTCTTAGCCACGAATTCGAGCTCGTTTAAAC (The sequence
complementary to the mrc1+ flanking region is underlined), and that used for cds1::kanMX6
comprised
5’-TTGATCACTCATTTGCACGTTTATTTGTGTTTACTGATATACATGGTTAAAGAAT
![Page 11: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/11.jpg)
11
TCATCCAGTTTTTCTGTTTTTAAGAATTCGAGCTCGTTTAAAC and
5’-CTATTTACAATATTATAAATTTGACGGTCTAAGTATAAAAATTAATTAATTATCAT
TTAGAATACTAAATATTAATAATCGGATCCCCGGGTTAATTAA (The sequence
complementary to the cds1+ flanking region is underlined). Yeast transformants were
selected on yeast extract (YE) plates containing 100 µg/ml of G418 disulfate (Nacalai
Tesque), and correct integration was confirmed by PCR using the primer pairs that
complemented the flanking regions of the integrated DNA (The primer sequences used are
available upon request). To obtain the adh1 promoter, a 0.8-kbp fragment was amplified
from yeast genomic DNA using the following primer pair:
5’-GCTCTAGATCGATGACATTCGAATGGCATGCCC and
5’-GGGGTACCATATGTATGTGGTTAGAAAAAAGAAAAGAC (The sequence
complementary to the adh1 promoter region is underlined). An ade6+:(adh1)p-hENT
construct was created to locate a 0.8-kbp XbaI-KpnI fragment in the adh1 promoter that is
followed by a 1.4-kbp KpnI-XbaI fragment containing the human equilibrative nucleoside
transporter (hENT) gene from pKS007 (KATOU et al. 2003), which is 70-bp downstream of
![Page 12: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/12.jpg)
12
the ade6+ gene. A ura4+:(adh1)p-TK construct was created to locate a 0.8-kbp ClaI-NdeI
fragment in the adh1 promoter that is followed by a 1.3-kbp BamHI fragment containing the
thymidine kinase (TK) gene from pYK001 (KATOU et al. 2003), which is 440-bp downstream
of the ura4+ gene.
Incorporation of 5-bromodeoxyuridine: G2 cells from log-phase cultures in YE
medium were collected by elutriation with a Beckman J6-MC centrifuge and resuspended in
fresh medium at a concentration of 5 × 106 cells/ml. Next, 5-bromodeoxyuridine (BrdU) and
HU were added to a final concentration of 100 µM and 10 mM, respectively. After 3-h
incubation, approximately 4 × 108 cells were collected and washed with washing buffer [5
mM EDTA, 50 mM NaF], and DNA was prepared as described (BAHLER et al. 1998). The
DNA was fragmented to approximately 0.5-kbp by sonication with Sonifier 250 (Branson)
three times at a tune level of 2 for 10 s. Following ethanol precipitation, the DNA was
suspended in 1.7 ml of TEN buffer [10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 150 mM NaCl]
supplemented with cesium chloride (CsCl) at a final concentration of 1 g/ml, and the DNA
solution was centrifuged at 80,000 rpm for 14 h in Hitachi CS120 with a RP120VT rotor
![Page 13: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/13.jpg)
13
(Hitachi). The DNA samples that were recovered from 14 fractions at the top of the
centrifuge tube were dialyzed against 10:1 TE [10 mM Tris-HCl (pH 7.4), 1 mM EDTA]
using the Gibco BRL microdialysis apparatus (Bethesda Research Laboratories). Following
heat denaturation (95° for 5 min), an equal volume of 20× SSC [0.3 M Na-citrate (pH 7.0), 3
M NaCl] was added to the DNA samples, and they were transferred to a Nytran nylon
membrane (Schleicher & Schuell) using SHM-48 Slot Blot Hybridization Manifold
(Scie-Plas). For Southern hybridization, a 3.2-kbp NotI-XbaI fragment that was prepared
from pXN289 (OKUNO et al. 1997) and a 1.0-kbp XbaI fragment from p2BN052-1 (OKUNO
et al. 1997) were labeled with 32P using the Megaprime DNA labeling system (Amersham)
and employed as the autonomous replication sequence (ARS) and non-ARS fragment probe,
respectively. Southern blot signals were detected using a Fuji BAS2500 phosphorimager and
were measured using the Image Gauge software (Fujifilm).
Preparation of cell extracts: Cells were washed with 1/2 culture volume of ice-cold
washing buffer [50 mM NaF, 5 mM EDTA], frozen in liquid nitrogen, and stored at –80°
before use. They were suspended in lysis buffer [50 mM HEPES (pH 7.4), 100 mM
![Page 14: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/14.jpg)
14
K-acetate, 2 mM EDTA, 1 mM DTT, 0.1% NP-40, 10% glycerol, 50 mM NaF, 60 mM
ß-glycerophosphate, 1 mM Na-orthovanadate, 1 mM PMSF, 1 mM benzamidine, 1 µg/ml
leupeptin, 1 µg/ml pepstatin A] and disrupted using Bead-Beater (Biospec Products) after the
addition of 5 µl of protease inhibitor cocktail (Sigma) and glass beads; the beads were then
removed by centrifugation. After the addition of 20% Triton X-100 to a final concentration
of 1%, the cell lysate was incubated at 4° for 30 min with rotation of the tube. The protein
extract was cleared by centrifugation at 15,000 rpm for 10 min at 4°, and the protein
concentration was determined by the Bradford assay (Protein Assay, BioRad).
Cds1 kinase assays: Cds1 kinase assays were performed essentially as described
elsewhere (BODDY et al. 1998). In a total volume of 0.5 ml, 1.5 mg of cell extracts was
mixed with glutathione-Sepharose-bound GST-Wee170 in lysis buffer supplemented with 1%
Triton X-100. After rotation for 1.5 h at 4°, the Sepharose beads were washed with 0.3 ml of
the lysis buffer supplemented with 1% Triton X-100 and then with 0.3 ml of kinase buffer [50
mM Tris-HCl (pH 7.6), 10 mM MgCl2] three times each. The mixture of beads was then
incubated with 50 µl of kinase buffer containing 100 µM ATP (Pharmacia) and 0.25 µl of
![Page 15: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/15.jpg)
15
[γ-32P]ATP (>4,000 Ci/mmol, ICN Biomedicals) at 30° for 30 min. The reaction was
terminated by the addition of 20 µl of Laemmli sample buffer (BioRad), followed by heat
denaturation. The Fuji BAS2500 phosphorimager was used to detect 32P-labeled proteins
that were then measured using the Image Gauge software (Fujifilm).
Flow cytometry analysis: The cells were fixed in 70% ethanol and stored at 4°. After
washing in 50 mM Na-citrate, they were suspended in 50 mM Na-citrate solution containing
100 µg/ml RNase and 500 ng/ml propidium iodide, incubated at 37° for 2 h, and then
subjected to sonication to resolve cell aggregation (Sonifier 250, Branson). The DNA
content of the cells was measured using the FACScan system with the CellQuest software
(Becton Dickinson).
![Page 16: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/16.jpg)
16
RESULTS
At their respective semipermissive temperatures, the orp1-4 and sna41-928 mutants
exhibit HU hypersensitivity in the absence of Chk1, a DNA damage checkpoint kinase:
Orc1 is required solely for replication initiation, while Cdc45 is required for both initiation
and elongation. To examine the relationship between replication initiation and elongation
and the response to replication elongation block, we used the orc1/orp1-4 and
cdc45/sna41-928 mutants. To demonstrate that DNA synthesis is partially defective in these
mutants at their respective semipermissive temperatures, the TK and hENT genes were
integrated into the yeast genome, allowing the incorporation of a heavy thymidine analog,
BrdU, into the synthesized DNA. TK converts exogenous thymidine to thymidine
monoposphate, which then enters the yeast pathway of thymidine triphosphate formation
(HODSON et al. 2003; MCNEIL and FRIESEN 1981). hENT is a membrane protein that
facilitates the diffusion of nucleosides down their concentration gradients (GRIFFITHS et al.
1997). Synchronous cultures in the G2 phase were obtained by centrifugal elutriation and
divided into two equal aliquots. To ensure that DNA synthesis occurred only around the
![Page 17: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/17.jpg)
17
origin, HU, which is a specific inhibitor of ribonucleotide reductase, was added to both
aliquots. BrdU was added to one aliquot to a final concentration of 100 µM. After 3-h
incubation in the presence of HU, DNA was extracted and separated on CsCl density
gradients. The fragment of interest in the gradients was determined by slot blot hybridization
using the ARS and non-ARS fragments as probes (Figure 1A). BrdU incorporation into the
ARS region was evident by its shift from the light to the heavy position (Figure 1B, upper
panel). As expected, the non-ARS region showed essentially the same profile in the presence
or absence of BrdU (Figure 1B, lower panel). At 28°, 47% and 29% of the ARS region
shifted to the heavy position in the wild-type and orp1 mutant strains, respectively (Figure
1C). At 30°, the efficiency of BrdU incorporation was reduced in the sna41 mutant
compared to that of the wild-type strain (Figure 1D). These results demonstrate that DNA
replication is partially defective in the orp1-4 and sna41-928 mutants at 28° and 30°,
respectively.
To study the effect of defective replication on the response to replication elongation block,
we examined the HU sensitivity of the orp1 and sna41 mutants by a serial dilution test with
![Page 18: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/18.jpg)
18
logarithmically growing cells (Figure 2). Since DNA damage checkpoint pathway is
activated and functions as a backup system to maintain cell viability when the replication
fork that is stalled by HU treatment is collapsed (BODDY et al. 1998; LINDSAY et al. 1998),
we carried out the HU sensitivity test in the presence or absence of Chk1. Although the orp1
mutant exhibited similar sensitivity as the wild-type strain, the orp1 chk1∆ mutant exhibited
higher sensitivity than the chk1∆ mutant at 25° and 28° (Figure 2A). The sna41 mutant also
exhibited HU hypersensitivity at 30° in the absence of Chk1 (Figure 2B). The enhancement
of HU sensitivity by the elimination of Chk1 was observed in the cds1∆ mutant (Figure 2B),
suggesting that the orp1 and sna41 mutants have defects in the Cds1 pathway. The
temperature sensitivity of the orp1 and sna41 mutants was also enhanced by a chk1 deletion,
and this underlines the importance of Chk1 in replication-deficient cells (Figure 2, data not
shown).
Activation of Cds1, a replication checkpoint kinase, is partially defective in the
orp1-4 and sna41-928 mutants: To determine whether the orp1 and sna41 mutations, at
their respective semipermissive temperatures, affect the activation of the Cds1 pathway, we
![Page 19: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/19.jpg)
19
examined the Cds1 kinase activity that is induced by HU treatment. Cell extracts of the
wild-type, orp1, and cds1∆ mutant strains were prepared before and after HU treatment at
28°, and an in vitro kinase assay was performed in the presence of [γ-32P]ATP and
bacteria-expressed GST-Wee170 as the substrate (Figure 3A & B). In the wild-type strain,
approximately 10-fold Wee1 phosphorylation induction was observed after HU treatment.
In the cds1∆ mutant, almost no Wee1 phosphorylation was observed (Figure 3A), indicating
that in this assay, Wee1 phosphorylation depends on Cds1. Wee1 phosphorylation in the
presence of HU was lower in the orp1 mutant than in the wild-type strain. Quantification of
the phosphorimager signal revealed that the Cds1 kinase activity was slightly but
significantly decreased in the orp1 mutant (Figure 3B). Further, Wee1 phosphorylation at
30° was also lower in the sna41 mutant than in the wild-type strain (Figure 3C & D). These
results are consistent with the notion that normal replication is required for full activation of
the replication checkpoint kinase (see DISCUSSION).
The HU sensitivity of the mrc1 mutant is suppressed by the sna41-928 mutation but
not by the orp1-4 mutation: To explore the genetic relationship between the orp1-4 and
![Page 20: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/20.jpg)
20
sna41-928 mutations and the replication checkpoint mutations, a series of double mutants
were constructed and examined for their sensitivity to HU (Figure 4). We observed that both
the orp1 and the sna41 mutations suppressed the HU sensitivity of cds1∆ cells (Figure 4A &
B). It is possible that a reduction in the number of replication forks can partially alleviate the
problem that occurs in the absence of Cds1 (see Discussion).
In addition to its role in Cds1 activation, Mrc1 is required to prevent the uncoupling of the
replication machinery from DNA synthesis. Contrary to the case of cds1∆ cells, mrc1∆ cells
did not exhibit suppressed HU sensitivity due to the orp1 mutation (Figure 4A). However,
the sna41 mutation specifically suppressed the HU sensitivity of mrc1∆ cells (Figure 4B).
To confirm that the sna41 mutation is a bona fide cause of the HU sensitivity suppression in
mrc1∆ cells, we introduced an empty vector (p.vector) and a plasmid containing the sna41+
or the mrc1+ gene (p.sna41 and p.mrc1, respectively) into yeast cells, and examined the HU
sensitivity. Figure 4C shows that sna41 mrc1∆ cells harboring p.sna41 exhibit higher
sensitivity than those harboring p.vector or p.mrc1. Importantly, p.sna41 did not affect the
HU sensitivity of mrc1∆ cells as well as the wild-type and sna41 cells (Figure 4C, data not
![Page 21: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/21.jpg)
21
shown). These results imply that a mutation of Cdc45 specifically suppresses the HU
sensitivity of the mrc1∆ mutant.
A time course analysis using an acute dose of HU revealed the efficient suppression of the
HU sensitivity of mrc1∆ cells by the sna41 mutation at 30°. Figure 5A shows that mrc1∆
cells are less sensitive than cds1∆ cells and that within the time course, the sensitivity of
mrc1∆ cells is almost entirely suppressed by the sna41 mutation. At the 6-h time point, the
relative viability of mrc1∆ cells was 2.6 ± 0.9%, while that of sna41 mrc1∆ cells was 118 ±
33%. Given the observation that the HU sensitivity of mrc1∆ cells was efficiently
suppressed by the sna41 mutation, it is possible that the sna41 mutation increases Cds1
activity in mrc1∆ cells. To test this, we performed an in vitro kinase assay to measure the
Cds1 activity in the mrc1∆, sna41 mrc1∆, and wild-type strains grown at 30° (Figure 5B &
C). We observed that the Cds1 kinase activity was equally low in mrc1∆ and sna41 mrc1∆
cells. Thus, it appears that the sna41 mutation suppresses the HU sensitivity but not the
defective Cds1 activation of mrc1∆ cells. It is also noted that there is a residual activation of
Cds1 kinase even in the absence of Mrc1, consistent with the different HU sensitivity in
![Page 22: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/22.jpg)
22
mrc1∆ and cds1∆ cells (Figure 5A). These results suggest that there are Mrc1-dependent and
Mrc1-independent pathways for Cds1 activation.
The sna41-928 mutation alleviates the defect in recovery from replication block in the
mrc1 mutant: Mrc1 as well as Cds1 is required for recovery from the replication block that
is induced by HU treatment. To examine the recovery, logarithmically growing cells of the
wild-type, mrc1∆, sna41, and sna41 mrc1∆ strains were treated with an acute dose of HU for
3 h to block replication, washed with distilled water, and released into HU-free medium to
allow them to resume cell cycle progression; the DNA content of the cells was then
monitored by FACS analysis (Figure 6A). The wild-type and sna41 cells showed essentially
the same phenotype; the DNA content reached 2C from 1C by 60 min after release. In
contrast, the DNA content of mrc1∆ cells increased very slowly, indicating that Mrc1 is
required for recovery from replication block. However, the FACS profile of sna41 mrc1∆
cells was similar to those of the wild-type and sna41 cells than that of mrc1∆ cells (Figure 6A,
see 40 and 60 min). Recovery from the replication block was also examined by staining the
cells with DAPI and counting the number of binucleate cells (Figure 6B). With the wild-type
![Page 23: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/23.jpg)
23
and sna41 strains, binucleate cells started accumulating at 80 min after release and reached a
peak at 100 min. With the mrc1∆ strain, no accumulation of binucleate cells was apparent.
However, with the sna41 mrc1∆ strain, binucleate cells were accumulated although later than
the wild-type and sna41 strains. In summary, these results show that the sna41 mutation
alleviates the defect in recovery from replication block in the mrc1∆ mutant.
Mutations in the MCM helicase can also suppress the HU sensitivity of the mrc1
mutant: Given that the MCM helicase as well as Cdc45 is essential for both initiation and
elongation phases of replication and that there are genetic and physical interactions between
them (MASUDA et al. 2003; MIYAKE and YAMASHITA 1998; YAMADA et al. 2004; ZOU and
STILLMAN 1998), mutations in MCM might also suppress the HU sensitivity of the mrc1∆
mutant. To test this possibility, we constructed a series of double mutants and examined their
sensitivity to HU (Figure 7). We first examined mutant alleles of the Mcm2 subunit of the
Mcm2-7 complex. A temperature-sensitive mutation of Mcm2, cdc19-P1 (FORSBURG and
NURSE 1994), suppressed the HU sensitivity of both mrc1∆ and cds1∆ cells at 25° (Figure
7A). However, a cold-sensitive mutation of Mcm2, nda1-367 (MIYAKE et al. 1993),
![Page 24: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/24.jpg)
24
suppressed the HU sensitivity of cds1∆ but not mrc1∆ cells at 33°(Figure 7B). These results
demonstrate that the HU sensitivity of mrc1∆ cells is suppressed by a mutation of Mcm2 in
an allele-dependent manner.
Another subunit of the MCM complex, Mcm5, was examined. It was observed that a
cold-sensitive mutation of Mcm5, nda4-108 (MIYAKE et al. 1993), suppressed the HU
sensitivity of mrc1∆ as well as cds1∆ cells at 35° (Figure 7C). It was confirmed that the nda4
mutation is a bona fide cause of the suppression in mrc1∆ cells, by comparison of the HU
sensitivity of nda4 mrc1∆ transformants harboring an empty vector or the plasmid containing
the nda4+ gene (p.vector and p.nda4, respectively) (Figure 7D). As was seen in the case of
sna41-928 (Figure 5A), the nda4 mutation efficiently suppressed the HU sensitivity of
mrc1∆ cells in a time course analysis using an acute dose of HU (Figure 7E). Thus, it appears
that the HU sensitivity of mrc1∆ cells can be suppressed not only by a mutation of Cdc45 but
also by specific mutations of the MCM helicase.
![Page 25: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/25.jpg)
25
DISCUSSION
Throughout the cell cycle, the ORC binds replication origins and is required exclusively
for replication initiation. In contrast, the Cdc45 protein is essential to both the initiation and
elongation phases of replication. To examine the relationship between initiation and
elongation defects and the response to replication elongation block, we used the
temperature-sensitive fission yeast mutants of Orc1 and Cdc45, i.e., orp1-4 and sna41-928,
respectively. We observed that at their respective semipermissive temperatures, the extent of
BrdU incorporation was lower in orp1 and sna41 cells than in the wild-type cells. At the
same temperatures, orp1 or sna41 cells exhibited HU hypersensitivity in the absence of Chk1
kinase and were partially defective in the HU-induced activation of Cds1 kinase. While the
HU sensitivity of the cds1∆ mutant was partially suppressed either by the orp1 or sna41
mutation, the sensitivity of the mrc1∆ mutant was specifically suppressed by the sna41
mutation.
Roles of Orc1 and Cdc45 in the activation of the replication checkpoint: To monitor
the replication efficiency of orp1-4 and sna41-928 cells at their respective semipermissive
![Page 26: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/26.jpg)
26
temperatures, we examined the incorporation of the thymine analog BrdU into genomic
DNA, and observed that it was lower in the orp1 and sna41 cells than in the wild-type cells.
It is likely that the initiation of replication is defective in the orp1 mutant, while both
initiation and elongation are defective in the sna41 mutant. At the same temperatures, the
orp1 and sna41 cells exhibited HU hypersensitivity in the absence of Chk1. A synergetic
enhancement of HU sensitivity is observed between the cds1 and chk1 mutants (BODDY et al.
1998; this study). Cds1 and Chk1 checkpoint kinases are involved in the replication and
DNA damage checkpoint pathways, respectively. In the absence of Cds1, at least a fraction
of the stalled forks is converted into aberrant DNA structures (e.g., double-strand breaks) that
in turn induce the Chk1 pathway. Thus, the enhancement of HU sensitivity by a chk1
deletion that is observed in the orp1 and sna41 mutants suggests that these mutants have a
defect in the Cds1 pathway. In fact, the HU-induced activation of Cds1 kinase is partially
impaired in the orp1 and sna41 mutants. Since the orp1 and sna41 mutants show HU
hypersensitivity only in the absence of Chk1, the reduced activity of Cds1 kinase might be
slightly insufficient for all the replication forks, and/or it could not arrest cell-cycle
![Page 27: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/27.jpg)
27
progression sufficiently without the aid of Chk1 kinase. These results are consistent with the
notion that normal replication is required for full activation of the replication checkpoint
mechanism. It is possible that the number of replication forks is reduced in the replication
mutant, and this accounts for the defect in checkpoint activation, as was proposed in budding
yeasts (LEE et al. 2003; SHIMADA et al. 2002; TERCERO et al. 2003). Recently, using
Xenopus egg extracts, it has been shown that even after DNA synthesis is inhibited, the
MCM helicase together with Cdc45 continues a certain extent of DNA unwinding to generate
single-stranded DNA, which is important for checkpoint activation (BYUN et al. 2005; ZOU
and ELLEDGE 2003). Thus, it is also possible that at its semipermissive temperature, the
replication elongation mutant is partially defective in the formation of a single-stranded
region that is sufficiently long for checkpoint activation. These two possibilities are not
mutually exclusive, and we consider that both hold true for the sna41 mutant, as discussed
below.
A mutation of either Orc1 or Cdc45 suppresses the HU sensitivity of the cds1 mutant:
The serial dilution test revealed that the sna41-928 mutation partially suppresses the HU
![Page 28: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/28.jpg)
28
sensitivity of the cds1∆ mutant. Since the orp1-4 mutation also suppresses the HU
sensitivity of cds1∆, it appears that a decrease in the number of replication forks can alleviate
the defect in cds1∆. It is possible that the protein factor that is required for the stability of
stalled forks is limited in a cell, and its activation by Cds1 is essential for a number of stalled
forks in wild-type cells. Alternatively, Cds1 might be required for the coordinated
processing of neighboring forks, since a decrease in the number of replication forks can lead
to an increase in the distance between the forks. Further studies are required to address these
possibilities.
A mutation of Cdc45 but not Orc1 suppresses the HU sensitivity of the mrc1 mutant:
The HU sensitivity of the mrc1∆ mutant was suppressed by the sna41-928 mutation but not
by the orp1-4 mutation. This specific suppression by the sna41 mutation suggests that a
defect in the elongation phase of replication accounts for the suppression of HU sensitivity in
mrc1∆ cells. A time course experiment using an acute dose of HU revealed that mrc1∆ cells
are less sensitive than cds1∆ cells and that the sensitivity of mrc1∆ cells is almost entirely
suppressed by sna41. When replication is blocked by HU, Mrc1 is required to activate Cds1
![Page 29: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/29.jpg)
29
and prevent the uncoupling of the replication machinery from DNA synthesis (KATOU et al.
2003; TANAKA and RUSSELL 2001). The Cds1 activation defect in mrc1∆ cells does not
appear to be suppressed by sna41 since the in vitro activity of Cds1 kinase was similarly low
in the mrc1∆ and sna41 mrc1∆ cells. However, the resumption of DNA synthesis and cell
cycle progression in mrc1∆ cells after release from HU arrest was facilitated by the sna41
mutation. Thus, it is likely that the role of Mrc1 in the prevention of uncoupling is related to
Cdc45.
Mutations in the MCM helicase suppress the HU sensitivity of the mrc1 mutant in an
allele-specific manner: We found that the HU sensitivity of mrc1∆ cells can be suppressed
not only by a mutation of Cdc45 but also by mutations of the MCM helicase. Mutations of
the Mcm2 subunit of MCM suppress the HU sensitivity of mrc1∆ cells in an allele-dependent
manner; the cdc19-P1 but not the nda1-376 mutation of Mcm2 suppresses the HU sensitivity
of mrc1∆ cells. However, at the same temperatures, the HU sensitivity of cds1∆ cells is
suppressed either by the cdc19 or the nda1 mutation, indicating that both mutations cause
some defect under the experimental conditions. It has been shown that the nda1 mutation
![Page 30: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/30.jpg)
30
causes an accumulation of cells with a 1C DNA content at a restrictive temperature
(FORSBURG and NURSE 1994). Chromatin binding of MCM is impaired in nda1 as well as
orc1/orp1-4 cells at their restrictive temperatures (YAMADA et al. 2004), indicating that
replication initiation is defective in nda1 cells. The initiation defect in nda1 cells may
account for the HU sensitivity suppression of cds1∆ cells, as was discussed for the
orc1/orp1-4 case (see above). Inability of the nda1 mutation to suppress the HU sensitivity
of mrc1∆ cells suggests that some specific defect in the elongation may be required for the
suppression. Contrary to the nda1 mutation, the cdc19 mutation does not accumulate cells
with a 1C DNA content at a restrictive temperature (FORSBURG and NURSE 1994), suggesting
that cdc19 causes a defect in an elongation phase of replication. The cdc19 mutation
decreases expression levels of Mcm2 and impairs interaction between MCM subunits even at
a nonrestrictive temperature of 25° (SHERMAN et al. 1998), the temperature at which the HU
sensitivity of mrc1∆ cells is suppressed by cdc19 (this study). Thus, the unstable replication
machinery formed in cdc19 cells, that may cause defects in both initiation and elongation
phases of replication, could account for the suppression of both cds1∆ and mrc1∆ cells.
![Page 31: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/31.jpg)
31
In addition to a mutation of Mcm2, we found that a mutation of Mcm5, nda4-108, also
suppresses the HU sensitivity of mrc1∆ and cds1∆ cells. Amino acid residues conserved
among the orthologs from different organisms are altered by sna41-928 (A410T), nda4-108
(R50C), cdc19-P1 (P257L and T272I) mutations (FORSBURG et al. 1997; YAMADA et al.
2004), suggesting that conserved functions of Cdc45 and MCM are affected by these
mutations. Interestingly, there is an intimate relationship between the nda4-108 and the
sna41-928 mutations. sna41-928 is originally identified as one of the Cdc45 mutations that
can suppress the cold-sensitive growth defect of nda4-108 cells (MIYAKE and YAMASHITA
1998; YAMADA et al. 2004). In both nda4 and sna41 cells at their restrictive temperatures,
association of Cdc45 to replication origins is severely impaired although MCM as well as
another replication factor, Sld3, is loaded and accumulated on the origin (YAMADA et al.
2004). In addition, in nda4 cells at a restrictive temperature, physical interaction between
MCM and Cdc45 proteins detected in wild-type cells is disrupted while the MCM complex
appears to be intact, and the cold-sensitivity of nda4 is partially alleviated by overexpression
of the wild-type sna41+ gene. Given these observations, it seems plausible that, even at the
![Page 32: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/32.jpg)
32
semipermissive temperature, the association between Mcm5 and Cdc45 may be partially
impaired in nda4 and sna41 cells. Collectively, the MCM complex integrity and/or its
association to Cdc45 appear to be impaired in the mutants that can suppress the HU
sensitivity of mrc1∆ cells. Our findings provide genetic evidence for that Mrc1 negatively
regulates the replication machinery containing Cdc45 and the MCM helicase for the recovery
from replication block.
![Page 33: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/33.jpg)
33
ACKNOWLEDGEMENTS
We are grateful to Drs. Mitsuhiro Yanagida, Paul Russell, Katsunori Tanaka, Paul Nurse,
Teresa Wang, Ayumu Yamamoto, Kunihiro Ohta, and Katsuhiko Shirahige for providing
strains, plasmids, and antibodies. We also thank Sanae Miyake and Shigeru Yamashita for
sharing their unpublished results, and the members of our laboratory for helpful discussions.
This work was supported by a Grant-in-Aid for Cancer Research from the Ministry of
Education, Science, Technology, Sports and Culture of Japan and by funding from the
Sumitomo Foundation and the Naito Foundation awarded to T.N.
![Page 34: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/34.jpg)
34
LITERATURE CITED
ALCASABAS, A. A., A. J. OSBORN, J. BACHANT, F. HU, P. J. WERLER et al., 2001 Mrc1
transduces signals of DNA replication stress to activate Rad53. Nat. Cell Biol. 3:
958-965.
ALFA, C., P. FANTES, J. HYAMS, M. MCLEOD and E. WARBRICK, 1993 Experiments with
Fission Yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
APARICIO, O. M., D. M. WEINSTEIN and S. P. BELL, 1997 Components and dynamics of
DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and
Cdc45p during S phase. Cell 91: 59-69.
BAHLER, J., J. Q. WU, M. S. LONGTINE, N. G. SHAH, A. MCKENZIE, 3RD et al., 1998
Heterologous modules for efficient and versatile PCR-based gene targeting in
Schizosaccharomyces pombe. Yeast 14: 943-951.
BELL, S. P., and A. DUTTA, 2002 DNA replication in eukaryotic cells. Annu. Rev. Biochem.
71: 333-374.
![Page 35: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/35.jpg)
35
BODDY, M. N., B. FURNARI, O. MONDESERT and P. RUSSELL, 1998 Replication checkpoint
enforced by kinases Cds1 and Chk1. Science 280: 909-912.
BODDY, M. N., A. LOPEZ-GIRONA, P. SHANAHAN, H. INTERTHAL, W. D. HEYER et al., 2000
Damage tolerance protein Mus81 associates with the FHA1 domain of checkpoint
kinase Cds1. Mol. Cell Biol. 20: 8758-8766.
BODDY, M. N., P. SHANAHAN, W. H. MCDONALD, A. LOPEZ-GIRONA, E. NOGUCHI et al.,
2003 Replication checkpoint kinase Cds1 regulates recombinational repair protein
Rad60. Mol. Cell Biol. 23: 5939-5946.
BRANZEI, D., and M. FOIANI, 2005 The DNA damage response during DNA replication. Curr.
Opin. Cell Biol. 17: 568-575.
BYUN, T. S., M. PACEK, M. C. YEE, J. C. WALTER and K. A. CIMPRICH, 2005 Functional
uncoupling of MCM helicase and DNA polymerase activities activates the
ATR-dependent checkpoint. Genes Dev. 19: 1040-1052.
![Page 36: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/36.jpg)
36
CALZADA, A., B. HODGSON, M. KANEMAKI, A. BUENO and K. LABIB, 2005 Molecular
anatomy and regulation of a stable replisome at a paused eukaryotic DNA replication
fork. Genes Dev. 19: 1905-1919.
CAPASSO, H., C. PALERMO, S. WAN, H. RAO, U. P. JOHN et al., 2002 Phosphorylation
activates Chk1 and is required for checkpoint-mediated cell cycle arrest. J. Cell Sci.
115: 4555-4564.
CARR, A. M., 2002 DNA structure dependent checkpoints as regulators of DNA repair. DNA
Repair 1: 983-994.
CASPARI, T., J. M. MURRAY and A. M. CARR, 2002 Cdc2-cyclin B kinase activity links Crb2
and Rqh1-topoisomerase III. Genes Dev. 16: 1195-1208.
CHONG, J. P., M. K. HAYASHI, M. N. SIMON, R. M. XU and B. STILLMAN, 2000 A
double-hexamer archaeal minichromosome maintenance protein is an
ATP-dependent DNA helicase. Proc. Natl. Acad. Sci. USA 97: 1530-1535.
FORSBURG, S. L., and P. NURSE, 1994 The fission yeast cdc19+ gene encodes a member of
the MCM family of replication proteins. J. Cell Sci. 107: 2779-2788.
![Page 37: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/37.jpg)
37
FORSBURG, S. L., D. A. SHERMAN, S. OTTILIE, J. R. YASUDA and J. A. HODSON, 1997
Mutational analysis of Cdc19p, a Schizosaccharomyces pombe MCM protein.
Genetics 147: 1025-1041.
FURNARI, B., A. BLASINA, M. N. BODDY, C. H. MCGOWAN and P. RUSSELL, 1999 Cdc25
inhibited in vivo and in vitro by checkpoint kinases Cds1 and Chk1. Mol. Biol. Cell
10: 833-845.
GRIFFITHS, M., N. BEAUMONT, S. Y. YAO, M. SUNDARAM, C. E. BOUMAH et al., 1997
Cloning of a human nucleoside transporter implicated in the cellular uptake of
adenosine and chemotherapeutic drugs. Nat. Med. 3: 89-93.
HARRIS, S., C. KEMPLEN, T. CASPARI, C. CHAN, H. D. LINDSAY et al., 2003 Delineating the
position of rad4+/cut5+ within the DNA-structure checkpoint pathways in
Schizosaccharomyces pombe. J. Cell Sci. 116: 3519-3529.
HARTWELL, L. H., and T. A. WEINERT, 1989 Checkpoints: controls that ensure the order of
cell cycle events. Science 246: 629-634.
![Page 38: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/38.jpg)
38
HODSON, J. A., J. M. BAILIS and S. L. FORSBURG, 2003 Efficient labeling of fission yeast
Schizosaccharomyces pombe with thymidine and BUdR. Nucleic Acids Res. 31:
e134.
HUANG, M., Z. ZHOU and S. J. ELLEDGE, 1998 The DNA replication and damage checkpoint
pathways induce transcription by inhibition of the Crt1 repressor. Cell 94: 595-605.
ISHIMI, Y., 1997 A DNA helicase activity is associated with an MCM4, -6, and -7 protein
complex. J. Biol. Chem. 272: 24508-24513.
IVESSA, A. S., B. A. LENZMEIER, J. B. BESSLER, L. K. GOUDSOUZIAN, S. L. SCHNAKENBERG
et al., 2003 The Saccharomyces cerevisiae helicase Rrm3p facilitates replication past
nonhistone protein-DNA complexes. Mol. Cell 12: 1525-1536.
KAI, M., M. N. BODDY, P. RUSSELL and T. S. WANG, 2005 Replication checkpoint kinase
Cds1 regulates Mus81 to preserve genome integrity during replication stress. Genes
Dev. 19: 919-932.
![Page 39: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/39.jpg)
39
KATOU, Y., Y. KANOH, M. BANDO, H. NOGUCHI, H. TANAKA et al., 2003 S-phase checkpoint
proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature 424:
1078-1083.
KELMAN, Z., J. K. LEE and J. HURWITZ, 1999 The single minichromosome maintenance
protein of Methanobacterium thermoautotrophicum ∆H contains DNA helicase
activity. Proc. Natl. Acad. Sci. USA 96: 14783-14788.
LABIB, K., J. A. TERCERO and J. F. DIFFLEY, 2000 Uninterrupted MCM2-7 function required
for DNA replication fork progression. Science 288: 1643-1647.
LEE, J., A. KUMAGAI and W. G. DUNPHY, 2003 Claspin, a Chk1-regulatory protein, monitors
DNA replication on chromatin independently of RPA, ATR, and Rad17. Mol. Cell
11: 329-340.
LEI, M., and B. K. TYE, 2001 Initiating DNA synthesis: from recruiting to activating the
MCM complex. J. Cell Sci. 114: 1447-1454.
![Page 40: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/40.jpg)
40
LINDSAY, H. D., D. J. GRIFFITHS, R. J. EDWARDS, P. U. CHRISTENSEN, J. M. MURRAY et al.,
1998 S-phase-specific activation of Cds1 kinase defines a subpathway of the
checkpoint response in Schizosaccharomyces pombe. Genes Dev. 12: 382-395.
LOPEZ-GIRONA, A., K. TANAKA, X. B. CHEN, B. A. BABER, C. H. MCGOWAN et al., 2001
Serine-345 is required for Rad3-dependent phosphorylation and function of
checkpoint kinase Chk1 in fission yeast. Proc. Natl. Acad. Sci. USA 98:
11289-11294.
MARTINHO, R. G., H. D. LINDSAY, G. FLAGGS, A. J. DEMAGGIO, M. F. HOEKSTRA et al.,
1998 Analysis of Rad3 and Chk1 protein kinases defines different checkpoint
responses. EMBO J. 17: 7239-7249.
MASUDA, T., S. MIMURA and H. TAKISAWA, 2003 CDK- and Cdc45-dependent priming of
the MCM complex on chromatin during S-phase in Xenopus egg extracts: possible
activation of MCM helicase by association with Cdc45. Genes Cells 8: 145-161.
MCNEIL, J. B., and J. D. FRIESEN, 1981 Expression of the Herpes simplex virus thymidine
kinase gene in Saccharomyces cerevisiae. Mol. Gen. Genet. 184: 386-393.
![Page 41: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/41.jpg)
41
MIYAKE, S., N. OKISHIO, I. SAMEJIMA, Y. HIRAOKA, T. TODA et al., 1993 Fission yeast genes
nda1+ and nda4+, mutations of which lead to S-phase block, chromatin alteration and
Ca2+ suppression, are members of the CDC46/MCM2 family. Mol. Biol. Cell 4:
1003-1015.
MIYAKE, S., and S. YAMASHITA, 1998 Identification of sna41 gene, which is the suppressor
of nda4 mutation and is involved in DNA replication in Schizosaccharomyces pombe.
Genes Cells 3: 157-166.
MURAKAMI, H., and H. OKAYAMA, 1995 A kinase from fission yeast responsible for
blocking mitosis in S phase. Nature 374: 817-819.
NEDELCHEVA, M. N., A. ROGUEV, L. B. DOLAPCHIEV, A. SHEVCHENKO, H. B. TASKOV et al.,
2005 Uncoupling of unwinding from DNA synthesis implies regulation of MCM
helicase by Tof1/Mrc1/Csm3 checkpoint complex. J. Mol. Biol. 347: 509-521.
NYBERG, K. A., R. J. MICHELSON, C. W. PUTNAM and T. A. WEINERT, 2002 TOWARD
MAINTAINING THE GENOME: DNA Damage and Replication Checkpoints.
Annu. Rev. Genet. 36: 617-656.
![Page 42: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/42.jpg)
42
OKUNO, Y., T. OKAZAKI and H. MASUKATA, 1997 Identification of a predominant
replication origin in fission yeast. Nucleic Acids Res. 25: 530-537.
RALEIGH, J. M., and M. J. O'CONNELL, 2000 The G(2) DNA damage checkpoint targets both
Wee1 and Cdc25. J. Cell Sci. 113: 1727-1736.
RHIND, N., B. FURNARI and P. RUSSELL, 1997 Cdc2 tyrosine phosphorylation is required for
the DNA damage checkpoint in fission yeast. Genes Dev. 11: 504-511.
SAKA, Y., F. ESASHI, T. MATSUSAKA, S. MOCHIDA and M. YANAGIDA, 1997 Damage and
replication checkpoint control in fission yeast is ensured by interactions of Crb2, a
protein with BRCT motif, with Cut5 and Chk1. Genes Dev. 11: 3387-3400.
SHERMAN, D. A., S. G. PASION and S. L. FORSBURG, 1998 Multiple domains of fission yeast
Cdc19p (MCM2) are required for its association with the core MCM complex. Mol.
Biol. Cell 9: 1833-1845.
SHIMADA, K., P. PASERO and S. M. GASSER, 2002 ORC and the intra-S-phase checkpoint: a
threshold regulates Rad53p activation in S phase. Genes Dev. 16: 3236-3252.
![Page 43: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/43.jpg)
43
SOGO, J. M., M. LOPES and M. FOIANI, 2002 Fork reversal and ssDNA accumulation at
stalled replication forks owing to checkpoint defects. Science 297: 599-602.
TANAKA, K., and P. RUSSELL, 2001 Mrc1 channels the DNA replication arrest signal to
checkpoint kinase Cds1. Nat. Cell Biol. 3: 966-972.
TERCERO, J. A., K. LABIB and J. F. DIFFLEY, 2000 DNA synthesis at individual replication
forks requires the essential initiation factor Cdc45p. EMBO J. 19: 2082-2093.
TERCERO, J. A., M. P. LONGHESE and J. F. DIFFLEY, 2003 A central role for DNA replication
forks in checkpoint activation and response. Mol. Cell 11: 1323-1336.
TYE, B. K., 1999 MCM proteins in DNA replication. Annu. Rev. Biochem. 68: 649-686.
WALTER, J., and J. NEWPORT, 2000 Initiation of eukaryotic DNA replication: origin
unwinding and sequential chromatin association of Cdc45, RPA, and DNA
polymerase α. Mol. Cell 5: 617-627.
WALWORTH, N. C., and R. BERNARDS, 1996 rad-dependent response of the chk1-encoded
protein kinase at the DNA damage checkpoint. Science 271: 353-356.
![Page 44: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/44.jpg)
44
YAMADA, Y., T. NAKAGAWA and H. MASUKATA, 2004 A novel intermediate in initiation
complex assembly for fission yeast DNA replication. Mol. Biol. Cell 15: 3740-3750.
YOU, Z., Y. KOMAMURA and Y. ISHIMI, 1999 Biochemical analysis of the intrinsic
Mcm4-Mcm6-Mcm7 DNA helicase activity. Mol. Cell Biol. 19: 8003-8015.
ZHAO, H., and P. RUSSELL, 2004 DNA binding domain in the replication checkpoint protein
Mrc1 of Schizosaccharomyces pombe. J. Biol. Chem. 279: 53023-53027.
ZHOU, B. B., and J. BARTEK, 2004 Targeting the checkpoint kinases: chemosensitization
versus chemoprotection. Nat. Rev. Cancer 4: 216-225.
ZOU, L., and S. J. ELLEDGE, 2003 Sensing DNA damage through ATRIP recognition of
RPA-ssDNA complexes. Science 300: 1542-1548.
ZOU, L., and B. STILLMAN, 1998 Formation of a preinitiation complex by S-phase cyclin
CDK-dependent loading of Cdc45p onto chromatin. Science 280: 593-596.
![Page 45: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/45.jpg)
45
TABLES
Table 1. Fission yeast strains used in this study.
Strain Genotype
TNF34 h-
TNF938 h-, orp1-4
HM328 h-, sna41-928
TNF344 h-, nda4-108
HM259 h-, nda1-376
TNF909 h-, cdc19-P1
HM350 h-, chk1::ura4+
TNF256 h-, cds1::kanMX6
TNF264 h-, mrc1::kanMX6
TNF1215 h-, orp1-4, chk1::ura4+
TNF947 h-, orp1-4, mrc1::kanMX6
TNF941 h-, orp1-4, cds1::kanMX6
TNF326 h-, sna41-928, chk1::ura4+
TNF293 h-, sna41-928, mrc1::kanMX6
TNF283 h-, sna41-928, cds1::kanMX6
TNF355 h-, nda4-108, mrc1::kanMX6
NNF103 h-, nda4-108, cds1::kanMX6
TNF912 h-, nda1-376, mrc1::kanMX6
TNF916 h-, nda1-376, cds1::kanMX6
TNF929 h-, cdc19-P1, mrc1::kanMX6
TNF899 h-, cdc19-P1, cds1::kanMX6
TNF351 h-, cds1::kanMX6, chk1::ura4+
TNF370 h-, mrc1::kanMX6, leu1-32
TNF1848 h-, sna41-928, mrc1::kanMX6, leu1-32
TNF374 h-, nda4-108, mrc1::kanMX6, leu1-32
TNF1055 h-, ade6+:(adh1)p-hENT, ura4+:(adh1)p-TK
TNF1079 h-, ade6+:(adh1)p-hENT, ura4+:(adh1)p-TK, orp1-4
TNF1065 h-, ade6+:(adh1)p-hENT, ura4+:(adh1)p-TK, sna41-928
![Page 46: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/46.jpg)
46
FIGURE LEGENDS
FIGURE 1.–––BrdU incorporation in the orp1-4 and sna41-928 mutants. BrdU
incorporation followed by density gradient fractionation was carried out to measure the
replication efficiency. (A) Positions of the ars2004 and ars2005 replication origins on
chromosome II are indicated as open boxes. Positions of the ARS and non-ARS regions used
as hybridization probes are indicated as filled boxes. (B) Slot blot analysis to detect the ARS
(top panel) and non-ARS (bottom panel) region in the wild-type strain (TNF1055) at 28°.
The fraction number of the CsCl density gradient is indicated at the bottom of the lower panel.
(C) BrdU incorporation in the ARS region in wild-type and orp1 (TNF1079) cells at 28°. (D)
BrdU incorporation in the ARS region in wild-type and sna41 (TNF1065) cells at 30°. The
percentage of the total DNA in each fraction in the absence (–BrdU, open circles) or presence
(+BrdU, closed circles) of BrdU is indicated. The proportion of the dark gray area to the total
gray area (dark and light gray) is indicated. Essentially, no BrdU incorporation was observed
in the non-ARS region ((B), data not shown).
![Page 47: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/47.jpg)
47
FIGURE 2.–––HU sensitivity of the orp1-4 and sna41-928 mutants. (A) Serial dilution
assay to examine the HU sensitivity of the wild-type (TNF34), chk1∆ (HM350), orp1
(TNF938), and orp1 chk1∆ (TNF1215) strains at 25° and 28°. (B) Serial dilution assay to
examine the HU sensitivity of the wild-type, chk1∆, sna41 (HM328), sna41 chk1∆ (TNF326),
cds1∆ (TNF256), and cds1∆ chk1∆ (TNF351) strains at 30°. Log-phase cultures in EMM
medium were serially diluted 10 fold with distilled water and plated onto YE medium
supplemented with 2 mM HU. The plates were incubated at the temperature indicated above
each panel.
FIGURE 3.–––Cds1 kinase activity in the orp1-4 and sna41-928 mutants. (A)
Exponentially growing wild-type (TNF34), orp1 (TNF938), and cds1∆ (TNF256) cells in
EMM medium were treated with 10 mM HU for 0, 3, or 4 h at 28°. GST-Wee170 was
expressed in E. coli and affinity purified using glutathione Sepharose 4B. Then, 1.5 mg of
the total extract prepared from yeast cells and GST-Wee170 beads were mixed and subjected
to kinase reactions with [γ-32P]ATP to probe the phosphorylated proteins (see Materials &
Methods). Reaction products were separated on 12% SDS-PAGE (29:1), the phosphorylated
![Page 48: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/48.jpg)
48
proteins were detected using a phosphorimager (upper panel, 32P), and the GST-Wee170 was
visualized by Coomassie Brilliant Blue staining (lower panel, Coomassie). (B) Relative
amount of phosphorylated Wee1 in the wild-type, orp1, and cds1∆ cells at 28°. (C) Cds1
kinase activity was measured using wild-type, sna41 (HM328), and cds1∆ cells as in (A),
except the temperature used was 30°. (D) Relative amount of phosphorylated Wee1 in the
wild-type, sna41, and cds1∆ cells at 30°. The value is the mean of two independent
experiments, and the error bar shows the standard deviation.
FIGURE 4.–––Suppression of the HU sensitivity of the replication checkpoint mutants by
the orp1-4 or sna41-928 mutation. Effect of the orp1-4 (A) and sna41-928 (B) mutations on
the HU sensitivity of the mrc1∆ and cds1∆ mutants was examined. HU sensitivity of the
isogenic wild-type (TNF34), orp1 (TNF938), sna41 (HM328), mrc1∆ (TNF264), cds1∆
(TNF256), orp1 mrc1∆ (TNF947), orp1 cds1∆ (TNF941), sna41 mrc1∆ (TNF293), and
sna41 cds1∆ (TNF283) strains was examined by a 10-fold serial dilution assay. (C) The
mrc1∆ leu1 (TNF370) and sna41 mrc1∆ leu1 (TNF1848) transformants harboring the vector
plasmid (p.vector; p940XB), which comprised the LEU2 gene of S. cerevisiae and ars2004
![Page 49: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/49.jpg)
49
(OKUNO et al. 1997), or the plasmid containing the sna41+ gene (p.sna41; pTN520) or the
mrc1+ gene (p.mrc1; pTN521) were grown to log phase in EMM, 10-fold serially diluted, and
spotted onto EMM plates supplemented with HU. The HU concentration and the incubation
temperature are indicated above each panel.
FIGURE 5.–––The sna41-928 mutation does not suppress the mrc1 defect in Cds1
activation. (A) Time course analysis of the HU sensitivity. Exponentially growing cells of
the wild-type (TNF34), sna41 (HM328), mrc1∆ (TNF264), cds1∆ (TNF256), sna41 mrc1∆
(TNF293), and sna41 cds1∆ (TNF283) strains that were grown at 30° in EMM medium were
treated with an acute dose of HU (10 mM). Aliquots of the cells were collected at the
indicated time point, appropriately diluted with distilled water, and plated on YE medium.
The viability corresponding to the 0-h time point is indicated. The value is the mean of three
independent experiments, and the error bar shows the standard deviation. (B) Exponentially
growing mrc1∆, sna41 mrc1∆, and cds1∆ cells in EMM medium were treated with 10 mM
HU for 0, 3, or 4 h at 30°. Using the cell extracts, phosphorylation of GST-Wee170 was
![Page 50: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/50.jpg)
50
examined as depicted in Figure 3. (C) Relative amount of phosphorylated Wee1 in mrc1∆,
sna41 mrc1∆, and cds1∆ cells.
FIGURE 6.–––The sna41-928 mutation suppresses the defect in recovery from HU arrest
in the mrc1∆ mutant. Exponentially growing cells of the wild-type (TNF34), sna41
(HM328), mrc1∆ (TNF264), and sna41 mrc1∆ (TNF293) strains in EMM medium were
treated with 10 mM HU for 3 h at 30°, washed with distilled water, and then released into
HU-free YE medium. Culture aliquots of 1 ml were collected at the indicated time points and
stored at 4° in 70% ethanol. (A) Flow cytometry analysis of the DNA content of the cells
after release from HU arrest. Black histograms represent the DNA content at the indicated
time points, and gray histograms represent that at the 0-h time point. (B) Percentage of
binucleate cells indicative of passage through mitosis. At each time point, at least 200 cells
were examined by microscopy, and the cells containing two DAPI-stained bodies were
counted.
FIGURE 7.–––Mutations in the MCM helicase suppress the HU sensitivity of the
replication checkpoint mutants. (A) HU sensitivity of the isogenic wild-type (TNF34),
![Page 51: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/51.jpg)
51
cdc19 (TNF909), mrc1∆ (TNF264), cds1∆ (TNF256), cdc19 mrc1∆ (TNF929), and cdc19
cds1∆ (TNF899) strains was examined by a 10-fold serial dilution test. (B) HU sensitivity of
the isogenic wild-type, nda1 (HM259), mrc1∆, cds1∆, nda1 mrc1∆ (TNF912), and nda1
cds1∆ (TNF916) strains was examined. (C) HU sensitivity of the isogenic wild-type, nda4
(TNF344), mrc1∆, cds1∆, nda4 mrc1∆ (TNF355), and nda4 cds1∆ (NNF103) strains was
examined. The HU concentration and the incubation temperature are indicated above each
panel. (D) The nda4 mrc1∆ leu1 (TNF374) transformants harboring the vector plasmid
(p.vector: pXN289) or the plasmid containing the nda4+ gene (p.nda4; pTN774) were grown
to log-phase in EMM at 35°, serially diluted 10 fold, and spotted onto EMM plates
supplemented with 6 mM HU. (E) Exponentially growing cells in EMM medium at 35° were
treated with an acute dose of HU (12.5 mM). Aliquots of cells were collected at the indicated
time points, appropriately diluted with distilled water, and plated on YE medium. The
viability corresponding to the 0-h time point is indicated. The value is the mean of three
independent experiments, and the error bar shows the standard deviation.
![Page 52: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/52.jpg)
![Page 53: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/53.jpg)
![Page 54: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/54.jpg)
![Page 55: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/55.jpg)
![Page 56: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/56.jpg)
![Page 57: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/57.jpg)
![Page 58: Regulation of DNA Replication Machinery by Mrc1 in Fission](https://reader030.vdocuments.net/reader030/viewer/2022012020/61688cfbd394e9041f707f42/html5/thumbnails/58.jpg)