regulation of intracellular aryl hydrocarbon …
TRANSCRIPT
University of the Pacific University of the Pacific
Scholarly Commons Scholarly Commons
University of the Pacific Theses and Dissertations Graduate School
2020
REGULATION OF INTRACELLULAR ARYL HYDROCARBON REGULATION OF INTRACELLULAR ARYL HYDROCARBON
RECEPTOR PROTEIN LEVELS RECEPTOR PROTEIN LEVELS
Jinyun Chen University of the Pacific, [email protected]
Follow this and additional works at: https://scholarlycommons.pacific.edu/uop_etds
Part of the Pharmacy and Pharmaceutical Sciences Commons
Recommended Citation Recommended Citation Chen, Jinyun. (2020). REGULATION OF INTRACELLULAR ARYL HYDROCARBON RECEPTOR PROTEIN LEVELS. University of the Pacific, Dissertation. https://scholarlycommons.pacific.edu/uop_etds/3675
This Dissertation is brought to you for free and open access by the Graduate School at Scholarly Commons. It has been accepted for inclusion in University of the Pacific Theses and Dissertations by an authorized administrator of Scholarly Commons. For more information, please contact [email protected].
1
REGULATION OF INTRACELLULAR ARYL HYDROCARBON RECEPTOR PROTEIN
LEVELS
By
Jinyun Chen
A Dissertation Submitted to the
Graduate School
In Partial Fulfillment of the
Requirements for the Degree of
DOCTOR OF PHILOSOPHY
Thomas J. Long School of Pharmacy
Pharmaceutical and Chemical Sciences
University of the Pacific
Stockton, California
2020
2
REGULATION OF INTRACELLULAR ARYL HYDROCARBON RECEPTOR PROTEIN
LEVELS
By
Jinyun Chen
APPROVED BY:
Dissertation Advisor: William Chan, Ph.D.
Committee Member: John Livesey, Ph.D.
Committee Member: Miki Park, Ph.D.
Committee Member: Wade Russu, Ph.D.
Committee Member: Craig Vierra, Ph.D.
Department Chair: William Chan, Ph.D.
3
REGULATION OF INTRACELLULAR ARYL HYDROCARBON RECEPTOR PROTEIN
LEVELS
Copyright 2020
By
Jinyun Chen
4
DEDICATION
This dissertation is dedicated to my loving parents and grandparents.
5
ACKNOWLEDGEMENTS
My gratitude goes to Dr. William Chan for his support, patience, and encouragement
throughout my graduate studies. It is not often that one finds an advisor that always finds the
time for listening to the little problems in the course of performing research. Your advice was
essential to the completion of this dissertation and has taught me innumerable lessons and
insights on the workings of academic research in general.
I would also like to thank my friends in UOP, for the wonderful times we shared,
specially the Saturday escaping tours. In addition, I would like to thank Yujuan, Jieyun, Hao,
Zhixin, Yingbo, Xinyu who gave me the necessary distractions from my research and made my
stay in Stockton memorable.
Finally, I would like to express my deepest gratitude to my parents and family. This
dissertation would not have been possible without their warm love, continued patience, and
endless support.
6
REGULATION OF INTRACELLULAR ARYL HYDROCARBON RECEPTOR PROTEIN
LEVELS
Abstract
by Jinyun Chen
University of the Pacific
2020
The aryl hydrocarbon receptor (AHR) is a ligand-activated signaling molecule which
controls tumor growth and metastasis, T cell differentiation, and liver development. Expression
levels of this receptor protein are sensitive to the cellular p23 protein levels in immortalized
cancer cell lines. As little as 30% reduction of the p23 cellular content can suppress the AHR
function. Here we reported that down-regulation of the p23 protein content in normal,
untransformed human bronchial/tracheal epithelial cells to 48% of its content also suppresses the
AHR protein levels to 54% of its content. This p23-mediated suppression of AHR is responsible
for the repression of (1) the ligand-dependent induction of the cyp1a1 gene transcription; (2) the
benzo[a]pyrene- or cigarette smoke condensate-induced CYP1A1 enzyme activity, and (3) the
benzo[a]pyrene and cigarette smoke condensate-mediated production of reactive oxygen species.
Reduction of the p23 content does not alter expression of oxidative stress genes or production of
PGE2. Down-regulation of p23 suppresses the AHR protein levels in two other untransformed
cell types, namely human breast MCF-10A and mouse immune regulatory Tr1 cells.
Collectively, down-regulation of p23 suppresses the AHR protein levels in normal and
untransformed cells and can in principle protect our lung epithelial cells from AHR-dependent
oxidative damage caused by exposure to agents from environment and cigarette smoking.
7
The AHR is expressed in triple-negative and non-triple-negative breast cancer cells. It
affects breast cancer growth and crosstalk with the estrogen receptor signaling. Normally the
AHR is degraded shortly after ligand activation via the action of 26S proteasome. Here we
report that the piperazinylpyrimidine compound Q18 triggers AHR protein degradation which is
mediated through chaperone-mediated autophagy in triple-negative breast cancer cells (MDA-
MB-468 and MDA-MB-231). This lysosomal degradation of AHR exhibits the following
characteristics: (1) not observed in non-triple-negative breast cancer cells (MCF-7, T47D, and
MDA-MB-361); (2) inhibited by progesterone receptor B but not estrogen receptor alpha; (3)
reversed by chloroquine but not MG132; (4) required LAMP2A; (5) triggered by 6 amino-
nicotinamide and starvation and (6) involved AHR-LAMP2A interaction mediated by 6 amino-
nicotinamide and starvation. The NEKFF sequence localized at amino acid 558 of human AHR
is a KFERQ-like motif of chaperone-mediated autophagy, essential for the LAMP2A-mediated
AHR protein degradation.
8
TABLE OF CONTENTS
List of Tables ................................................................................................................................ 13
List of Figures ............................................................................................................................... 14
List of Abbreviations .................................................................................................................... 15
Chapter 1: Introduction ................................................................................................................. 18
1.1. Aryl hydrocarbon receptor (AHR) ................................................................. 18
1.2. AHR structure and function ........................................................................... 18
1.3. Aryl hydrocarbon receptor signaling ............................................................. 20
1.4. AHR associated proteins ................................................................................ 22
1.4.1. HSP90 ............................................................................................. 22
1.4.2. XAP2............................................................................................... 22
1.4.3. p23................................................................................................... 23
1.5 Degradation of AHR ....................................................................................... 24
1.6. AHR and disease ............................................................................................ 25
1.6.1. AHR and cancer .............................................................................. 25
1.6.1.1. AHR and breast cancer .................................................... 26
1.6.1.2. AHR and lung cancer ....................................................... 27
1.6.2. AHR and other diseases .................................................................. 28
1.7. Autophagy ...................................................................................................... 29
Chapter 2: Down-regulation of p23 in normal lung epithelial cells reduces toxicities from
exposure to benzo[a]pyrene and cigarette smoke condensate via an aryl hydrocarbon
receptor-dependent mechanism .................................................................................................... 32
2.1. Introduction .................................................................................................... 32
9
2.2. Materials and Methods ................................................................................... 33
2.2.1. Reagents .......................................................................................... 33
2.2.2. Transient transfection...................................................................... 35
2.2.3. Western blot analysis ...................................................................... 36
2.2.4. Reverse transcription-quantitative PCR .......................................... 36
2.2.5. Ethoxyresorufin O-deethylase (EROD) assay ................................ 37
2.2.6. Reactive oxygen species assay ........................................................ 37
2.2.7. PCR array on reactive oxygen species gene expression ................. 38
2.2.8. PGE2 enzyme-linked immunosorbent assay (ELISA) .................... 38
2.2.9. Statistical analysis ........................................................................... 38
2.3. Results ............................................................................................................ 39
2.3.1. Transient transfection of the p23-specific shRNA reduced the
p23 and AHR protein levels in normal human lung epithelial cells ......... 39
2.3.2. Down-regulation of p23 in normal human lung epithelial cells
promoted degradation of the AHR protein ............................................... 40
2.3.3. Down-regulation of p23 in normal human lung epithelial cells
suppressed the ligand-induced cyp1a1 gene expression ........................... 41
2.3.4. Down-regulation of p23 in normal human lung epithelial cells
suppressed the benzo[a]pyrene- and cigarette smoke
condensate-induced CYP1A1 enzyme activity ......................................... 42
2.3.5. Down-regulation of p23 in normal human lung epithelial cells
suppressed the benzo[a]pyrene- or cigarette smoke
condensate-mediated reactive oxygen species production ....................... 44
2.3.6. Treatment with benzo[a]pyrene does not alter oxidative gene
expression in normal human lung epithelial cells when p23 was
downregulated ........................................................................................... 47
2.3.7. Down-regulation of p23 reduced the AHR protein levels in
untransformed human MCF-10A and normal mouse Tr1 cells ................ 49
10
2.3.8. Knockdown of p23 does not affect the PGE2 levels in human
lung epithelial cells ................................................................................... 51
Chapter 3: The aryl hydrocarbon receptor undergoes chaperone-mediated autophagy in
triple-negative breast cancer cells ................................................................................................. 53
3.1. Introduction .................................................................................................... 53
3.2. Material and methods ..................................................................................... 55
3.2.1. Reagents .......................................................................................... 55
3.2.2. Western blot analysis ...................................................................... 57
3.2.3. Reverse transcription-quantitative PCR .......................................... 57
3.2.4. Generation of lentivirus-mediated stable knockdown cells ............ 58
3.2.5. Transient transfection...................................................................... 58
3.2.6. Co-immunoprecipitation ................................................................. 58
3.2.7. Proximity ligation assay .................................................................. 59
3.2.8. Site-directed mutagenesis ............................................................... 59
3.2.9. Gel shift assay ................................................................................. 59
3.2.10. Statistical analysis ......................................................................... 60
3.3. Results ............................................................................................................ 60
3.3.1. Suppression of the AHR protein levels in triple-negative, but
not in non-triple-negative, breast cancer cells by Q18 ............................. 60
3.3.2. Degradation of AHR in triple-negative breast cancer cells is
dependent on progesterone receptor but not estrogen receptor ................ 62
3.3.3. Q18 is an AHR antagonist .............................................................. 66
3.3.4. Q18 promotes the autophagy-mediated AHR protein
degradation and does not affect the AHR transcript levels ....................... 69
3.3.5. Degradation of AHR in triple-negative breast cancer cells is
LAMP2A-mediated ................................................................................... 72
11
3.3.6. Treatment of Q18, 6-AN or starvation in MDA-MB-468 cells
causes interaction between AHR and LAMP2A in proximity ligation
assay .......................................................................................................... 73
3.3.7. Treatment of Q18 increases the LAMP2 expression in TNBC
but not in non-TNBC cells ........................................................................ 73
3.3.8. AHR contains a CMA signature motif............................................ 79
Chapter 4: Discussion ................................................................................................................... 84
References ..................................................................................................................................... 95
Appendices
A. Methodology .............................................................................................................. 106
A1. DNA cloning ................................................................................................ 106
A2. DNA Miniprep ............................................................................................. 108
A3. DNA Maxiprep ............................................................................................ 108
A4. Site-direct mutagenesis ................................................................................ 109
A5. Cell culture ................................................................................................... 110
A6. Transient transfection ................................................................................... 111
A7. Lentiviral transfection .................................................................................. 111
A8. Preparation of cells lysate ............................................................................ 112
A9. Western Blot ................................................................................................ 113
A10. Co-immunoprecipitation ............................................................................ 114
A11. RT-qPCR .................................................................................................... 115
A12. Muse cell analysis ...................................................................................... 116
A13. Ethoxyresorufin O-deethylase (EROD) assay ........................................... 118
A14. Proximity ligation assay (PLA).................................................................. 118
B. List of oligonucleotide primers .................................................................................. 120
12
C. Glycerol stock numbers .............................................................................................. 123
13
LIST OF TABLES
Table
1. Primer sequences used for RT-PCR…………………………………………………35
2. Oxidative Stress Gene Expression Analysis Results Comparing
BaP-Treated Scramble shRNA Transfected HBTE Cells (Control Sample)
With BaP-Treated p23-Knockdown HBTE Cells (Test Sample)…………..…...…..48
3. Recipe for SDS-PAGE…..……………………………………………...………….114
14
LIST OF FIGURES
Figure
1. Domain structures of the human AHR (hAHR)………………………………….…20
2. Schematic of intracellular AHR signaling after ligand binding……………….……21
3. Western blot analysis results showing that down-regulation of p23
reduced the AHR protein levels in HBTE cells by increasing the AHR
protein degradation……..………………………………………………………..…..40
4. Reverse transcription-quantitative PCR results showing that suppression
of the ligand-induced AHR target gene expression in HBTE cells when p23
was down-regulated……………………………………………………………….....42
5. CYP1A1 enzyme activity assay results showing that down-regulation of
p23 suppressed the BaP- and CSC-induced CYP1A1 activity in HBTE
cells……………………………………………………………………………….….43
6. Cell analysis results showing that down-regulation of p23 suppressed the
BaP- or CSC-mediated ROS production in HBTE cells…………………..…………47
7. Western blot analysis results showing that down-regulation of p23
suppressed the AHR protein levels in MCF-10A (A) and mouse Tr1 (B) cells……..50
8. ELISA results showing the PGE2 levels in HBTE cells…………………………..…52
9. Western blot analysis of the AHR protein levels in TNBC and non-TNBC
cells after Q18 treatment…………………………………..…………………………62
10. Effect of PR-B and ERα on the Q18-mediated suppression of the AHR
protein levels..……………………………………………………………………..…65
11. Effect of Q18 on AHR ligand binding……………………………………………….68
12. Effect of Q18 on AHR gene transcription, message stability, and
protein stability in MDA-MB-468 cells……………………………………..………71
13. Effect of the LAMP2A-mediated CMA on AHR degradation…………………..…..78
14. Identification of CMA motif of human AHR………………………………………..82
15
LIST OF ABBREVIATIONS
Act D actinomycin D
AHR aryl hydrocarbon receptor
AHRR aryl hydrocarbon receptor repressor
ARNT aryl hydrocarbon receptor nuclear translocator
ATG autophagy gene
ATP adenosine triphosphate
bHLH basic helix-loop-helix
B[a]P benzo[a]pyrene
BMAL brain muscle ARNT-like 1
βNF β-naphthoflavone
BSA bovine serum albumin
CSC cigarette smoke condensate
CHIP carboxyl terminus of hsc70-interacting protein
CHX cycloheximide
CLOCK circadian locomotor output cycles kaput
CMA chaperone-mediated autophagy
cPGES cytosolic prostaglandin E2 synthase
CQ chloroquine
CYP450 cytochrome P450
DMEM dulbecco's modified eagle medium
DMSO dimethyl sulfoxide
16
DRE dioxin response element
ER endoplasmic reticulum
ERα estrogen receptor α
EROD 7-ethoxycoumarin O-demethylase
FBS fetal bovine serum
FICZ 6-formylindolo[3, 2-b]carbazole
GA geldanamycin
GAPDH glyceraldehyde 3-phosphate dehydrogenase
GFP green fluorescent protein
GR glucocorticoid receptor
HAH halogenated aromatic hydrocarbons
HBSS Hank's balanced salt solution
HBTE human bronchial/tracheal epithelial
HIF1α hypoxia-inducible factor
HSP90 heat shock protein 90
IP immunoprecipitation
Kyn kynurenine
LAMP2 lysosomal-associated membrane protein 2
LC3 microtubule-associated protein light chain 3
NPAS neuronal PAS domain-containing protein
PAH polycyclic aromatic hydrocarbon
PAS PER/ARNT/SIM homology domain
PE phosphatidylethanolamine
17
PI3K phosphoinositide 3-kinase
PR-B progesterone receptor-B
ROS reactive oxygen species
RT-qPCR real-time quantitative polymerase chain reaction
SDS-PAGE sodium dodecyl sulfate polyacrylamide electrophoresis
SIM single-minded proteins
TAD transactivation domain
TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin
Tr1 type I regulatory T
UPS ubiquitin proteasomal system
XAP hepatitis B virus X-associated protein
3MC 3-methylcholanthrene
6-AN 6-aminonicotinamide
18
CHAPTER 1: INTRODUCTION
1.1. Aryl hydrocarbon receptor (AHR)
The aryl hydrocarbon receptor belongs to the basic helix-loop-helix-PER-ARNT-SIM
(bHLH-PAS) family, which includes hypoxia-inducible factor (HIF)-1α (oxygen sensing), aryl
hydrocarbon receptor repressor (AHRR, downregulate AHR activity), circadian locomotor
output cycles kaput (CLOCK, circadian rhythm regulation), brain muscle ARNT-like 1 (BMAL-
1), neuronal PAS domain-containing protein (NPAS) and single-minded proteins (SIM1 and
SIM2, neurogenesis). AHR protein can form heterodimer with the class II bHLH-PAS protein,
the AHR nuclear translocator (ARNT), acting as a functional transcription factor to respond to
environmental pollutants (such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or polycyclic
aromatic hydrocarbons (such as benzo[a]pyrene (B[a]P)) and endogenous substances (such as
kynurenine (Kyn) or 6-formylindolo[3, 2-b]carbazole (FICZ)). The consequences of AHR
activation lead to a myriad of signaling pathways that involve metabolism, development,
reproduction, apoptosis, inflammation and oxidative stress via regulating AHR target gene
expression.
1.2. AHR structure and function
The bHLH-PAS family proteins share a conserved structure with a bHLH region and
tandem PAS regions at amino-terminal. The bHLH region comprises a short basic region, two
amphipathic α helices separated with a short variable loop [1]. The basic domain is responsible
for DNA binding through direct contact with the backbone of DNA strands. The α helix
domains of the HLH motif provide the interface tether with the major groove of specific
response element [2] and facilitate the formation of protein dimers. The AHR-ARNT
19
heterodimer interacts with the DNA response element (DRE) via positively charged residues on
the bHLH domain. ARNT residues recognize its target sequence CGTG of DRE via the H94,
E98, and R102. AHR uses S36, H39, and R40 to form interactions with the first three bases of
DRE [3].
The PAS domain is named after the three founding members: Drosophila Period (PER),
the human aryl hydrocarbon receptor nuclear translocator (ARNT) and Drosophila Single-
minded (SIM). Functions of the AHR PAS domain involve interaction with chaperone proteins,
such as 90-kDa heat shock protein (HSP90) (PAS-B), and heterodimerization with its partner
protein ARNT (both PAS-A and PAS-B). Sensing of the environmental pollutants is also
achieved through the binding of the PAS-B domain with AHR ligands [4]. The PAS-A motif
(mouse AHR) forms a five-stranded antiparallel β-sheet and four α-helices flanking the sheet [5].
The PAS-B domain is more flexible than the PAS-A in adapting to other proteins and ligands
with varied interfaces. Just like HIF-1α-ARNT, AHR-ARNT shows cooperation between the
PAS-A domains and the respective bHLH domains to positioning the amino-terminal of PAS
domain in proximate to DNA [6].
Deletion analysis identified the transactivation domain (TAD) at the carboxyl-terminal of
AHR that affects DRE binding and transcriptional activity (Figure 1) [7]. For both class I and II
PAS proteins, such as AHR (class I member) and ARNT (class II member), transactivation is
mediated by recruiting CREB, SRC1 and RIP140 coactivators [8]. The TAD region consists of
an acidic, a Q-rich and a P/S/T rich domain [9]. Partial deletion of these subdomains contribute
slightly different levels of inhibiting the ligand-induced transactivation of human AHR (hAHR),
whereas the Q-rich single subdomain has the most predominant effect [10]. Complete removal of
the Q-rich subdomain from the hAHR results in inactivation of AHR [11]. Likewise, the
20
coactivator SRC-1 and RIP140 mainly interact with the Q-rich subdomain of hAHR TAD [12].
A recent report showed a short motif in the Q-rich subdomain (aa 648-666) that mediates the
nuclear export of AHR [13], whereas the well-characterized nuclear export signal (NES) is
located in the amino-terminal of AHR (aa 63-73), adding a new role of the C-terminal of AHR in
the protein trafficking and activation.
Figure 1. Domain structures of the human AHR (hAHR). The colored boxes indicate the
domains of human AHR. The horizontal lines indicate functional regions for the AHR. Numbers
under each box and line represent amino acid residues of protein domain boundaries. b, basic
region; HLH, helix-loop-helix; PAS, PER/ARNT/SIM homology regions; TAD, transactivation
domain; N, amino terminus; C, carboxyl terminus.
1.3. Aryl hydrocarbon receptor signaling
In the native state, the inactive, unliganded AHR resides in the cytosol complexed with at
least two molecules of HSP90 and cochaperone proteins: xenobiotic-associated protein 2 (XAP2)
and p23. These (co)-chaperone proteins contribute to the stability and cytosolic localization of
AHR, maintaining it in a ligand and DNA binding-competent state. AHR ligands bind to the
ligand binding domain of AHR causing conformational change and exposing the nuclear
localization signal (NLS) domain. Once the receptor is translocated into the nucleus, it
dissociates from the cytoplasmic complex allowing recognizes ARNT to form a heterodimer.
21
The heterodimer binds to a consensus DNA sequence (TN (N represents T or C) GCGTG),
namely DRE, where ARNT recognizes the 3’-GTG and AHR recognizes the 5’-TNGC bases.
After binding to the DRE, the DNA-bound AHR-ARNT heterodimer then subsequently recruits
coregulators to the TAD facilitating chromatin remodeling and target gene transcription.
Specific coactivators (e.g. SRC-1) have been shown to interact with the Q-rich subdomain of
AHR TAD utilizing LXXLL motifs. After that, the AHR-ARNT complex releases AHR and
exposes NES trafficking back to the cytoplasm. The AHR is ubiquitinated in the cytoplasm or
nucleus and targeted to 26S proteasome for degradation.
Figure 2. Schematic of intracellular AHR signaling after ligand binding.
A variety of chemicals bind to the chaperone-bound cytoplasmic aryl hydrocarbon receptor
(AHR), thereby stimulates its translocation to the nucleus, where the chaperones are exchanged
for AHR nuclear translocator (ARNT). The AHR-ARNT dimer binds to a cognate DNA
response element (DRE) in cis to induce transcription of genes for a range of biological outputs.
Cytochrome P450 gene products are crucial for the feedback metabolism of xenobiotics that
22
(Continued) initially activate the AHR. HSP90, heat shock protein 90; XAP2, HBV X-
associated protein; ADH, alcohol dehydrogenase; GST, glutathione s-transferase.
1.4. AHR associated proteins
1.4.1. HSP90
The HSP90 family is a highly expressed and conserved chaperone protein in eukaryotic
cells and has been shown to regulate ligand binding, folding and maintain stability of its client
proteins, thus affecting their physiological functions. Post-translational modifications of the
HSP90, such as phosphorylation at serine residues, have been reported to affect the binding
affinity with AHR and its transactivation activity [14, 15]. HSP90 assists AHR in its inactive
state in the absence of ligand and in proper conformation to bind ligand [16]. The AHR still
maintains the ability of binding to the ligand when dissociate from HSP90. The interaction of
AHR and HSP90 is essential for ligand mediated AHR signaling in an ARNT independent
manner in yeast expression system [17]. Furthermore, ligand-dependent HSP90 dissociation is
essential for the formation of AHR-ARNT [18], which require the involvement of p23 [19].
1.4.2. XAP2
Hepatitis B virus X-associated protein (XAP2), is also known as AHR-interacting protein
(AIP) or immunophilin homolog ARA9, which contains the tetratricopeptide repeat (TPR) motifs
(acts as protein-protein interaction domain) and works as a chaperone protein for steroid
hormone receptors. XAP2 can interact with HSP90, AHR, or both directly via the highly
conserved TPR domain [20]. Overexpression of XAP2 increases AHR stability [20] and
responsiveness [21], whereas depletion of XAP2 increases ubiquitination of AHR and further
degradation [22, 23]. These results indicate that the XAP2 is necessary and sufficient to maintain
AHR expression and signaling. Additionally, following ligand binding, overexpression of XAP2
23
affects the nuclear translocation of AHR with accumulated AHR complex in the cytoplasm,
which is PAS-B domain-dependent but NLS and bHLH domain-independent [24]. Another
TPR-containing protein, C-terminal HSP70-interacting protein (CHIP), acts as a E3 ubiquitin
ligase that mediates the proteasomal degradation of AHR mainly dependent on its N-terminal
TPR domain. While the mutation analysis confirmed that XAP2 ablates CHIP-induced AHR
destabilization using its TPR domain [22].
1.4.3. p23
Mammalian p23 (also known as PTGES3, Sba1 in yeast) is a small acidic protein and
acts as a co-chaperone protein to enhance the folding of its client proteins, such as HSP90. The
stable β-sheet and a flexible C-terminal tail [25] of p23 is highly conserved and the protein is
expressed in all the tissues. Deletion of p23 is lethal to embryos due to immature lung
development [26] and impaired glucocorticoid receptor (GR) function in null embryonic
fibroblasts [27]. The primary role of p23 is to stabilize the conformation of HSP90 by binding to
the N-terminal domain of HSP90 that contains adenosine triphosphate (ATP)-binding domain.
The HSP90 inhibitor, geldanamycin (GA), can disassociate p23 from HSP90. p23 is required to
fulfill the functions of AHR including stabilizing the cytoplasmic AHR complex, increasing
AHR-ARNT heterodimerization and DNA binding upon ligand binding [28]. However, p23
seems to be insignificant in AHR expression and function in vivo [29]. Our group reported that
in various carcinoma cell lines, p23 expression level is essential in protecting AHR protein from
degradation [30]. Our findings are consistent with the research in that overexpression of p23 in
vivo upregulates the expression of AHR and its target genes in a ligand-independent pathway
[31]. p23 also has a chaperone activity on its own which is independent of HSP90 in affecting
the activities of multiple steroid receptors. Our group constructed a p23 mutant with minimal
24
HSP90 binding affinity and this mutant revealed that p23 stabilizes AHR proteins independent of
HSP90 [32]. Moreover, p23 is reported to exhibit cytosolic prostaglandin E2 synthase (cPGES)
activity that contributes to the production of PGE2 [33].
1.5 Degradation of AHR
Ligand binding results in the degradation of AHR, while the other cytoplasmic complex
components remain stable following ligand binding. This AHR depletion can be observed
sharply in two hours shortly post ligand treatment. AHR degradation has been extensively
studied. It occurs via 26S proteasomal pathway. Degradation can be blocked in the presence of
proteasome inhibitors like MG132, epoxomicin or lactacystin. Inhibitors of calpains
(calpastatin), lysosomal inhibitor (chloroquine, CQ) and other serine and cysteine proteases
inhibitors (PMSF and leupeptin) cannot reverse the ligand-induced outcomes [34]. Many studies
have shown the increase of ubiquitinated AHR after ligand binding, though no E3 ligase has
been identified that is involved in the ligand-induced degradation of AHR.
Likewise, AHR can be degraded in a ligand-independent manner. GA, a specific HSP90
inhibitor, directly associates with the ATP-binding pocket of HSP90 and interrupts the formation
of AHR-HSP90. Consequently, GA results in a prompt reduction of AHR two hours after
exposure without affecting the HSP90 protein levels. This degradation can be overcome by the
pretreatment with MG132 or lactacystin [35]. GA does not affect the stability of AHR proteins
in reticulocyte lysates. AHRR shares a highly conserved sequence with AHR in bHLH and
PAS-A domains. It is identified as a negative AHR regulator via interaction with ARNT thus
preventing the heterodimerization of AHR and ARNT followed by suppression of AHR
transactivation. The impaired AHR signaling by AHRR is not caused by competitive binding
with ARNT nor occupancy in DRE [36]. CHIP is identified as a chaperone protein for GR and
25
promotes GR ubiquitylation. Considering the similarities between the AHR and GR, researchers
found that the overexpression of CHIP can also accelerate the degradation of AHR mediated
through ubiquitylation [37]. Nevertheless, this degradation can be restored by the
overexpression of XAP2 [22]. When knock down CHIP in Hepa1c1c7 cells, there is no
significant difference on AHR and HSP90 protein levels [38], indicating there might be
compensatory mechanisms existing in this cell line and the other CHIP-like E3 ligase works in a
similar pathway to make up the absence of CHIP.
1.6. AHR and disease
A myriad of studies indicated that the AHR is associated with various physiological and
pathophysiological processes, such as cell survival and apoptosis, endoplasmic reticulum (ER)
stress, DNA damage, regulation of oxidative stress and inflammation. These cellular responses
would partially rely on the xenobiotics-induced outcome and the canonical AHR signaling.
Crosstalk of AHR with other proteins and transcription factors like estrogen receptor (ER), NF-
κB, β-catenin, mitogen activated protein kinase (MAPK) also contribute to diseases.
1.6.1. AHR and cancer
A well-known mechanism that links AHR to tumor initiation is that xenobiotics activate
AHR signaling and turn on the transcription of phase I enzymes, which in turn convert pre-
carcinogens into genotoxic carcinogens and lead to DNA mutation. Recent studies showed that
aberrant AHR expression and its constitutive activation are found in multiple tumor models
without any exogeneous ligands introduced into the system. The AHR has been reported to be
involved in different carcinogenesis processes including cancer stem cell transformation, pro-
/anti-oncogenes modulation, cancer cell proliferation and metastasis, crosstalk with ER and
breaking the balance between pro- and anti-inflammatory responses. Indeed, the dichotomous
26
roles of AHR observed on tumorigenesis strongly rely on the cell types or tumor models and the
limitations of using cell models.
1.6.1.1. AHR and breast cancer
Deletion of AHR caused immature mammary gland in rodents, which is considered as
evidence that the AHR may be essential in breast development. AHR mRNA and proteins are
significantly increased in human breast cancer cells, human mammary tumors and 7,12-
dimethylbenz[a]anthracene (DMBA)-induced mammary tumors in mice, indicating AHR may
serve as a biomarker of breast cancer. Exclusive up-regulation of AHR protein levels allows
normal mammary epithelial cells to acquire malignant properties, with higher epithelial-
mesenchymal transition (EMT), proliferation rate and invasiveness [39], which reveals the role
of AHR in inducing malignant transformation. Furthermore, stable knockdown of AHR in
MDA-MB-231 cells, a triple negative breast cancer cell line, reduced unlimited growth of the
cancer cells as well as the orthotopic tumor growth and experimental lung metastasis in mouse
xenograft model transplanted with MDA-MB-231 cells [40]. From clinical breast cancer
samples, researchers found that AHR hyper-expression is parallel with the negativity of ERα,
which is consistent with the antagonistic role of AHR to ER signaling. The AHR has been
reported to epigenetically regulate BRCA1, a tumor suppressor, the mutated or deficient genotype
of BRCA1 is associated with a high possibility of developing breast cancer. Activation of AHR
by TCDD causes recruitment of DNA methyltransferase to the BRCA1 promoter and represses
the E2-dependent induction of BRCA1 via CpG methylation [41]. Additionally, the
constitutively activated AHR also plays an important role in breast cancer by inducing the
expression of a battery of genes such as SLUG [42], a regulatory factor in promoting EMT, and
cyclooxygenase-2 (COX2) in inducing immune resistance.
27
In contrast, the AHR has been reported to have anti-breast cancer activity [43]. The
treatment of various AHR agonists and selective modulators inhibited TNBC cell proliferation
and xenograft tumor growth [44]. Expression of AHR sensitized TNBC cells to an ER-positive
breast cancer antagonist, Raloxifen, which was identified as an AHR ligand [45]. Omeprazole,
an AHR agonist downregulated chemokine CXCR4 level in breast cancer cells, indicating the
anti-metastatic effect of AHR signaling [46]. The pro-oncogenic and anti-oncogenic roles of
AHR may be explained by genetic variation presented in the identical cell line, different tumor
stages, the unexpected stress introduced by the treatments and lack of immunity involvement in
cultured cells or nude mice. Generation of doubly transgenic mutants by crossing ahr-/- mice
with transgenic breast cancer mice can be used in further validating the interplay of AHR in
breast tumorigenesis.
1.6.1.2. AHR and lung cancer
The AHR is highly expressed in lung tumor biopsies from lung cancer patients [47]. A
pro-oncogenic role of AHR in lung cancer progression has been demonstrated in enhanced cell
proliferation, migration and survival. AHR promoted EGFR tyrosine kinase inhibitors (TKIs)
resistance in non-small cell lung cancer (NSCLC) cells by increasing the interaction of Src and
JAK2 in a non-canonical AHR signaling pathway [48]. Overexpression of AHR and treatment
with AHR agonists promoted proliferation of A549 lung cancer cells, while downregulation of
ARNT blocked this effect [49]. AHR agonists including benzo[a]pyrene (BaP) and other
polycyclic aromatic hydrocarbons (PAHs) are enriched in cigarette smoke and particulate
pollutants, which are most likely to induce lung cancer. After the activation of AHR, BaP can be
metabolized into carcinogenic BaP-7,8-dione by CYP1A1 enzyme and further increases DNA
adduct formation and apoptosis in normal lung tissues. Moreover, during the metabolism of
28
BaP, two molecules of reactive oxygen species are released [50], which play positive roles in
promoting inflammation in the pulmonary tissues. It has been shown that AHR dimerizes with
RelA in the nucleus then binds to the NF-κB response element and induces the expression of IL-
6 [51], which plays a role in lung tumorigenesis. The AHR has also been shown to interact with
another NF-κB protein: RelB. Loss of AHR expression in lung fibroblasts can cause enhanced
COX-2 and PGE2 by exposure to cigarette smoke extract (CSE). And the ability of the AHR in
attenuating pulmonary inflammation or even lung cancer may due to the interaction between
AHR and RelB thus protecting the RelB from degradation [52].
1.6.2. AHR and other diseases
Ligand mediated AHR signaling has been reported to modulate innate and adaptive
immunity that lead to inflammatory diseases. It is well established that several AHR ligands
including TCDD and indole-3-carbinol (I3C) promote the expansion of regulatory T cells from
naive T cells, counterbalancing the pro-inflammatory signaling. In contrast, another AHR
ligand, FICZ, increase the differentiation of T cells in an opposing direction: T helper 17 cells
[53]. The mechanisms that cause the diverse outcomes by AHR agonists are still unclear.
Nevertheless, the altered balance between effector and regulatory T cells may tip the balance to
inflammation. In addition, the AHR contributes to the development of inflammatory disease
phenotypes by affecting the expression and function of immunoregulatory factors (e.g. cytokines,
FOXP3, STAT1, NLRP3 inflammasome) and signaling, such as NF-κB [54-57].
Deletion and ligand treatment studies suggest that the AHR may play dual roles in the
cardiovascular system. The phenotype of ahr null mice reveals that AHR is required in the
development of myocardium and controlling the expression of regulatory genes involved in
cardiogenesis and cardiac homeostasis [58]. However, it is believed that cardiotoxicity is caused
29
by CYP450 induction after exposure to PAHs in an AHR-dependent manner, which eventually
causes an increase of ROS. NQO1 and GSTA1, which can also be induced by activated AHR,
are part of the antioxidant defense system that neutralize the ROS and show the cardioprotective
properties. TCDD mediated AHR activation negatively regulates the homeostasis in
cardiovascular system in varied species. In human, exposure to a high dose of TCDD increases
risk of ischemic heart disease [59]. Cardiomyocyte-specific knockout of AHR protects from
NKX2.5 haploinsufficiency induced heart hypertrophy [60].
1.7. Autophagy
Autophagy is a highly conserved eukaryotic process that degrades the damaged cellular
organelles, aggregated proteins and bulky molecules. The function of autophagy is reflected in
cellular homeostasis and aberrant autophagy is related to neuron degeneration, aging,
vasculopathy and cancer [61-64]. Macroautophagy (referred to here as autophagy),
microautophagy and chaperone-mediated autophagy (CMA) are three main forms of autophagy
which differ in the way of delivery to the lysosome.
Autophagy is regulated by autophagy gene (ATG) through the formation of a
phagophore. Class III phosphoinositide 3-kinase (PI3K), which consists of Beclin1,
VPS34/VPS15, p150 and ATG14, is increased under stress or starvation to initiate autophagy.
The membrane compartments (phagophore) are enriched in phosphatidylinositol 3-phosphate
(PI3P), which recruits other ATGs to complete autophagic structure formation. Several cellular
organelles, such as ER, mitochondria and endosome, provide membrane source and contribute to
the formation of double-membrane vesicles [65]. Microtubule-associated protein 1 light chain 3
(LC3-I) conjugates with phosphatidylethanolamine (PE) to form the lipidated, autophagosome-
bound LC3-II in the presence of ATG12-ATG5 complex. p62/SQSTM1, which is defined as a
30
selected autophagy adaptor, interacts with both ubiquitinated cargoes via C-terminal ubiquitin-
associated (UBA) domain and LC3-II via LC3-interacting region (LIR) and delivers the protein
cargo to the autophagosome. The autophagosome then fuses with endosomes and lysosomes for
cargo degradation.
In contrast, CMA selectively degrades the KFERQ-like motif bearing proteins in the
lysosomes [66]. The pentapeptide motif is not limited to specific amino acids, but it is defined
by their biochemical and physical properties. This motif is flanked by a Q or N on either side
and contains one or two of the hydrophobic residues (I, L, V, F), one or two of the positively
charged residues (K, R) and one of the negatively charged residues (D, E). The KFERQ-like
motif is directly recognized by HSC70 and cochaperones, such as CHIP. The HSC70-substrate
complexes then bind to the cytosolic domain of LAMP2A, which is a rate-limiting element in
CMA. Binding of substrate promotes LAMP2A assembly into multimeric complex, facilitating
the translocation of unfolding substrate into the lumen and degradation by the proteases [67].
After that, LAMP2A dissociates into monomer and re-enters into another round of lysosomal
entry of substrates.
Microautophagy degrades the damaged organelles in the late endosomes by
internalization of the bulky cargo. Recent studies also reported a selective microautophagy. The
selective substrate contains a KFERQ-like motif for the recognition by the chaperone protein
HSC70. The HSC70-substrate complex is also internalized by the endosome without the
involvement of LAMP2A and unfolding of the substrate [68].
The general ideal regarding autophagy is pro-survival, since it removes the unwanted
materials and allows cells to survive under unfavorable conditions, such as hypoxia, starvation
and oxidative stress. However, hyperactivated autophagy may result in cell death. There is
31
extensive connection between autophagy and apoptosis. An anti-apoptotic protein Bcl-2
interacts with Beclin-1 via BH3 domain accordingly and inactivates autophagy. This inhibition
can be restored by stress induced phosphorylation of Bcl-2 or BH3 domain of Beclin-1. Several
intracellular signals, such as the tumor necrosis factor receptor (TNF-R) family, and FADD-like
IL-1β–converting enzyme inhibitory protein (FLIP), are also involved in both processes.
Additionally, ATG5 and ATG12 are reported to induce apoptosis, thereby functioning both as
pro-apoptosis and pro-autophagic regulators [69, 70]. The interplay between autophagy and
apoptosis remains complex and controversial and whether autophagy directly controls the
process of apoptosis or merely shares some common machineries is unknown. Understanding
the pathways may tip the balance between survival and death which is crucial to determining the
utility of targeting autophagy in cancer treatment and other diseases.
32
CHAPTER 2: DOWN-REGULATION OF P23 IN NORMAL LUNG EPITHELIAL CELLS
REDUCES TOXICITIES FROM EXPOSURE TO BENZO[A]PYRENE AND CIGARETTE
SMOKE CONDENSATE VIA AN ARYL HYDROCARBON RECEPTOR-DEPENDENT
MECHANISM
2.1. Introduction
Many cellular responses to chemical agents from our environment and diet can be
mediated through the aryl hydrocarbon receptor (AHR). This receptor is a ligand-activated
transcription factor which regulates a vast battery of target gene expression and cross-talks with
numerous endogenous molecules to elicit diverse biological functions—effects ranging from
sensing of xenobiotics [71], to modulation of immune response [72, 73], and control of cell
growth and metastasis [43, 74-78]. Exposure of air pollutants and cigarette smoke in the lungs is
known to activate pulmonary AHR which, in turn, may affect the inflammatory status of the lung
and contribute to pulmonary cell damage, leading to respiratory diseases and cancer [79, 80].
One of the best examples of chemicals that activate the lung AHR is benzo[a]pyrene (BaP) from
cigarette smoking. BaP is an AHR ligand which up-regulates the cytochrome P450 1A1
(CYP1A1) expression in the lung [81]. CYP1A1 and epoxide hydrolase are well known for their
involvement in bioactivation of BaP to form the carcinogenic BaP diol expoxide which alkylates
DNA in the lung, leading to carcinogenesis [82]. In addition, metabolism of BaP, initiated by
CYP1A1, has been shown to increase reactive oxygen species (ROS) production [83], which in
principle may cause pulmonary oxidative stress that can lead to respiratory diseases. The p23
co-chaperone is part of the AHR cytoplasmic complex and can affect the AHR function in many
ways: 1). p23 preserves the ligand responsiveness of AHR [19]; 2). it mediates the
geldanamycin-induced AHR degradation [84]; 3). it promotes the formation of the AHR gel shift
complex [85]. However, the AHR levels and function are unaltered in p23-knockout embryo
33
[86]. These p23 null mice did not survive, making it difficult to assess whether p23 is indeed
dispensable for the endogenous AHR function in these mice. On the contrary, we observed that
down-regulation of p23 in immortalized cancer cells-such as mouse hepatoma Hepa1c1c7,
human cervical HeLa, and human hepatoma Hep3B-promotes AHR protein degradation without
ligand treatment [30]. In an effort to understand the implication of this p23 effect on AHR, we
examined the effect of p23 down-regulation in normal and untransformed cells. Here we provide
evidence that downregulation of p23 causes reduction of the AHR protein levels in
untransformed human lung, human breast, and mouse immune cells. Particularly, down -
regulation of p23 protects human lung epithelial cells from the AHR-mediated toxicities upon
exposure to BaP or cigarette smoke condensate (CSC).
2.2. Materials and Methods
2.2.1. Reagents
Human bronchial/tracheal epithelial (HBTE) cells were purchased from Lifeline Cell
Technology (Frederick, Maryland) and grown in BronchiaLife complete medium (Lifeline Cell
Technology, Frederick, Maryland). Human breast MCF-10A cells (American Type Culture
Collection, Manassas, Virginia) were maintained in mammary epithelial cell growth medium
(MEGM, Lonza, Walkersville, Maryland). Naïve T cells were isolated from C57BL/6 mouse
spleen using the Pan T cell isolation kit from Miltenyi Biotech (Sunnyvale, California) and were
subsequently differentiated into Tr1 cells in an anti-CD3 (4 ml of PBS containing 2 mg/ml of
anti-CD3) coated T75 flask using TGF-β1 (2 ng/ml), IL-27 (25 ng/ml), and anti-CD28 (2 mg/ml)
by incubation for 96h at 37℃. C57BL/6 mice were purchased from Jackson Laboratory
(Sacramento, California); TGF-β1 and IL-27 from R&D Systems (Minneapolis, Minnesota);
anti-CD3 and anti-CD28 from eBioscience Thermo Fisher (Grand Island, New York). All cells
34
were maintained as monolayer cultures at 37℃ in an incubator with an atmosphere of 5% CO2.
BaP was purchased from Sigma (St. Louis, Missouri). Cycloheximide (CHX) was purchased
from Santa Cruz Biotechnology (Santa Cruz, California). CSC was prepared from research
cigarettes (3R4F; Kentucky Tobacco Research Council, Lexington, KT) on a FTC smoke
machine. The total particulate matter (TPM) on the filter was calculated by the weight gain on
the filter. The condensate was extracted with DMSO by soaking and rotation to prepare a 50
mg/ml solution. EcoTransfect transfection reagent was purchased from Oz Biosciences (San
Diego, California). pLKO.1 p23-specific short-hairpin RNA (shRNA) plasmid (#3,
CCAAATGATTCCAAGCATAAA) was purchased from Thermo Scientific (Rockford, Illinois).
pLKO.1 shRNA scramble plasmid was purchased from Addgene (Cambridge, Massachusetts).
The codon humanized pGFP2-N2 plasmid was purchased from BioSignal Packard (Montreal,
Canada). Direct-zol RNA kit was purchased from Zymo Research (Irvine, California). MMLV
highperformance reverse transcriptase was purchased from Epicentre (Madison, Wisconsin).
The iQ SYBR green supermix was purchased from Bio-Rad (Hercules, California). All human
primers for cyp1a1, cyp1a2, nqo1, ugt1a1, ahrr, 18 s (Table 1) were purchased from Invitrogen
custom primer (Thermo Fisher Scientific, Grand Island, New York). The Muse Oxidative Stress
kit was purchased from EMD Millipore (Billeria, Massachusetts). Anti-AHR (SA210)
polyclonal rabbit IgG was purchased from Enzo Life Sciences (Farmingdale, New York). Anti-
p23 (JJ3) monoclonal mouse IgG was purchased from Thermo Fisher Scientific (Rockford,
Illinois). Anti-β-actin monoclonal mouse IgG was purchased from Ambion (Austin, Texas). All
secondary donkey IgGs conjugated with IRDye 800CW or 680RD were purchased from LI-COR
Bioscience (Lincoln, Nebraska).
35
Table 1
Primer sequences used for RT-PCR
Gene Forward primer Reverse primer
cyp1a1 5’-GGCCACATCCGGGACATCACAGA-3’ 5’-TGGGGATGGTGAAGGGGACGAA-3’
cyp1a2 5’-CTGGGCACTTCGACCCTTAC-3’ 5’-TCTCATCGCTACTCTCAGGGA-3’
cyp1b1 5’-CACCAAGGCTGAGACAGTGA-3’ 5’-GATGACGACTGGGCCTACAT-3’
nqo1 5’-TGAAGGACCCTGCGAACTTTC-3’ 5’-GAACACTCGCTCAAACCAGC-3’
ugt1a1 5’-TTGTCTGGCTGTTCCCACTTA-3’ 5’-GGTCCGTCAGCATGACATCA-3’
ahrr 5’-GCGCCTCAGTGTCAGTTACC-3’ 5’-GAAGCCCAGATAGTCCACGAT-3’
18s 5’-CGCCCCCTCGATGCTCTTAG-3’ 5’-CGGCGGGTCATGGGAATAAC-3’
Note. Sequences of forward and reverse primers used to amplify AHR target gene transcripts and
18S.
2.2.2. Transient transfection
For HBTE and MCF-10A cells, cells were plated at a density of 105 cells per well of a 6-
well plate and transfected with pLKO.1 p23-specific shRNA plasmid DNA and shRNA plasmid
using EcoTransfect reagent as followed: plasmid DNA (2 µg for HBTE and 5 µg for MCF-10A
cells) and EcoTransfect reagent (6 µl for HBTE and 10 µl for MCF-10A cells) were diluted into
100 µl of advanced MEM, respectively. The two solutions were mixed gently and incubated for
20 min at room temperature. Thereafter, the complexes were added into the cells growing with
complete medium and incubated for 72 hr in a 5% CO2 incubator at 37℃. Transfection of Tr1
cells was initiated using 4D-Nucleofector system (V4XP-3024) following the manufacture’s
protocol (Lonza, Cologne, Germany). Briefly, 106 Tr1 cells were resuspended into 100 µl
nucleofector solution. Four microgram of plasmid DNA were added into the mixture and
transferred into the transfection cuvette, then the Nucleofection process was started on the 4D-
36
Nucleofector Core Unit. After transfection, the cells were pipetted back to the prewarmed media
and incubate the cells for 72h in a 5% CO2 incubator at 37℃.
2.2.3. Western blot analysis
Western blot analysis was performed using a previously described method [30]. Briefly,
20 µg of whole cell lysate, which were prepared in 25mM HEPES, pH 7.4, 0.4M sodium
chloride, 1mM EDTA, and 10% glycerol, was separated by 12% SDS-PAGE. Wet transfer was
performed to transfer proteins from gel to nitrocellulose membrane at 300mA for 120 min at
4℃. Membranes were incubated for 1 hr at room temperature in blocking solution (PBS
containing 5% BSA, 0.1% Tween-20, and 0.05% sodium azide), followed by primary antibody
incubation with SA-210 or JJ3 overnight at 4℃. Incubation with secondary donkey antibody
conjugated with IRDye was carried out in blocking solution for 2 hr at room temperature. A
washing step (5 times of 5 min wash with PBS + 0.1% Tween-20) was done after antibody
incubation. The bands were visualized using the LI-COR Odyssey system (Lincoln, Nebraska).
The intensity of AHR and p23 protein bands was quantified relative to the signals obtained for β-
actin protein.
2.2.4. Reverse transcription-quantitative PCR
After incubation with BaP (5 µM) and CSC (5, 10, or 50 µg/ml) for 6 hr, total cellular
RNA was isolated from HBTE cells transfected with scramble or p23KD shRNA using Direct
zol kit according to the manufacturer’s instruction. The concentration of RNA was determined
by measuring the absorbance at 260nm (260/280 > 1.8) using a Nanodrop Lite
spectrophotometer (Thermo Fisher Scientific Inc., Waltham, Massachusetts). Then, the first-
strand cDNA was synthesized using Epicentre MMLV reverse transcription kit. Quantitative
analysis of AHR target genes expression was performed by cDNA amplification using a Bio-Rad
37
CFX Connect real-time PCR system as described previously [87]. The fold changes of gene
transcript levels between treated and untreated cells were normalized by the housekeeping gene
18S. The PCR data were analyzed using ΔΔCT methods [88] by the following equation: fold
change = 2−Δ(ΔCT
), where ΔCT = CT(target) - CT(18S) and ΔΔCT = ΔCT(treated) - ΔCT(untreated).
2.2.5. Ethoxyresorufin O-deethylase (EROD) assay
We performed the EROD assay to determine the CYP1A1 enzyme activity. HBTE cells
were transiently transfected in 12-well plate for 66 hr, then the cells were maintained with BaP
(5 µM) and CSC (5, 10, or 50 µg/ml) for an additional 6 hr. Thereafter, the cells were washed
once with 0.5 ml of PBS, followed by incubation with 0.5 ml of fresh media supplemented with
2.5 µM 7-ethoxyresorufin and 10 µM dicumarol. After 1-h incubation in 37℃, 100 µl of the
supernatant was transferred from each well into a 96-well black plate and formation of resorufin
was measured by fluorescence using a Molecular Devices Softmax spectrophotometer (excitation
at 544 nm, emission at 590 nm). The relative EROD activity was calculated by subtracting the
sample fluorescence with the background fluorescence in which the media contained the same
ingredients in the absence of cells.
2.2.6. Reactive oxygen species assay
We determined the oxidative stress status of HBTE cells by quantifying the amount of
superoxide present using a Muse cell analyzer according to the manufacturer’s instruction (EMD
Millipore, Billerica, California). Briefly, HBTE cells were transiently transfected in 12-well
plate for 64 h, then CSC (5, 10, or 50 µg/ml) and BaP (5 µM) were added into the medium for
additional 8-h incubation. Cells were then resuspended in 1× Assay Buffer at a concentration of
106/ml and stained with the dihydroethidium-based reagent for 30 min at 37℃. Intracellular
ROS contents were subsequently read by the instrument.
38
2.2.7. PCR array on reactive oxygen species gene expression
Transfected HBTE cells were treated with BaP (5 µM) in the last 6 hr before harvest.
RNA extraction and first-strand cDNA synthesis were performed as described under reverse
transcription quantitative PCR section. Twenty micrograms of cDNA sample were mixed with
91 µl of RNase-free water. RT2 profiler PCR array was performed according to manufacturer’s
protocol (QIAGEN, Germantown, Maryland). Briefly, for each 96-well plate, PCR components
mix were prepared by mixing 102 µl of diluted cDNA synthesis sample with 1.350 ml of 2× iQ
SYBR Green Supermix as well as 1.248 ml of RNase-free water. Then 25 µl of PCR
components mixture were added into each well of the RT2 profiler PCR array. Polymerase chain
reaction was performed using the cycling conditions: hotstart at 95℃ for 10 min, 40 cycles of
95℃ for 15 s, followed by 60℃ for 1 min. Fluorescence readings were recorded at 60℃. The
ramp rate between 95℃ and 60℃ was adjusted to 1℃/s. The PCR array data were analyzed by
V4 based on the ΔΔCT method.
2.2.8. PGE2 enzyme-linked immunosorbent assay (ELISA)
We used the Cayman PGE2 ELISA kit according to the manufacturer’s recommendation
to measure the PGE2 levels in HBTE cells. In brief, HBTE cells were transiently transfected in
12-well plate for 64h with either p23-specific shRNA or scramble shRNA plasmid. After that,
cells were incubated with LPS (0.05 or 5 µg/ml) or H2O2 (800 µM) for additional 8 hr at 37℃.
A 50 µl aliquot of cell culture supernatant was subjected to PGE2 measurement. The absorbance
of each well was read at 412 nm using a BioTek Epoch microplate spectrophotometer.
2.2.9. Statistical analysis
GraphPad Prism 7 software was used to perform statistical analysis. Unpaired t-test with
multiple comparisons using the Holm-Sidak method was used for Figures 1A and 2. Two-way
39
ANOVA was used for Figure 1B whereas two-way ANOVA with Bonferroni multiple
comparisons was used for Figures 3, 4B, 5A, and 5B. One-way ANOVA with Bonferroni
multiple comparisons was used for Figure 4D. All data were means with error bars representing
the standard deviation. The number of the asterisk indicates the p-value of statistical
significance as follows: p > .05 (ns, not significant), p < .05 (*), p < .01 (**), p < .001 (***), and
p < .0001 (****).
2.3. Results
2.3.1. Transient transfection of the p23-specific shRNA reduced the p23 and AHR protein
levels in normal human lung epithelial cells
To address the effect of p23 on AHR expression in HBTE cells, we transiently
transfected a plasmid carrying the p23-specific shRNA cDNA into cells and then measured the
AHR protein levels 72 hr after transfection. Transfection of the plasmid carrying the scramble
shRNA cDNA was used as the negative control. We observed that both p23 and AHR were
down-regulated significantly to 48% and 54%, respectively, of their positive control contents
(Figure 3A). This modest p23 knockdown efficiency is expected since p23 is involved in the
RISC-mediated silencing machinery and its levels should be somewhat maintained for proper
cellular function [89]. Transfection of a plasmid carrying a GFP cDNA was used for comparison
and the results supported that knocking down of the p23 protein is responsible for the reduction
of the AHR protein levels in HBTE cells. The estimation of the AHR and p23 protein contents
using LI-COR Western blot analysis fell within the linear range of detection.
40
2.3.2. Down-regulation of p23 in normal human lung epithelial cells promoted degradation
of the AHR protein
Next, we examined whether the reduction of the AHR protein levels in p23-knockdown
HBTE cells is caused by increased AHR protein degradation. After transient transfection, we
treated HBTE cells with 40 μg/ml of CHX to inhibit general protein synthesis so that we could
compare the half-life of the AHR protein of different conditions. We observed that after 6 hr of
CHX treatment, there were 86% and 60% of AHR remaining in the scramble shRNA-transfected
and the p23-specific shRNA-transfected HBTE cells, respectively (Figure 3B). The AHR half-
life was reduced from 22 to 7.8 hr when p23 was knocked down (accelerated by 2.8-fold),
supporting that downregulation of p23 in HBTE cells increases AHR protein degradation.
Figure 3. Western blot analysis results showing that down-regulation of p23 reduced the AHR
protein levels in HBTE cells by increasing the AHR protein degradation. β-actin was the loading
control. A, Transient knockdown of p23 suppressed the AHR protein levels. NC, negative
41
(Continued) control, transient knockdown with a scramble shRNA plasmid; p23KD, transient
knockdown of p23 using a p23-specific shRNA plasmid. The graph represents means ± SD,
n=4. The p23 and AHR bands of pGFP transfected HBTE cells were controls that were
arbitrarily set as 1 in each experiment for normalization, which were 1 ± 0.455 and 1 ± 0.422
(mean ± SD), respectively. B, Transient knockdown of p23 (p23KD) increased the AHR protein
degradation. p23KD, transient knockdown of p23 using a p23-specific shRNA plasmid; NC,
negative control, transient knockdown with a scramble shRNA plasmid. The amount of AHR
protein remained after 40 μg/ml of CHX treatment (0-6 h). The graph represents means ± SD,
n=3. The AHR bands of NC and p23KD HBTE cells at time zero were set as 1, which were 1 ±
0.274 and 1 ± 0.239 (mean ± SD), respectively, to normalize the AHR amount remaining over
time in each experiment. Images on top are a representative of the Western blot image.
2.3.3. Down-regulation of p23 in normal human lung epithelial cells suppressed the ligand-
induced cyp1a1 gene expression
To address whether knockdown of p23 would suppress AHR function, we examined
whether p23-knockdown HBTE cells would exhibit reduced AHR-mediated gene transcription.
We used BaP (5 μM) and CSC (10 μg/ml) to activate AHR and measured the amount of six AHR
target gene transcripts-namely cyp1a1, cyp1a2, cyp1b1, nqo1, ugt1a1, and ahrr-in HBTE cells
transfected with either a scrambled shRNA or p23-specific shRNA plasmid. We observed that
only cyp1a1 gene transcription was consistently compromised when the p23 content was down-
regulated (Figure 4). The CSC mediated ahrr gene transcription was also reduced when p23 was
knocked down; however, the BaP-mediated ahrr gene transcription was not altered. Although an
appreciative amount of cyp1b1 gene transcription was measured when HBTE cells were treated
with either BaP or CSC, the extent of this gene transcription was not affected by the change in
p23 content. We cannot rule out the possibility that BaP and CSC affect cyp1b1 gene
transcription via an AHR independent mechanism. The remaining three AHR target genes -
namely cyp1a2, nqo1, and ugt1a1- were induced to a much lesser extent in HBTE cells and not
affected by the p23 content. It is conceivable that expression of AHR target genes is cell-
42
specific and many of them are not induced via AHR in HBTE cells. Collectively, cyp1a1 was
the most AHR responsive gene in HBTE cells and its induction was affected by the p23 content.
Figure 4. Reverse transcription-quantitative PCR results showing that suppression of the ligand-
induced AHR target gene expression in HBTE cells when p23 was down-regulated. Transcripts
of 6 AHR target genes were analyzed: cyp1a1, cyp1a2, cyp1b1, nqo1, ugt1a1, and ahrr. HBTE
cells, transfected with either scramble shRNA (NC) or p23-specific shRNA (p23KD), were
treated with either 10 μg/ml of CSC or 5 μM BaP for 6 hr. All graphs represent means ± SD,
n=4.
2.3.4. Down-regulation of p23 in normal human lung epithelial cells suppressed the
benzo[a]pyrene- and cigarette smoke condensate-induced CYP1A1 enzyme activity
To assess whether reduction of the AHR content to 54% in HBTE cells, as a result of p23
knockdown, would negatively affect the normal AHR function, we performed the EROD assay
to determine the ligand-induced CYP1A1 activity. We used BaP, which is a known AHR ligand,
and CSC, which contains BaP and other ingredients that might be AHR ligands, to activate the
AHR-dependent cyp1a1 gene expression. We observed that the EROD activities were all
43
significantly suppressed in the p23-knockdown HBTE cells when compared with the HBTE cells
transfected with a scramble shRNA plasmid (Figure 5). Specifically, down-regulation of p23 in
HBTE cells suppressed the CSC-induced (5-50 μg/ml) EROD activity to 32-45% and the BaP-
induced (5 μM) activity to 49% when compared with the values in HBTE cells with normal p23
content. It is very evident from this EROD experiment that 46% reduction of the AHR content
in HBTE cells definitely has functional implications.
Figure 5. CYP1A1 enzyme activity assay results showing that down-regulation of p23
suppressed the BaP- and CSC-induced CYP1A1 activity in HBTE cells. p23KD, transient
knockdown of p23 with a p23-specific shRNA plasmid; NC, negative control, transient
knockdown with a scramble shRNA plasmid. EROD (CYP1A1) activity from each experiment
were normalized to represent the fold increase over control by arbitrarily set the DMSO-treated
NC and p23KD HBTE cells as 1, which were 1 ± 0.405 and 1 ± 0.136 (mean ± SD), respectively.
The graph represents means ± SD, n=3.
CSC
(5g
/mL)
CSC
(10
g/m
L)
CSC
(50
g/m
L)
BaP
(5M
)0
1
2
3
4
5
6 NC
p23KD
Norm
ali
zed
ER
OD
act
ivit
y
* ***
* *
44
2.3.5. Down-regulation of p23 in normal human lung epithelial cells suppressed the
benzo[a]pyrene- or cigarette smoke condensate-mediated reactive oxygen species
production
Next, we examined whether down-regulation of p23 in HBTE cells alters the ROS
production caused by BaP or CSC. In addition to BaP, other CSC ingredients can cause ROS
production. We treated the HBTE cells transfected with either a scramble shRNA or p23-
specific shRNA plasmid with BaP (5 μM) or CSC (5-50 μg/ml) for 8 hr and then measured the
ROS levels using a Muse cell analyzer. We observed that 5 μM BaP generated ROS in about
34% of the total cell population in the scramble shRNA transfected cells and this amount of ROS
production was significantly reduced to 14% when p23 was down-regulated (Figs. 6A and 6B).
Similar trend was observed with the 10 μg/ml of CSC treatment; a reduction of ROS production
was observed from 35% to 19%, which was equal to suppression of ROS production to 54%
when p23 was downregulated. However, higher (50 μg/ml) or lower (5 μg/ml) concentration of
CSC did not show any difference in ROS production, suggesting that lower than 10 μg/ml of
CSC might not be sufficient to trigger ROS production and higher than 10 μg/ml of CSC
generated ROS via a p23 independent mechanism. When we repeated the same experiment
using Jurkat cells which lack CYP1A1 activity, we observed background amounts of ROS
formation in all conditions except 50 μg/ml of CSC, suggesting that CSC at high concentration
produced ROS via a CYP1A1 independent mechanism (Figs. 6C and 6D). Hydrogen peroxide
was used as the positive control to confirm that ROS production was feasible in Jurkat cells.
45
46
(Continued)
47
(Continued)
Figure 6. Cell analysis results showing that down-regulation of p23 suppressed the BaP- or CSC-
mediated ROS production in HBTE cells. Jurkat cells were used as a control for CYP1A1
independent ROS production. Histograms represent the amount of normal (blue/dark shade, M1)
and ROS-producing (red/light shade, M2) HBTE cells (A) and Jurkat (C) upon CSC (5-50
µg/ml) or BaP (5 μM) treatment. About 800 μM H2O2 treatment is the positive control to make
sure that ROS can be produced in Jurkat cells. DMSO was the negative control. p23KD,
transient knockdown of p23 with a p23-specific shRNA plasmid; NC, negative control, transient
knockdown with a scramble shRNA plasmid. Graph (B) represents summary of HBTE cells (A)
n = 5 whereas graph (D) represents summary of Jurkat (C) n = 3. Both graphs represent means ±
SD.
2.3.6. Treatment with benzo[a]pyrene does not alter oxidative gene expression in normal
human lung epithelial cells when p23 was downregulated
Next, we examined whether suppression of BaP-mediated ROS production by reduced
p23 content in HBTE cells (Figure 6B) could be mediated by changes in oxidative stress gene
expression. We obtained cDNA from the BaP-treated scramble shRNA transfected and p23-
knockdown HBTE cells. Knockdown of the p23 content in these cells was confirmed by LI-
COR Western blot analysis before we proceeded with the experiment. Results from the PCR
48
array study showed that there were no significant changes in 84 oxidative stress genes that were
analyzed (Table 2). Five genes - epx, prex1, gpx5, gpx6, and ttn - showed >2-fold changes;
however, the CT numbers were all beyond 30 which made them unreliable.
Table 2
Oxidative Stress Gene Expression Analysis Results Comparing BaP-Treated Scramble shRNA
Transfected HBTE Cells (Control Sample) With BaP-Treated p23-Knockdown HBTE Cells (Test
Sample)
Gene
name
Fold Up- or
Down-
Regulation (Cq)
Gene
name
Fold Up- or
Down-Regulation
(Cq)
Gene
name
Fold Up- or
Down-Regulation
(Cq)
ALB 1.34 (25.1) GSR -1.41 (25.06) PRDX2 1.10 (22.06)
ALOX12 1.00 (29.01) GSS 1.73 (23.67) PRDX3 1.09 (20.79)
AOX1 1.02 (25.81) GSTP1 1.18 (18.09) PRDX4 1.03 (21.84)
APOE 1.01 (24.64) GSTZ1 1.22 (26.47) PRDX5 1.24 (21.3)
ATOX1 1.19 (22.49) GTF2I 1.09 (21.38) PRDX6 1.15 (21.82)
BNIP3 -1.02 (21.89) HMOX1 1.26 (26.46) PREX1 9.06 (34.5)
CAT 1.14 (23.59) HSPA1A 1.05 (22.07) PRNP -1.01 (20.25)
CCL5 1.06 (25.01) KRT1 -1.18 (32.58) PTGS1 -1.07 (28.04)
CCS 1.40 (26.57) LPO -1.93 (31.03) PTGS2 -1.23 (23.31)
CYBB -2.13 (31.46) MB -1.32 (30.3) PXDN -1.17 (22.38)
CYGB -1.03 (20.72) MBL2 -1.71 (32.38) RNF7 1.18 (23.02)
DHCR24 1.07 (22) MGST3 1.06 (22.4) SCARA3 -1.56 (28.68)
DUOX1 1.10 (23.97) MPO -1.66 (32.95) VIMP 1.17 (23.53)
DUOX2 1.21 (26.04) MPV17 1.17 (24.15) SEPP1 -1.01 (26.83)
DUSP1 1.68 (23.51) MSRA -1.03 (26.52) SFTPD -1.22 (29.14)
EPHX2 1.06 (27.72) MT3 1.07 (30.39) SIRT2 1.15 (24.31)
EPX 22.23 (38.52) NCF1 1.55 (19.03) SOD1 1.14 (22.09)
FOXM1 -1.13 (28.04) NCF2 1.05 (22.76) SOD2 1.17 (21.01)
FTH1 1.17 (15.9) NOS2 -1.32 (28.19) SOD3 -1.32 (27.79)
GCLC 1.19 (22.4) NOX4 1.01 (29.22) SQSTM1 1.05 (18.74)
GCLM 1.40 (23.86) NOX5 1.09 (29.23) SRXN1 1.04 (22.67)
GPX1 1.21 (19.15) NQO1 1.47 (22.25) STK25 -1.01 (23.24)
GPX2 1.28 (22.18) NUDT1 -1.31 (27.28) TPO -1.12 (30.16)
GPX3 1.03 (22.33) OXR1 1.06 (23.81) TTN -2.62 (31.57)
GPX4 1.15 (20.56) OXSR1 -1.05 (23.74) TXN 1.22 (20.38)
GPX5 -2.26 (32.45) PDLIM1 1.08 (20.52) TXNRD1 1.32 (21.7)
GPX6 -4.13 (30.63) PNKP 1.05 (24.61) TXNRD2 -1.01 (26.37)
GPX7 -1.01 (27.51) PRDX1 1.13 (24.01) UCP2 1.46 (24.71)
49
(Continued) Note. Cells were treated with 5 µM BaP for 6 hr. The “-” symbol indicates
downregulation. Cq is the threshold cycle of control samples. When the Cq is relatively high (>
30), it indicates that the expression level of the gene is very low and unreliable.
2.3.7. Down-regulation of p23 reduced the AHR protein levels in untransformed human
MCF-10A and normal mouse Tr1 cells
Next, we examined whether down-regulation of p23 in other normal cells could reduce
AHR protein levels. We performed the transient knockdown experiment using either
untransformed human breast MCF-10A cells or mouse Tr1 cells. We observed that the p23 and
AHR protein levels were significantly reduced to 62% and 79%, respectively, when the p23-
knockdown MCF-10A cells were compared to the scramble shRNA transfected control cells
(Figure 7A). For controls, we transfected the cells with either a GFP expressing plasmid or a
scramble shRNA expressing plasmid and observed that the p23 and AHR protein levels were not
significantly altered. Expression of AHR in naïve T and Tr1 cells showed that the differentiation
was successful since we expected minimal AHR expression in naïve T cells but robust AHR
expression in Tr1 cells. As we compared the p23-knockdown and the scramble shRNA-
transfected mouse Tr1 cells, we observed that when the p23 content was downregulated to 58%
of control, the AHR protein levels were significantly reduced to 57% of control (Figure 7B).
50
Figure 7. Western blot analysis results showing that down-regulation of p23 suppressed the AHR
protein levels in MCF-10A (A) and mouse Tr1 (B) cells. β-actin was the loading control. (A)
51
(Continued) WT, wild-type untreated; pGFP, transient transfection of a GFP expressing plasmid
(pGFP2-N2); NC, negative control, transient knockdown with a scramble shRNA plasmid;
p23KD, transient knockdown of p23 with a p23-specific shRNA plasmid. β-actin was the
loading control. This graph represents means ± SD, n = 4. The p23 and AHR bands of WT were
controls that were arbitrarily set as 1, which were 1 ± 0.222 and 1 ± 0.237 (mean ± SD),
respectively, to normalize all values for each experiment as fold over control. (B) naïve T, NT,
undifferentiated T cells; Tr1, Type 1 regulatory T cells; NC, transient negative control
knockdown Tr1; p23KD, transient p23 knockdown Tr1. This graph represents means ± SD, n =
4 except naïve T, NT (n = 3). The p23 and AHR bands of Tr1 were controls that were arbitrarily
set as 1, which were 1 ± 0.317 and 1 ± 0.364 (mean ± SD), respectively, to normalize all values
for each experiment as fold over control.
2.3.8. Knockdown of p23 does not affect the PGE2 levels in human lung epithelial cells
Next, we investigated whether reduced p23 content would reduce the PGE2 levels in
HBTE cells since p23 has been shown to be a PGE2 synthase. We confirmed that the p23 levels
were indeed transiently knocked down before we proceeded with the ELISA analysis (Figure 8,
top). Results from ELISA showed no significant change of PGE2 levels with the p23 knockdown
(Figure 8, bottom). Although there was some reduction of PGE2 levels when HBTE cells were
treated with H2O2 or LPS, these changes were not observed when p23 was downregulated.
Collectively, changes of the PGE2 levels were not consistent with the PGE2 synthesis activity of
p23.
52
Figure 8. ELISA results showing the PGE2 levels in HBTE cells. HBTE cells transfected with
either p23-specific shRNA (p23KD) or scramble shRNA negative control (NC), were treated
with vehicle (water), LPS (0.05 or 5 µg/ml final concentration) or H2O2 (800 μM final
concentration). Top images are a representative of replicate data. Bottom graph represents
means ± SD, n = 3.
53
CHAPTER 3: THE ARYL HYDROCARBON RECEPTOR UNDERGOES CHAPERONE-
MEDIATED AUTOPHAGY IN TRIPLE-NEGATIVE BREAST CANCER CELLS
3.1. Introduction
Autophagy plays an important role in various normal physiological functions such as
immune responses, liver and cardiac function, aging, and responses to infection [90]. In
addition, it is implicated in disease development such as cancer, metabolic disorders, and
neurodegeneration. Autophagy can be categorized into macroautophagy, microautophagy, and
chaperone-mediated autophagy [91]. Macroautophagy generally involves sequestration of
organelles into the formation of the double-membrane structure of autophagosome, followed by
lysosomal fusion for degradation. Microautophagy involves lysosomal internalization of the
whole organelle, such as mitochondria and peroxisomes, and a region of cytosol for degradation.
Chaperone-mediated autophagy (CMA) allows selective client proteins to directly enter
lysosomes for degradation [67]. This CMA-mediated lysosomal entry requires the HSC70
chaperone to bring client proteins to the CMA receptor LAMP2A at the lysosomal membrane
[92]. This client protein-LAMP2A interaction starts the process of unfolding the client protein
before internalization into lysosomes for degradation by hydrolytic enzymes [93]. CMA client
proteins contain HSC70 interaction motif which has been mapped as a pentapeptide sequence
initially shown as KFERQ [94]. Since then, many KFERQ-like motifs have been reported which
follow the general rules of this CMA signature motif.
The aryl hydrocarbon receptor (AHR) is a ligand-activated signaling molecule essential
for a variety of cellular functions; for example, this receptor is involved in xenobiotic sensing
[95], normal physiological functions (such as liver development [96, 97], immune response [98,
99], and hematopoietic stem cell differentiation [100]), and many diseases (such as breast and
54
other cancers [43, 101, 102], cardiac disorders [60, 103], respiratory disorders [104, 105],
metabolic disorders [106, 107] and macular degeneration [108, 109]. AHR resides in the
cytoplasm as a complex containing one molecule of AHR, two molecules of HSP90, one
molecule of p23, and one molecule of XAP2 [110-112]. The canonical signaling mechanism of
this receptor is initiated by ligand binding to AHR, causing the conformational change which
reveals the nuclear localization sequence of AHR. Nuclear internalization of the AHR complex
can then occur via a pendulin-dependent mechanism [113]. Binding of ARNT to AHR
dissociates the AHR complex [19], resulting in the active transcription factor in the form of
AHR/ARNT heterodimer. Binding of this transcription factor to the DRE enhancer upregulates a
battery of target gene transcription – most notably is the cytochrome P450 genes cyp1a1, cyp1a2,
and cyp1b1[114]. Another heterodimeric complex of AHR – AHR/RelB – has been reported to
regulate different AHR-dependent gene transcription [115].
After ligand activation, AHR undergoes ubiquitination and is degraded via the 26S
proteasome as early as 1-2 hours after ligand treatment [116]. Displacement of HSP90 from
AHR in the cytoplasm by geldanamycin (GA) also causes the AHR protein degradation via the
same ubiquitin-proteasome system [117]. We observed that down-regulation of p23 promotes
the AHR protein degradation without ligand treatment [30], unveiling the potential dynamics of
AHR protein synthesis and degradation for maintaining the AHR cellular levels. However, the
mechanism responsible for the degradation of AHR without addition of an exogenous ligand is
largely uncharacterized.
Q18 is a synthetic piperazinylpyrimidine molecule which was originally designed to be a
tyrosine kinase inhibitor [118]. Although no tyrosine kinase target has been identified thus far,
Q18 causes cell death in a few cell lines, including MDA-MB-468 cells, via unclear
55
mechanisms. High throughput gene expression screening revealed that CYP1A1 was
upregulated by about 8-fold in MDA-MB-468 cells after Q18 treatment for 24 hours
(unpublished data); this observation was also confirmed in our lab (data not shown). To our
surprise, the AHR protein is rapidly degraded upon Q18 treatment. Although it is unclear how
CYP1A1 can be upregulated by Q18 while AHR expression is actually suppressed, Q18 is
nevertheless an effective tool to unveil how TNBC cells regulate the AHR protein levels without
exogeneous ligand treatment. Here we provide evidence supporting that AHR is a CMA client
protein which undergoes lysosomal degradation in TNBC cells.
3.2. Material and methods
3.2.1. Reagents
Cell lines: MDA-MB-468 cells were maintained in Advanced MEM (Gibco)
supplemented with 5% FBS (Gemini Bio), streptomycin (100μg/ml), and penicillin (100
units/ml) (Invitrogen). MDA-MB-231 cells were a gift from Dr. Jesika Faridi (University of the
Pacific) and were grown in DMEM/F12 (1:1) (Gibco) with 10% FBS, streptomycin (100μg/ml),
and penicillin (100 units/ml). MCF-7 and T47D cells were obtained from ATCC. MDA-MB-
361 cells were a gift from Dr. Xiaoling Li (University of the Pacific). Rat H4G1.1c3 stable cells
carrying a DRE-driven GFP cDNA [119] were a gift from Dr. Michael Denison (UC Davis).
Both MDA-MB-468 and T47D cells, which were used to generate most of the data in this
chapter, were authenticated by ATCC. Cells, if not specified, were grown in 10% FBS
containing HyClone DMEM (Fisher Scientific), streptomycin (100 μg/ml) and penicillin (100
units/ml). All cells were maintained as monolayer at 37 °C and 5% CO2.
Chemicals: 3-Methylcholanthrene (3MC) was purchased from Supelco Analytical. Q18
((4-(5-ethylpyrimidin-2-yl)piperazin-1-yl)(4-((quinazolin-4-ylamino)methyl)phenyl)methanone)
56
was synthesized in Wade Russu’s laboratory. Cycloheximide (CHX) was purchased from Santa
Cruz Biotechnology. MG132 was purchased from Cayman Chemical. Actinomycin D,
geldanamycin (GA), chloroquine (CQ), 6-amino-nicotinamide (6-AN), CH223191, puromycin
dihydrochloride, β-napthoflavone (βNF), HBSS, PMSF, and leupeptin were purchased from
Sigma-Aldrich. DRE (sense: TCGAGTAGATCACGCAATGGGCCCAGC and antisense:
TCGAGCTGGGCCCATTGCGTGATCTAC) with IRD700 conjugated at the 5’ end of both
strands was purchased from Integrated DNA Technology.
Plasmids: pcDNAHygro(+)LAMP2AS was a gift from Dr. Janice Blum (Addgene
plasmid #86146). pcDNA3-PRB, pCMV-ERα were gifts from Dr. Elizabeth Wilson (Addgene
plasmid #89130 and #101141, respectively). Lentiviral pLKO.1 plasmid carrying the human
PR-B specific shRNA (RHS4533-EG5241, NM_000926.4) was purchased from Dharmacon.
The pLKO.1 scramble shRNA plasmid was purchased from Addgene. The codon humanized
pGFP2-N2 plasmid was purchased from BioSignal Packard. The pGFP2-AHR plasmid was
generated by cloning the full length human AHR cDNA sequence upstream to the GFP cDNA at
EcoRV site of pGFP2-N2. All cloned plasmids were sequenced to confirm the identity
(Functional Biosciences). Purified plasmid was generated using the Zymopure maxiprep kit
(Zymo Research).
Antibodies: Anti-AHR (SA210) polyclonal rabbit IgG was purchased from Enzo Life
Sciences. Mouse monoclonal anti-LAMP2 (H4B4, sc-18822), mouse monoclonal anti-PR (B-30,
sc-811), mouse monoclonal anti-GFP (B-2, sc-9996 AF790), and mouse monoclonal anti-ERα
(F-10, sc-8002) antibodies were purchased from Santa Cruz. Rabbit anti-GAPDH polyclonal
IgG was purchased from Sigma-Aldrich. Anti-β-actin monoclonal mouse IgG was purchased
57
from Ambion. All secondary donkey antibodies conjugated with IRDye 800CW or 680RD were
purchased from LI-COR Bioscience.
3.2.2. Western blot analysis
Western blot analysis was performed as described previously [120]. In brief, whole cell
lysates were prepared by three cycles of freeze/thaw followed by incubation on ice for 30 min in
HEDG buffer (25 mM HEPES, pH 7.4, 1 mM EDTA, 1 mM DTT, 10% glycerol) containing 0.4
M KCl, 1 mM PMSF, and 2 µg/ml of leupeptin, followed by centrifugation (16,000 × g for 10
min at 4 °C). BCA protein assay (Thermal Fisher) was used to determine protein content.
Typically, 60 μg of lysates were used for Western blot analysis. Results were analyzed using a
LI-COR CLx Odyssey imager. The intensity of target proteins was normalized with β-actin or
the total protein using Revert total protein stain (LI-COR). Dilutions of antibodies were as
follows: anti-AHR SA210, 1:4000; anti-LAMP2 H4B4, 1:200; anti-PR-B B-30, 1:200; anti-GFP
B-2-AF790 conjugate, 1:200; anti-ERα F10, 1:200; anti-GAPDH G9545, 1:5000; anti-β-actin
AM4302, 1:5000; all donkey secondary antibodies, 1:10,000.
3.2.3. Reverse transcription-quantitative PCR
RNA was extracted from cells using Direct-zol RNA kit (Zymo Research). cDNA
synthesis was performed using MMLV high performance reverse transcriptase (Epicentre). RT-
qPCR was performed using a Bio-Rad CFX Connect real-time PCR system as described
previously [120]. All primers used were as follows: cyp1a1 (forward: 5’-
GGCCACATCCGGGACATCACAGA -3’ and reverse: 5’-
TGGGGATGGTGAAGGGGACGAA -3’), ahr (forward:5’- ACATCACCTACGCCAGTCGC -
3’ and reverse: 5’- TCTATGCCGCTTGGAAGGAT -3’), 18S (forward: 5’-
CGCCCCCTCGATGCTCTTAG -3’ and reverse: 5’- CGGCGGGTCATGGGAATAAC -3’)
58
(Invitrogen). The fold changes of gene transcript levels between treated and untreated cells were
normalized by 18S using the 2-Cq method [88].
3.2.4. Generation of lentivirus-mediated stable knockdown cells
Lentivirus-mediated delivery of shRNA was performed as described previously [30].
PR-B-specific lenti shRNA or scramble shRNA pLKO.1 plasmid was transfected into AD293
cells with the viral envelope plasmid (pCMV-VSV-G) and the packaging plasmid (pCMV-dR8.2
dvpr) using Endofectin transfection reagent (Genecopoeia) to allow packaging and amplification
of the lentivirus. T47D cells were infected with the viral particles (0.5 ml) in the presence of 8
μg/ml of polybrene for 24 hours. Puromycin (4 μg/ml) was used to select for stable cells with
PR-B knockdown. Cells were analyzed by Western blot analysis on the seventh day after
infection.
3.2.5. Transient transfection
Transient transfection was processed using EcoTransfect transfection reagent (Oz
Biosciences) following the manufacturer’s instruction. Briefly, MDA-MB-468 cells were plated
at a density of 105 cells per well of a 6-well plate. The plasmid (4 µg) was delivered to cells by
transfection with 16 µl of EcoTransfect reagent. Cells were harvested 72 hours after
transfection.
3.2.6. Co-immunoprecipitation
Protein G magnetic beads (Thermo Fisher Scientific), which had been preincubated with
co-immunoprecipitation antibody for 30 min at room temperature, were incubated with whole
cell lysates (2 mg) overnight at 4 °C with rotation. Protein G beads were then washed with the
buffer (HEDG containing 150 mM NaCl and 0.1 % Tween-20) three times at 4 °C. Western blot
analysis was performed to visualize the results.
59
3.2.7. Proximity ligation assay
Proximity ligation assay was performed according to the protocol of Duolink Reagents
Red (Sigma-Aldrich). Briefly, cells were fixed on glass slides and permeabilized using cold
methanol and then incubated with corresponding rabbit and mouse antibodies for 1 hour at
37 °C. Anti-rabbit PLUS and anti-mouse MINUS probes were added and incubated for 1 hour at
37 °C. Ligation (1:40 dilution, 30 min at 37 °C) and polymerization (1:80 dilution, 100 min at
37 °C) were then performed successively. Slides were then mounted before imaging with DAPI
for 2 min at room temperature. Fluorescence images were acquired using a Keyence BZ-X700
fluorescence microscope.
3.2.8. Site-directed mutagenesis
pGFP2-AHR E559A/F561A and E559A/F561L mutants were created using QuikChange
lightning site-directed mutagenesis kit according to the manufacturer’s protocol (Stratagene).
Mutant strand was amplified by PCR reaction containing 10 ng of template DNA (pGFP2-AHR)
and 125 ng of each primer (Forward: 5’-
GACATCAGACACATGCAGAATGCAAAAGCTTTCAGAAATGATTTTTCTGGTGAGG -
3’, Reverse: 5’-
CCTCACCAGAAAAATCATTTCTGAAAGCTTTTGCATTCTGCATGTGTCTGATGTC -3’).
XL10-Gold ultracompetent cells were used for transformation. Originally E559A/F561A was
designed but DNA sequencing results confirmed that we had both E559A/F561A and
E559A/F561L mutants.
3.2.9. Gel shift assay
Pichia expressed human AHR and ARNT were used to form the ligand-dependent AHR
gel shift complex as described previously [121] with modification. In brief, 6His-AHR and
60
6His-ARNT expressed in 9 ml and 2 ml of Pichia culture, respectively, were enriched by metal
affinity purification into 0.75 ml of HEDG except 50% glycerol. 6His-human p23 from 600 ml
of bacterial culture was likewise enriched into 1.5 ml of PBS and was used to promote the
formation of the AHR gel shift complex [85]. AHR gel shift complex was formed by adding the
AHR ligand NF (10 M) into AHR (2 l), ARNT (0.5 l) and p23 (1 l), followed by addition
of dIdC (3 g) and DRE-IRD700 (0.5 pmol). A LI-COR CLx imager was used to visualize the
results when electrophoresis was complete.
3.2.10. Statistical analysis
All data are reported as mean ± SD and analyzed using Prism GraphPad version 8.
Statistical analysis was determined by one-way or two-way ANOVA with multiple comparisons,
or Student’s t test. The number of asterisk indicates the p value of statistical significance as
follows: p > 0.05 (ns, not significant), p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p <
0.0001 (****).
3.3. Results
3.3.1. Suppression of the AHR protein levels in triple-negative, but not in non-triple-
negative, breast cancer cells by Q18
We treated two TNBC and two non-TNBC cells with 10 µM Q18 for various time period
to determine its effect on the AHR protein levels. We observed that AHR protein levels were
significantly suppressed after Q18 treatment by 50% as early as 2 and 24 hours, respectively, in
triple-negative MDA-MB-468 and MDA-MB-231 cells (Fig 9A). This suppression was not
observed in non-triple-negative MCF-7 cells within a 24-hour treatment period (Fig. 9B, left).
Although we observed 50% suppression of the AHR protein levels by Q18 in non-triple-negative
MDA-MB-361 cells, the effect was transient – the AHR levels were reverted to normal in 4
61
hours (Fig. 9B, right). Collectively, the AHR protein levels were uniquely suppressed by Q18 in
triple-negative breast cancer cell lines.
62
(Continued)
Figure 9. Western blot analysis of the AHR protein levels in TNBC and non-TNBC cells after
Q18 treatment. (A) MDA-MB-468 and MDA-MB-231 (TNBC). (B) MCF-7 and MDA-MB-
361 (non-TNBC). Cells were treated with 10 M Q18 or DMSO (vehicle) for the indicated
times. All lanes contain 60 g of whole cell lysates. The amount of AHR were normalized by
-actin. The normalized value of AHR from Q18 treatment was divided by the normalized value
from DMSO treatment to calculate the relative abundance of AHR at each timepoint. Y-axis
represents the fold difference of Q18 over DMSO at each timepoint. Results are means ± SD of
three independent experiments. One-way ANOVA with Dunnett’s multiple comparisons test
was used to determine statistical significance. **p < 0.01, ***p < 0.001, ****p < 0.0001 compared
with zero timepoint in MDA-MB-468 and MDA-MB-231 cells. MCF-7 and MDA-MB-361 data
were all statistically insignificant when compared with the zero timepoint.
3.3.2. Degradation of AHR in triple-negative breast cancer cells is dependent on
progesterone receptor but not estrogen receptor
Since TNBC cells do not express ERα and PR-B, we performed transient transfection
experiments to alter the cellular ERα or PR-B levels in an effort to address whether Q18
suppression of the AHR protein levels is ERα or PR-B dependent. We observed that down-
63
regulation of the PR-B levels in PR-B positive T47D cells using the PR-B-specific shRNA
sensitized the Q18 suppression of the AHR protein levels (Fig. 10A), supporting that the absence
of PR-B in MDA-MB-468 cells allows the downregulation of AHR by Q18 to occur.
Conversely, exogenous expression of ERα in MDA-MB-468 cells had no effect on the Q18-
mediated AHR protein degradation (Fig. 10B), ruling out the involvement of ERα in this Q18
effect. Although it was very evident that Q18 failed to alter the AHR protein levels in MDA-
MB-468 cells after transient transfection of a PR-B expressing plasmid (Fig. 10C, left), we were
unable to detect any exogenous PR-B expression by Western blot analysis after transfection (data
not shown). The transfected pr-b message levels were at a very low level, as reflected by a Cq
number beyond 30 (Fig. 10C, right). However, the endogenous pr-b message levels were
consistently two orders of magnitude lower than the transfected levels at 24 hours after
transfection. It is conceivable that very small amounts of PR-B expression in MDA-MB-468
cells would be sufficient to suppress the Q-18-mediated AHR degradation.
64
65
(Continued)
Figure 10. Effect of PR-B and ERα on the Q18-mediated suppression of the AHR protein levels.
Time-course Q18 treatment of: (A) T47D stable cells carrying either PR-B specific shRNA or
scramble shRNA. AHR at zero time was arbitrarily set to one for comparison. (B) MDA-MB-
468 cells transiently transfected with the plasmid carrying the full length ERα cDNA (pCMV-
ERα). Control represents non-transfected cells. (C, left panel) MDA-MB-468 cells transiently
transfected with the plasmid carrying the full length PR-B cDNA (pcDNA3-PR-B) or the
pcDNA3 plasmid which was derived from pcDNA-PR-B after Srf I and Eco RV digest to remove
75% of PR-B cDNA (control). All lanes for Western blot analysis contain 60 g of whole cell
lysates. All Western blot (A-C) data of AHR were normalized by total protein stain. All results
are means ± SD of three independent experiments. Two-way ANOVA with Sidak’s multiple
comparisons test was used in 2A for statistical analysis. *p < 0.05, ***p < 0.001 when compared
between PR-B shRNA and scramble shRNA. Unpaired t test was used in 2B and 2C for
statistical analysis. *p < 0.05 when compared to control. The pr-b message levels were
determined by RT-qPCR 24 or 48 h post-transfection, normalized by 18S (C, right panel). Cq of
pr-b message 24 h post transfection were 32-33 whereas 48 h post transfection were 35-36. The
Cq of pr-b message in untransfected cells were all above 39. Y-axis represents fold increase of
pr-b messages of PR-B transfected over empty plasmid transfected. Although the PR-B
transfected cells consistent showed more pr-b message, all Cq numbers were beyond 30,
showing that the amount of all pr-b messages were all very low so that no statistics was
performed.
66
3.3.3. Q18 is an AHR antagonist
Next, we addressed whether Q18 could act as an AHR ligand and in turn cause AHR
protein degradation. We treated the rat H4G1.1c3 cells which were stably transfected with a
plasmid carrying a DRE-driven GFP cDNA with 1 M Q18 – 10-fold less concentration than
what was used for the MDA-MB-468 cell study since 10 M caused significant H4G1.1c3 cell
death (data not shown). We detected minimal GFP expression when comparing with treatment
of an AHR ligand 3MC at 1 M concentration for 12 hours, suggesting that Q18 is not an AHR
ligand and cannot activate the DRE-driven gene transcription (Fig. 11A, top panel). When we
pre-treated the cells with 1 M Q18 two hours before the 1 M 3MC treatment, we observed that
there was noticeable reduction in GFP fluorescence in the presence of Q18, suggesting that Q18
acted as an AHR antagonist, analogous to the AHR antagonist CH223191 (Fig. 11B, middle and
bottom panels). Q18 did not cause degradation of AHR in H4G1.1c3 cells, suggesting that lack
of the GFP expression in the presence of Q18 in H4G1.1c3 cells is not due to a lesser amount of
AHR (data not shown). Next, we examined whether Q18 could cause the ligand-dependent AHR
gel shift formation. We used the Pichia expressed human AHR and ARNT [121] to form the
AHR gel shift complex, which was βNF-, AHR- and ARNT-dependent (Fig. 11B, lanes 1-4).
Co-chaperone p23 was used to promote the gel shift formation. We observed that unlike an
AHR ligand βNF, Q18 was not able to generate the AHR gel shift complex at 10 µM
concentration (Fig. 11B, lane 12), consistent with our rat H4G1.1c3 cell study that Q18 is not an
AHR ligand. Q18 could, however, inhibit the formation of the βNF-dependent AHR gel shift
complex at 50 M concentration, although higher concentration did not show more inhibition
(Fig. 11B, lanes 8-10). The AHR antagonist CH223191 was used as the control to show the
concentration-dependent inhibition of the βNF-dependent AHR gel shift complex formation (Fig.
67
11B, lanes 5-7). Collectively, data from DRE-driven GFP expression and gel shift studies
supported that Q18 is an AHR antagonist which competes with an AHR ligand in binding to the
ligand binding domain of AHR.
68
(Continued)
Figure 11. Effect of Q18 on AHR ligand binding. (A) Treatment of Q18, CH223191 and 3MC
in rat H4G1.1c3 cells stably transfected with a plasmid carrying a DRE-driven GFP cDNA (left
top diagram). Cells were treated for 12-14 hours (as indicated in the right top timeline diagram)
with DMSO, 1 M 3MC, 1 M Q18, 10 M CH223191, 1 M 3MC plus 1 M Q18, or 1 M
3MC plus 10 M CH223191. Q18 could not cause GFP formation but could block the GFP
formation caused by 3MC. CH223191 was used as the AHR antagonist control. Top panel
represents one experiment; middle and bottom panels represent another experiment. These two
experiments were repeated two more times with similar results. (B) Effect of Q18 on the
formation of the AHR/ARNT/DRE gel shift complex. Gel shift complex was formed in the
presence of 10 M NF as the AHR ligand (lanes 1-4). 10 M Q18 could not form the AHR gel
shift complex but could suppress the NF-dependent AHR gel shift formation at 50 M
concentration (lanes 8-10 and 12). CH223191 (CH) was used as the AHR antagonist control
(lanes 5-7 and 11). Arrows indicate the AHR/ARNT/DRE gel shift complex and free DRE
conjugated with IRD700 (free probe). This gel shift experiment was repeated once with similar
results.
69
3.3.4. Q18 promotes the autophagy-mediated AHR protein degradation and does not affect
the AHR transcript levels
Next we investigated whether the suppression of the AHR protein levels by Q18 is
caused by reduction of the AHR transcript and/or promotion of the AHR protein degradation.
We observed that there was no statistically significant difference in the AHR transcript levels in
the presence of 10 µM Q18 for up to 24 hours (Fig. 12A, left). We performed actinomycin D
experiment to determine whether Q18 could increase the degradation of the AHR transcript in
MDA-MB-468 cells. We observed that the AHR transcript levels were not altered by Q18 when
transcription was inhibited by actinomycin D (Fig. 12A, right), suggesting that suppression of the
AHR protein levels by Q18 does not involve transcriptional and RNA stability control. Next we
measured the AHR protein half-life in MDA-MB-468 cells when protein synthesis was inhibited
by 30 µg/ml of cycloheximide. We observed that AHR protein was degraded significantly faster
in the presence of Q18 (Fig. 12B), supporting that Q18 triggers AHR protein degradation. This
Q18-dependent AHR protein degradation was not affected by the proteasome inhibitor MG132
since the presence of MG132 did not significantly change the AHR protein half-life (Fig. 12C),
suggesting that proteasomal degradation is not involved in the Q18-mediated AHR degradation.
On the contrary, degradation of the AHR protein by Q18 was retarded significantly in the
presence of the autophagy inhibitor chloroquine (Fig. 12D).
70
71
(Continued)
Figure 12. Effect of Q18 on AHR gene transcription, message stability, and protein stability in
MDA-MB-468 cells. (A) The ahr message levels were measured after 10 M Q18 or DMSO
(vehicle) treatment for 0-24 h (left). The half-life of the ahr message was determined in the
presence of 5 g/ml of actinomycin D (Act D) or DMSO (vehicle) with or without 10 M Q18
treatment (right). The relative ahr mRNA levels were determined using 18S and DMSO vehicle
control (2-Cq method). One-way ANOVA with Dunnett’s multiple comparisons test was used
in analyzing Q18 treatment data (left). Unpaired t test was used in analyzing Act D +/- Q18
treatment data (right). Results are means ± SD of: (left) n = 6 for zero, 4-hour, and 8-hour
timepoints; n = 3 for 2-hour and 24-hour timepoints; (right) n = 3. n represents number of
independent experiments. All data were statistically insignificant. (B) The AHR protein half-life
was determined in the presence of 30 g/ml of cycloheximide (CHX) with or without 10 M
Q18 treatment. The images are representative of the data. Two-way ANOVA with Tukey’s
multiple comparisons test was used for the statistical analysis. ****p < 0.0001 showed that there is
a significant difference of AHR protein levels in CHX treated cells versus CHX plus Q18 treated
cells. (C) same as (B) +/- 10 M MG132. Results are means ± SD of seven independent
experiments. Two-way ANOVA with Turkey’s multiple comparisons test was used for statistical
analysis. There is no difference of AHR degradation in CHX plus Q18 group vs. CHX plus Q18
plus MG132 group (p = 0.4582). (D) same as (B) +/- 20 M chloroquine (CQ). Results are
means ± SD of: n = 3 for DMSO group; n = 4 for CHX plus Q18 and CHX plus Q18 plus CQ
group. n represents number of independent experiments. Two-way ANOVA with Tukey’s
multiple comparisons test was used in statistical analysis. ***p < 0.001 compared between CHX
plus Q18 and CHX plus Q18 plus CQ treated cells.
72
3.3.5. Degradation of AHR in triple-negative breast cancer cells is LAMP2A-mediated
Since chloroquine blocked the Q18-mediated AHR protein degradation, we investigated
whether LAMP2A, an essential protein responsible for importing client protein into lysosomes
for CMA [122], is involved in the degradation of AHR. We used a LAMP2 antibody from Santa
Cruz Biotechnology (H4B4, sc-18822) which detects LAMP2A in a broad region. This antibody
has been used by other researchers to detect LAMP2A expression [123]. We observed that
LAMP2A could be down-regulated in MDA-MB-468 cells via transient transfection of a plasmid
carrying the LAMP2A-specific antisense cDNA. When the LAMP2A expression was
suppressed in MDA-MB-468 cells, degradation of the AHR protein was significantly reversed at
4 and 8 hours after Q18 treatment from 11-13% to 46-55% remaining (Fig. 13A). The amount of
the LAMP2A protein increased after 8 hours of Q18 treatment while AHR was substantially
reduced, suggesting that Q18 may upregulate LAMP2A, leading to AHR degradation. Next we
addressed whether the accumulated LAMP2A could interact with AHR. We performed co-
immunoprecipitation experiment and observed that AHR was co-precipitated with LAMP2 and
vice versa in a time-dependent manner in the presence of Q18 (Fig. 13B). In addition, activation
of CMA by 6-AN or starvation (via HBSS treatment) also upregulated LAMP2A expression and
degraded AHR in MDA-MB-468 cells, although the timing of the AHR suppression varied
between these two treatments (Fig. 13C). However, reduction of the AHR levels by GA, a
reported CMA activator, did not show any noticeable difference in the LAMP2A protein levels.
Results from the co-immunoprecipitation experiment after 24 h treatment of 6-AN showed that
AHR interacted with LAMP2A and CQ could significantly block the 6-AN-dependent AHR
degradation in the cycloheximide experiment (Fig. 13D). AHR might be partially degraded by
73
26S proteasome after 6-AN treatment since MG132 was able to reverse some of the AHR
degradation but this effect was not statistically significant (Fig. 13D). On the contrary, treatment
of MDA-MB-468 cells with GA showed more pronounced degradation of AHR, which was not
reversed by either CQ or MG132 (Fig. 13E).
3.3.6. Treatment of Q18, 6-AN or starvation in MDA-MB-468 cells causes interaction
between AHR and LAMP2A in proximity ligation assay
Next we examined whether activation of CMA in MDA-MB-468 cells could induce the
AHR-LAMP2A interaction in proximity ligation assay. GAPDH, which is a CMA client protein
[124], was used as the positive control to show the interaction between LAMP2A and client
protein during CMA. Treatment of Q18 increased the interaction between GAPDH and
LAMP2A, supporting that Q18 triggered CMA in MDA-MB-468 cells after 8 hours of treatment
(Fig. 13F). Likewise, interaction between AHR and LAMP2A was noticeably increased up to 8
hours of Q18 treatment. Other means of CMA activation by either 6-AN or starvation also
showed a clear increase of the AHR-LAMP2A interaction at 24 and 48 hours, respectively (Fig.
13G). CMA activation by 6-AN and starvation was confirmed using the GADPH control.
However, we failed to detect any interaction between AHR and LAMP2A when MDA-MB-468
cells were treated with 1 g/ml of GA for 24 hours (Fig. 13H).
3.3.7. Treatment of Q18 increases the LAMP2 expression in TNBC but not in non-TNBC
cells
Next we examined whether the LAMP2A expression could be upregulated by Q18 to
cause AHR degradation. We observed that Q18 treatment of up to 48 hours increased the
LAMP2A expression in TNBC (MDA-MB-468 and MDA-MB231) but not in non-TNBC (MCF-
74
7 and T47D) cells (Fig. 13I). PR-B expression was observed in non-TNBC but not in TNBC
cells.
75
(Continued)
76
(Continued)
77
(Continued)
78
(Continued)
Figure 13. Effect of the LAMP2A-mediated CMA on AHR degradation. (A) MDA-MB-468
cells were transiently transfected with either empty plasmid pcDNAHydro(+) or
pcDNAHydro(+) LAMP2AS carrying the LAMP2-specific antisense and treated with 10 M
Q18 for 0-8 hours. Zero timepoints were arbitrarily set as 1 to normalize the AHR amount
remaining at 4 and 8 hours. Y-axis represents the amount of AHR remaining. Results are means
± SD of three independent experiments. Unpaired t test was used for statistical analysis. *p <
0.05 when compared the AHR levels of LAMP2A knockdown with empty plasmid transfected
cells. The amount of AHR was normalized by total protein stain whereas each lane contained 60
g of protein loaded. (B) MDA-MB-468 cells were treated with 10 μM Q18 for 0, 4, or 8 hours,
followed by immunoprecipitation of 2 mg of whole cell lysates with either AHR or LAMP2
antibody. IP represents the antibody used to do the immunoprecipitation whereas WB represents
Western blot analysis of protein shown. Input represents 0.5% of sample to start the experiment.
(C) 10 μM 6-AN, HBSS (mimic starvation), or 1 μg/ml GA was added to MDA-MB-468 cells
for 0, 24 or 48 hours (0 or 24 hours for GA treatment). Results are means ± SD of three
independent experiments. The amount of AHR and LAMP2A was normalized by total protein
stain whereas each lane contained 60 g of protein loaded. One-way ANOVA with Dunnet’s
79
(Continued) multiple comparisons test (6-AN and HBSS treatment) and unpaired t test (GA
treatment) were used for statistical analysis. *p < 0.05, **p < 0.01 when compared to zero
timepoint. (D) MDA-MB-468 cells were treated with 10 μM 6-AN for 0 or 24 hours, followed
by immunoprecipitation with AHR antibody (IP) and Western detection of LAMP2 (WB) (left,
bottom). Weak but detectable amount of LAMP2A was observed after 24 hours of 6-AN
treatment. Input represents 0.5% of sample used to start the experiment. MDA-MB-468 cells
was treated with 10 μM 6-AN for 24 hours. In the last 8 hours before harvest, CHX (30 μg/ml),
MG132 (10 μM) or CQ (20 μM) were added to the cells (right, top left with timeline diagram).
Results are means ± SD of three independent experiments. One-way ANOVA with Tukey’s
multiple comparisons test was used for statistical analysis. *p < 0.05 when compared CHX
group with 6-AN + CHX group and 6-AN + CHX group with CHX + 6-AN + CQ group.
Difference between 6-AN + CHX group and 6-AN + CHX + MG132 group is not significant.
(E) MDA-MB-468 cells were treated with 1 μg/ml of GA for 24 hours (see timeline diagram, top
right). CHX (30 μg/ml), MG132 (10 μM) or CQ (20 μM) were added to cells in the last 8 hours.
Results are means ± SD of three independent experiments. One-way ANOVA with Tukey’s
multiple comparisons test was used for statistical analysis. The amount of AHR was normalized
by total protein stain whereas each lane contained 60 g of protein loaded. (F-H) Interaction
between AHR and LAMP2A, GAPDH and LAMP2A were tested in MDA-MB-468 cells in situ
followed by 10 μM Q18, 10 μM 6-AN, HBSS or 1 μg/ml of GA treatment for a period of time.
Proximity ligation assay signals were shown as red fluorescent spots around the nucleus (blue).
Negative control (NC) was performed without antibodies. Each panel represents either GAPDH-
LAMP2A interaction (GAPDH:LAMP2A) or AHR-LAMP2A interaction (AHR:LAMP2A).
GAPDH was used as the positive control. AHR-LAMP2A interaction was detected in Q18, 6-
AN and HBSS treatments but not in GA treatment. This experiment was repeated twice with
similar results. (I) MDA-MB-468, MDA-MB-231, MCF-7 and T47D cells were treated with 10
M Q18 or DMSO (vehicle) for 0-48 hours. Western blot analysis was performed to detect
AHR, LAMP2 and PR-B levels. Each lane contained 60 g of protein loaded. This experiment
was repeated once with similar results.
3.3.8. AHR contains a CMA signature motif
AHR contains three putative sequences – QKTVK, QDVIN, and NEKFF – that follow
the general requirement of a CMV signature motif (Fig. 14A). When we transiently expressed
the GFP fusion of the full length human AHR in MDA-MB-468 cells, we observed that the GFP-
AHR fusion was degraded significantly within six hours of the Q18 treatment (Fig. 14B),
validating that the GFP fusion of AHR has the same fate as the endogenous AHR when treated
with Q18. However, when we monitored the levels of the GFP fusion of an AHR construct
(amino acid 1-295 of human AHR, C∆553) which contains two out of the three putative
80
signature motifs, we observed that it remained stable up to 8 hours of Q18 treatment in MDA-
MB-468 cells (Fig. 14C), suggesting that the two putative motifs close to the bHLH domain are
not used to trigger AHR degradation. Next we generated GFP-AHR mutants E559A/F561A and
E559A/F561L which changed the NEKFF motif into NAKAF and NAKLF, respectively. After
transient transfection, we observed that both mutants were statistically more resistant from
degradation up to 24 hours when compared to GFP-AHR, supporting that this motif is a KFERQ-
like motif that is recognized to undergo CMA (Fig. 14D).
81
(Continued)
82
(Continued)
Figure 14. Identification of CMA motif of human AHR. (A) schematic of human AHR (hAHR)
and AHR construct C553 indicating the location of the three putative CMA motifs: QKTVK,
QDVIN, and NEKFF. (B) MDA-MB-468 cells were transiently transfected with pGFP2-N2-
AHR. Cells were then treated with 10 μM Q18 for 0-6 hours. Results are means ± SD of three
independent experiments. One-way ANOVA with Dunnett’s multiple comparisons test (bar
graph) and two-way ANOVA with Sidak’s multiple comparisons test (line graph) were used for
statistical analysis. *p < 0.05, **p < 0.01 and ***p < 0.001 when compared with zero timepoint.
There is no difference between GFP-AHR and endogenous AHR degradation. Bottom diagram
and top left images show degradation of the transfected GFP-AHR upon Q18 treatment in MDA-
MB-468 cells. The amount of AHR and GFP-AHR was normalized by total protein stain
whereas each lane contained 60 g of protein loaded. (C) MDA-MB-468 cells were transiently
transfected with pEGFP-C2-C∆553 or pEGFP-C2 plasmid (empty vector, EV). Cells were
treated with 10 M Q18 or DMSO (vehicle) for 0-8 hours. Results are means ± SD of three
independent experiments. Unpaired t test was used for statistical analysis. There is no
difference between Q18 and vehicle treatment. EGFP-C553 was stable in the presence of Q18
for up to 8 hours. (D) MDA-MB-468 cells were transiently transfected with pGFP2-N2-AHR
(NEKFF), pGFP2-N2-AHRE559A/F561A (NAKAF) or pGFP2-N2-AHRE559A/F561L (NAKLF) and then
treated with 10 μM Q18 for 0, 8, or 24 hours. Both NAKAF and NAKLF mutants were
statistically more stable than GFP-AHR with NEKFF in the presence of Q18. Results are means
± SD (with error bars of above half only) of five independent experiments. The table represents
the mean values ± SD with zero timepoints set as one for comparison. Two-way ANOVA with
83
(Continued) Turkey’s multiple comparisons test was used for statistical analysis. **p < 0.01 and
****p < 0.0001 when compared with pGFP2-N2-AHR transfected cells.
84
CHAPTER 4: DISCUSSION
p23 has been shown to have multiple regulatory mechanisms affecting AHR signaling. In
yeast system, human p23 facilitates AHR signaling [125]. Expression of SBA1 (yeast p23) in a
Hsp90 mutant strain restores AHR signaling to the wild-type level [126]. p23 overexpressed
transgenic mice develop hydronephrosis with upregulated AHR signaling pathway [127]. Our
previous study using human and mouse cancer cells showed that endogenous p23 is required in
maintaining AHR protein levels in the absence of exogeneous ligands [30]. p23 protects the
AHR from degradation in a 26S proteasome-independent way and does not need HSP90 in
stabilizing the AHR [32]. Previous studies have highlighted the dispensable role of p23 as an
AHR modulator. In their study, AHR still expressed and worked normally in the p23
heterozygous adults and null embryos [86]. Therefore, in our current study, we knocked down
p23 in normal human and mouse cells to study the modulation of p23 on the AHR under normal
condition. The normal human bronchial/trachea cells showed reduction of AHR proteins when
p23 proteins were knocked down, and the reduction is due to elevated protein degradation. This
effect was reproducible in non-tumorigenic human breast epithelial MCF-10A cells and mouse
immune Tr1 cells, which is consistent with what we observed in tumorigenic cells. The
aforementioned opposite observations indicate that there might be potential p23 compensatory
mechanisms in maintaining AHR protein levels in animal models which are lacking in cultured
cells in vitro.
To further track whether p23 knockdown would interfere with AHR signaling, we
introduced AHR ligand BaP, a key component of cigarette smoke and an AHR ligand, and CSC,
which contains a mixture of metals, free radicals and PAHs, to induce AHR target genes in the
85
HBTE cells with different p23 genetic background. Downregulation of p23 abolished the ligand-
induced CYP1A1 enzyme activity by detecting the conversion of 7-ethoxyresorufin to
fluorescent resorufin, which is consistent with the impaired cyp1a1 induction in the p23KD cells.
BaP induced ROS has been reported to strongly depend on the AHR signaling pathway
by knockdown analysis [128]. It is well studied that during the metabolism of BaP, the catechol
form of BaP is oxidized by aldo-keto reductases (AKRs) to BaP-7,8-trans-dihydrodiol which is
then subsequently auto-oxidized to BaP-7,8-dione, releasing superoxide anions [50]. In addition,
treatment of AHR ligand 3-methycholanthrene (3-MC) transactivates p40phox, which is a
regulatory factor for NADPH oxidase activity and thus contributes to the production of ROS
[129]. β-naphthoflavone-induced cyp1a1/cyp1a2 and ROS production can be attenuated by AHR
antagonist resveratrol [130]. In our study, BaP treatment served as a positive control and our
results are in agreement with the previous reports that BaP increases the intracellular ROS levels.
p23 silencing blocks the production of ROS by AHR agonists and this reduction is proven to be
p23-dependent and is not caused by the inhibition/induction of oxidant/antioxidant genes.
Cigarette smoking is a pathological factor in various lung disease including chronic
obstructive pulmonary disease (COPD) and lung cancer. Long-term exposure to cigarette smoke
causes elevated ROS production in the lung, with higher rate of lipid peroxidation and lower
antioxidant capacities [131]. Elevated ROS levels is associated with the production of
inflammatory mediators, including: IL-8, IL-6, IL-1β, and PTGS2 in normal human bronchial
epithelial BEAS2B cells [132]. It has been demonstrated that AHR is involved in CS-induced
oxidative stress. Here, knockdown of p23 reduced the ROS amount in the lung epithelial cells
induced by CSC. A high dose of CSC (50μg/ml) kept ROS production at a high level and was
not affected by the downregulation of p23. The reason might due to an overdose of PAHs from
86
CSC generating ROS in an AHR-independent pathway. This argument is confirmed in the
Jurkat cells, which lack AHR/CYP1A1 axis, that a high dose of CSC also induced the production
of ROS. In contrast, AHR is also reported to have a protective role against ROS. Pulmonary
fibroblasts derived from AHR deficient mice and AHR knockout A549 cells have heightened
ROS production by CSC compared to AHR normally expressed cells. CSC treatment in AHR
deficient models repressed the expression of antioxidant genes, including srxn1 and nqo1 [133].
The inhibitory effect on srxn1 in exposure to CS is related to upregulation of miR-96 in a non-
canonical AHR pathway [134]. It is plausible that the activation of AHR can generate both
oxidant and antioxidant responses simultaneously with different kinetics. Which pathway is
predominant will depend on the AHR response to the ligands or environmental toxins that may
vary between cell lines from different anatomical regions. The respiratory epithelium represents
the main non-keratinized interface to environment, so the epithelial cells within it are susceptible
to environmental toxins and oxidant compounds. Studying the interaction between tobacco and
respiratory epithelial cells is critical to learn the lung's response to cigarette smoke and the
defense mechanism to ROS by targeting p23.
Cigarette smoking triggers lung inflammation and lung cancer is associated with the
enhanced expression of COX-2 and prostaglandins. CSC is reported to induce mPGES-1 and
COX-2 protein and increase PGE2 production in AHR-dependent mechanisms in lung fibroblasts
[135]. Antagonizing AHR signaling could inhibit CSC-induced COX-2, mPGES-1, and PGE2
production. p23 has been identified as a cytosolic prostaglandin E2 synthase (cPGES) and is
involved in the catalysis of prostaglandin endoperoxide (PGH2) to form PGE2. In our current
p23KD cell model, we did not observe any alteration on the basal PGE2 levels compared to WT
cells, suggesting that the synthesis of PGE2 might be accomplished by other PGESs in the low-
87
expressing p23 cells. To our surprise, LPS and H2O2 treatment did not cause any induction of
PGE2 in WT cells, indicating the primary pulmonary epithelial cells might be insensitive to this
inflammatory stimulus.
The AHR has been recognized as a mediator linking cigarette smoke with inflammatory
disease, like rheumatoid arthritis [136] and chronic pancreatitis. CS activates the AHR and
increases the production of IL-22 which promotes the development of pancreatitis [137]. The
mechanisms of the interaction between the AHR signaling pathway and CS-mediated
inflammation are probably multifactorial:
1. AHR ligands and free radicals from CS burning products activate AHR, which causes
an imbalance between oxidant events (e.g. production of ROS) and antioxidant events
(e.g. activation of Nrf2 signaling);
2. the AHR is involved in CS-mediated production of inflammatory mediators, like:
COX-2, PGE2 and cytokines;
3. CS-induced AHR activity affects the immune system, including: expansion of Th17
cells [138] and neutrophil infiltration [134].
Targeting the AHR signaling pathway might lead to a reduction in smoking-induced
inflammatory diseases. Our current study presents a potent, indirect but specific therapy by
targeting the AHR via p23 modulation to downregulate ROS production by cigarette smoke in
the normal lung cells.
The AHR is hyper-expressed in most malignant breast cell lines, while its overexpression
is estrogen receptor-independent, due to the roughly similar levels of AHR transcript and protein
in ER positive and negative cell lines [139, 140]. AHR expression is also associated with breast
cancer invasion. Overexpression of AHR alone is sufficient to transfer normal mammary
epithelial cells to a carcinogenic phenotype [39], and down-regulation of AHR inhibits MDA-
MB-231 cell growth and metastasis [40]. In our present study, we used the
88
piperazinylpyrimidine compound Q18, a potent growth inhibitor of MDA-MB-468 cells [118].
We observed that this compound enhanced MDA-MB-468 cell apoptosis in 24 hours. What is
more surprising is that Q18 dramatically downregulated AHR proteins in a time-dependent
manner in MDA-MB-468 cells. Unlike the biphasic effect on AHR protein levels caused by
AHR agonists, Q18 induced sustained elimination of AHR protein in TNBC cell lines and this
effect was not observed in ER+, PR+ BC cell lines.
It is widely accepted that the AHR is down-regulated rapidly by ligand-dependent
ubiquitin-proteasome system (UPS), due to the ability of proteasome inhibitor MG132 to block
ligand-mediated AHR degradation [34, 141]. To validate whether Q18 is an AHR ligand, we
used a rat hepatoma cell line with an AHR-responsive green fluorescent protein reporter gene
and identified that Q18 cannot activate AHR signaling. What’s more, cyp1a1 induction by Q18
is apparently distinct from AHR agonists treatment, by which it significantly decreased cyp1a1
message levels in 8 hours. Of note, a late induction of cyp1a1 was seen after 24 hours’
treatment, indicating the sustained induction of the AHR signaling pathway at very low level of
AHR protein. It also appeared that the AHR protein can be degraded without exogenous ligand,
similar to the HSP90 inhibitor geldanamycin, which degrades the AHR without ARNT
dimerization and DNA binding. This degradation pathway is via 26S proteasome and can be
reversed by MG132 as well [35]. Surprisingly, we did not find any indications of ubiquitin-
proteasomal degradation from Q18 treated MDA-MB-468 cells such as an accumulation of
ubiquitinated-AHR or MG132-mediated restoration of AHR.
The alteration of ahr message level cannot explain the low AHR protein level since Q18
only caused a 0.25-fold decrease on ahr transcripts in 2 hours and did not decrease further in 24
hours. In addition, we did not observe faster ahr mRNA degradation by Q18 when blocking the
89
synthesis of new mRNA. Even if mRNA levels are not exactly equivalent to protein levels that
originated from same genes, at steady state, mRNA levels primarily reflect the protein levels
[142]. When the homeostasis is broken by introducing an environmental stimulus like Q18,
other mechanisms like microRNA (miRNA), UPS or autophagy will be involved in altering the
protein levels. It is reported that miR‐15a/16‐1 and miR-378 down-regulate AHR protein levels
in mouse naïve T cells and human hepatocytes [143, 144]. Nevertheless, they remains a lack of
evidence that the AHR is the direct target of these miRNAs and the downregulation could just be
cell type-specific or treatment-dependent. A recent study identified a functional binding site of
miR-375 in the 3’-UTR of the ahr gene [145], indicating the AHR is a direct target of miR-375.
Overexpression of miR-375 in a human intestinal cell line repressed AHR expression at both
mRNA and protein levels, and further affected AHR downstream activity, which suggests a
novel down-regulatory mechanism on the AHR protein.
Our protein stability assay revealed a further degradation of AHR protein when
introducing Q18 in a short time frame (0-6h). The AHR is a well-established substrate for UPS,
however, recent research reported the interaction between autophagy and the UPS [146, 147] and
many proteins can be degraded by both of the mechanisms [148]. Here we used chloroquine
(CQ), an inhibitor of autophagy, and observed that it partially blocked the Q18-mediated
degradation of AHR. Recently published data showed the crosstalk between the AHR
expression and autophagy in keratinocytes with features of psoriasis. Treatment with
chloroquine significantly increased the AHR and CYP1A1 mRNA and protein levels in HaCaT
cells [149], which is consistent with our observations. Many other studies are focused on the
dichotomous roles of AHR in mediating autophagy under physiological and pathological
conditions, including:
90
1. AHR expression levels are inversely related to autophagy activity, which affect lung
cancer cells invasion [150];
2. inhibition of the AHR signaling by its antagonist α-naphthoflavone (α-NF) or siRNA
abrogated particulate matter-induced autophagy in HaCaT cells [151];
3. the AHR ligand kynurenine suppressed starvation-induced autophagy in an AHR-
dependent manner in bone marrow stem cells [152];
4. AHR strong agonist TCDD revealed a cytoprotective role on bovine kidney cell line
by inducing autophagy [153].
These conflicting effects might be derived from different in vitro models, treatment duration and
dosage.
Interestingly, the increased LAMP2 protein was noted in Q18 treated MDA-MB-468
cells. LAMP2, primarily expressed on the lysosomal membrane, is required for lysosomal
biogenesis [154, 155] and the maturation of phagosome and autophagosome [156]. Our results
demonstrated that Q18 treatment increases LAMP2 expression. This result suggested that Q18
causes an elevated number of lysosomes and increased autophagy activity. Human LAMP2 has
three isoforms: A, B and C, they share the same sequence in their luminal region while different
sequence in transmembrane and cytosolic tails [157]. Research has revealed that LAMP2A, but
not other isoforms, contributes to substrate binding and delivers proteins from cytoplasm to
lysosome, which is thought to mediate CMA [158]. Therefore, a change of LAMP2A level is
correlated with the activity of CMA. To explore the role of LAMP2A and to distinguish the
function of LAMP2A from other isoforms, we introduced a LAMP2A specific anti-sense RNA
into MDA-MB-468 cells. We found the knockdown of LAMP2A slows the AHR degradation by
Q18, which elucidates a more specific mechanism regarding LAMP2A on AHR degradation.
Our co-IP and PLA results further revealed the direct or indirect interaction of AHR and
LAMP2A protein only occurred after the treatment of Q18 for at least 4 hours.
91
To study this mechanism further, it is interesting to use other CMA inducers and explore
whether the AHR degradation can be induced in MDA-MB-468 cells in a similar manner. 6-
aminonicotinamide (6-AN), a glucose-6-phosphate dehydrogenase inhibitor, geldanamycin and
prolonged starvation were reported to promote lysosomal proteolysis via CMA in fibroblasts
[122, 159]. Here, both of 6-AN treatment and HBSS starvation decreased AHR while elevated
LAMP2A proteins in MDA-MB-468 cells. In addition, these findings correlated with the
elevated interaction between AHR and LAMP2A observed in MDA-MB-468 cells, validating
that the CMA machinery exists in MDA-MB-468 cells and is triggerable to target AHR for
degradation via LAMP2A. MG132 and CQ restored 6-AN suppressed AHR protein levels,
suggesting that 6-AN contributes to AHR degradation through two proteolytic mechanisms:
proteasome and autophagy. Geldanamycin was also able to lower AHR protein to a very low
level, yet no change of LAMP2A proteins and interaction of AHR and LAMP2A were observed
simultaneously. It was reported HSP90 inhibition would even decrease LAMP2A on different
cell types, suggesting the essential role of HSP90 in stabilizing LAMP2A on the lysosomal
membrane [93]. The discrepant effect of geldanamycin on CMA may be due to the sensitivity of
different cell lines to the same dose of HSP90 inhibitor and multiple subnetworks related to
HSAP90 directly or indirectly work on CMA pathway.
CMA targeted protein shared a specific pentapeptide amino acid sequence, a KFERQ-like
motif, which is recognized by HSC70 and delivered to LAMP2A on the lysosomal membrane
[160]. This motif has recently been shown to be utilized for targeting of proteins to late
endosomes in order to undergo microautophagy [68]. Since substrate proteins are targeted to the
lysosomal membrane by HSC70 upon recognition of the KFERQ-like targeting motif in their
sequences, alterations in this motif by site-directed mutagenesis was utilized to support the
92
function of this motif in CMA. Our sequence alignment results disclosed three KFERQ-like
motifs that are located on the bHLH domain (aa20-24: QKTVK and aa59-63: QDVIN) and the
TAD domain (aa558-562: NEKFF), while only the motif on the TAD domain is required to
mediate the degradation of AHR by Q18. Moreover, mutations in the NEKFF motif of AHR
partially prevented Q18-induced degradation, thus validating that the presence of the motif on
AHR can ensure the selective degradation of AHR by CMA. 24 h or even longer treatment of
Q18 still degraded the AHR mutant to a certain degree, indicating there might be more CMA
motifs on the AHR targeting for CMA. Meanwhile, activation of CMA only by the CMA
inducers is less complete than removal of AHR by Q18, suggesting that Q18 may both activate
CMA and cause the transformation of AHR protein and convert other pre-CMA motifs to
functional CMA motifs and lead to the cleanup of AHR.
The TNBC cell type-specific results caused by Q18 implied that the differences might be
due to the biological properties of TNBC cells. Since it is known that TNBC lacks ER, PR and
HER2, we then brought ER and PR back to MDA-MB-468 cells to see whether the outcomes
could be different. We did not emphasize the action of HER2, since MCF-7 cells, which lack of
HER2, behaved the same as other BC cells. The results indicated that the estrogen receptor
status unlikely influences AHR stability in TNBC cells. Moreover, the endogenously expressed
ERα was also degraded by Q18. The crosstalk between AHR and ER is most extensively
studied. TCDD-activated AHR interacts with ERα in breast cancer cells and causes proteasome-
dependent degradation of ERα [161]. Q18 showed E2-like or TCDD-like properties in
degrading ERα in a time-dependent manner, while we did not further explore whether this
degradation is proteasome-dependent. Regarding the interaction of progesterone and AHR, it
was reported that the PR inhibits TCDD-induced AHR transactivation [162]. Regulation of
93
AHR expression by progesterone (P4) seems biphasic (low dose induces AHR expression, high
dose reduces AHR expression) [163], and when administrated together with E2, P4 is able to
upregulate AHR expression [164]. In our findings, PR-B re-expression significantly slowed the
degradation rate of AHR by Q18 in MDA-MB-468 cells. Knockdown of PR-B in T47D cells
sensitized the AHR proteins to Q18 treatment, indicating that PR-B, directly or indirectly,
interacts with AHR and neutralizes the enhanced susceptibility of AHR protein towards Q18.
The AHR protein was decreased by about 70% in Q18 treated MDA-MB-468 cells versus
vehicle treatment. However, the ahr transcripts were slightly reduced in these cells and was not
parallel with protein levels. The decreased AHR protein likely correlates with the unhealthy
state of the cells. The relationship between AHR expression and apoptosis is complex. In liver
cells, AHR expression and ligand-mediated activity promotes FasL-induced apoptosis [165].
Nevertheless, there is accumulating opposite evidence illustrating the anti-apoptotic effects of
endogenous AHR:
1. downregulation of AHR in keratinocytes and breast cancer cells increases UV-
induced apoptosis [166, 167];
2. inhibition of AHR expression in hepatoma cells promotes the induction of apoptosis
via a highly developed level of oxidative stress and DNA damage, while activating
AHR suppresses apoptosis [168];
3. AHR silenced lung epithelial cells and AHR-/- mice have increased susceptibility to
cigarette smoke-induced apoptosis [79].
In our current study, AHR was completely eliminated by Q18 in 24 h, while significant apoptosis
can be observed at this timepoint and even more apoptosis occurred post 24 h, inferring the anti-
apoptotic effect of AHR protein in TNBC cells.
There is known crosstalk between autophagy and apoptosis where active autophagy
under cellular stress swipes out damaged mitochondria and pro-apoptotic proteins, thus
94
protecting the cells from apoptosis. In some cases, elevated autophagy contributes to cell death
via extensive crosstalk with pro-apoptotic signaling pathways. CMA, similar to autophagy,
displays a cytoprotective role and inhibits apoptosis [169, 170]. In our current study,
simultaneously increased CMA activity and apoptosis was observed in Q18 treated MDA-MB-
468 cells. Alternatively, Q18 induced apoptosis may be independent of CMA. There is
considerable complex cross talk between autophagy, lysosomal activity and apoptosis. It is
likely each process is contributing to the phenotype in some way and adding to the complexity of
these findings. Whether Q18-induced downregulation of AHR and activation of CMA in MDA-
MB-468 cells directly or indirectly impacts cell survival is unclear and investigating the link
between CMA, loss of AHR protein and apoptosis following Q18 treatment is the next point to
address.
95
REFERENCES
1. Atchley, W.R., W. Terhalle, and A. Dress, Positional dependence, cliques, and predictive
motifs in the bHLH protein domain. Journal of Molecular Evolution, 1999. 48(5): p. 501-
516.
2. Jones, S., An overview of the basic helix-loop-helix proteins. Genome Biology, 2004.
5(6).
3. Schulte, K.W., et al., Structural Basis for Aryl Hydrocarbon Receptor-Mediated Gene
Activation. Structure, 2017. 25(7): p. 1025-+.
4. Gu, Y.Z., J.B. Hogenesch, and C.A. Bradfield, The PAS superfamily: Sensors of
environmental and developmental signals. Annual Review of Pharmacology and
Toxicology, 2000. 40: p. 519-561.
5. Wu, D.L., et al., Structure and Dimerization Properties of the Aryl Hydrocarbon
Receptor PAS-A Domain. Molecular and Cellular Biology, 2013. 33(21): p. 4346-4356.
6. Wu, D.L., et al., Structural integration in hypoxia-inducible factors. Nature, 2015.
524(7565): p. 303-+.
7. Jain, S., et al., POTENT TRANSACTIVATION DOMAINS OF THE AH RECEPTOR AND
THE AH RECEPTOR NUCLEAR TRANSLOCATOR MAP TO THEIR CARBOXYL
TERMINI. Journal of Biological Chemistry, 1994. 269(50): p. 31518-31524.
8. Beischlag, T.V., et al., Recruitment of the NCoA/SRC-1/p160 family of transcriptional
coactivators by the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear
translocator complex. Molecular and Cellular Biology, 2002. 22(12): p. 4319-4333.
9. Rowlands, J.C., I.J. McEwan, and J.A. Gustafsson, Trans-activation by the human aryl
hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator proteins:
Direct interactions with basal transcription factors. Molecular Pharmacology, 1996.
50(3): p. 538-548.
10. Reen, R.K., A. Cadwallader, and G.H. Perdew, The subdomains of the transactivation
domain of the aryl hydrocarbon receptor (AhR) inhibit AhR and estrogen receptor
transcriptional activity. Archives of Biochemistry and Biophysics, 2002. 408(1): p. 93-
102.
11. Ko, H.P., et al., Transactivation domains facilitate promoter occupancy for the dioxin-
inducible CYP1A1 gene in vivo. Molecular and Cellular Biology, 1997. 17(7): p. 3497-
3507.
12. Kumar, M.B., R.W. Tarpey, and G.H. Perdew, Differential recruitment of coactivator
RIP140 by Ah and estrogen receptors - Absence of a role for LXXL motifs. Journal of
Biological Chemistry, 1999. 274(32): p. 22155-22164.
13. Tkachenko, A., et al., The Q-rich/PST domain of the AHR regulates both ligand-induced
nuclear transport and nucleocytoplasmic shuttling. Scientific Reports, 2016. 6.
14. Ogiso, H., et al., Phosphorylation analysis of 90 kDa heat shock protein within the
cytosolic arylhydrocarbon receptor complex. Biochemistry, 2004. 43(49): p. 15510-
15519.
15. Chen, H.S. and G.H. Perdew, SUBUNIT COMPOSITION OF THE HETEROMERIC
CYTOSOLIC ARYL-HYDROCARBON RECEPTOR COMPLEX. Journal of Biological
Chemistry, 1994. 269(44): p. 27554-27558.
96
16. Pongratz, I., G.G.F. Mason, and L. Poellinger, DUAL ROLES OF THE 90-KDA HEAT-
SHOCK PROTEIN HSP90 IN MODULATING FUNCTIONAL ACTIVITIES OF THE
DIOXIN RECEPTOR - EVIDENCE THAT THE DIOXIN RECEPTOR FUNCTIONALLY
BELONGS TO A SUBCLASS OF NUCLEAR RECEPTORS WHICH REQUIRE HSP90
BOTH FOR LIGAND-BINDING ACTIVITY AND REPRESSION OF INTRINSIC DNA-
BINDING ACTIVITY. Journal of Biological Chemistry, 1992. 267(19): p. 13728-13734.
17. Carver, L.A., V. Jackiw, and C.A. Bradfield, THE 90-KDA HEAT-SHOCK PROTEIN IS
ESSENTIAL FOR AH RECEPTOR SIGNALING IN A YEAST EXPRESSION SYSTEM.
Journal of Biological Chemistry, 1994. 269(48): p. 30109-30112.
18. Heid, S.E., R.S. Pollenz, and H.I. Swanson, Role of heat shock protein 90 dissociation in
mediating agonist-induced activation of the aryl hydrocarbon receptor. Molecular
Pharmacology, 2000. 57(1): p. 82-92.
19. Kazlauskas, A., L. Poellinger, and I. Pongratz, Evidence that the Co-chaperone p23
regulates ligand responsiveness of the dioxin (aryl hydrocarbon) receptor. Journal of
Biological Chemistry, 1999. 274(19): p. 13519-13524.
20. Meyer, B.K. and G.H. Perdew, Characterization of the AhR-hsp90-XAP2 core complex
and the role of the immunophilin-related protein XAP2 in AhR stabilization.
Biochemistry, 1999. 38(28): p. 8907-8917.
21. LaPres, J.J., et al., ARA9 modifies agonist signaling through an increase in cytosolic aryl
hydrocarbon receptor. Journal of Biological Chemistry, 2000. 275(9): p. 6153-6159.
22. Lees, M.J., D.J. Peet, and M.L. Whitelaw, Defining the role for XAP2 in stabilization of
the dioxin receptor. Journal of Biological Chemistry, 2003. 278(38): p. 35878-35888.
23. Pollenz, R.S. and E.J. Dougherty, Redefining the role of the endogenous XAP2 and C-
terminal hsp70-interacting protein on the endogenous Ah receptors expressed in mouse
and rat cell lines. Journal of Biological Chemistry, 2005. 280(39): p. 33346-33356.
24. Kazlauskas, A., L. Poellinger, and I. Pongratz, The immunophilin-like protein XAP2
regulates ubiquitination and subcellular localization of the dioxin receptor. Journal of
Biological Chemistry, 2000. 275(52): p. 41317-41324.
25. Weaver, A.J., et al., Crystal structure and activity of human p23, a heat shock protein 90
co-chaperone. Journal of Biological Chemistry, 2000. 275(30): p. 23045-23052.
26. Grad, I., et al., The Hsp90 cochaperone p23 is essential for perinatal survival. Mol Cell
Biol, 2006. 26(23): p. 8976-83.
27. Lovgren, A.K., M. Kovarova, and B.H. Koller, cPGES/p23 is required for glucocorticoid
receptor function and embryonic growth but not prostaglandin E-2 synthesis. Molecular
and Cellular Biology, 2007. 27(12): p. 4416-4430.
28. Shetty, P.V., B.Y. Bhagwat, and W.K. Chan, P23 enhances the formation of the aryl
hydrocarbon receptor-DNA complex. Biochem Pharmacol, 2003. 65(6): p. 941-8.
29. Flaveny, C., G.H. Perdew, and C.A. Miller, The Aryl-hydrocarbon receptor does not
require the p23 co-chaperone for ligand binding and target gene expression in vivo.
Toxicology Letters, 2009. 189(1): p. 57-62.
30. Nguyen, P.M., et al., p23 co-chaperone protects the aryl hydrocarbon receptor from
degradation in mouse and human cell lines. Biochemical Pharmacology, 2012. 84(6): p.
838-850.
31. Lee, J., et al., Transgenic overexpression of p23 induces spontaneous hydronephrosis in
mice. International Journal of Experimental Pathology, 2011. 92(4): p. 251-259.
97
32. Pappas, B., et al., p23 protects the human aryl hydrocarbon receptor from degradation
via a heat shock protein 90-independent mechanism. Biochemical Pharmacology, 2018.
152: p. 34-44.
33. Tanioka, T., et al., Molecular identification of cytosolic prostaglandin E2 synthase that is
functionally coupled with cyclooxygenase-1 in immediate prostaglandin E2 biosynthesis.
J Biol Chem, 2000. 275(42): p. 32775-82.
34. Ma, Q. and K.T. Baldwin, 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced degradation of
aryl hydrocarbon receptor (AhR) by the ubiquitin-proteasome pathway - Role of the
transcription activaton and DNA binding of AhR. Journal of Biological Chemistry, 2000.
275(12): p. 8432-8438.
35. Song, Z.J. and R.S. Pollenz, Ligand-dependent and independent modulation of aryl
hydrocarbon receptor localization, degradation, and gene regulation. Molecular
Pharmacology, 2002. 62(4): p. 806-816.
36. Evans, B.R., et al., Repression of aryl hydrocarbon receptor (AHR) signaling by AHR
repressor: Role of DNA binding and competition for AHR nuclear translocator.
Molecular Pharmacology, 2008. 73(2): p. 387-398.
37. Pollenz, R.S. and E.J. Dougherty, Redefining the role of the endogenous XAP2 and C-
terminal hsp70-interacting protein on the endogenous Ah receptors expressed in mouse
and rat cell lines. J Biol Chem, 2005. 280(39): p. 33346-56.
38. Morales, J.L. and G.H. Perdew, Carboxyl terminus of hsc70-interacting protein (CHIP)
can remodel mature aryl hydrocarbon receptor (AhR) complexes and mediate
ubiquitination of both the AhR and the 90 kDa heat-shock protein (hsp90) in vitro.
Biochemistry, 2007. 46(2): p. 610-21.
39. Brooks, J. and S.E. Eltom, Malignant Transformation of Mammary Epithelial Cells by
Ectopic Overexpression of the Aryl Hydrocarbon Receptor. Current Cancer Drug Targets,
2011. 11(5): p. 654-669.
40. Goode, G.D., et al., Knockdown of aberrantly upregulated aryl hydrocarbon receptor
reduces tumor growth and metastasis of MDA-MB-231 human breast cancer cell line.
International Journal of Cancer, 2013. 133(12): p. 2769-2780.
41. Romagnolo, D.F., et al., Constitutive expression of AhR and BRCA-1 promoter CpG
hypermethylation as biomarkers of ERalpha-negative breast tumorigenesis. BMC
Cancer, 2015. 15: p. 1026.
42. Ikuta, T. and K. Kawajiri, Zinc finger transcription factor Slug is a novel target gene of
aryl hydrocarbon receptor. Experimental Cell Research, 2006. 312(18): p. 3585-3594.
43. Kolluri, S.K., U.H. Jin, and S. Safe, Role of the aryl hydrocarbon receptor in
carcinogenesis and potential as an anti-cancer drug target. Arch Toxicol, 2017. 91(7): p.
2497-2513.
44. Kolluri, S.K., U.H. Jin, and S. Safe, Role of the aryl hydrocarbon receptor in
carcinogenesis and potential as an anti-cancer drug target (vol 91, pg 2497, 2017).
Archives of Toxicology, 2017. 91(9): p. 3209-3209.
45. O'Donnell, E.F., et al., The aryl hydrocarbon receptor mediates raloxifene-induced
apoptosis in estrogen receptor-negative hepatoma and breast cancer cells. Cell Death &
Disease, 2014. 5.
46. Jin, U.H., et al., The aryl hydrocarbon receptor ligand omeprazole inhibits breast cancer
cell invasion and metastasis. Bmc Cancer, 2014. 14.
98
47. Portal-Nunez, S., et al., Aryl hydrocarbon receptor-induced adrenomedullin mediates
cigarette smoke carcinogenicity in humans and mice. Cancer Res, 2012. 72(22): p. 5790-
800.
48. Ye, M., et al., Activation of the Aryl Hydrocarbon Receptor Leads to Resistance to EGFR
TKIs in Non-Small Cell Lung Cancer by Activating Src-mediated Bypass Signaling. Clin
Cancer Res, 2018. 24(5): p. 1227-1239.
49. Shimba, S., et al., Overexpression of the aryl hydrocarbon receptor (AhR) accelerates the
cell proliferation of A549 cells. J Biochem, 2002. 132(5): p. 795-802.
50. Zhang, L., et al., Detoxication of benzo[a]pyrene-7,8-dione by sulfotransferases (SULTs)
in human lung cells. J Biol Chem, 2012. 287(35): p. 29909-20.
51. Dalwadi, H., et al., Cyclooxygenase-2-dependent activation of signal transducer and
activator of transcription 3 by interleukin-6 in non-small cell lung cancer. Clin Cancer
Res, 2005. 11(21): p. 7674-82.
52. Baglole, C.J., et al., The aryl hydrocarbon receptor attenuates tobacco smoke-induced
cyclooxygenase-2 and prostaglandin production in lung fibroblasts through regulation of
the NF-kappaB family member RelB. J Biol Chem, 2008. 283(43): p. 28944-57.
53. Quintana, F.J., et al., Control of T(reg) and T(H)17 cell differentiation by the aryl
hydrocarbon receptor. Nature, 2008. 453(7191): p. 65-71.
54. Busbee, P.B., et al., Use of natural AhR ligands as potential therapeutic modalities
against inflammatory disorders. Nutr Rev, 2013. 71(6): p. 353-69.
55. Rothhammer, V., et al., Type I interferons and microbial metabolites of tryptophan
modulate astrocyte activity and central nervous system inflammation via the aryl
hydrocarbon receptor. Nat Med, 2016. 22(6): p. 586-97.
56. Wei, Z.F., et al., Norisoboldine, an Anti-Arthritis Alkaloid Isolated from Radix Linderae,
Attenuates Osteoclast Differentiation and Inflammatory Bone Erosion in an Aryl
Hydrocarbon Receptor-Dependent Manner. Int J Biol Sci, 2015. 11(9): p. 1113-26.
57. Nakahama, T., et al., Aryl hydrocarbon receptor deficiency in T cells suppresses the
development of collagen-induced arthritis. Proc Natl Acad Sci U S A, 2011. 108(34): p.
14222-7.
58. Carreira, V.S., et al., Ah Receptor Signaling Controls the Expression of Cardiac
Development and Homeostasis Genes. Toxicological Sciences, 2015. 147(2): p. 425-435.
59. Flesch-Janys, D., et al., Exposure to polychlorinated dioxins and furans (PCDD/F) and
mortality in a cohort of workers from a herbicide-producing plant in Hamburg, Federal
Republic of Germany. Am J Epidemiol, 1995. 142(11): p. 1165-75.
60. Wang, Q., et al., Aryl Hydrocarbon Receptor Ablation in Cardiomyocytes Protects Male
Mice From Heart Dysfunction Induced by NKX2.5 Haploinsufficiency. Toxicol Sci, 2017.
160(1): p. 74-82.
61. Nixon, R.A., The role of autophagy in neurodegenerative disease. Nat Med, 2013. 19(8):
p. 983-97.
62. Nguyen, H.T., et al., Small-Vessel Vasculopathy Due to Aberrant Autophagy in LAMP-2
Deficiency. Sci Rep, 2018. 8(1): p. 3326.
63. Amaravadi, R.K., A.C. Kimmelman, and J. Debnath, Targeting Autophagy in Cancer:
Recent Advances and Future Directions. Cancer Discov, 2019. 9(9): p. 1167-1181.
64. Martinez-Lopez, N., D. Athonvarangkul, and R. Singh, Autophagy and aging. Adv Exp
Med Biol, 2015. 847: p. 73-87.
99
65. Juhasz, G. and T.P. Neufeld, Autophagy: a forty-year search for a missing membrane
source. PLoS Biol, 2006. 4(2): p. e36.
66. Dice, J.F., Peptide sequences that target cytosolic proteins for lysosomal proteolysis.
Trends Biochem Sci, 1990. 15(8): p. 305-9.
67. Kaushik, S. and A.M. Cuervo, The coming of age of chaperone-mediated autophagy. Nat
Rev Mol Cell Biol, 2018. 19(6): p. 365-381.
68. Sahu, R., et al., Microautophagy of Cytosolic Proteins by Late Endosomes.
Developmental Cell, 2011. 20(1): p. 131-139.
69. Yousefi, S., et al., Calpain-mediated cleavage of Atg5 switches autophagy to apoptosis.
Nat Cell Biol, 2006. 8(10): p. 1124-32.
70. Rubinstein, A.D., et al., The autophagy protein Atg12 associates with antiapoptotic Bcl-2
family members to promote mitochondrial apoptosis. Mol Cell, 2011. 44(5): p. 698-709.
71. Burbach, K.M., A. Poland, and C.A. Bradfield, CLONING OF THE AH-RECEPTOR
CDNA REVEALS A DISTINCTIVE LIGAND-ACTIVATED TRANSCRIPTION FACTOR.
Proceedings of the National Academy of Sciences of the United States of America, 1992.
89(17): p. 8185-8189.
72. Mezrich, J.D., et al., An Interaction between Kynurenine and the Aryl Hydrocarbon
Receptor Can Generate Regulatory T Cells. Journal of Immunology, 2010. 185(6): p.
3190-3198.
73. Nguyen, N.T., et al., Aryl hydrocarbon receptor negatively regulates dendritic cell
immunogenicity via a kynurenine-dependent mechanism. Proceedings of the National
Academy of Sciences of the United States of America, 2010. 107(46): p. 19961-19966.
74. Barnes-Ellerbe, S., K.E. Knudsen, and A. Puga, 2,3,7,8-tetrachlorodibenzo-p-dioxin
blocks androgen-dependent cell proliferation of LNCaP cells through modulation of pRB
phosphorylation. Molecular Pharmacology, 2004. 66(3): p. 502-511.
75. Bunaciu, R.P. and A. Yen, Activation of the Aryl Hydrocarbon Receptor AhR Promotes
Retinoic Acid-Induced Differentiation of Myeloblastic Leukemia Cells by Restricting
Expression of the Stem Cell Transcription Factor Oct4. Cancer Research, 2011. 71(6): p.
2371-2380.
76. Dever, D.P. and L.A. Opanashuk, The Aryl Hydrocarbon Receptor Contributes to the
Proliferation of Human Medulloblastoma Cells. Molecular Pharmacology, 2012. 81(5):
p. 669-678.
77. Fan, Y.X., et al., The Aryl Hydrocarbon Receptor Functions as a Tumor Suppressor of
Liver Carcinogenesis. Cancer Research, 2010. 70(1): p. 212-220.
78. Silginer, M., et al., The aryl hydrocarbon receptor links integrin signaling to the TGF-
beta pathway. Oncogene, 2016. 35(25): p. 3260-3271.
79. de Souza, A.R., et al., Genetic Ablation of the Aryl Hydrocarbon Receptor Causes
Cigarette Smoke-induced Mitochondrial Dysfunction and Apoptosis. Journal of
Biological Chemistry, 2011. 286(50): p. 43214-43228.
80. Thatcher, T.H., et al., Aryl hydrocarbon receptor-deficient mice develop heightened
inflammatory responses to cigarette smoke and endotoxin associated with rapid loss of
the nuclear factor-kappaB component RelB. Am J Pathol, 2007. 170(3): p. 855-64.
81. Wei, C., et al., Induction of CYP1A1 and CYP1A2 expressions by prototypic and atypical
inducers in the human lung. Cancer Letters, 2002. 178(1): p. 25-36.
100
82. Bartsch, H., DNA adducts in human carcinogenesis: Etiological relevance and structure-
activity relationship. Mutation Research-Reviews in Genetic Toxicology, 1996. 340(2-3):
p. 67-79.
83. Phuong, M.N., et al., Benzo a pyrene Increases the Nrf2 Content by Downregulating the
Keap1 Message. Toxicological Sciences, 2010. 116(2): p. 549-561.
84. Pollenz, R.S. and C. Buggy, Ligand-dependent and -independent degradation of the
human aryl hydrocarbon receptor (hAHR) in cell culture models. Chemico-Biological
Interactions, 2006. 164(1-2): p. 49-59.
85. Shetty, P.V., B.Y. Bhagwat, and W.K. Chan, p23 enhances the formation of the aryl
hydrocarbon receptor-DNA complex. Biochemical Pharmacology, 2003. 65(6): p. 941-
948.
86. Flaveny, C., G.H. Perdew, and C.A. Miller, 3rd, The Aryl-hydrocarbon receptor does not
require the p23 co-chaperone for ligand binding and target gene expression in vivo.
Toxicol Lett, 2009. 189(1): p. 57-62.
87. Ren, L.N., et al., Selective suppression of the human aryl hydrocarbon receptor function
can be mediated through binding interference at the C-terminal half of the receptor.
Biochemical Pharmacology, 2016. 107: p. 91-100.
88. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p.
402-8.
89. Pare, J.M., P. LaPointe, and T.C. Hobman, Hsp90 cochaperones p23 and FKBP4
physically interact with hAgo2 and activate RNA interference-mediated silencing in
mammalian cells. Molecular Biology of the Cell, 2013. 24(15): p. 2303-2310.
90. Mizushima, N., et al., Autophagy fights disease through cellular self-digestion. Nature,
2008. 451(7182): p. 1069-75.
91. Majeski, A.E. and J.F. Dice, Mechanisms of chaperone-mediated autophagy. Int J
Biochem Cell Biol, 2004. 36(12): p. 2435-44.
92. Cuervo, A.M. and J.F. Dice, Unique properties of lamp2a compared to other lamp2
isoforms. J Cell Sci, 2000. 113 Pt 24: p. 4441-50.
93. Bandyopadhyay, U., et al., The chaperone-mediated autophagy receptor organizes in
dynamic protein complexes at the lysosomal membrane. Molecular and Cellular Biology,
2008. 28(18): p. 5747-5763.
94. Chiang, H.L. and J.F. Dice, Peptide sequences that target proteins for enhanced
degradation during serum withdrawal. J Biol Chem, 1988. 263(14): p. 6797-805.
95. Burbach, K.M., A. Poland, and C.A. Bradfield, Cloning of the Ah-receptor cDNA reveals
a distinctive ligand-activated transcription factor. Proc Natl Acad Sci U S A, 1992.
89(17): p. 8185-9.
96. Schmidt, J.V., et al., Characterization of a murine Ahr null allele: involvement of the Ah
receptor in hepatic growth and development. Proc Natl Acad Sci U S A, 1996. 93(13): p.
6731-6.
97. Gonzalez, F.J. and P. Fernandez-Salguero, The aryl hydrocarbon receptor: studies using
the AHR-null mice. Drug Metab Dispos, 1998. 26(12): p. 1194-8.
98. Nguyen, N.T., et al., Aryl hydrocarbon receptor negatively regulates dendritic cell
immunogenicity via a kynurenine-dependent mechanism. Proc Natl Acad Sci U S A,
2010. 107(46): p. 19961-6.
101
99. Mezrich, J.D., et al., An interaction between kynurenine and the aryl hydrocarbon
receptor can generate regulatory T cells. J Immunol, 2010. 185(6): p. 3190-8.
100. Boitano, A.E., et al., Aryl hydrocarbon receptor antagonists promote the expansion of
human hematopoietic stem cells. Science, 2010. 329(5997): p. 1345-8.
101. Schlezinger, J.J., et al., A role for the aryl hydrocarbon receptor in mammary gland
tumorigenesis. Biol Chem, 2006. 387(9): p. 1175-87.
102. Silginer, M., et al., The aryl hydrocarbon receptor links integrin signaling to the TGF-
beta pathway. Oncogene, 2016. 35(25): p. 3260-71.
103. Seymour, E.M., M.R. Bennink, and S.F. Bolling, Diet-relevant phytochemical intake
affects the cardiac AhR and nrf2 transcriptome and reduces heart failure in hypertensive
rats. J Nutr Biochem, 2013. 24(9): p. 1580-6.
104. Wong, P.S., et al., Arylhydrocarbon receptor activation in NCI-H441 cells and C57BL/6
mice: possible mechanisms for lung dysfunction. Am J Respir Cell Mol Biol, 2010. 42(2):
p. 210-7.
105. Lee, S.M., et al., Inhibition of acute lethal pulmonary inflammation by the IDO-AhR
pathway. Proc Natl Acad Sci U S A, 2017. 114(29): p. E5881-e5890.
106. Zhang, L., et al., Metabolomics Reveals that Aryl Hydrocarbon Receptor Activation by
Environmental Chemicals Induces Systemic Metabolic Dysfunction in Mice. Environ Sci
Technol, 2015. 49(13): p. 8067-77.
107. Belton, K.R., et al., Metabolomics Reveals Aryl Hydrocarbon Receptor Activation
Induces Liver and Mammary Gland Metabolic Dysfunction in Lactating Mice. J
Proteome Res, 2018. 17(4): p. 1375-1382.
108. Choudhary, M., et al., Aryl hydrocarbon receptor knock-out exacerbates choroidal
neovascularization via multiple pathogenic pathways. J Pathol, 2015. 235(1): p. 101-12.
109. Gutierrez, M.A., et al., A novel AhR ligand, 2AI, protects the retina from environmental
stress. Sci Rep, 2016. 6: p. 29025.
110. Carver, L.A. and C.A. Bradfield, Ligand-dependent interaction of the aryl hydrocarbon
receptor with a novel immunophilin homolog in vivo. J Biol Chem, 1997. 272(17): p.
11452-6.
111. Ma, Q. and J.P. Whitlock, Jr., A novel cytoplasmic protein that interacts with the Ah
receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional
response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. J Biol Chem, 1997. 272(14): p. 8878-84.
112. Petrulis, J.R., et al., The hsp90 Co-chaperone XAP2 alters importin beta recognition of
the bipartite nuclear localization signal of the Ah receptor and represses transcriptional
activity. J Biol Chem, 2003. 278(4): p. 2677-85.
113. Kazlauskas, A., et al., The hsp90 chaperone complex regulates intracellular localization
of the dioxin receptor. Mol Cell Biol, 2001. 21(7): p. 2594-607.
114. Nebert, D.W., A. Puga, and V. Vasiliou, Role of the Ah receptor and the dioxin-inducible
[Ah] gene battery in toxicity, cancer, and signal transduction. Ann N Y Acad Sci, 1993.
685: p. 624-40.
115. Vogel, C.F., et al., RelB, a new partner of aryl hydrocarbon receptor-mediated
transcription. Mol Endocrinol, 2007. 21(12): p. 2941-55.
116. Davarinos, N.A. and R.S. Pollenz, Aryl hydrocarbon receptor imported into the nucleus
following ligand binding is rapidly degraded via the cytosplasmic proteasome following
nuclear export. J Biol Chem, 1999. 274(40): p. 28708-15.
102
117. Pollenz, R.S. and C. Buggy, Ligand-dependent and -independent degradation of the
human aryl hydrocarbon receptor (hAHR) in cell culture models. Chem Biol Interact,
2006. 164(1-2): p. 49-59.
118. Shallal, H.M. and W.A. Russu, Discovery, synthesis, and investigation of the antitumor
activity of novel piperazinylpyrimidine derivatives. European Journal of Medicinal
Chemistry, 2011. 46(6): p. 2043-2057.
119. Peters, A.K., et al., Interactions of polybrominated diphenyl ethers with the aryl
hydrocarbon receptor pathway. Toxicological Sciences, 2006. 92(1): p. 133-142.
120. Chen, J.Y., P. Yakkundi, and W.K. Chan, Down-Regulation of p23 in Normal Lung
Epithelial Cells Reduces Toxicities From Exposure to Benzo a pyrene and Cigarette
Smoke Condensate via an Aryl Hydrocarbon Receptor-Dependent Mechanism.
Toxicological Sciences, 2019. 167(1): p. 239-248.
121. Zheng, Y., et al., Binding studies using Pichia pastoris expressed human aryl
hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator proteins.
Protein Expr Purif, 2016. 122: p. 72-81.
122. Massey, A.C., et al., Consequences of the selective blockage of chaperone-mediated
autophagy. Proceedings of the National Academy of Sciences of the United States of
America, 2006. 103(15): p. 5805-5810.
123. Ferreira, J.V., et al., K63 linked ubiquitin chain formation is a signal for HIF1A
degradation by Chaperone-Mediated Autophagy. Sci Rep, 2015. 5: p. 10210.
124. Cuervo, A.M., et al., Activation of a selective pathway of lysosomal proteolysis in rat
liver by prolonged starvation. Am J Physiol, 1995. 269(5 Pt 1): p. C1200-8.
125. Cox, M.B. and C.A. Miller, 3rd, The p23 co-chaperone facilitates dioxin receptor
signaling in a yeast model system. Toxicol Lett, 2002. 129(1-2): p. 13-21.
126. Cox, M.B. and C.A. Miller, 3rd, Cooperation of heat shock protein 90 and p23 in aryl
hydrocarbon receptor signaling. Cell Stress Chaperones, 2004. 9(1): p. 4-20.
127. Lee, J., et al., Transgenic overexpression of p23 induces spontaneous hydronephrosis in
mice. Int J Exp Pathol, 2011. 92(4): p. 251-9.
128. Tsuji, G., et al., An environmental contaminant, benzo(a)pyrene, induces oxidative stress-
mediated interleukin-8 production in human keratinocytes via the aryl hydrocarbon
receptor signaling pathway. J Dermatol Sci, 2011. 62(1): p. 42-9.
129. Wada, T., et al., Aryl hydrocarbon receptor modulates NADPH oxidase activity via direct
transcriptional regulation of p40phox expression. Mol Pharmacol, 2013. 83(5): p. 1133-
40.
130. Anandasadagopan, S.K., et al., beta-Naphthoflavone-Induced Mitochondrial Respiratory
Damage in Cyp1 Knockout Mouse and in Cell Culture Systems: Attenuation by
Resveratrol Treatment. Oxid Med Cell Longev, 2017. 2017: p. 5213186.
131. Tavilani, H., et al., Oxidative stress in COPD patients, smokers, and non-smokers. Respir
Care, 2012. 57(12): p. 2090-4.
132. Natarajan, K., et al., Organic dust induces inflammatory gene expression in lung
epithelial cells via ROS-dependent STAT-3 activation. Am J Physiol Lung Cell Mol
Physiol, 2019. 317(1): p. L127-l140.
133. Sarill, M., et al., The aryl hydrocarbon receptor suppresses cigarette-smoke-induced
oxidative stress in association with dioxin response element (DRE)-independent
regulation of sulfiredoxin 1. Free Radic Biol Med, 2015. 89: p. 342-57.
103
134. Rogers, S., et al., Aryl hydrocarbon receptor (AhR)-dependent regulation of pulmonary
miRNA by chronic cigarette smoke exposure. Sci Rep, 2017. 7: p. 40539.
135. Martey, C.A., et al., The aryl hydrocarbon receptor is a regulator of cigarette smoke
induction of the cyclooxygenase and prostaglandin pathways in human lung fibroblasts.
Am J Physiol Lung Cell Mol Physiol, 2005. 289(3): p. L391-9.
136. Cheng, L., et al., Aromatic hydrocarbon receptor provides a link between smoking and
rheumatoid arthritis in peripheral blood mononuclear cells. Clin Exp Rheumatol, 2019.
37(3): p. 445-449.
137. Xue, J., et al., Aryl Hydrocarbon Receptor Ligands in Cigarette Smoke Induce
Production of Interleukin-22 to Promote Pancreatic Fibrosis in Models of Chronic
Pancreatitis. Gastroenterology, 2016. 151(6): p. 1206-1217.
138. Talbot, J., et al., Smoking-induced aggravation of experimental arthritis is dependent of
aryl hydrocarbon receptor activation in Th17 cells. Arthritis Research & Therapy, 2018.
20.
139. Yang, X.H., et al., Constitutive regulation of CYP1B1 by the aryl hydrocarbon receptor
(AhR) in pre-malignant and malignant mammary tissue. Journal of Cellular
Biochemistry, 2008. 104(2): p. 402-417.
140. Eltom, S.E., A.A. Gasmelseed, and D. Saoudi-Guentri, The aryl hydrocarbon receptor is
over-expressed and constitutively activated in advanced breast carcinoma. Cancer
Research, 2006. 66(8).
141. Pollenz, R.S., Specific blockage of ligand-induced degradation of the Ah receptor by
proteasome but not calpain inhibitors in cell culture lines from different species.
Biochemical Pharmacology, 2007. 74(1): p. 131-143.
142. Liu, Y.S., A. Beyer, and R. Aebersold, On the Dependency of Cellular Protein Levels on
mRNA Abundance. Cell, 2016. 165(3): p. 535-550.
143. Nakano, M., et al., RNA Editing Modulates Human Hepatic Aryl Hydrocarbon Receptor
Expression by Creating MicroRNA Recognition Sequence. Journal of Biological
Chemistry, 2016. 291(2): p. 894-903.
144. Lu, Z., et al., MicroRNA 15a/16-1 suppresses aryl hydrocarbon receptor-dependent
interleukin-22 secretion in CD4(+) T cells and contributes to immune-mediated organ
injury. Hepatology, 2018. 67(3): p. 1027-1040.
145. Papageorgiou, L., M. Freytsis, and M.H. Court, Transcriptome association analysis
identifies miR-375 as a major determinant of variable acetaminophen glucuronidation by
human liver. Biochemical Pharmacology, 2016. 117: p. 78-87.
146. Pohl, C. and I. Dikic, Cellular quality control by the ubiquitin-proteasome system and
autophagy. Science, 2019. 366(6467): p. 818-+.
147. Kocaturk, N.M. and D. Gozuacik, Crosstalk Between Mammalian Autophagy and the
Ubiquitin-Proteasome System. Frontiers in Cell and Developmental Biology, 2018. 6.
148. Webb, J.L., et al., alpha-synuclein is degraded by both autophagy and the proteasome.
Journal of Biological Chemistry, 2003. 278(27): p. 25009-25013.
149. Kim, H., J. Kim, and B. Chung, The roles of aryl hydrocarbon receptor and autophagy in
pathogenesis of psoriasis. Journal of Investigative Dermatology, 2019. 139(9): p. S274-
S274.
150. Tsai, C.H., et al., The inhibition of lung cancer cell migration by AhR-regulated
autophagy. Scientific Reports, 2017. 7.
104
151. Jang, H.S., et al., Particulate Matter-Induced Aryl Hydrocarbon Receptor Regulates
Autophagy in Keratinocytes. Biomolecules & Therapeutics, 2019. 27(6): p. 570-576.
152. Kondrikov, D., et al., Kynurenine inhibits autophagy and promotes senescence in aged
bone marrow mesenchymal stem cells through the aryl hydrocarbon receptor pathway.
Experimental Gerontology, 2020. 130: p. 110805.
153. Fiorito, F., et al., 2,3,7,8-Tetrachlorodibenzo-p-dioxin induced autophagy in a bovine
kidney cell line. Toxicology, 2011. 290(2-3): p. 258-270.
154. Huynh, K.K., et al., LAMP proteins are required for fusion of lysosomes with
phagosomes. Embo Journal, 2007. 26(2): p. 313-324.
155. Eskelinen, E.L., et al., Role of LAMP-2 in lysosome biogenesis and autophagy. Molecular
Biology of the Cell, 2002. 13(9): p. 3355-3368.
156. Saftig, P., W. Beertsen, and E.L. Eskelinen, LAMP-2 - A control step for phagosome and
autophagosome maturation. Autophagy, 2008. 4(4): p. 510-512.
157. Cuervo, A.M. and J.F. Dice, Unique properties of lamp2a compared to other lamp2
isoforms. Journal of Cell Science, 2000. 113(24): p. 4441-4450.
158. Kaushik, S. and A.M. Cuervo, Chaperone-mediated autophagy: a unique way to enter
the lysosome world. Trends in Cell Biology, 2012. 22(8): p. 407-417.
159. Finn, P.E., et al., Effects of small molecules on chaperone-mediated autophagy.
Autophagy, 2005. 1(3): p. 141-145.
160. Dice, J.F., PEPTIDE SEQUENCES THAT TARGET CYTOSOLIC PROTEINS FOR
LYSOSOMAL PROTEOLYSIS. Trends in Biochemical Sciences, 1990. 15(8): p. 305-309.
161. Wormke, M., et al., The aryl hydrocarbon receptor mediates degradation of estrogen
receptor alpha through activation of proteasomes. Molecular and Cellular Biology, 2003.
23(6): p. 1843-1855.
162. Kuil, C.W., et al., Interference between progesterone and dioxin signal transduction
pathways - Different mechanisms are involved in repression by the progesterone receptor
A and B isoforms. Journal of Biological Chemistry, 1998. 273(15): p. 8829-8834.
163. Darwish, W.S., et al., Constitutive Effects of Lead on Aryl Hydrocarbon Receptor Gene
Battery and Protection by beta-carotene and Ascorbic Acid in Human HepG2 Cells.
Journal of Food Science, 2016. 81(1): p. T275-T281.
164. Rataj, F., et al., Progesterone, as well as 17 beta-estradiol, is important for regulating
AHR battery homoeostasis in the rat uterus. Archives of Toxicology, 2015. 89(3): p. 393-
404.
165. Park, K.T., et al., The aryl hydrocarbon receptor predisposes hepatocytes to Fas-
mediated apoptosis. Molecular Pharmacology, 2005. 67(3): p. 612-622.
166. Pollet, M., et al., The AHR represses nucleotide excision repair and apoptosis and
contributes to UV-induced skin carcinogenesis. Cell Death and Differentiation, 2018.
25(10): p. 1823-1836.
167. Bekki, K., et al., The aryl hydrocarbon receptor (AhR) mediates resistance to apoptosis
induced in breast cancer cells. Pesticide Biochemistry and Physiology, 2015. 120: p. 5-
13.
168. Marlowe, J.L., et al., The aryl hydrocarbon receptor binds to E2F1 and inhibits E2F1-
induced apoptosis. Molecular Biology of the Cell, 2008. 19(8): p. 3263-3271.
169. Xie, W., et al., Chaperone-mediated autophagy prevents apoptosis by degrading
BBC3/PUMA. Autophagy, 2015. 11(9): p. 1623-1635.
105
170. Saha, T., LAMP2A overexpression in breast tumors promotes cancer cell survival via
chaperone-mediated autophagy. Autophagy, 2012. 8(11): p. 1643-1656.
106
APPENDIX A. METHODOLOGY
A1. DNA cloning
Designing primers: In order to clone a gene of interest, two primers (forward and reverse
primers) need to be constructed with the ability to amplify the sequence between them. The
basics of a primer contain leader sequence, restriction enzyme recognition site and homologous
region which is homologous to the gene of interest. Homologous region normally has 18-24
bases that are homologous to the open reading frame (OFR) from the plasmid DNA. We will
compose a Kozak sequence and add enzyme restriction site and 15-21 bases upstream of the
restriction site to the 5' end of the homologous region as our forward primer. Reverse primer is
the reverse complement of the ORF which includes the stop codon (or excludes the stop codon in
order to express the downstream epitope tag on the expression vector) and restriction enzyme site
and downstream of restriction enzyme. The GC content from the annealing portion should be ≥
40%.
PCR amplification: We used Q5 high-fidelity DNA polymerase (New England Biolabs,
Ipswich, MA) to amplify the insert DNA with low mutation and better performance. The
annealing temperature is selected based on the melting temperature of the homologous portion of
the primer. Otherwise, we will run a PCR program with gradient annealing temperature (50 °C -
70 °C) on Bio-Rad PCR machine. We will use the temperature under which gives the most
abundant PCR product. Each 25 µl reaction contains 0.1 ng DNA template, 1.3 µl forward and
reverse primers (100 µM), respectively, 5 µl 5× reaction buffer (NEB) and 0.5 µl 10 mM dNTPs,
add water to make 25 µl volume. Q5 DNA polymerase (0.3 µl/RXN) is added when sample
heated to 98 °C. Thermal cycler condition is started at 98 °C for 30s, then 30 cycles of (98 °C,
107
10s; 55 °C, 15s; 72 °C, 1 min/kb), followed by 2 min at 72 °C and hold at 4 °C. Load all the
PCR product on a DNA gel (0.8-2% depend on the size of insert DNA) in 1× TBE buffer to
visualize the band.
Using single restriction enzyme cut: one restriction enzyme (e.g. EcoRV), which is
located at the multiple cloning site of the vector, is used to digest the recipient plasmid and it
generates a blunt end. For each digestion reaction: 3 µg of recipient plasmid is mixed with 2 µl
10× BSA, 1 µl restriction enzyme and 2 µl corresponding 10× buffer and add water for a final
volume of 20 µl. The digestion is processed at least 3 hours or as long as overnight at 37 °C.
Then the linearized plasmid is isolated on a DNA gel and extracted by Wizard SV Gel and PCR
Clean-Up System (Promega, Madison, WI). 0.02-0.08 picomole of linearized plasmid is ligated
to 8 × pmole of insert DNA in the presence of 10 µl of Gibson assembly master mix (2×, New
England Biolabs) and incubated for 20 min at 50 °C. ng/µl of DNA is converted to pmol by:
pmol = (weight in ng) × 1000 / (basepair × 650 daltons). Ligated DNA is immediately chilled on
ice and diluted in 1:3 in nuclease free H2O for later electroporation in order to minimize the salts.
Transformation: 1 µl of Gibson assembly product is added into 40 µl of BL21 DE3
electrocompetent cells, then transfer the cells into pre-chilled 2 mm gap electroporation cuvette.
A short electric pulse, about 2500 volts, is applied to the cells causing smalls holes in the
membrane through which the DNA enters. The cells are then incubated in 1ml LB media by
~250 rpm shaking for 90 minutes at 37 °C. The cells (200-400 µl) is spread on LB agar plates
containing appropriate antibiotic (e.g., 25 µg/mL zeocin for pGFP2-N2) using a “hockey puck”
spreader. Incubate the plate(s) in the 37 °C overnight with the agar side up and the lid side down
and store it to fridge (4 °C) the next day.
108
A2. DNA Miniprep
Colonies from the above plate are picked and grown in 3 ml of LB media containing
appropriate antibiotics for 16-18 hours. The bacteria culture is centrifuged at 3100 g for 10 min
and discard the supernatant. Resuspend the pellet in 200 µl of Buffer I (50 mM Tris-HCl, 10
mM EDTA, pH 8.0) by vortex. Lyse the bacteria in 200 µl Buffer II (200 mM NaOH, 1% SDS)
by shaking. Neutralize the reaction by the addition of 200 µl Buffer III (3 M sodium acetate, pH
5.5). Precipitates generated in neutralization step is removed by centrifuge at 3100 g for 30 min.
The liquid portion of lysate is further mixed with 500 µL of phenol/chloroform/isoamyl alcohol
+ Tris buffer (heavier, bottom layer), so as to denature protein in the sample. After 5 min
centrifuge at 16000 g, the protein stays in the interface of the two layers. 360 µl of the upper
layer is transferred into 40 µl, 3 M NaAc containing tube followed by the addition of 800 µl of
EtOH (200 Proof). Incubate the mixture in -20 °C for 30 min and spin down the sample at
16000 g for 15 min in 4 °C. Discard the supernatant, dry the pellet in the hood for 30 min.
Resuspend the pellet with 20 µL of nuclease free H2O. The reconstituted plasmid is then cut by
two restriction enzymes which are close to the ends of insert sequence at both sides. The insert
DNA will be released on a DNA gel purification.
A3. DNA Maxiprep
We used ZymoPURE II Plasmid Maxiprep Kit to purify DNA plasmid in large scale.
The positive colony is picked up by sterile toothpick and grown in 3 ml LB media at 37 °C for 8
hours. Then transfer 1ml bacteria starter into 500 ml LB media and shake for another 17 hours.
Spin down the bacteria at 4 °C at 3100 g for 10 min. The bacterial cell pellet is resuspended in
14 ml of P1 buffer (Red) by pipetting. Then the bacteria cells are lysed in 14 ml of P2 (Blue) by
gently inversion for 2-3 minutes until the solution becomes clear and purple. Add 14 ml of P3
109
(Yellow) to neutralize the reaction and it will form yellow precipitate. Filter the liquid portion of
cell lysate by Syringe Filter to remove the viscous precipitate and mix it with 14 ml of Binding
Buffer. Allow the solution to flow through Zymo-Spin V-P Column by vacuum. Wash the
column with Wash 1 and Wash 2. After remove the buffer residue by centrifuge at ≥ 10000 × g
for 1 min. Elute the DNA from the column in 400 µl of Elution Buffer and incubate for 2 min at
room temperature. Collect the elute DNA in a 1.5 ml centrifuge tube by centrifuge at ≥ 10,000
× g for 1 minute. The concentration and rough purity (ratio of 260 nm/280 nm) of the plasmid
DNA is analyzed by Nanodrop (Thermal Fisher).
A4. Site-direct mutagenesis
In vitro site-directed mutagenesis is to create targeted DNA alterations in double-strand
plasmid DNA. For example, pGFP2-AHRE559A/F561A mutants were created from pGFP2-AHR
using QuikChange lightning site-directed mutagenesis kit (Stratagene).
Primer design: Substitutions of bases in the desired nucleotide sequence are put in the
center of the forward primer, including 10~25 complementary nucleotides (to the existing
sequence) on both sides of the mutations. The reverse primer is the reverse complement form of
forward primer. Calculate the GC% and Tm of each primer (GC% ≥ 40, Tm ≥ 78).
Mutant strand DNA generation: The PCR will amplify the new sequence and the final
product will have the desired sequence with the base changes. For each 50 μl PCR reaction, it
contains 10 ng of template DNA (pGFP2-AHR), 125 ng of each primer (forward and reverse), 1
μl of deoxynucleotide-triphosphates (dNTPs), 5 μl of 10× reaction buffer, 1.5 μl of QuikSolution
reagent and 1 μl of QuikChange Lightning Enzyme. The PCR reaction is performed following
the reaction start at 95 °C for 2 min, 18 cycles of (95 °C for 20 s, 60 °C for 10 s, and 68 °C 3.5
min, 30 s/kb of plasmid length), the reaction ends up at 68 °C for 5 min. The product is
110
immediately mixed with 2 μl of DpnI restriction enzyme and incubated for 5-10 min at 37 °C.
DpnI only cleaves at methylated sites, so only the template plasmid is eliminated during the
digestion but not the PCR product.
Transformation: For each reaction, aliquot 45 μl of thawed XL10-Gold ultracompetent
cells into 15 ml bacteria culture tube. 2 μl of β-ME is added into the competent cells and chilly
incubated on ice for 2 min. Then add 2 μl of the digested DNA into the pre-prepared competent
cells, mix well by swirling and incubate on ice for 30 min. After the incubation, heat-pulse the
tube into 42 °C water bath for 30s and put back onto ice for 2 min. 0.5 ml of pre-warmed
(42 °C) SOB medium (2% bacto tryptone, 0.5% yeast extract, 10 mM sodium chloride, 25 mM
potassium chloride, 10 mM magnesium chloride, 10 ml magnesium sulfate, adjust pH to 7.0) was
added into each tube, then shake the tube at 37 °C for 1h at 225 rpm. The cell cultures (400 ml)
are then spread on the LB plate and incubate at 37 °C overnight. Finally, pick several colonies
from each transformation, miniprep, and sequence to check for the mutation.
A5. Cell culture
MCF-10A are maintained in mammary epithelial cell growth medium (MEGM, Lonza,
Walkersville, Maryland). Dissociation of MCF-10A cells from culture vessel by TrypLE express
(Gibco, Carlsbad, CA) needs 17 min. Human bronchial/tracheal epithelia cells are grown in
BronchiaLife complete medium (Lifeline Cell Technology, Frederick, Maryland). MDA-MB-
468 cells are grown in Advanced MEM which supplemented with 5% FBS. MCF-7, T47D,
MDA-MB-361 and rat H4G1.1c3 stable cells are maintained in DMEM supplemented with 10%
FBS (Gemini Bio, Woodland, CA). MDA-MB-231 cells are cultured in Gibco DMEM/F12 (1:1)
with 10% FBS. All the complete media are supplemented with 2 mM GlutaMAX, 100 units/ml
111
of penicillin, and 0.1 mg/ml of streptomycin. All the cells are grown in 5% CO2 incubator at
37 °C.
A6. Transient transfection
For each reaction (apply to one well of 6-well plate), the ratio of DNA amount (μg)
versus transfect reagent volume (μl) can be varied from different cell lines (2 μg / 6 μl for HBTE
cells and 5 μg / 10 μl for MCF-10A cells, 4μg / 16 μl for 468 cells), it needs to be optimized to
achieve the best transfection efficiency before applying to the cells. Alteration of the cell culture
vessel may also change the ratio for the same cell line. Cell density at the time of transfection
would be 70-90% confluence. Appropriate amount of plasmid DNA and EcoTransfect reagent
are diluted into 100 μl of Opti-MEM (Gibco), respectively. The two solutions are mixed gently
and incubated for 20 min at room temperature. Thereafter, 200 μl of the DNA-liposome
complexes are added into the cells growing with complete medium and incubate the cells for 72h
in a 5% CO2 incubator at 37 °C.
A7. Lentiviral transfection
Lentivirus generation: AD-293 cells (Agilent Technologies, Santa Clara, CA) are seeded
in T25 flask with 80% confluency before transfection. The complete medium of AD-293 (10%
FBS DMEM supplemented with 2 mM GlutaMAX, 100 units/ml of penicillin, and 0.1 mg/ml of
streptomycin) is changed to the same medium without antibiotics before transfection. 2.5 μg of
pLKO.1 Lentiviral PGR shRNA plasmid (TRCN0000003321, Dharmacon), 0.625 μg of pCMV-
VSV-G envelope vector and 1.875 μg of packaging vector pCMV-dR8.2 dvpr are mixed and
diluted into 250 μl of Opti-MEM. At the same moment, 10 μl of EndoFectin Max reagent
(Genecopoeia) is added into 240 μl of Opti-MEM. Gently mix the two solutions well and
incubate for 20 min at room temperature. Add the mixture drop-by-drop into the medium of
112
AD-293 cells and incubate overnight in a 5% CO2 incubator at 37 °C. Fresh complete medium is
changed on the next morning (day 2), start to collect the medium after another 24 hours
incubation (day 3). Repeat the medium changing step on day 3 and collect the medium on day 4.
Combine the medium collected on two subsequent days, centrifuge the medium at 1250 rpm for
5 min to remove the cell debris. Then the supernatant of the medium is ready to infect the target
cells or freeze in -80 °C for long-term storage.
T47D cells infection: The optimal puromycin concentration should be determined before
handling the lentivirus. Generally, the optimal puromycin concentration would cause cells
complete death in 3-5 days. Change the cell culture medium with 8 μg/ml polybrene before virus
infection. T47D cells at 90% confluence are infected with viral particles (0.5 ml) and incubated
for 24 h. The virus containing medium is discarded on the next day and change with fresh
complete medium. 4 μg/ml of puromycin is used to select stable clones expressing the shRNA
after 24 h of infection. Cells with PGR protein shortage can be analyzed by immunoblot on the
seventh day after infection.
A8. Preparation of cells lysate
Cell pellets are suspended in in HEDG buffer (25 mM HEPES, 1 mM EDTA, 1 mM
DTT, 10% glycerol, adjusted pH to 7.4) containing 0.4 M KCl, 1% NP40 plus protease inhibitor:
PMSF (1 mM) and leupeptin (2 µg/ml) (Sigma-Aldrich). Whole cell lysates are prepared by
three cycles of freeze/thaw and incubation on ice for 30 min. The lysates are collected and
cleared by centrifugation (16,000 × g for 10 min at 4 °C). Dilute the cell lysates from 0.4 M KCl
buffer environment to 0.15 M KCl for long-term storage in -80 °C. Protein content in the lysate
supernatant is determined by bicinchoninic acid assay using Piece BCA protein assay reagents
(Thermal Fisher) and bovine serum albumin (BSA) as a standard. Briefly, prepare 10 mg/ml
113
BSA stock in H2O, then make several dilutes (using HEDG buffer as solvent) with the range
from 0-1 mg/ml as standards. Cell lysates need to be diluted 1:5 - 1:20 in HEDG buffer in order
to keep the concentrations in the linear range of BCA standards. For 96-well plate measurement,
10 µl of standard or diluted sample replicate need to load into each well. After that, 190 µl of
BCA working reagent (50 parts of Reagent A plus 1 part of Reagent B, v/v) is added into each
well. Incubate the whole plate in 37 °C incubator for 30 min. The absorbance reading is
performed in a UV-spectrometer at 562 nm.
A9. Western Blot
Appropriate amount of protein is mixed well with treatment buffer (62.5 mM Tris-HCl
pH 6.8, 10% glycerol, 4% SDS, 0.02% Bromphenol blue plus 5% 2-mercaptoethanol), and then
heated at > 95 °C for 1.5 min to denature the proteins. M-XStable prestained protein ladder
(UBPBio) and denatured protein samples are subjected to electrophoresis on SDS-PAGE gels in
1× TGS buffer (VWR) at 200 volts until all the dye front reach the bottom of the gel. Then,
assemble the transfer “sandwich” following the order (from black to clear frame) of sponge, two
layers of filter paper, gel, nitrocellulose membrane, two layers of filter paper, sponge. Wet
transferring is run in transfer buffer (25 mM Tris, 192 mM glycine and 20% methanol) at 300
mA for 120 min at 4 °C. Total protein stain (optional) is performed after wet transferring, the
membrane is removed from transfer apparatus and rinsed with dH2O. Incubate the membrane
with 5 mL of REVERT Total Protein Stain (LI-COR) for 5 minutes with shaking. Afterward, the
membrane is rinse twice with wash buffer and dH2O successively and subjected to Odyssey
image system at 700 nm channel. Then destain the membrane in 5 ml removal buffer with 5 min
shaking. The membrane is placed in 20ml of blocking buffer (PBS solution containing 5%
bovine serum albumin, 0.1% (v/v) Tween-20 and 0.05% sodium azide) for 1 hour with shaking at
114
room temperature. Primary antibodies and IRDye-conjugated secondary antibodies are diluted in
blocking buffer. Incubate the membrane with primary antibody overnight with gentle shaking at
4 °C. The membrane is washed five times in PBST, with 5 min shaking each time. Then the
membrane is incubated in secondary antibody at room temperature for 2 hours. Wash the
membrane in the same way as primary antibody wash. The protein signals on the membrane are
visualized using the LI-COR CLx Odyssey system. The intensity of target protein bands was
quantified relative to the signals obtained from GAPDH or β-actin protein or Revert total protein
staining.
Table 3
Recipe for SDS-PAGE gel (2 × gels, Bio-Rad 1.5mm spacer)
Resolving gel Stacking gel
10% 12% 15% 16.5%
H2O (ml) 8.2 6.9 4.8 3.8 H2O (ml) 3.4
acrylamide/bis-
acrylamide
(30/0.8) (ml)
6.7 8.0 10.1 11.1
acrylamide/bis-
acrylamide
(30/0.8) (ml)
0.575
1.5 M Tris Buffer, pH
8.8 (ml) 5
0.5 M Tris Buffer, pH
6.8 (ml) 1.25
10 % ammonium
Persulfate (μl) 100
10 % ammonium
Persulfate (μl) 50
TEMED (μl) 10 TEMED (μl) 5
A10. Co-immunoprecipitation
Prepare cell lysates as above mentioned to collect adequate protein amount (200 μg-2
mg). Incubate lysate with 1st primary antibody (check the antibody datasheet for recommended
antibody amount) at RT for 30 min. While incubating, pre-equilibrate Dynabeads protein G
magnetic beads (Invitrogen) at RT as following: aliquot 3 μL of homogeneous magnetic beads
into each GeneMate microfuge tube (BioExpress). 0.5 mL of dH2O is added into each tube, tap
115
the tube to resuspend the beads in water, then put the tubes on magnetic holders for 1min and
discard the soup. Repeat the washing step for three times. After the last wash, wash the beads
with 0.5 mL of IP buffer (HEDG buffer containing 150 mM NaCl and 0.1% Tween-20) to finish
pre-equilibration. Completely remove all the IP buffer after quick spin, then mix the samples
with IP buffer containing 1 mg/mL of BSA and pre-equilibrated beads. Incubate the mixture
under gentle rotation (50 rpm) in 4 °C for 16-18 h. On the next day, discard the supernatant from
the beads. Wash the beads three times with IP buffer. For each wash, 1 ml IP buffer is gently
mixed with the beads by 5 min rotation at 4 °C and discard the supernatant after pulling the
beads to the tube wall on magnet. After the last wash, quick spin the tube to remove all buffer.
Add 40 μL treatment buffer in each tube and vortex vigorously to elute the protein from beads.
A11. RT-qPCR
RNA isolation: Add 400 μl TRI Reagent for each well of 12-well plate and mix well by
pipetting. Incubate the mixture for 5 minutes at RT. 400 μl of ethanol (200 proof) is added in
each well and mixed completely. The purification of RNA is performed by Direct-zol RNA
miniprep PLUS kit (Zymo). Transfer the mixture into a Zymo-Spin Column in a Collection
Tube and centrifuge at 12500 × g for 30 s. Transfer the column into a new collection tube and
discard the flow-through. Wash the column with 400 μl RNA Wash Buffer and spin down to
remove the flow-through. Add DNase I dilute (for each RXN: 5 μl DNase I (6 U/μl) plus 75 μl
DNA Digestion Buffer) to the column matrix and incubate at RT for 15 min. Then wash the
column with 400 μl Direct-zol RNA PreWash twice and 700 μl RNA Wash Buffer, successively.
Completely remove the wash buffer by 2.5 min centrifuge. Then add 50 μl of nuclease-free H2O
to elute the RNA from the column. The eluted RNA can be used immediately for 1° cDNA
synthesis or stored at -80 °C in the presence of RNase inhibitor (0.3 μl each).
116
MMLV High Performance Reverse Transcriptase cDNA Synthesis: For each reaction in
order to denature RNA and anneal primers, combine 1 µg of RNA, 2 µL of random primer (1:5
dilution) and H2O to a final volume of 10 µL on ice, in a sterile (RNase-free) 0.2-ml PCR tube.
The PCR tube is heated at 65 °C for 2 min, and 4 °C for 1 min in thermocycler. After that,
transfer 10 µl of the following mix into each tube: 3 µl of RNase-free water, 2 µl of 10× MMLV
buffer, 2 µl of 100 mM DTT, 0.5 µl of ScriptGuard RNase inhibitor, 2 µl of dNTP mix and 0.5
µl of MMLV high performance reverse transcriptase (Lucigen). The reaction is performed in
thermal cycler with 10 min at RT, followed by 37 °C for 1 h. Terminate reaction is processed by
heating at 85 °C for 5 min and cooling off for 1 min in thermocycler. The product can be stored
at -80 °C.
RT-PCR detection: For each reaction, add 1 µl of cDNA template (target genes using
neat cDNA, housekeeping gene use 1:1000 diluted cDNA) in 19 µl SYBR Green mix (10 µl of
iTaq SYBR Green master mix (Bio-Rad), 2 µl of forward and reverse primers (400 nM final
dilution), 5 µl of RNase-free H2O). The PCR thermal cycle condition for AHR is as following:
start with 95 °C for 30 s, 40 cycles of 95 °C for 10 s, followed by 60 °C for 1 min with
fluorescence readings taken at 60 °C. The fold changes in the level of these genes between
treated and untreated cells were normalized by the levels of 18S. The PCR data were analyzed
using ΔΔCT methods by the following equation: fold change = 2−Δ(ΔCT
), where ΔCT = CT(target)
- CT(18S) and ΔΔCT = ΔCT(treated) - ΔCT(untreated).
A12. Muse cell analysis
Muse cell analyzer let the single cell suspension flow through the microcapillary tube and
the fluorescent of the cells will be captured and converted into signals. Simple and non-imaging
117
assays (ex. cell counting and viability, cell apoptosis, cellular signaling) can be done using Muse
cell analyzer.
a. cell death and apoptosis
Cell apoptosis are detected based on the structural integrity status of cell membrane.
Once the cells started apoptosis, the phosphatidylserine will be externalized to the cell surface,
where the dead cell marker will bind to the molecules. Cells with pre-treatment are dissociated
from culture vessels and resuspended in complete media (contains at least 1% FBS) at cell
density with the range from 1×105 to 5×105 cells/ml. 100 μl of the cell suspension is mixed with
100 μl of Muse Annexin V & Dead Cell Reagent in sample tube. Incubate the cell mixture at RT
for 30 min in the dark. Use a negative (healthy cells without any treatment) and positive control
(cells with treatment that caused almost all the cells dead) to set up and validate the detection
methods. The first plot is to exclude debris based on size by dragging up/down the threshold
marker. The second plot allows to sort cells on four cell populations-live, early apoptotic, late
apoptotic, and dead. After adjusting the instrument, use control cells to verify the settings. All
the samples need to vortex for 3-5s before injection. When the readings are done, two plots and
statistics can be export as Excel and original file for further analysis.
b. ROS detection
The Muse Oxidative Stress Reagent contains dihydroethidium, which can be oxidized to
fluorophore ethidium bromide that bound to DNA and given the red fluorescence. Muse
Oxidative Stress Reagent need to be diluted 1:8000 in 1× Assay Buffer to make the working
solution. Cells are resuspended in 1× Assay Buffer at the density between 1 × 106 to 1 × 107
cells/ml. 10 μl of the cell suspension is mixed well with 190 μl of working solution in sample
tube. Incubate the cell suspension at 37 °C for 30 min in the dark, then cell samples are
118
subjected to the cell analyzer. Use negative control (non-treated cells) and positive control (cells
with oxidant treatment that cause the cells generate abundant of ROS) to adjust the instrument
settings. The first plot is still to eliminate cell debris. The second histogram divides the cell
populations into two part: ROS+ and ROS-.
A13. Ethoxyresorufin O-deethylase (EROD) assay
EROD assay is used to determine the CYP1A1 enzyme activity by which catalyzes the
reaction from 7-ethoxyresorufin to fluorescent resorufin. 5 × 104 cells are seeded onto 24-well
plate. After appropriate treatment, discard the medium and the cells are washed once with 0.5 ml
of PBS. Cells are incubated with 0.5 ml of fresh media supplemented with 2.5 μM 7-
ethoxyresorufin and 10 μM dicumarol. After 1-hour incubation in 37 °C, 100 μl of the
supernatant is transferred from each well into a black 96-well plate with clear bottom and
formation of resorufin is measured by fluorescence using a Molecular Devices Softmax
spectrophotometer (excitation at 544 nm, emission at 590 nm). The relative EROD activity was
calculated by subtracting the sample fluorescence with the background fluorescence in which the
media contained the same ingredients in the absence of cells.
A14. Proximity ligation assay (PLA)
4×105 cells are seeded on the coverslip preplaced on a 12-well plate. After each
treatment, cells are fixed and permeabilized by chilled 100% methanol at RT for 5 min. The
cells need to be washed three times with cold PBS. For each well, add one drop of Duolink
Blocking Solution to cover the whole coverslip and incubate the whole plate at 37 °C for 1 hour.
Next add 40 μl of primary antibodies (two antibodies raised from rabbit and mouse, respectively)
onto coverslip, incubate for 1 hour at 37 °C. Primary antibodies are diluted (dilution ratio is
based on datasheet recommended concentration for immunocytochemistry or use 10 folds of
119
western blot-used concentration) in Duolink Antibody Diluent. Mixed and diluted (1:5 dilution
in Duolink Antibody Diluent) anti-rabbit PLUS and anti-mouse MINUS probes are then applied
to the cells for 1 hour at 37 °C. Then ligase (1:40 dilution in Duolink Antibody Diluent) and
polymerase (1:80 dilution in Duolink Antibody Diluent) are incubated with the cells for 30 min
and 100min at 37 °C, successively. The coverslips are washed twice with 1× wash buffer A for
5 min between each incubation steps. After the amplification step, cells are washed twice with
1× wash buffer B for 10 min each followed by one wash with 0.01× wash buffer B for 1min.
Cells are mounted before imaging with DAPI (0.5 μg/ml in water) for 2 min at room
temperature. Fluorescence images were acquired by fluorescence microscope in 20× objective
(Keyence BZ-X700).
120
APPENDIX B: LIST OF OLIGONUCLEOTIDE PRIMERS
ahr RT-PCR
OL615 5’-ACATCACCTACGCCAGTCGC-3’
OL616 5’-TCTATGCCGCTTGGAAGGAT-3’
cyp1a1 RT-PCR
OL109 5’-GGCCACATCCGGGACATCACAGA-3’
OL110 5’-TGGGGATGGTGAAGGGGACGAA-3’
cyp1a2 RT-PCR
OL788 5’-CTGGGCACTTCGACCCTTAC-3’
OL789 5’-TCTCATCGCTACTCTCAGGGA-3’
cyp1b1 RT-PCR
OL333 5’-CACCAAGGCTGAGACAGTGA-3’
OL334 5’-GATGACGACTGGGCCTACAT-3’
nqo1 RT-PCR
OL468 5’-TGAAGGACCCTGCGAACTTTC-3’
OL469 5’-GAACACTCGCTCAAACCAGC-3’
ugt1a1 RT-PCR
OL792 5’-TTGTCTGGCTGTTCCCACTTA-3’
OL793 5’-GGTCCGTCAGCATGACATCA-3’
ahrr RT-PCR
OL794 5’-GCGCCTCAGTGTCAGTTACC-3’
OL795 5’-GAAGCCCAGATAGTCCACGAT-3’
18s RT-PCR
121
OL96 5’-CGCCCCCTCGATGCTCTTAG-3’
OL97 5’-CGGCGGGTCATGGGAATAAC-3’
pGFP2-N2-AHR cloning
OL856 5'-
GAGAATTCTCACGCGTCTGCAGGATACCATGAACAGCAGCAGCGCCAACATC
-3'
OL857 5’-
CGGGCCCGCGGTACCGCAAGCTTGATACAGGAATCCACTGGATGTCAAATCA
GG-3’
pGFP-N2 sequencing set
OL858 5’-TCGCCGGACACGCTGAACT-3’
OL859 5’-TGGCACCAAAATCAACGGGACTT-3’
pGFP2-N2-AHR ND515 cloning
OL869 5’-
GAGAATTCTCACGCGTCTGCAGGATACCATGCAGCCTCAGGATGTGAACTCA
TTTG-3’
OL857 5’-
CGGGCCCGCGGTACCGCAAGCTTGATACAGGAATCCACTGGATGTCAAATCA
GG-3’
pGFP2-N2-AHR-aa516-600 cloning
OL869 5’-
GAGAATTCTCACGCGTCTGCAGGATACCATGCAGCCTCAGGATGTGAACTCA
TTTG-3’
122
OL870 5’-
CGGGCCCGCGGTACCGCAAGCTTGATGTTGATAATCTGAAGGTATGAAGGGA
GA-3’
Mutate pGFP2-N2-AHR-aa516-600
OL875 5’-
GACATCAGACACATGCAGAATGCAAAAGCTTTCAGAAATGATTTTTCTGGTG
AGG-3’
OL876 5’-
CCTCACCAGAAAAATCATTTCTGAAAGCTTTTGCATTCTGCATGTGTCTGATG
TC-3’
123
APPENDIX C: GLYCEROL STOCK NUMBERS
Glycerol # Construct Strain
GS168 pGFP2-N2 XL1-Blue
GS192 pEGFP-AHR-CD553 JM109
GS370 pLKO.1-p23siRNA1475 Stbl3
GS375 pLKO.1-shRNA Stbl3
GS655 pcDNAHygro(+)LAMP2AS NEB 5-alpha
GS673 pcDNAHygro(+) NEB 5-alpha
GS687a&b pCMV-hERalpha DH5alpha
GS688a&b pcDNA3/PRB DH4alpha
GS689a&b pGFP2-N2-AHR XL1-Blue
GS691a&b pGFP2-N2-ND515 XL1-Blue
GS692a&b pGFP2-N2-AHR aa516-600 XL1-Blue
GS693a&b pLKO.1 lentiviral PGR shRNA Stbl3
GS708a&b
pGFP2-N2-AHR aa516-600
mutant
XL1-Blue