regulation of mitotic bubr1 phosphorylation by the bubr1 ...regulation of mitotic bubr1...
TRANSCRIPT
Regulation of mitotic BubR1 phosphorylation by the BubR1 pseudokinase domain
Mémoire
Michelle Mathieu
Maîtrise en biologie cellulaire et moléculaire
Maître ès sciences (M. Sc.)
Québec, Canada
© Michelle Mathieu, 2015
iii
Résumé
BubR1 est une protéine importante dans le point de contrôle de la mitose pour la stabilisation
des interactions entre kinétochores et microtubules (KT-MT). Ces fonctions protègent de la
ségrégation anormale des chromosomes et de l’instabilité du génome. BubR1 possède des
sites de phosphorylation mitotique hautement conservés dans le domaine régulant
l’attachement des kinétochores (KARD), où S676 et S670 sont phosphorylées
respectivement par la kinase polo-like 1 (Plk1) et par la kinase cycline-dépendante 1 (Cdk1).
Ces sites de phosphorylation sont essentiels pour le recrutement de la phosphatase PP2A-
B56, qui stabilise les interactions KT-MT. Nos résultats montrent que la délétion entière ou
des mutations qui déstabilisent le domaine pseudokinase de BubR1, causent la perte de
phosphorylation des résidus S676 et S670 en mitose. Notre hypothèse est que le domaine
pseudokinase de BubR1 peut jouer un rôle essentiel dans la régulation de la phosphorylation
du KARD et donc dans la stabilisation des interactions KT-MT.
v
Abstract
The mitotic protein BubR1 functions in the spindle assembly checkpoint (SAC) by stabilizing
kinetochore-microtubule (KT-MT) interactions. These functions protect the cell from
abnormal chromosome segregation and genome instability. BubR1 has highly conserved
mitotic phosphorylation sites in the kinetochore-attachment regulatory domain (KARD); the
residue S676 is phosphorylated by polo-like kinase-1 (Plk1) and S670 is phosphorylated by
cyclin-dependent kinase-1 (Cdk1). These phosphorylation sites are essential for KARD
recruitment of protein phosphatase PP2A-B56, which stabilizes KT-MT interactions. Our
results show that mutations that cause pseudokinase domain instability and a highly stable
truncation mutant of BubR1 were found to cause loss of mitotic S676 and S670
phosphorylation. We hypothesize that the pseudokinase domain of BubR1 may play an
important role in the regulation of KARD phosphorylation and thus the stabilization of KT-
MT interactions.
vii
Table of Contents
Résumé ............................................................................................................................................. iii Abstract ............................................................................................................................................. v Table of Contents ............................................................................................................................ vii List of Tables ..................................................................................................................................... ix List of Figures .................................................................................................................................... xi List of Abbreviations: ...................................................................................................................... xiii Dedication ....................................................................................................................................... xv Acknowledgements ....................................................................................................................... xvii I Introduction ..................................................................................................................................... 1
I.1 Cell Cycle .................................................................................................................................................... 1 I.1.1. G1 phase ............................................................................................................................................ 2 I.1.2. Restriction Point ............................................................................................................................... 2 I.1.3. S phase .............................................................................................................................................. 3 I.1.4. G2 phase ............................................................................................................................................ 3 I.1.5. G2/M Checkpoint .............................................................................................................................. 3 I.1.6. M phase ............................................................................................................................................. 4 I.1.7. Spindle Assembly Checkpoint .......................................................................................................... 6
I.2. Post-translational modifications .............................................................................................................. 7 I.2.1. Protein Kinases ................................................................................................................................. 7
I.2.1.1. Mitotic Kinases .......................................................................................................................... 9 I.2.1.1.1. Cdk1 ................................................................................................................................... 9 I.2.1.1.2. Plk1 .................................................................................................................................. 10 I.2.1.1.3. Mps1 ................................................................................................................................ 10 I.2.1.1.4. Bub1 ................................................................................................................................. 11 I.2.1.1.5. Aurora B ........................................................................................................................... 11
I.2.2. Phosphoprotein Phosphatases ......................................................................................................... 12 I.2.2.1. Mitotic Protein Phosphatases .................................................................................................. 12
I.2.2.1.1. PP1 ................................................................................................................................... 12 I.2.2.2.2. PP2A ................................................................................................................................ 13
I.3. Pseudokinases ........................................................................................................................................ 13 I.3.1. Mitotic Pseudokinase: BubR1......................................................................................................... 14
I.3.1.1. Functions of BubR1 ................................................................................................................. 16 I.3.1.1.1. BubR1 in Spindle Assembly Checkpoint ......................................................................... 16 I.3.1.1.2. KT-MT attachment .......................................................................................................... 17 I.3.1.1.3. Timer Function ................................................................................................................. 18
I.3.1.2. BubR1 Domains ...................................................................................................................... 19 I.3.1.2.1. KEN boxes ....................................................................................................................... 20 I.3.1.2.2. TPR domain ..................................................................................................................... 20 I.3.1.2.3. GLEBS domain ................................................................................................................ 21 I.3.1.2.4. KARD domain ................................................................................................................. 22 I.3.1.2.5. Pseudokinase domain ....................................................................................................... 23
I.4. BubR1 and Disease ................................................................................................................................. 24 II. Context of My Study .................................................................................................................... 27 III. Materials and Methods............................................................................................................... 29
III.1. Plasmid Preparations ............................................................................................................................ 29
viii
III.2. Mutagenesis ......................................................................................................................................... 29
III.3. Cell Culture ............................................................................................................................................ 30
II.4.Transfections .......................................................................................................................................... 30 III.4.1. siRNA Transfections: INTERFERin ............................................................................................ 30 III.4.2. Plasmid Transfections: JetPrime .................................................................................................. 31 III.4.3. Electroporation: Flip-in System ................................................................................................... 31
III.5. Okadaic Acid Hyperphosphorylation Assay .......................................................................................... 32
III.6. ImmunoPrecipitation and Pull-Down .................................................................................................... 33
III.7. Western blot ......................................................................................................................................... 34
III.8. Immunofluorescence ............................................................................................................................. 34
III.9.Analysis via ImageJ ................................................................................................................................ 35 IV. Results ....................................................................................................................................... 41
IV.1. Pseudokinase domain mutations cause a loss of stability and hyperphosphorylation ......................... 41
IV.2. Pseudokinase BubR1 stability causes loss of BubR1 phosphorylation .................................................. 42
IV.3. Mutation of other conserved kinase domain residues does not alter phosphorylation status ............. 43
IV.4. Creation of BubR1 truncated pseudokinase stable cell line .................................................................. 45
IV. 5. BubR1 pseudokinase mutations BubR1KD and BubR1731X are never hyperphosphorylated ................. 45
IV. 6. Loss of BubR1 phosphorylation S676 and S670 by pseudokinase domain mutations ......................... 47
IV. 7. BubR1KD and BubR1731X show loss of pS676 and pS670 through immunofluorescence ....................... 50
IV. 8. Plk1-BubR1 binding remains intact despite loss of Plk1 hyperphosphorylation .................................. 53
IV. 9. Loss of BubR1-Bub3 interaction causes loss of S676 phosphorylation ................................................ 54 V. Discussion ................................................................................................................................... 57 VI. Conclusion and Perspectives ...................................................................................................... 63
VI. 1. Perspectives ......................................................................................................................................... 63 References ...................................................................................................................................... 67
ix
List of Tables
Table 1. Table of Primers ..................................................................................................... 37
Table 2 Table of Plasmids .................................................................................................... 38
Table 3. Table of Antibodies ................................................................................................ 39
xi
List of Figures
Figure 1 The cell cycle. ........................................................................................................... 1
Figure 2 Phases of mitosis. ..................................................................................................... 4
Figure 3 Spindle assembly checkpoint pathway. .................................................................... 6
Figure 4 Critical sequence alignment of conserved motifs. .................................................... 8
Figure 5 Parallel evolution of MADBUB paralogs. ............................................................. 14
Figure 6 Model for KT-MT attachment stabilization. .......................................................... 18
Figure 7 BubR1 domains. ..................................................................................................... 19
Figure 8 GLEBS BubR1 domain. ......................................................................................... 21
Figure 9 BubR1 evolutionary KARD domain conservation. ................................................ 22
Figure 10 MVA Mutants. ...................................................................................................... 25
Figure 11 BubR1 conserved pseudokinase residue mutation. .............................................. 27
Figure 12 BubR1 stability and hyperphosphorylation loss due to conserved pseudokinase
residue mutation. ................................................................................................................... 41
Figure 13 MVA and BubR1KD mutations. ............................................................................ 42
Figure 14 Pseudokinase motif II, VI and VII mutations and pseudokinase truncation mutation
(BubR1731X)........................................................................................................................... 44
Figure 15 Expression of BubR1. ........................................................................................... 45
Figure 16 No hyperphosphorylation of BubR1KD or BubR1731X. ......................................... 46
Figure 17 The α-pS435 is mitotic and phospho-specific. ..................................................... 47
Figure 18 Comparative phosphorylation of equal relative BubR1 levels. ............................ 48
Figure 19 siBubR1 effectively knock-down endogenous BubR1. ....................................... 50
Figure 20 Loss of pS670 and pS676 in pseudokinase domain mutations were confirmed. . 52
Figure 21 Plk1 binds to all BubR1 cell line mutations. ........................................................ 53
Figure 22 Forced localization does not rescue the BubR1 S676 phosphorylation. .............. 54
Figure 23 siCenpE reduces levels of BubR1 while increasing BubR1 phosphorylation. ..... 64
xiii
List of Abbreviations:
A: (Ala) Alanine
APC/C: Anaphase promoting complex or cyclosome
ATP: Adenosine-5’-Triphosphate
BUB: Budding uninhibited by benzimidazole
BUB1B: Budding uninhibited by benzimidazole 1 beta
BUBR1: Budding uninhibited by benzimidazole-related 1
C: (Cys) Cysteine
Cdc20: Cell division cycle 20
Cdk1: Cyclin-dependent kinase 1
CenpE: Centromere-associated protein E
D: (Asp) Aspartate
DNA: Deoxyribonucleic acid
E: (Glu) Glutamate
F: (Phe) Phenylalanine
G: (Gly) Glycine
G1: Gap 1
G2: Gap 2
GLEBS Gle2-binding sequence
H: (His) Histadine
I: (Ile) Isoleucine
K: (Lys) Lysine
KD: Kinase dead
KEN-box Lys-Glu-Asn-box
KMN: Knl1/Mis12/Ndc80 complex
Knl1 Kinetochore null 1
KT: Kinetochore
L: (Leu) Leucine
M: (Met) Methionine
M phase: Mitotic phase
Mad: Mitotic arrest deficient
MCC: Mitotic checkpoint complex.
Mps1: Monopolar spindle 1
mRNA Messenger RNA
MT: Microtubule
N: (Asn) Asparagine
NEBD: Nuclear envelope breakdown
OA: Okadaic acid
P: (Pro) Proline
PBD: Polo-box domain
PKA: Protein kinase A
Plk1: Polo-like kinase 1
PP1: Protein Phosphatase 1
PP2A: Protein Phosphatase 2A
PTC : Premature termination codons
Q: (Gln) Glutamine
R: (Arg) Arginine
Rb: Retinoblastoma
RNA: Ribonucleic acid
S: (Ser) Serine
S phase: Synthesis phase
SAC: Spindle assembly checkpoint
xiv
siRNA: Small interfering RNA
T: (Thr) Threonine
TPR: Tetratricopeptide repeat
UTR: Untranslated region
V: (Val) Valine
W: (Trp) Tryptophan
WCE: Whole cell extract
Y: (Tyr) Tyrosine
xv
Dedication
I dedicate this work and research to my family, my father Gaetan Mathieu, my mother Karen
Marks, my brother Georges Mathieu and the sister of my heart Katherine Rheuark.
xvii
Acknowledgements
My sincere thanks to Dr. Sabine Elowe for her time and the knowledge that she has
imparted to me and to Philippe Thebault for training me in the various techniques used in the
laboratory. I would like to acknowledge Dr. Elowe for performing the siRNA transfection of
the CenpE assay and Philippe Thebault for the creation of the BubR1WT and BubR1KD stable
cell lines, and the testing of the pS435 antibody. Thank you, Danielle Caron and Guillaume
Combes for all your help, particularly in French. I would like to thank Adeel Ashgar, Luciano
Gama-Braga and Audrey Lajeunesse for all their time and aid during our work together. I
would like to thank Dr. Denis Soulet for his aid with ImageJ and a thanks to Dr. Patrick
Meraldi for the HHFR5 cells. I would also like to acknowledge the NSERC, FRQNT, and
CIHR for providing the funding for my research.
1
I Introduction
The adult human body is comprised of approximately 3.72 ± 0.81 x 1013 cells1. These cells
are derived from a single zygote, which repeatedly divides via the cell division cycle2.
Careful replication of genetic information and equal division of chromosomes is necessary
to ensure the integrity and viability of daughter cells. The cell division cycle (cell cycle) is a
series of cellular events responsible for cellular growth, replication of genetic information
and division of material into two daughter cells3-5. In 1989, Murray and Kirschner suggested
that the cell cycle is controlled by both, cell cycle timers and checkpoints. These timers and
checkpoints ensure the careful regulation of the cell cycle, as each successive cell cycle event
is dependent on the accurate completion of previous events3.
I.1 Cell Cycle
Figure 1 The cell cycle.
The four major phases of the cell cycle, G1, S, G2 and Mitosis, including Cytokinesis and G0. The cell
depictions indicate relative chromosome content in relation to the cell cycle phases. G1 and G0 are diploid
with two copies of every chromosome. S and G2 are tetraploid with duplicate copies of the original two
chromosomes. The progress through mitosis and cytokinesis begins with tetraploid cells and ends with equal
division of chromosome copies resulting in diploid daughter cells. (Figure from website:
http://www2.le.ac.uk/departments/genetics/vgec/schoolscolleges/topics/cellcycle-mitosis-
meiosis6)
2
The cell cycle can be divided into two major phases: interphase and the mitotic (M) phase
(Figure 1)7. The cell spends most of its life in interphase. Interphase can be further divided
into three phases: the Gap 1 (G1) phase, the Synthesis (S) phase, and the Gap 2 (G2) phase7.
Interspersed between these phases are three major checkpoints that arrest cell cycle
progression until essential cell cycle processes can be completed8. These checkpoints are
known as the restriction point, the G2/M checkpoint and the spindle assembly checkpoint
(SAC)7,8.
I.1.1. G1 phase
The first phase of the cell cycle, after the completion of cellular division, is the G1 phase
(Figure 1)7. During the G1 phase, the cell integrates intercellular, metabolic, stress and
environmental signals9. Then the cell must trigger one of several pathways: 1) To enter a
quiescent state known as G0, 2) to commence the cell division cycle or 3) to activate
programmed cell death. Regulation of cell cycle progression is predominantly controlled by
cyclin-dependant kinases (Cdk) and cyclins, regulatory Cdk subunits5. Progression through
G1 requires regulation by Cdk4 or Cdk6, which complexes with cyclin D10. Cyclin D has a
high turnover rate due to its instability and thus, cyclin D levels require continued mitogenic
signalling to induce protein expression, synthesis and assembly with their Cdk partners10.
I.1.2. Restriction Point
The first checkpoint, the G1/S checkpoint (restriction point in mammals), is the juncture
at which the cell commits itself to cellular division. This restriction point is controlled by
active retinoblastoma (Rb) protein family members that suppress cellular growth through
inhibition of gene transcription11. Mitogenic signalling allows for activation of Cdk4 or Cdk6
by cyclin D causing the phosphorylation of Rb protein family members and the subsequent
deactivation of Rb protein activity10,11. This reduction of gene transcription inhibition allows
for cyclin E expression10. Cyclin E complexes and activates Cdk2. Cdk2-cyclin E,
irreversibly deactivates Rb proteins through hyperphosphorylation12. Once the cell
overcomes the restriction point the cell is committed to completing the entire cell cycle. The
cell activates Cdks, such as Cdk2 via the interaction with cyclins E1, E2 and A promoting
entry into the S phase and DNA replication9,13,14.
3
I.1.3. S phase
The second phase of the cell cycle is the S phase, in which DNA synthesis occurs (Figure
1)7. Activated Cdk2-cyclin E is considered essential for facilitating the initiation of DNA
replication; however, this complex is deactivated in early S phase to prevent re-replication
of the DNA sequences12. Cdk2-cyclin E autophosphorylates cyclin E, thereby targeting the
cyclin for degradation15. The regulation of Cdk2-cyclin E is tightly controlled, as errors could
cause genomic instability and tumorigenesis. As S phase concludes, cyclin A begins
associating with Cdk1. Both complexes Cdk2-cyclin A and Cdk1-cyclin A phosphorylate
substrates involved with DNA replication and cell cycle progression12.
I.1.4. G2 phase
The G2 phase follows the S phase (Figure 1)8. During the G2 phase, cyclin A begins to be
degraded and cyclin B is synthesized allowing for Cdk1-cyclin B complex formation12. The
Cdk1-cyclin A functions in the nucleus and Cdk1-cyclin B proteins function in the
cytoplasm16. These complexes phosphorylate proteins necessary to ensure that all DNA
synthesis is complete, and errors such as DNA damage are corrected prior to entry into the
next phase. This step is controlled by the G2/M Checkpoint.
I.1.5. G2/M Checkpoint
Before the cell can proceed into the M phase, the cell must overcome the G2/M checkpoint.
This checkpoint ensures that the cell’s genetic material is replicated successfully and without
DNA damage4. Near the end of the G2 phase, a large percentage of the Cdk1 is associated
with the cyclin B, and activated Cdk1-cyclin B promotes the entry into mitosis12,17. Cdk1
activity is inhibited by its phosphorylation on T14/Y15, by kinases such as Wee1 and Myt117
A multitude of parallel feedback loops regulates the balance between Cdk1 inhibition and its
activation; when the balance shifts in favor of Cdk1 activation progression into M phase
occurs.
4
I.1.6. M phase
During the M phase of the cell cycle, the doubled contents of the cell are partitioned into
two daughter cells8. The activation of Cdk1-cyclin B complex has been seen to specifically
regulate mitotic entry and targets a variety of mitotic proteins5. This activity triggers a series
of morphological alterations, which have been categorized into five mitotic phases: prophase,
prometaphase, metaphase, anaphase, and telophase (Figure 2)8,19.
Prophase is the first stage of cellular division and is marked by the condensation of
chromatin into chromosomes, and the separation of the sister chromatids, except for their
Figure 2 Phases of mitosis.
There are five phases of mitosis: prophase, prometaphase, metaphase, anaphase and telophase. The
tetraploid cell exits the G2 phase and enters the first mitotic phase, prophase. In prophase, the spindle
fibers appear, and chromosomes condense. The cell then progresses into prometaphase, where the
nuclear envelope breaks down (NEBD), and the spindle fibers begin interacting with the
chromosomes. In metaphase, the chromosomes become aligned at the metaphase plate. The
transition from metaphase to anaphase is irreversible and controlled by the mitotic checkpoint. After
checkpoint satisfaction, the cells enter into anaphase, and the chromosomes are separated to the
opposing spindle poles. In telophase, the nuclear membrane reforms and chromosome condensation
is reversed. In cytokinesis, the cytoplasm is divided between the two daughter cells and the two
diploid daughter cells are separated. (Figure from website:
http://www2.le.ac.uk/departments/genetics/vgec/schoolscolleges/topics/cellcycle-mitosis-
meiosis18)
5
centromeres (Figure 2)8. The centromere is a region of the eukaryotic chromosome that
becomes visible as a site at which two sister chromatids remain connected2,20. The
centromeres serve as the foundations upon which protein complexes can localize during
mitosis2.
The second stage of mitosis is prometaphase during which the nuclear membrane breaks
down (NEBD), and the spindle microtubules (MTs) begin interacting with the centromeres
of the sister chromatids via their kinetochores (KTs; Figure 2)19. The KT is a large complex
composed of many proteins, localized to the chromosomal centromeres, to which the spindle
fibers attach and move the chromosomes in mitosis20.
The third stage of the mitotic phase is the metaphase19. During metaphase, chromosomes
are attached to spindle MTs and the chromosomes are pulled into alignment at the imaginary
metaphase plate located between the two opposing spindle poles (Figure 2)20. The SAC is a
mitotic checkpoint that arrests the cell before the onset of anaphase inhibiting mitotic
progression until all chromosomes are aligned at the metaphase plate and properly attached
to MTs2.
Once the cell progresses through the mitotic checkpoint, anaphase immediately
commences by the shortening of MTs, which pulls apart the sister chromatids to opposing
spindle poles2. In the final mitotic stage, telophase, the nuclear envelope reforms around the
DNA, and the chromosomes reverse the process of condensation. Cytokinesis occurs
dividing the cytoplasm between the two daughter cells by the formation of a plasma
membrane between the two daughter nuclei20.
6
I.1.7. Spindle Assembly Checkpoint
The SAC is an important, evolutionarily conserved, surveillance mechanism that delays
entry into anaphase until all chromosomes are properly attached to MTs21. This delay
promotes error correction and equal division of genetic material into two daughter cells. Cells
failing to achieve proper KT-MT attachments may have either unattached KTs or have non-
bioriented chromosomes (Figure 3)22,23. These improper attachments lead to the activation of
SAC signalling and the recruitment of major checkpoint proteins to the affected KTs21,24.
These checkpoint proteins include mitotic arrest deficient (Mad1 and Mad2), budding
uninhibited by benzimidazoles (Bub1 and Bub3), Bub1 related-1 (BubR1) and cell division
cycle 20 (Cdc20).
The activation of the SAC causes the formation of the mitotic checkpoint complex (MCC)
(Figure 3)25. The MCC is composed of Mad2, Bub3, BubR1 and Cdc20. This complex
functions to inhibit the anaphase-promoting complex/cyclosome (APC/C) from degrading
key mitotic proteins (Figure 3)25,26. The MCC interferes with APC/C activation by inhibiting
the APC/C’s association with co-activators, Cdh1 or Cdc2025,27. Proteins such as cyclin B1
Figure 3 Spindle assembly checkpoint pathway.
Errors that lead to chromosomal missegregation cause activation of the SAC, and trigger the formation of
the mitotic checkpoint complex (MCC). This complex is responsible for the inhibition of the anaphase-
promoting complex/cyclosome (APC/C), an E3 ubiquitin ligase. The APC/C ubiquinates key mitotic
proteins, such as cyclin B and securin, targeting these proteins for degradation, which then allows for mitotic
exit.
7
and securin are targets of ubiquination by APC/C and are subsequently degraded by the 26S
proteasome26. Cyclin B1 is necessary for the continued activity of Cdk1 during mitosis.
Securin inhibits separase activity and the degradation of securin frees separase. Separase is
then able to cleave the cohesin at centromeres, which hold the sister chromatids together.
Inhibition of APC/C, therefore, prevents separase release and prevents premature and
potentially unequal separation of the sister chromatids between daughter cells (Figure 3).
I.2. Post-translational modifications
Post-translational modifications (PTMs) of proteins are a major mode of cell cycle activity
regulation28-30. PTMs are enzymatically induced, chemical alterations of proteins after the
protein’s translation from mRNA31. These modifications are highly important and have the
potential to significantly alter the protein’s functional capabilities. PTMs can alter a protein’s
physical or chemical properties, conformational status and stability as well as their cellular
localization and activity. More than 400 specific PTMs have been discovered and among the
most common PTMs are phosphorylation, acetylation, ubiquitination, and sumoylation31,32.
I.2.1. Protein Kinases
The most common PTM discovered is phosphorylation, and kinases (the enzymes that
mediate this modification) account for 1.7% of all human genes32,33. Many proteins can
exhibit more than one functional role throughout the cell cycle and PTM by enzymes, such
as kinases, allows protein functions to be reversibly fine-tuned towards a specific function34.
A kinase is a protein responsible for the catalytic transfer of a high-energy phosphate, such
as the adenosine-triphosphate (ATP) γ phosphate, to another protein substrate20. The
predominant residues that are phosphorylated are serine, threonine and tyrosine and a kinase
usually targets residues residing in specific consensus motifs34. A given kinase can vary
greatly in the number of sites they are known to target, from a few key sites to hundreds of
sites across many proteins35. In one study on Saccharomyces cerevisiae, kinases were used
against in vitro substrate targets and it was found that 1 to 256 substrates could be recognized
by a given kinase, with an average of 47 targets recognized per kinase36.
8
Protein kinases are very similar structurally, however, they still maintain the ability to
select specific substrate targets through various mechanisms35,37. Kinase selectivity can be
controlled through structure, charge and hydrophobicity of the catalytic kinase cleft allowing
for the binding of only certain substrate motifs35. Proteomic screens have been performed to
discover the ideal substrate, consensus sequence, preferred by a particular kinase38-40. In
addition, other alternative methods of kinase specificity regulation exist. Some kinases make
use of docking sites or binding partners with docking sites providing an increased affinity for
the substrate to which the kinase interacts35. Phosphorylation specificity may also be
controlled by sequestering the kinase interactions to a specific time or location within a
cellular compartment (e.g., protein scaffold or cell cycle time point). Not all methods of
controlling kinase specificity are used by any one kinase; yet, these methods along with some
other modes of kinase phosphorylation regulation play a major role the control of cell cycle
division.
In eukaryotic organisms, protein kinases are one of the largest gene families28,33. The
protein kinase A (PKA) catalytic subunit was the first protein kinase structure to be solved
and is still used today as a prototype of the protein kinase superfamily41.
Figure 4 shows several characteristic amino acid, motifs found in functional kinases37.
These motifs are situated to allow for the resulting kinase structure to position both, the ATP,
and the protein substrate28. The enzyme then aids in the catalytic transfer of the phosphate
Figure 4 Critical sequence alignment of conserved motifs.
Multiple sequence alignment of important catalytic kinase consensus motifs: protein kinase A (PKA), human
Bub1 (hBub1) and human BubR1 (hBubR1) Essential mitotic residues are K72, D166, D184 (PKA
numbering) for catalytic activity are conserved in both hBub1 and hBubR1 proteins. (Adapted from
Suijkerbuijk, van Dam et al. 2012)
9
between the ATP and the target substrate. Hanks, Quinn et al., using multiple alignment of
known protein kinases, were the first to describe the 11 different subdomain motifs conserved
in protein kinases37. Subdomains, such as shown in Figure 4, were under intense scrutiny to
ascertain the functions of the each specific conserved region as it pertains to kinase activity37.
The first subdomain (Figure 4), motif I, is a Glycine-rich loop also called the P-loop
containing the consensus sequence (GxGxxG) and is found in both proteins that bind to
nucleotides as well as kinases42. The Glycine-rich loop acts as a flexible component of ATP
binding, normally lacking a firm structure in the absence of its ATP substrate37. The second
subdomain, motif II (VAIK) in PKA related proteins, carries a charged lysine. This lysine
stabilizes the α- and β- phosphates of the ATP to position the γ-phosphate for its catalytic
transfer to the substrate, in functional kinases. The Glutamate (E), in the motif III (Figure 4),
contains an invariant residue that is highly conserved in active kinases. The biochemical
function of the catalytic loop, motif VI (Figure 3), is suggested to aid in substrate proton
removal and help position the Mg2+ cofactor. The DFG subdomain, motif VII, is proposed to
be important for chelation of Mg2+ and modification of the ATP-binding site43. Although
these motifs are highly conserved within the PKA family of protein kinases, some kinases
within this family may express modified motifs, while still remaining active kinases.
I.2.1.1. Mitotic Kinases
Mitotic regulation relies heavily on PTM of cellular proteins44. A large number of these
proteins are phosphorylated by multiple mitotic kinases45. The regulatory network which
controls activation of the SAC needs to be tightly controlled with reversible PTMs to allow
for mitotic progression after SAC signalling has ceased34,46,47. Phosphorylation plays a major
role in SAC regulation, some of the mitotic kinases responsible include Cdk1, Plk1, Bub1,
Mps1, and Aurora B5,21.
I.2.1.1.1. Cdk1
Cell-cycle progression is driven by Cdks48. Cdks are a family of serine/threonine kinases,
which bind to and are activated by cyclins49. One mode of Cdk regulation is, in part, driven
by the production and destruction of its regulatory subunits, the cyclin proteins49. Mitotic
10
entry is carefully controlled by Cdk1 in a complex with cyclin B1. Prior to mitosis, Cdk1 is
kept in a quiescent state, due to phosphorylation of T14/Y158. This inhibitory
phosphorylation is lost as the cell enters mitosis8. During mitotic progression, various
proteins require phosphorylation by activated Cdk1 to promote downstream protein-protein
interactions50,51. Cdk1-cyclin B1 targets substrates with a serine or a threonine that precedes
a proline for phosphorylation44. Active Cdk1 is important for remaining in the M phase, as
the cell progresses to mitotic completion the Cdk1 is rapidly inactivated through degradation
of its cyclin co-factor52.
I.2.1.1.2. Plk1
Another family of serine/threonine kinases, which plays an important role in mitosis are
the polo-like kinases (Plks)53. These kinases aid in cellular division and proliferation
throughout various eukaryotic species. The Plk family members have a non-catalytic C-
terminal domain called the polo-box domain (PBD)53,54. In Plk1, two polo-box motifs appear
in tandem creating a 12-stranded β sandwich domain; this domain is necessary for Plk1
substrate recognition54. Proteomic studies have shown that both polo-boxes are essential for
proper Plk1 PBD-ligand binding to occur and are vital for protein localization and mitotic
metaphase to anaphase transition54,55. The prior phosphorylation of a serine or a threonine on
the Plk1 substrate targets is often required to prime the PBD docking site of the target
protein54. Both Cdk1 and Plk1 itself may act as priming kinases for generating this
phosphorylated PBD docking site54,56,57. For example, the BubR1 protein is phosphorylated
at T620 by Cdk1 allowing for the Plk1 PBD to target the BubR1 protein51. In the Plk1 PBD
two residues are found to be critical for ligand binding (H538 and K540)54; these residues
when mutated to alanine disrupt PBD ligand recognition, regardless of prior priming
phosphorylation of substrate target51,54,58. Plk1 has been seen to play a role in post-
translational regulation of several proteins involved in mitotic control, although only a few
Plk1 target substrates have been studied in detail53,59,60.
I.2.1.1.3. Mps1
Monopolar spindle 1 (Mps1) is an essential kinase for proper upstream mitotic
surveillance signalling and regulation of segregation61,62; however, only a few regulatory
11
proteins for the dynamic control of its function have been identified61,62. It has been proposed,
that as the Mps1 protein is recruited, increasing levels of Mps1 cause the proteins to
homodimerize and autophosphorylate63. This autophosporylation fully activates Mps1 kinase
catalytic activity. The Mps1 kinase protein primes the dividing cell at the end of interphase
in preparation for SAC activation64. During mitosis, the active Mps1 kinase is responsible
for the phosphorylation of the kinetochore null 1 (Knl1) MELT motifs allowing the
heterodimer Bub1-Bub3 to be recruited to the KT in response to SAC signalling61.
I.2.1.1.4. Bub1
Bub1 is also a serine/threonine kinase that plays an important role in protein recruitment
and centromere protein assembly65. Bub1 has been reported to phosphorylate substrates to
inhibit mitotic progression66. The N-terminal, non-catalytic region of the kinase, functions to
recruit proteins critical for mitotic inhibition, such as Mad1, Mad2, Bub3, BubR1, and CenpE
(centromere protein E)65,67. Kinase Bub1 and related pseudokinase BubR1 both
heterodimerizes with Bub3, a protein essential for their localization to the kinetochore68-70.
Bub1 is recruited to the kinetochores by prior phosphorylation of the Knl1 protein by Mps171.
Knl1 (Blinkin/Spc105/Spc7 homologue) is an evolutionarily conserved, KT protein that
functions as a protein scaffold during mitosis72. The N-terminal region of the Knl1 was found
to play a role in Bub1 phosphorylation of histone H2A, which promotes downstream
recruitment of kinase Aurora B73. Bub1 activity has also been cited as a negative regulator
of programed cell death74.
I.2.1.1.5. Aurora B
Aurora B phosphorylation of various KT proteins plays a critical role in mitosis by aiding
in the correction of KT-MT attachment error73. For example, the phosphorylation of mitotic
protein Hec1 by Aurora B destabilizes erroneous KT-MT attachments that could lead to
chromosome lagging or tearing75,76. Aurora B also performs a very limited role in response
to unattached KTs during the mitotic checkpoint77. During mitosis, Aurora B promotes the
recruitment of mitotic surveillance proteins such as Mad1, BubR1, and CenpE77. Bub1 kinase
activity ensures proper localization of Aurora B to the KT78. The regulation of Aurora B by
12
Bub proteins controls the dynamics of mitotic error correction machinery by regulating
Aurora B localization and the phosphorylation status of various Aurora B targets47,79-81.
I.2.2. Phosphoprotein Phosphatases
In contrast to kinases, phosphoprotein phosphatases are enzymes, which dephosphorylate
previously phosphorylated protein targets. These protein phosphatases fall into two
categories, serine/threonine protein phosphatases and protein tyrosine phosphatases.
Proteomic analysis of 6600 human protein phosphorylation sites showed that phosphoserine
(pS), phosphothreonine (pT) and phosphotyrosine (pY) accounted for 86.4%, 11.8% and
1.8% of phosphorylated amino acids, respectively82. Interestingly, there are 428
serine/threonine kinases and 90 tyrosine kinases currently reported83, whereas there are 107
tyrosine phosphatases and ~30 serine/threonine phosphatases.
I.2.2.1. Mitotic Protein Phosphatases
The activity of protein phosphatases counterbalances kinase activity allowing for the
phosphorylation of target substrates to be reversible84. This reversible signalling permits the
phosphorylation of proteins to be tightly regulated and is used for the integration of cellular
signalling and decision-making. Two major serine/threonine protein phosphatases found to
be active during mitosis are protein phosphatase 1 (PP1) and protein phosphatase type 2A
(PP2A)85.
I.2.2.1.1. PP1
In early mitosis, the protein phosphatase PP1 activity is inhibited by the Cdk1-cyclin B
complex86,87, which leads to a state of increased phosphorylation of PP1 target substrates.
Reduced levels of Cdk1-cyclin B allow for PP1 to dephosphorylate itself and return to a state
of full activity86,88. The KT protein, Knl1, recruits active PP1 to the SILK/RVSF consensus
motifs found within Knl1 and is regulated by the phosphorylation of the motifs89. This protein
phosphatase recruitment permits the phosphatase mediated dephosphorylation of the Knl1
MELT motif and other KT associated proteins phosphorylated by Mps1, thereby promoting
KT-MT stability near the end of metaphase89-91. PP1 is also able to delocalize PP2A-B56
from the KT and silence the surveillance machinery arresting mitotic progression90. During
13
mitosis, the recruitment of PP1 to Knl1 can be inhibited by Aurora B phosphorylation of the
RVSF motif89, demonstrating tight regulatory control of the phosphorylation status of various
kinase and phosphatase proteins.
I.2.2.2.2. PP2A
Another phosphatase, PP2A, is a heterotrimeric protein consisting of a structural subunit,
a catalytic subunit and a variable regulatory subunit92. The protein’s regulatory subunit
provides the essential biochemical factors necessary for fine-tuning substrate specificity and
substrate targeting, creating more specialised functioning of the PP2A protein trimer.
Currently, 25 different regulatory subunits have been identified for PP2A, among them are
B55 and B56, which has been seen to be active in mitosis47.
Both PP1 and PP2A have been shown to counteract the Aurora B and Mps1 activity
leading to the silencing of surveillance machinery, which inhibits mitotic progression, to
ensure the proper division of genetic material to daughter cells80,89-91,93.
I.3. Pseudokinases
The human genome project (HGP) has uncovered a large amount of data, which has since
been closely scrutinized, including information on the human kinase complement of the
genome33. From this massive influx of bioinformatics data, it has been found that 10% of
homologous gene sequences to known protein kinases have mutations in gene positions of
key catalytic residues33,94-97. The essential residues are K72, D166 and D184, using
traditional nomenclature based on the protein kinase A (PKA) model (Figure 4)41.These
mutations cause a loss of those important catalytic residues and suggest the absence of
enzymatic activity98,99. In proteins containing kinase motifs, the lack of catalytic activity
suggested by the loss of these key catalytic residues is why such proteins were given the label
of pseudokinase37,94. However, in a few cases proteins have been found lacking these
important catalytic residues while seemingly retaining catalytic activity; therefore, these
proteins are not pseudokinases, but functional kinases95,98,99. By contrast, if a protein retains
the key catalytic residues for a kinase but is modified in other critical motifs, this also may
result in loss of kinase function and thus is a pseudokinase100.
14
I.3.1. Mitotic Pseudokinase: BubR1
Early genetic screens lead to the discovery of several protein-coding genes that when
mutated, caused errors in the SAC of S. cerevisiae101-103. The genes were discovered through
genetic screening and were found to code for proteins Mad1, Mad2, Mad3, Bub1, Bub3, and
Mps1101-103. The yeast Mad3 protein (which lacks a kinase domain entirely) is recognized as
an orthologue to human BubR1100. BubR1 has also been noted for its homology to Bub1104.
The BubR1 protein is very unusual. This protein retains the kinase motifs as well as the
key residues found in catalytically active kinases (Figure 4). However, in many eukaryotic
species the functional role of the BubR1 C-terminal ‘kinase’ domain has been highly
controversial. Reports from several laboratories suggest that the C-terminal BubR1 domain
is non-essential for the APC inhibition105,106 or the SAC function51,107. In contrast, other
Figure 5 Parallel evolution of MADBUB paralogs.
Of the SAC proteins, BubR1 was the first to show evidence of function outside of the spindle assembly
checkpoints and has been seen in other processes and during other cellular phases. The presence of a domain
is denoted by colour, KEN box (blue), TPR (green) and kinase/pseudokinase (yellow). *M. pusilla, (orange)
has only a partially present domain. The absence of the domains are denoted by (white). (Adapted from
Suijkerbuijk, van Dam et al. 2012)
15
research groups suggest that the C-terminal domain activity is important for the full
restoration of checkpoint function108-110.
Researchers undertook to study the BubR1 C-terminal domain more closely and resolved
to track the evolutionary development of Bub1 and BubR1 from its Last Eukaryotic Common
Ancestor (LECA) (Figure 5)100. Their research suggests that the LECA of Bub1 and BubR1,
which they named MADBUB, underwent multiple instances of parallel evolution. This
parallel evolution resulted in gene duplication and a subfunctionalization between the two
gene facsimiles. Over time, certain domains of each protein were lost, such as the KEN
domain in Bub1-like proteins and kinase domain in Mad3/BubR1-like proteins. The N-
terminal domains of metazoan BubR1 and Mad3 include an important region for SAC
functioning111; loss of this region is detrimental to accurate checkpoint arrest in these cells.
It was assumed that amino acid motifs found from the alignment and sequencing of multiple
kinases would reveal key residues, which were essential to those of functional kinases37.
These key residues would thereby be responsible for allowing the phosphate transfer that
defines kinase catalytic activity.
The human BubR1 protein contains the key motifs typically required for a catalytically
active kinase domain (Figure 4). The retention of these key residues in BubR1 suggests to
some that the BubR1 protein might have the ability to interact with ATP37. However, the
human BubR1’s motif I has lost many of the glycine residues, which characterize the glycine-
rich loop, a region that normally acts as a flexible component of ATP binding (Figure 4). In
addition, in motif VI the conserved lysine, K168 in PKA, is a serine, S884 in BubR1, which
becomes phosphorylated completely reversing the charge in the catalytic region of the BubR1
protein (Figure 4)100. This charge reversal would suggest that the interactions, which would
normally take place in this region in an active kinase may not occur.
Finally, the mutation of BubR1D882A, a mutation of one of the three highly conserved
catalytic residues found in BubR1, had no effect on BubR1 function100. In light of this
evidence, the BubR1 C-terminal domain is suggested not to act as a kinase domain, but
instead is retained for protein stability and thereby protein the functioning of the other protein
domains of BubR1. Thus, despite retention of all the catalytic residues the BubR1 should,
actually, be classified as a pseudokinase.
16
I.3.1.1. Functions of BubR1
Three functional roles are suggested for BubR1 during mitosis. These functions are
BubR1’s activity in the spindle assembly checkpoint leading to successful mitotic exit21, its
role in stabilizing the KT-MT interactions47,112, and finally its activity in controlling the
duration of mitosis113. To better understand the functional roles of different BubR1 domains,
attempts are being made to separate the functions by domain targeted mutations114. It remains
to be determined if all the various BubR1 functions are independent or interdependent in
relation to one another; however, research is currently underway to isolate these functions
and perhaps determine this answer.
I.3.1.1.1. BubR1 in Spindle Assembly Checkpoint
The BubR1 protein is an important part of the MCC21. The MCC is composed of BubR1,
Bub3, Mad2, and Cdc20. The activation of the SAC inhibits the degradation of both the
cyclin B and securin, preventing the mitotic progression into anaphase25,26. To understand
the role of BubR1 in the SAC, an in-depth look at certain protein pathways that take place
during mitosis is required.
The mitotic protein Mad2 exists in two conformations inactive, open (O-) Mad2 and
active, closed (C-) Mad2115. Mad1 forms a core complex with C-Mad2. Mad1-C-Mad2
captures Cdc20 and forms C-Mad2-Cdc20. At this time, BubR1 forms a heterodimer with
Bub3, through the BubR1 GLE2p-binding sequence (GLEBS) domain70. The BubR1 protein
also contains two Lys-Glu-Asn (KEN) domains, as well as a tetratricopeptide repeat (TPR)
domain116. Following preassembly of the C-Mad2-Cdc20, the N-terminal KEN box (KEN1)
and the TPR domains together form the Cdc20 binding region21,117. The two complexes
Mad2-Cdc20 and BubR1-Bub3 then assemble to form the MCC. The MCC functions to
prevent the activation of APC/C21.
In recent studies, immunoprecipitation assays have shown that the BubR1 is capable of
complexing with a second Cdc20118, this indicates that more Cdc20 is sequestered by the
MCC than originally understood. The C-terminal KEN box (KEN2) has also been found to
interact directly with APC/C119, demonstrating that it can directly inhibit the APC/C from
17
binding to Cdc20. Therefore, BubR1 blocks the APC/C activation by preventing the Cdc20
cofactors from interacting with the APC/C in multiple ways. These findings underscore the
essential nature of BubR1 function in SAC checkpoint.
Recent work on the BubR1 kinetochore attachment regulatory domain (KARD) has
suggested that the BubR1 recruitment of PP2A may play a role in the silencing of the SAC93.
The Mps1 kinase activity activates the SAC120, and the SAC signalling recruits Bub1-Bub3
to the Knl1 at the KT61,64,72,121. This activity further drives SAC signalling, thereby
maintaining Bub1-Bub3 recruitment to the kinetochore61,64. PP2A-B56 recruited to BubR1,
is responsible for KT-MT stabilization and has been implicated in SAC silencing, by
dephosphorylating the substrates targeted by Mps1 kinase activity47,79-81,93. Loss of Mps1
phosphorylation causes loss of Bub1 at kinetochore64,93. In brief, BubR1 recruits PP2A-B56,
which dephosphorylates the Mps1 phosphorylated substrates silencing the SAC.
I.3.1.1.2. KT-MT attachment
Creating proper KT-MT attachments are vital for equal cellular segregation of genetic
materials. Earlier experiments have suggested that the BubR1 protein plays a role in
correcting KT-MT attachment errors and acts in an antagonistic capacity to Aurora B and
Mps1 phosphorylation (Figure 6)77,93,112,122. The KT is partly formed by the KMN
(Knl1/Mis12/Ndc80 complex) a protein scaffolding to which other KT proteins interact
during prometaphase123,124. The KMN complex binds to the constitutive centromere-
associated network (CCAN) and acts as the linkage site for plus end spindle MT
interactions115,123.
When the dynamic MT attachments need to be corrected, the KMN proteins become
phosphorylated (Figure 6)61,73; certain kinases, such as Aurora B and Mps1, have been
identified as phosphorylating the KT associated proteins to promote the KT-MT attachment
turnover. Aurora B was identified as the principle kinase responsible for the KT-MT
destabilization75,76,125. The MT destabilization caused by Aurora B phosphorylation of
incorrect KT-MT attachments allows the opportunity for the MTs to re-connect to a more
appropriate attachment site. It was discovered that early KT-MT interactions were protected
from destabilization by Aurora B through its dephosphorylation by PP2A-B56 79.
18
Figure 6 Model for KT-MT attachment stabilization.
Kinases phosphorylate Knl1 allowing for the destabilization of improper KT-MT interactions and
recruitment of Bub1-Bub3. This recruitment allows for the downstream recruitment of BubR1-Bub3. Kinases
such as Cdk1 and Plk1 phosphorylate BubR1 KARD domain at S670 and S676, respectively. This
phosphorylation allows for the recruitment of PP2A-B56. PP2A-B56 dephosphorylates Knl1 and other
substrates allowing for the disassociation of recruited proteins at the KT and promotes stabilization of KT-
MT interactions.
Research has revealed the Mps1 phosphorylation of Knl1 allows docking of Bub3 at the
MELT motifs and recruitment of Bub161,126,127. Bub1 activity enables the recruitment of
several downstream proteins, such as Bub3, BubR1, Mad1 and Mad2 (Figure 6)128-134. More
recent studies have shown that phosphorylation of the BubR1 KARD domain by Plk1 and
Cdk1 kinases localizes PP2A-B56 directly to BubR147,51,80,135. PP1 and PP2A have been
shown to dephosphorylate the Knl1, opposing both the phosphorylation of Aurora B and
Mps1 (Figure 6)61,85,93. PP2A-B56 activity regulates the release of BubR1 and Bub1 from the
KTs, silencing the SAC and stabilizing the MT attachments47,75,76,93,125
I.3.1.1.3. Timer Function
In a population of animal cells, the average duration observed in mitotic cells is fairly
consistent113. Roughly 80%, of cells after entering mitosis, will initiate anaphase 20-30
minutes after NEBD22,113. Alterations in the mitotic proteins can hasten the progression of
19
cells through mitosis, particularly mutations that disrupt SAC functioning. The average time
that a vertebrate cell spends in mitosis, from the point at which the last KT attaches to the
start of anaphase, is an average of 23 minutes22. Perturbation of SAC functioning, through
loss of Mad2 or BubR1, shortens the time spent in mitosis136. Other mutations that cause
malorientation of chromosomes have been seen to increase the duration of the mitotic
delay113. However, only a certain amount of time in mitosis is possible before the cells will
either enter into apoptosis or the proteins maintaining chromosome cohesion will degrade,
and anaphase will commence115.
I.3.1.2. BubR1 Domains
The BubR1 domains can be divided into three predominant regions. The NH2 (N) terminal
region contains the domains important for SAC function, and KT recruitment: KEN1, KEN2,
TPR, and GLEBS (Figure 7). This N-terminal region is highly conserved in both the BubR1
and Bub1 homologs of humans as well as those of other organisms100. The middle region
contains the KARD, which is required for stabilizing KT-MT interactions47. Lastly, the
COOH (C) terminal contains the conserved pseudokinase domain.
Figure 7 BubR1 domains.
A schematic representation shows several highly conserved domains of the BubR1 protein. The KEN1, TPR,
and KEN2 domains are necessary for SAC functioning. The GLEBS domain is essential for BubR1
localization to the KT. Recently, the KARD domain and its phosphorylation sites S670 and S676, have been
found to be important for their role in KT-MT stability. However, the C-terminal pseudokinase domain has
a conserved pseudokinase domain of undetermined functional significance.
20
I.3.1.2.1. KEN boxes
The two amino acid sequences of Lys-Glu-Asn have been named KEN box domains and
are found at in human BubR1 at positions 26-28 (KEN1) and 304-306 (KEN2). The KEN
box was originally identified as a motif that is a substrate for poly-ubiquination by APC/C
for subsequent degradation by the proteasome137. However, this is not the case for BubR1
causing much interest in their study. These KEN box domains in BubR1 were instead
discovered to be important for SAC function and for Cdc20 binding138,139. In one study, the
KEN1 was found to be critical for direct interaction with Cdc20, but not the KEN2 in
humans135. These results were also found in yeast111,138. The KEN1 domain exists in a highly
flexible segment of BubR1, which may lead to greater or lesser accessibility of this region to
Cdc20 depending on the other, PTMs or protein interactions140,141.
It was recently discovered that the KEN2 box interacts with the APC/C as a
pseudosubstrate, further blocking APC/C substrate recruitment119. The KEN2 is suggested to
be targeted by APC/C as if the KEN2 was a true ‘degron’ motif142. However, BubR1 is
acetylated, and this acetylation allows for APC/C targeting, but simultaneously prevents the
APC/C from ubiquitinating the BubR1 protein140,142,143. The errors causing loss of BubR1
acetylation would, therefore, allow for BubR1 ubiquitination and subsequent degradation,
thereby permitting SAC signalling defects and promoting aberrant chromosome
segregation143.
I.3.1.2.2. TPR domain
BubR1 contains TPR region, a consensus of 34 amino acids, triple in tandem repeats. The
TPR domain occurs in human BubR1 N-terminal residues 50-204. This amino acid motif
creates a structure of a helix-turn-helix, which is then packed into a spiral of alpha-helices144.
This domain aids in the BubR1’s binding to Knl1145. TPR also aids the KEN1 interaction
between BubR1 and Cdc20-Mad2 leading to the formation of the MCC21,24.
21
I.3.1.2.3. GLEBS domain
Figure 8 GLEBS BubR1 domain.
The GLEBS domain is vital for BubR1-Bub3 heterodimerization and subsequent localization of BubR1 to
the kinetochore. The mutation of the BubR1E413K within the BubR1 GLEBS domain prevents the dimerization
of BubR1 with Bub3.
The GLEBS is a motif that was first identified in budding yeast nuclear pore 116 protein
(scNup116p) and acts as a docking site of the GLE2 protein (scGle2p) in the nuclear pore
complex68. Human ribonucleic acid export 1 (RAE1), an mRNA export factor, also identified
as GLE2, is found to bind to an NUP98 via this GLEBS motif70. The RAE1 and Bub3 seen
in yeast and higher eukaryotes share sequence homology. The BubR1 protein also contains
a GLEBS motif at residues 400-440; however, there has been no evidence that there is protein
interaction between BubR1 and NUP98. Studies in mice show that the BubR1 and Bub1
GLEBS motifs were found to be sufficient for Bub3 binding70. Bub3 is an important protein
for BubR1 localization to the KT and is considered a part of the MCC21.
A study was performed using the point mutation BubR1E413K (Figure 8), which prevents
BubR1 heterodimerization with Bub3, to better understand the interaction and functions of
the BubR1-Bub3 complex135. The BubR1 protein exhibits a mitotic electrophoretic upshift
caused by Plk1 mediated hyperphosphorylation of the BubR1 protein51. There has been no
evidence that this hyperphosphorylation is necessary for SAC functioning. The mitotic
BubR1E413K mutation loses this characteristic hyperphosphorylation, as well as other mitotic
specific phosphorylations on the BubR1 S670 and S676 residues51,135. The phosphorylation
of both S676 and S670 has recently been observed to be important for the regulation of stable
KT-MT attachments47. Besides S670 and S676, several other mitotic specific
phosphorylation sites have been discovered throughout BubR1, among them is S435, which
22
occurs in the GLEBS domain146. However, the kinase phosphorylating this residue has yet to
be discovered.
I.3.1.2.4. KARD domain
Figure 9 BubR1 evolutionary KARD domain conservation.
The KARD domain is highly conserved across multiple species. Three residues have been observed to be
important for KT-MT attachment stability. The phosphorylation of S676, S670 and T680 have been noted
for importance in the recruitment of PP2A-B56. The residues include phosphorylated residues (red), highly
conserved residues (purple), and moderately conserved residues (brown). (Adapted from Suijkerbuijk,
Vleugel et al. 2012)
The middle region of the BubR1 protein contains the KARD domain (Figure 9).
Phosphorylation of this domain by Plk1 and Cdk1 allows for the recruitment of PP2A-B56
to BubR147,51,80,135. The BubR1 KARD domain includes three well-conserved
serine/threonine residues S670, S676 and T680, which are phosphorylated during mitosis47.
Specific point mutations have suggested that loss of phosphorylation of these three residues
in the KARD domain significantly increases the chromosome misalignment. Also, pull-down
assays have confirmed that loss of these residues causes a loss of PP2A-B56 recruitment to
the BubR1 protein.
BubR1 phosphorylation by Cdk1 at T620 allows for Plk1 binding and phosphorylation to
occur at S67651. Cdk1 phosphorylation is also responsible for the phosphorylation of S670
on BubR1135,146. These phosphorylations lead to the recruitment of PP2A-B56 and the
subsequent dephosphorylation by phosphatases permits the stabilization of the KT-MT
interactions and the continuation of mitotic progression80.
23
I.3.1.2.5. Pseudokinase domain
The pseudokinase domain of BubR1 has been an area of debate for many years, for both
its kinase activity and its functional significance100,106,109,110,147,148. Some recent research has
been fairly convincing of the lack of kinase activity in the human pseudokinase100. This
research suggests that the BubR1 pseudokinase domain has no catalytic kinase function but
is, instead, important for structural stability, which in turn supports other BubR1 mitotic
functions.
Another avenue of inquiry into the kinase versus pseudokinase debate, suggests that the
BubR1 kinase activity is CenpE-dependent108,109. CenpE is a KT associated MT motor
protein, which may link the SAC to MT capture. Previous research has indicated that CenpE
is essential for chromosome alignment at metaphase149-151. This motor protein is associated
with unattached KTs in the rapidly dividing cells of mice149 and is suggested to act as a KT
attachment sensor, which binds both MT and KT recruited checkpoint proteins108. In Xenopus
egg extracts, CenpE was linked to the activation and maintenance of SAC signalling and the
loss of CenpE leads to the inhibition of Mad1/Mad2 recruitment152. One protein found to
bind to CenpE is the SAC protein BubR1153, which also happens to be implicated in KT-MT
regulation47. Also, upon immunodepletion of CenpE in Xenopus cells there is no effect on
cellular levels of BubR1108; however, the SAC signalling was eliminated, and recruitment of
BubR1 to the KT was slightly reduced. Therefore, CenpE does have an effect on BubR1
activity via protein localization, although it remains to be fully understood if this effect is
confined to KT recruitment or if CenpE aids BubR1 in other functional capacities.
However, not all BubR1 kinase or pseudokinase domains are created equal and in certain
species residual kinase function may remain. An example of this is seen in the BubR1 of
Drosophila melanogaster, where the kinase activity is required for proper spindle function
but is unnecessary for the fly SAC114. Thus, each model must be looked at individually as the
BubR1 protein domain functions may be relatively similar, but the exact mechanism of action
may be species specific.
24
I.4. BubR1 and Disease
BubR1 is an extremely important cellular protein and loss of this protein is non-viable in
eukaryotic cells110. In addition, several disease states have been attributed with lowered levels
of BubR1154,155. Researchers observed that reduced levels of the BubR1 protein in cells
resulted in shortened lifespan, cachectic dwarfism, lordokyphosis, cataracts, impaired
healing and loss of subcutaneous fat154. These expressed phenotypes are similar to those
found with advanced age.
Over time, the levels of BubR1 naturally become reduced suggesting that BubR1 plays a
regulatory role in aging154. Due to this decrease in BubR1 protein levels, more protein
segregation errors may be found resulting in aneuploidy cells154,155. Aneuploidy is a state in
which a cell does not have the normal chromosome complement. However, it has been noted
that artificially increasing BubR1 protein levels has resulted in a reduced levels of aneuploidy
cell development156. Mosaic variegated aneuploidy syndrome (MVA; OMIM 257300) is
another disease state caused by mutations in the Bub1-Beta (BUB1B) gene, which codes for
the BubR1 protein157,158. MVA is a rare autosomal recessive disorder. This disorder is
characterized by mosaic aneuploidies, trisomies, and monosomies, caused by incorrect
chromosome segregation159. Individuals with MVA develop a number of genetic
abnormalities depending on the tissue and the severity of errors involved160-162.
The affected patients with MVA carry either monoallelic or biallelic mutation of the
BUB1B gene157,158. Monoallelic mutations of BUB1B either cause missense or nonsense
mutations, combined with an allelic variant causing a low expression level of the BubR1
protein from the other allele158. Biallelic mutations typically harbor one missense and one
nonsense version of the BUB1B gene mutants157. A missense mutation is caused by a
substitution mutation in the gene sequence, which results in an amino acid change in the final
protein product163. Figure 10 shows several missense mutations found in MVA patients158,164.
Nonsense mutations create a premature termination codon (PTC)163,164. In mRNA, when
PTCs are created they cause a failure to remove exon junction complexes and thus mRNA
with PTCs are targeted by other proteins recognizing the remaining exon junction
complexes163. These proteins degrade the mutant mRNA and thereby prevent the build-up of
25
truncated proteins. The BubR1 mutations that create PTCs cause a low BubR1 mutant protein
levels caused by nonsense-mediated decay (NMD) in patients expressing this protein.
One example of a BubR1 nonsense mutation is BUB1B731X, and this mutation is found in
patients expressing MVA100. The mRNA derived from this mutation causes MVA due to its
production of PTCs and rapid mRNA degradation causing low to non-existent expression of
the BubR1731X protein in patient cells. The BubR1731X exhibits a complete truncation of
pseudokinase domain (Figure 10)158,164. Interestingly, BubR1731X when expressed after
plasmid transfection was found to be extremely stable. By contrast, researchers have tested
the protein stability of several other BubR1 protein mutants expressed in MVA patients164.
Many of the missense mutations found in MVA patients caused protein instability, and these
missense mutations were often discovered to be in or near the BubR1 pseudokinase domain
(Figure 10).
Figure 10 MVA Mutants.
The MVA mutations, BubR1R727C, BubR1R814H, BubR1L844F, and BubR1L1012P have been found to cause
BubR1 protein instability. Mutations causing this instability in MVA patients appear to be localized in and
around the BubR1 pseudokinase domain.
27
II. Context of My Study
Figure 11 BubR1 conserved pseudokinase residue mutation.
The mitotic HeLaS3 cells were transiently transfected with 3x-Myc-BubR1 mutants. The mutation of the
BubR1K795R and BubR1KD within the pseudokinase domain appear to cause a loss of the characteristic
mitotic BubR1 upshift causes by Plk1 activity. (Sabine Elowe, unpublished data)
The unusual pseudokinase BubR1 is a SAC protein that is very important for both KT-
MT stabilization and SAC signalling21,47,51,135. It is an unusual pseudokinase in that it has
conserved several residues that are important for catalytic kinase activity. However, there has
been much debate over the last decade as to whether or not human BubR1 is a functional
kinase or a non-functional pseudokinase100,109,165. A recent study by Kops’ team, presented a
convincing article, suggesting that BubR1 is a pseudokinase, and proposed that the retention
of this pseudokinase domain in humans was a matter of protein stability100. Based on this
evidence, we proceeded to test not the potential kinase activity of the BubR1 protein, but
rather the domain’s function in relation to BubR1’s phosphorylation. One major factor in
understanding BubR1 protein functioning is understanding how the PTMs, in particular
phosphorylation, affects and controls its functioning47,51,135,146. Certain BubR1
phosphorylations have been found to be important to mitotic regulation47.
Previous results obtained through transient transfections and Western blotting showed that
substitution mutations within the pseudokinase domain of human BubR1 exhibiting an
altered phosphorylation phenotype during mitosis (Figure 11). Mitotic, BubR1wild-type
(BubR1WT) has a characteristic electrophoretic upshift, caused by a hyperphosphorylation of
the BubR1 protein by the kinase Plk151. The BubR1K795R and BubR1K795R/D911A (BubR1kinase
28
dead or BubR1KD) are mutations in sites that would inhibit catalytic activity in functional
kinase orthologues of BubR1100, by targeting what would be a region of ATP-binding in the
‘kinase’ subdomains II and VII, K72 and D184 in PKA37. The resultant BubR1 protein mutants
created by these targeted mutations would be unable to perform the catalytic phosphate
transfer of a functional kinase, if the kinase was functional. Interestingly, the mutation of
these residues caused a loss hyperphosphorylation (Figure 11), and as the BubR1 protein is
suggested to be a pseudokinase100, this loss of hyperphosphorylation is not due to loss of
kinase functioning.
It is known that the BubR1WT protein has a highly, unstable, pseudokinase domain, and
several single point mutations, within the pseudokinase domain have the ability to de-
stabilize the protein as seen in several patients exhibiting MVA157,158,164. We ventured to
discover why these pseudokinase domain mutations, BubR1K795R and BubR1KD, disrupted
the hyperphosphorylation normally observed in mitotic BubR1 (Figure 11).
We hypothesize that the BubR1 pseudokinase domain may play a role in regulation of
BubR1 phosphorylation independent of protein stability. My project set out to study and
better understand how the alterations of the BubR1 pseudokinase domain changed the
phosphorylation status of several known phosphorylation sites of BubR1. We performed
experiments to discover if the phosphorylation of BubR1 was dependent on the stability of
the protein or if the BubR1 phosphorylation was necessary for protein stabilization.
29
III. Materials and Methods
III.1. Plasmid Preparations
Plasmids containing a gene of interest were transformed into DH5α, Escherichia coli. A
measure of 100 ng of plasmid DNA was incubated with DH5α chemically competent bacteria
for 30 minutes at 4 ˚C. The mixture was placed at 42˚C for one minute and then again at 4
˚C for one minute. A volume of 1 ml of Luria-Bertani (LB) media (10 g/L Bacto-Tryptone,
5 g/L yeast extract, and 10 g/L NaCl) was added to the mixture and incubated at 37˚C with
agitation for 50 minutes. A sample of the bacteria was plated on selection LB-agar selection
media (10 g/L Bacto-Tryptone, 5 g/L yeast extract, 10 g/L NaCl, and 15 g/L Bacto-Agar with
Ampicillin (100 µg/ml) and incubated overnight. Bacterial colonies were selected and grown
overnight in in LB media, supplemented with antibiotics to maintain selection. The plasmids
were then extracted and purified from the bacteria using the manufacturers’ protocol from
either the E.Z.N.A. Plasmid Mini Kit I or E.Z.N.A. Plasmid Midi Kit (Omega bio-tek).
III.2. Mutagenesis
The plasmids were derived from 3xMyc BubR1-WT (Dr. Sabine Elowe). All mutagenesis
mutations were performed according the protocol of the Phusion Site-Directed Mutagenesis
Kit for 50 µl of reaction, using Phusion High-Fidelity DNA Polymerase (New England
Biolabs) the appropriate template vector (50 ng) and specific primers were designed (25 μM)
(Table 1). After the PCR reactions were performed, the PCR product was incubated at 37˚C
for 2 hours with DpnI (20U) (New England Biolabs). A volume of 10 μl of the final product
was transformed into DH5α and plated on selection LB-agar media with Ampicillin (100
µg/ml) and incubated overnight. Colonies from the mutagenesis were chosen and mini-preps
were performed. All mutagenesis reactions were verified by sequencing (Centre de
Recherche du CHUL (CHUQ)). All plasmids, and their selection sensitivity can be found in
Table 2.
30
III.3. Cell Culture
The cell lines, HeLaS3 and HHFR5, were routinely maintained in DMEM Dulbecco’s
Modified Eagle Medium (ThermoScientific) supplemented with either 10% FBS (PAA) or
10% BGS (ThermoScientific) over the course of my studies. The stable cell lines, BubR1WT,
BubR1KD, and BubR1731X, were established in HHFR5 cells using the Flp-In System
(Invitrogen) (III.4.3. Electroporation: Flip-in System). These stable cell lines were
maintained in DMEM supplemented with either 10% FBS or 10% BGS with the addition of
Hygromycin (MultiCell) 300 ng/ml. All cell lines were grown at 37˚C at 5% CO2.
II.4.Transfections
The plasmids (Table 2) used in the experiments were transfected into cells using
electroporation or JetPrime (Polyplus), while the siRNA was transfected by INTERFERin
(Polyplus). The media prior to all transfection was exchanged for DMEM supplemented with
either 10% FBS or 10% BGS and without antibiotics.
III.4.1. siRNA Transfections: INTERFERin
To view siRNA treated cell lines after siRNA transfection, the cell lines were plated on
coverslips in 3.5 cm tissue culture dishes at 37˚C with 5% CO2 to achieve 40-50% confluence
prior to transfection. After a 24 hour incubation, cells were treated with siRNA. The BubR1-
specific siRNA duplex directed against the 3’untranslated region (UTR) [5’-
GTCTCACAGATTGCTGCCT-3’]) was purchased from Qiagen51. The CenpE siRNA
duplex directed against 944-966 (5’-AATGAGGTATCAACTGATGAA-3’)166. The Gl2i
duplex was used as a control in the human cells167; Gl2i targets an unrelated luciferase mRNA
found in insects.
The siRNA was transfected using INTERFERin (Polyplus) according to the
manufacturer’s protocol. Briefly, for each 3.5 cm dish, 5 pmol of siRNA was complexed in
200 µl of RNA serum-free medium (Opti-MEM) with 8 µl of INTERFERin reagent and
incubated for 10 minutes at room temperature. The complexes were then added to the 3.5 cm
dishes. After a 48 hour incubation, the cells were synchronized in mitosis by single thymidine
arrest (2 mM; Sigma-Alderich) for 16 hours and released after thorough washing with sterile
31
PBS 1x. After 10 hours, the cells entered into mitosis and were treated for 15 min with
nocodazole (0.1 µg/ml; Sigma-Alderich). Cells were then fixed to the coverslips with
PTEMF fixation media (see III.8. Immunofluorescence).
III.4.2. Plasmid Transfections: JetPrime
For transfection of the HeLaS3 or HHFR5 cells, the cells were seeded into tissue culture
dishes to obtain an 80% confluence prior to transfection with JetPrime (polyplus). The cells
were transiently transfected with plasmids at a ratio of 1.5 μg DNA for each 1x106 cells to
be transfected. The plasmids were suspended in the manufacturer’s recommended volume of
JetPrime Buffer, followed by the addition of JetPrime reagent at a ratio of 1 μg of DNA to 2
μl of JetPrime Reagent. The transfection mixture was incubated at room temperature for 10
minutes to allow for the formation of complexes. Following the incubation, the complexes
were applied to the cells. The cells were then incubated at 37˚C with 5% CO2 for 4 hours.
For analysis in mitosis, cells were synchronized after the 4 hour incubation via a single
thymidine block (2 mM; 24 hours), followed by nocodazole arrest (0.1 µg/ml; 16 hours). The
mitotic cells were then collected via shake off and lysed using fresh RIPA lysis buffer (50
mM Tris at pH 7.5, 150 mM NaCl, NaF 10mM, NP-40 1%, sodium deoxycholate 0.1%, 0.1
mM Sodium vanadate, 20 mM β-Glycerophosphate, Sodium pyrophosphate 10 mM,
Leupeptin 1 µg/ml, Aprotinin 1 µg/ml, and Pefabloc 1 mM). All samples were measured and
equalized via a BCA assay (Pierce), according to manufacturer’s protocol. Samples were
heated to 95˚C for 5 minutes in Laemmli blue sample buffer (10% SDS, 10 mM β-
mercatoethanol, 20% glycerol, 0.2 M Tris-HCl, pH 6.8 and 0.05% Bromophenol blue) and
resolved by Western blot (III.7. Western blot).
III.4.3. Electroporation: Flip-in System
To perform electroporation, DMEM 10% FBS, hypoosmolar buffer (eppendorf), CO2-
independent media (Life technologies) supplemented with 10% FBS and glutamine (2 mM)
and trypsin 0.05% were pre-heated to 37˚C before usage. The HHFR5 cells were derived
from HeLaS3 cell lines and contain a Flp Recombination Target (FRT) for creation of stable
cell lines, using the Flp-In System (Life Technologies). This cell line was a kind gift from
Dr. Patrick Meraldi to Dr. Sabine Elowe’s Laboratory. The HHFR5 cells are used because
32
they contain only one site of homologous recombination, indicating that only one copy of the
gene of interest will be stably expressed by a cell in the final stable cell line. The HHFR5
cells used for Flp-In System were cultured in DMEM 10% FBS with the addition of Zeocin
400 µg/ml, for Flp Recombination Target site selection.
In preparation for the assay, HHFR5 cells were seeded in tissue culture dishes to obtain
1.6 x107 cells, once cells achieve 70-80% confluence. The HHFR5 cells were thoroughly
washed to remove all traces of FBS supplement. The cells were suspended in 800 µl of
hypoosmolar buffer with a plasmid mixture (plasmid DNA of interest to pOG44 (Invitrogen)
ratio of 8:1) to cell ratio of 5 µg DNA to 1x106 cells.
The mixture was combined and transferred to the electroporation cuvette. The
electroporation machine (Bio-Rad) was calibrated for 1.6 x107 cells in a 4 mm gap cuvettes
(100 µs, 400 V, 12 pulses, and 3 second pause between pulses). After electroporation the
cells were incubated at room temperature for 10 minutes. The cells were gently seeded into
two 15 cm tissue culture dishes each containing 20 ml of DMEM 10% FBS and incubated at
37˚C. After a 24 hour incubation, at 37˚C with 5% CO2, the media was exchanged to remove
cellular debris.
After another 24 hour incubation, the media was again exchanged for fresh media DMEM
10% FBS, but supplemented with Hygromycin 300 µg/ml for selection of gene expression.
Following this step, the media was changed at 72 hour intervals for DMEM 10% FBS
supplemented with Hygromycin 300 µg/ml. When cell colonies were large enough to be
transferred to 24-well plates each colony of cells was placed in its own well and allowed to
attach. Once colonies were large enough they were tested via Western blotting and
immunofluorescence with α-myc to determine if the creation of the stable cell line was
successful.
III.5. Okadaic Acid Hyperphosphorylation Assay
For each stable cell line, 5 x 106 cells were seeded into 15 cm tissue culture dishes
containing 20 ml DMEM 10% FBS supplemented with Hygromycin 300 µg/ml. The cells
were synchronized in mitosis by single thymidine block (2 mM; 24 hours), followed by
33
nocodazole arrest (0.1 µg/ml; 15 hours). The mitotic cells were collected and resuspended in
3 ml DMEM supplemented with 10% FBS or 10% BGS Hygromycin 300 µg/ml and fresh
nocodazole at 0.1 µg/ml. For each cell line, 1 ml of the cell suspension was aliquoted into
three wells of a 6-well plate. The cells were then treated with either DMSO, Okadaic Acid at
1 mM, or Okadaic Acid at 0.4 mM. The mitotic cells were then incubated for 1 hour at 37˚C
with 5% CO2, then collected and lysed using fresh RIPA lysis buffer and revealed through
Western blotting.
III.6. ImmunoPrecipitation and Pull-Down
Lysates for both immunoprecipitation and pull-down experiments were measured and
equalized using a BCA assay (Pierce), according to manufacturer’s protocol and measured
at 562 nm. Assays were performed using equal total concentration of protein lysate or to
equalized levels of relative mutant BubR1 protein expressed in stable cell lines.
The immunoprecipitation of stable cell lines was performed using 2 mg of each stable cell
line lysate and incubated overnight in the presence of 10 µl Protein G Agarose beads (Life
technologies) and α-myc antibodies, at a concentration of 1 µg antibody to 1 mg of protein.
For the GST-pull-down experiments of the stable cell lines, 2 mg of each stable cell line
lysate was incubated for 2 hours in the presence of 3 µg of GST-PBDWT or GST-PBDAA
immobilized on glutathione-sepharose (GE Healthcare)58.
The BubR1 mutant phosphorylation assay required stable cell line lysates to be equalized
for relative BubR1 protein levels. To obtain an equalized level of BubR1 proteins between
the cell lines the lysate quantity was adjusted for BubR1 mutant expression level (BubR1WT,
2 mg; BubR1KD, 3.3 mg and BubR1731X; 0.18 mg); the adjusted quantities of cell line lysates
were then incubated overnight with 10 µl Protein G Agarose beads and 2 µg of α-myc
antibodies.
After extensive washing, the beads were boiled in Laemmli blue sample buffer and
resolved by Western blot (III.7. Western blot).
34
III.7. Western blot
After samples were boiled in Laemmli blue sample buffer, the lysed samples were directly
loaded on 7.5% SDS poly-acrylamide gels as well as a protein ladder Precision blue
(BioRad). The samples were migrated in SDS PAGE Running buffer (1 g/L SDS, 3.03 g/L
Tris and 14.41 g/L glycin), for 90 minutes at 120 V. The proteins were transferred to PVDF
membrane (Millipore) via semi-dry transfer (Bio-Rad) using a gradient created by three
buffers: Anode 1 (300 mM Tris, 20 % MeOH at pH 10.4), Anode 2 (30 mM Tris, 20 %
MeOH at pH 10.4) and Cathode (250 mM Tris, 40 mM aminocephalosporanic acid, 0.05 %
SDS at pH 9.4).
The PVDF membranes were blocked with Milk 5% TBS-Tween 0.005% with 0.002 %
azide. Primary antibodies were diluted in Milk 5% TBS-Tween with 0.002 % azide as well
(Table 3), and incubated a 4˚C overnight. The membrane was washed extensively with TBS-
Tween 0.05% and incubated for 1 hour in TBS-Tween 0.05% with a secondary antibody
(Table 3). The membrane was again washed extensively and incubated in either in house
ECL (100 mM Tris HCl pH 8.5, 0.225 mM Coumaric Acid, 6.3 mM Luminol) or Super ECL
(Thermo Scientific). The detection of chemiluminescence was observed through
autoradiography.
III.8. Immunofluorescence
Immunofluorescence was used to study the cells following siRNA transfection and
synchronization in mitosis (III.4.1. siRNA Transfections: INTERFERin). The cells were
fixed to the coverslips using PTEMF fixation media (TX100 0.2%, Pipes pH 3.8 20 mM,
MgCl2 1mM, EGTA 10 mM, and formaldehyde 4%) for 10 minutes at room temperature.
The cells were gently washed with PBS1X, and the coverslips were blocked for 30 minutes
with PBS 1x-BSA 3% and then treated with primary antibodies suspended in PBS 1x-BSA
3% at concentrations (Table 3). The cells were washed three times with PBS-Tween 0.2%
and the secondary antibodies were applied also suspended in PBS 1x-BSA 3%. The
coverslips were then washed three times with PBS-Tween 0.2%, and once with H2O and
placed on coverslips in DABCO mounting media (Sigma-Aldrich). Images were acquired by
confocal laser scanning microscopy (Olympus) equipped with a modified yokagawa spinning
35
disc (CSUX, Quorum technologies) with a 100X (oil immersion) objective and Metamorph
software (Molecular Devices, LLC). The data was quantified by ImageJ software168.
III.9.Analysis via ImageJ
The images obtained from the immunofluorescence assays were uploaded into ImageJ for
analysis168. The maximum projection was used to stack each series of images (30 steps, 0.2
mm between steps, using TxRed, GFP, Cy5 and Dapi channels). The fluorescence of the α-
CREST antibody was used to label the centromere, and its relative intensity was used to
normalize the signals of interest. The normalized levels of the BubR1 phospho-antibodies
fluorescence were compared to the normalized levels of fluorescently labelled BubR1 or
BubR1 mutant proteins. The ratios were compared to each cell line using a student t-test.
Each immunofluorescence experiment examined 10-20 cells and was performed in triplicate.
37
Table 1. Table of Primers
BubR1
mutation Direction Sequence
S884A Fwd CATGGTGACTTGGCTCCAAGGTGTCTGATTCTCAGAAACAGAATC
Rev TGGAGCCAAGTCACCATGGACTATTTCTGCTTTGTGTAGCATCTC
S884D Fwd CATGGTGACTTGGATCCAAGGTGTCTGATTCTCAGAAACAGAATC
Rev TGGATCCAAGTCACCATGGACTATTTCTGCTTTGTGTAGCATCTC
S884E Fwd CATGGTGACTTGGAACCAAGGTGTCTGATTCTCAGAAACAGAATC
Rev TGGTTCCAAGTCACCATGGACTATTTCTGCTTTGTGTAGCATCTC
D911A Fwd GAAGATAGTGGCCTTTTCCTACAGTGTTGACCTTAGGGTG
Rev GAAAAGGCCACTATCTTCAAAGCTTGATGATTGTTCTTGTTACAAT
S913A Fwd GAAGATAGTGGACTTTGCCTACAGTGTTGACCTTAGGGTG
Rev GCAAAGTCCACTATCTTCAAAGCTTGATTGTTCTTGTTACAAT
L844F Fwd TAAACTGCTTCACCTTT CAGGATCTTCTCCAACAC
Rev AAAGGTGAAGCAGTTTA TATATTGGTGCCAAACAATAC
R814H Fwd TTAAAGGAACATTTAAAT GAAGATTTTGATCATTTTT
Rev ATTTAAATGTTCCTTTAA CTTGAGGTTGATATAAAAGTC
R727C Fwd CACAGTATTGCAGACAG CTACTGAAGTCCCTACCAGA
Rev CTGTCTGCAATACTGTG AACACCATGGTGACTG
L1012P Fwd GTGTCTGTTCCTGGGG AGCTTGCAGCAGAAATGAAT
Rev CCCCAGGAACAGACAC TGTGGCCTCATCATTGG
K795A Fwd AACAGTAATAGCGGTA TCTTCTCAACCTGTCC
Rev TACCGCTATTACTGTT AATTCTGCAGAGTTTCTTG
K795R Fwd AACAGTAATAAGGGTA TCTTCTCAACCTGTCC
Rev TACCCTTATTACTGTT AATTCTGCAGAGTTTCTTG
38
Table 2 Table of Plasmids
Plasmid Template Author Selection Tags
pcDNA 3.1 3xMyc
(c) pcDNA 3.1 3xMyc (c) H. Sillje Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-WT
TOPOvectorPCR4-
TOPO A. Hanisch Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-KD
pcDNA 3.1 3xMyc (c)
BubR1-K795R
Dr.Sabine
Elowe Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-R727C
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA5/TO/FRT/3x
Myc (c) BubR1-731X
pcDNA5/TO/FRT/3x
Myc (c) BubR1-WT
Philippe
Theabault Hygromycin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-K795A
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-K795R
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-D882A
pcDNA 3.1 3xMyc (c)
BubR1-WT
Dr.Sabine
Elowe Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-D882N
pcDNA 3.1 3xMyc (c)
BubR1-WT
Dr.Sabine
Elowe Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-S884A
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-S884D
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-S884E
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-R814H
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-L844F
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-D911A
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-S913A
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-L1012P
pcDNA 3.1 3xMyc (c)
BubR1-WT
Michelle
Mathieu Ampicillin/Neomycin 3xMyc
pcDNA5/TO/FRT/3x
Myc (c) Mis 12
Bub1-WT
pcDNA 3.1 3xMyc (c)
BubR1-WT
Dr.Sabine
Elowe Hygromycin/Neomycin 3xMyc
pcDNA5/TO/FRT/3x
Myc (c) Mis 12
Bub1-E413K
pcDNA5/TO/FRT/3x
Myc (c) Mis 12 Bub1-
WT
Dr.Sabine
Elowe Hygromycin/Neomycin 3xMyc
pcDNA 3.1 3xMyc
(c) BubR1-E413K
pcDNA 3.1 3xMyc (c)
BubR1-WT
Dr.Sabine
Elowe Ampicillin/Neomycin 3xMyc
39
Table 3. Table of Antibodies
Anti-Body Stock Conc. Primary/Secondary Host Company WB IF
α-BubR1 0.38 µg/ml Primary mouse Homemade 1 µg/ml 1 µg/ml
α-pS676 - Primary rabbit Homemade 1:1000 1:1000
α-pS670 0.38 µg/ml Primary rabbit Homemade 1 µg/ml 1 µg/ml
α-pS435 N/A Primary rabbit Homemade 1:100 -
α-myc 1 mg/ml Primary mouse Santa Cruz 1 µg/ml 1 µg/ml
α-myc 200 µg/ml Primary rabbit Santa Cruz 1 µg/ml 1 µg/ml
α-Bub3 250 µg/ml Primary mouse BD Transduction
Labs 1 µg/ml -
α-tubulin 200 µg/ml Primary mouse Santa Cruz 0.2 µg/ml -
α-mHRP 0.8 mg/ml Secondary mouse Jackson
ImmunoResearch 1:10,000 -
α-rHRP 0.8 mg/ml Secondary rabbit Jackson
ImmunoResearch 1:10,000 -
α-m488 1.5 mg/ml Secondary mouse Jackson
ImmunoResearch - 1:1000
α-r488 1.5 mg/ml Secondary rabbit Jackson
ImmunoResearch - 1:1000
α-m549 1.5 mg/ml Secondary mouse Jackson
ImmunoResearch - 1:1000
α-r549 1.5 mg/ml Secondary rabbit Jackson
ImmunoResearch - 1:1000
α-m594 1 mg/ml Secondary mouse ThermoScientific - 1:1000
α-r594 1 mg/ml Secondary rabbit ThermoScientific - 1:1000
α-hCy5 1.5 mg/ml Secondary human Jackson
ImmunoResearch - 1:1000
α-CREST 2 ml Secondary human ImmunoVision - 1:1000
Hoeschest
33342 5 mg/ml Primary/Secondary - Cell Signaling - 1 µg/ml
41
IV. Results
IV.1. Pseudokinase domain mutations cause a loss of stability and
hyperphosphorylation
Previous results showed the loss of BubR1 hyperphosphorylation in both BubR1K795R and
BubR1KD mutations (Figure 11). To confirm these results and to test if mutant stability may
play a role in the loss of this BubR1 hyperphosphorylation, BubR1 mutant plasmid constructs
were created containing 3xMyc-tags. These plasmids, BubR1WT, BubR1K795R, and
BubR1D911A and BubR1KD, were transiently transfected into HeLaS3 cells, and the cells were
collected in mitosis following nocodazole treatment (Figure 12). Nocodazole inhibits MT
polymerization preventing the formation of KT-MT interactions and thus blocks the
separation of chromosomes during mitosis, thereby arresting the cells in prometaphase and
triggering the activation of the SAC.
Figure 12 shows that relatively equal levels of protein were loaded as seen by the α-
tubulin loading control. Transfected BubR1 proteins were tagged with 3xMyc to
discriminate them from endogenous BubR1 proteins found in the cell line. The BubR1WT in
lane 1 expressed the typical mitotic hyperphosphorylation phenotype. The BubR1K795R
Figure 12 BubR1 stability and hyperphosphorylation loss due to conserved pseudokinase residue mutation.
BubR1WT, BubR1K795R, BubR1D911A and BubR1KD, mutations were transiently transfected into HeLaS3 cells
and synchronized in mitosis. The BubR1 mutant proteins were detected using α-myc antibodies to
differentiate the signal from endogenous BubR1 proteins. Equal amounts of protein loading of the whole cell
extract (WCE) was confirmed by the α-tubulin antibody.
42
mutation, while exhibiting the characteristic upshift phenotype, had a marked decrease in
levels of BubR1 hyperphosphorylation relative to BubR1WT, (Figure 12). Also, both
BubR1D911A and BubR1KD showed a complete loss of the BubR1 upshift, despite extensive
testing via overexposure during autoradiography. All substitution mutations that were tested
showed a marked decrease in mutant protein level as compared to the BubR1WT. These
BubR1 mutations were observed to be both less stable and showed a decrease in levels of
hyperphosphorylation.
IV.2. Pseudokinase BubR1 stability causes loss of BubR1 phosphorylation
Loss of BubR1 protein stability appeared to cause a loss of BubR1 hyperphosphorylation
(Figure 12). To better examine the relationship between protein stability and BubR1
Figure 13 MVA and BubR1KD mutations.
A. Many mutations that cause instability of the BubR1 protein appear to be localized in or near the BubR1
pseudokinase domain. The BubR1 mutant proteins BubR1R727C, BubR1R814H, BubR1L844F, and BubR1L1012P
were discovered in patients expressing MVA.
B. The status of the hyperphosphorylation was tested in BubR1 proteins found in MVA patients. Plasmids
containing BubR1 sequences which code for the mutant proteins were transfected into HeLaS3 cells and the
cells were arrested in mitosis. Equal protein loading was used for each condition and confirmed by with the
α-tubulin antibody. The Western blot was probed with α-myc to differentiate the hyperphosphorylation of
the BubR1 protein mutants from the endogenous BubR1.
43
hyperphosphorylation, plasmids were created containing mutant BUB1B sequences found in
patients exhibiting MVA that were known to produce unstable BubR1 proteins157. Many of
these MVA mutations were found to be located in or near the pseudokinase domain of BubR1
(Figure 13A). HeLaS3 cells were transiently transfected with the plasmids for these unstable
MVA mutations (see section I.4.), as well as BubR1KD, BubR1K795R, BubR1K795A (Figure
13B). The samples were loaded with equal levels of protein lysate as measured by BCA
assay, and relative levels were shown by α-tubulin probing.
Several of the unstable MVA mutations, BubR1R727C, BubR1R814H and BubR1L1012P, were
observed in very low quantities, suggesting that these proteins were unstable (Figure 13B).
There was also no observable hyperphosphorylation in these proteins. In contrast, we saw
BubR1L844F had an equally low level of protein compared to that of the other MVA mutants,
yet, retained the hyperphosphorylation banding pattern. Whether this retention of
phosphorylation was equivalent to BubR1WT requires further study.
IV.3. Mutation of other conserved kinase domain residues does not alter
phosphorylation status
Certain residues that are found to be important for the catalytic activity in functional
kinases, when mutated in pseudokinase BubR1 (K795 and D911), caused a loss of stability
and loss of hyperphosphorylation in BubR1. We decided to test the phosphorylation status
of other BubR1 protein mutations in residues that are highly conserved in functional kinases
(Figure 4, 14A and 14B). Using the motifs discovered by Hanks et al.37, mutations were
chosen by their conservation in the BubR1 protein and functional importance to BubR1
homologues. BubR1D882A and BubR1D884A are located in motif VI, the catalytic loop (Figure
4). The BubR1S913A and BubR1D911A mutations are situated in the motif VII, and BubR1K795R
is located in motif II (Figure 4). The final mutation used was the BubR1731X mutation, which
truncates the entire BubR1 pseudokinase domain (Figure 14A). Plasmids containing these
mutant sequences were transiently transfected into HeLaS3 cells, and the cells were collected
during mitotic arrest after treatment with nocodazole.
44
Figure 14 Pseudokinase motif II, VI and VII mutations and pseudokinase truncation mutation (BubR1731X).
A. BubR1 mutations, which occur in the highly conserved residues found in functional kinases in motif II,
VI and VII as well as the BubR1731X. The BubR1731X contains the N-terminal and M-terminal regions of
BubR1 (1-731 aa), but lacks the C-terminal domain.
B. The plasmids containing BubR1 sequences which coding for BubR1D882A, BubR1S884A, BubR1S913A were
transfected into either HeLaS3 cells or HHFR5 cells were arrested in mitosis. The relative protein loading
levels was indicated by the α-tubulin antibody. The result is representative of both cell lines. The Western
blot was probed with α-myc to differentiate the phosphorylation from the endogenous BubR1 protein.
The single point mutations of BubR1D882A, BubR1D884A and BubR1S913A showed no
significant effect on the characteristic BubR1 upshift (Figure 14B), indicating that these
residues were less important for BubR1 functioning and stability, despite their evolutionary
conservation. The BubR1731X did not appear to exhibit the mitotic hyperphosphorylation
observed in the other pseudokinase mutations (Figure 14B). The protein loading shown by
α-tubulin probing, suggested that there may be a higher level of mutant BubR1731X than
BubR1WT within the transfected HeLaS3 cell lysate during mitosis (Figure 14B).
45
IV.4. Creation of BubR1 truncated pseudokinase stable cell line
Figure 15 Expression of BubR1.
The stable cell lines expressing BubR1WT, BubR1KD and BubR1731X were synchronized in mitosis and 50 μg
of protein lysate were loaded in each condition. Expression of BubR1 protein mutants was confirmed in the
cell lines via Western blotting with α-myc antibodies. Equal protein loading of stable cell lines was confirmed
by α-Bub3 antibodies.
In previous years, cell lines for BubR1WT and BubR1KD had been created. In order to better
study the function of the pseudokinase domain, it was determined that a stable cell line
lacking the BubR1 pseudokinase domain would aid in furthering our understanding of the
domain. After the creation of the stable cell line containing BubR1731X, upon characterization
of the cell lines it was noted that the level of BubR1 protein expression seen between the
mutants varied (Figure 15). The BubR1KD protein was expressed at 0.6 fold less than
BubR1WT, while BubR1731X was expressed 11 fold more. Figure 15 shows equal total protein
loading as seen by equal levels of the endogenous Bub3 protein between the BubR1 mutant
cell lines. To accurately see the phosphorylation phenotype of the BubR1 mutants, the
amount of the total protein used was based on relative protein mutant level expressed.
IV. 5. BubR1 pseudokinase mutations BubR1KD and BubR1731X are never
hyperphosphorylated
The loss of hyperphosphorylation was seen in both BubR1 pseudokinase domain
mutations, BubR1KD and BubR1731X. To determine if these mutants are phosphorylated, but
then rapidly lose their mitotic phosphorylation, we decided to use phosphatase inhibitors to
prevent dephosphorylation of the BubR1 proteins. The BubR1 cell line mutants, BubR1WT,
BubR1KD and BubR1731X were treated with nocodazole, which arrested the cells in mitosis.
The cells were then further treated with okadaic acid, an inhibitor of both PP2A and PP1.
46
Figure 16 No hyperphosphorylation of BubR1KD or BubR1731X.
The stable cell lines were arrested in mitosis. The mitotic cells were treated with, 0, 0.4 or 1 μM of okadaic
acid, a PP1 and PP2A inhibitor, for 1 hour. The equal levels of protein loading for each treatment are
indicated by the α-tubulin antibody. The level and hyperphosphorylation of the BubR1 mutant proteins were
indicated by α-myc probing to differentiate the mutant protein from endogenous BubR1 expression.
Both PP2A and PP1 are protein phosphatases, responsible for the dephosphorylation of many
proteins during mitosis. The cell lines contained both endogenous BubR1 and a 3xMyc-
tagged BubR1 mutants, BubR1WT, BubR1KD, and BubR1731X. To differentiate the mutants
from the endogenous proteins found within the cell α-myc was used to probe the Western
blots for their 3xMyc-tags. In cells expressing the BubR1WT mutant, there can be seen an
accumulation of super-hyperphosphorylated BubR1WT protein (Figure 16A and 16B).
However, after treatment with okadaic acid, BubR1KD does not show a significant upshift
when compared to BubR1WT (Figure 16A). A similar result was observed in BubR1731X, the
large band of the BubR1731X mutant did not show any hyperphosphorylation after
phosphatase inhibition.
47
IV. 6. Loss of BubR1 phosphorylation S676 and S670 by pseudokinase domain
mutations
The loss of mitotic hyperphosphorylation was observed in several BubR1 protein mutants;
however, this result does not mean that all mitotic BubR1 phosphorylations are lost. To
discover, specific mitotic phosphorylation sites that are affected by these various BubR1
mutations, phospho-specific antibodies were required which target these specific mitotic
phosphorylations. The α-pS435 is a homemade antibody created by immunization of rabbits
with a phospho-peptide sequence and tested for the both mitotic BubR1 and phospho-protein
specificity (Figure 17; Philippe Thebault, unpublished results).
Figure 17 The α-pS435 is mitotic and phospho-specific.
The α-pS435 was used in Western blotting on endogenous BubR1 from HeLaS3 cells arrested by thymidine
block or nocodazole arrest. The immunoprecipitation of endogenous BubR1 was performed on mitotic lysate
and treated with and without calf intestinal alkaline phosphatase (CIP). (Philippe Thebault, unpublished
results)
Cells were arrested at the G1/S transition by thymidine and in mitosis by nocodazole.
Thymidine arrests the cells the at the G1/S transition by thymidine feedback inhibition of
DNA synthesis. The expressed protein BubR1 was immunoprecipitated with an α-myc
antibody. The assay was then probed with α-pS435 serum showing in lanes 3 and 5 that the
antibody binds to the BubR1 protein only during mitosis (Figure 17). This result confirmed
that the phosphorylation was mitotic specific. The immunoprecipitation samples of BubR1
were also treated with calf intestinal phosphatase (CIP), ensuring that all the BubR1 serine
and threonine residues were not phosphorylated. Lanes 5 and 6 show loss of the mitotic
BubR1 phosphorylation by CIP treatment prevents the α-pS435 serum interaction with the
48
protein. These results underscored the mitotic specificity and the phospho-specificity of the
α-pS435 antibody.
Figure 18 Comparative phosphorylation of equal relative BubR1 levels.
A. The BubR1 stable cell lines were synchronized in mitosis using a single thymidine block (2 mM)
followed by nocodazole arrest (0.1 μg/ml). The BubR1 protein levels were equalized based upon
cell line expression levels.
B and C. The immunoprecipitation of the BubR1 mutant cell lines used lysate quantities, which
equalized expressed mutant BubR1 levels. The phosphorylation of the immunoprecipitates was
indicated with α-pS676, α-pS670, and α-pS435 homemade antibodies.
The cell lines derived from HHFR5 cells stably expressed BubR1 mutants: BubR1WT,
BubR1KD, and BubR1731X. The BubR1 hyperphosphorylation, which was lost in BubR1KD
and BubR1731X proteins is specific to the endogenous BubR1 of mitotic cells (Figure 15 and
18A). The loss of this hypserphosphorylation in these pseudokinase domain mutants
BubR1KD and BubR1731X provided two models of pseudokinase domain modification, upon
which to perform further testing of pseudokinase domain function. We desired to see if other
49
mitotic specific phosphorylation sites were lost in these two pseudokinase domain mutations.
Different sites of BubR1 phosphorylation can be observed through a combination of
immunoprecipitation (IP) and Western blotting.
The 3xMyc-tagged mutant BubR1 proteins from the stable cell lines, as well as a
background control using the HHFR5 cell line were collected via immunoprecipitation using
α-myc antibodies. This immunoprecipitation separated the tagged, BubR1 mutant proteins
expressed in the cell lines from the endogenous BubR1 proteins.
To properly compare mutant BubR1 protein phosphorylation levels, the amount of cell
lysate was adjusted to obtain to obtain relatively equal levels of tagged BubR1WT, BubR1KD
and BubR1731X after immunoprecipitation. Figure 18A shows the different levels of the whole
cell extract (WCE) used to obtain relatively equal levels of the mitotic BubR1 mutants
expression in the different cell lines as seen by α-tubulin probing. The amount of BubR1
protein lysate used was equalized to the amount of BubR1 protein obtained from 2mg of
BubR1WT.
After immunoprecipitation and Western blotting, the equalized levels of BubR1 protein
are probed with α-pS676, α-pS670, and α-pS435, to determine the phosphorylation status of
these mitotic BubR1 mutants. Antibodies for pS676 and pS670 were previously shown to be
specific only to the phosphorylated residue51,135. The BubR1 mutants, BubR1KD, and
BubR1731X, showed loss of pS676 and pS670 (Figure 18B). In contrast, it did not appear as
if the pS435 was lost in the pseudokinase domain mutant cell lines (Figure 18C). Figure 18C
shows that BubR1731X was immunoprecipitated in lower amounts as observed by the α-myc
probing, which could explain why pS435 signal appeared to be lost. It may be possible that
both kinase domain mutants had different effects on various mitotic BubR1phosphorylation
sites.
50
IV. 7. BubR1KD and BubR1731X show loss of pS676 and pS670 through
immunofluorescence
To both confirm and quantify the loss of BubR1 phosphorylation seen in both BubR1
pseudokinase domain mutants BubR1KD and BubR1731X, we performed immunofluorescence
assays testing both the S676 and S670 BubR1 phosphorylation levels. To view the
phosphorylation of the mutants, it was necessary to inhibit the production of endogenous
BubR1 protein, as these proteins would express normal BubR1 phosphorylation levels and
obscure the results. A concentration assay was used to select the ideal concentrations of
siBubR1-3’UTR and siRNA transfection reagent (Figure 19). The condition at 5 pmol of
siBubR1 and 8 µl of reagent was determined to be the ideal, for the mutant phosphorylation
assays.
An immunofluorescence assay was then used to confirm and quantify the loss of BubR1
phosphorylation, the cells were treated with siBubR1 to deplete the endogenous BubR1 and
therefore the endogenous BubR1 phosphorylation. The stable cell lines derived from HHFR5
cells expressing BubR1WT, BubR1KD, and BubR1731X mutants were treated with nocodazole
and fixed with PTEMF. A BubR1-specific siRNA duplex was used to deplete the endogenous
BubR1 protein targeting the 3’UTR region. The BubR1 mutants introduced into the stable
cell lines through plasmids lack this UTR region, and thus, only the endogenous BubR1
Figure 19 siBubR1 effectively knock-down endogenous BubR1.
HeLaS3 cells were depleted of endogenous BubR1 via using INTERFERin (polyplus) transfection reagent.
The siBubR1 was tested at 0, 2.2, 5, and 10 pmols and the level of reagent was tested at 2, 4 and 8 μl. The
Gl2i at 5 pmol was used as the control. The HeLaS3 cells were collected 72 hours after transfection and
tested for levels of endogenous BubR1 using α-BubR1 antibody. Equal levels of protein lysate were
confirmed with the α-tubulin antibody.
51
protein was depleted. The HHFR5 controls showed significant reduction in endogenous
BubR1 levels, when treated with the siBubR1 as compared to the Gl2i controls (Figure 20A
and 20B). The stable cell line cells, which were also depleted of endogenous BubR1, were
then tested for either their BubR1 S670 or S676 phosphorylation intensities (Figure 20A and
20B). A loss of BubR1 S670 and S676 phosphorylation was observed in both BubR1KD and
BubR1731X stable cell lines when compared to the phosphorylation seen in BubR1WT cells.
Measurements of immunoprecipitation intensities confirmed that the BubR1 mutations,
BubR1KD and BubR1731X exhibit a significant loss of BubR1 phosphorylation at pS670
(Figure 20C) and pS676 (Figure 20D), relative to BubR1WT fluorescence intensities.
However, the measurements of pS435 levels were not determined as the current antibody is
unable to be utilized for immunofluorescence.
52
Figure 20 Loss of pS670 and pS676 in pseudokinase domain mutations were confirmed.
A and B. The HHFR5 and the stable cell lines expressing BubR1WT, BubR1KD and BubR1731X cells was
transfected with siBubR1 directed against the 3’UTR region or Gl2i. The cells were released for 10 hours
after thymidine block and were treated with nocodazole for 15 minutes to elevate the phosphorylation of
S670. The cells were then fixed and stained with antibodies against α-pS670 or α-pS676 (TxRed), α-myc or
α-BubR1 (GFP) and α-CREST (blue). The DNA was visualized with Hoechst 33342.
C and D. Quantification of the levels of S670 and S676 phosphorylation normalized to CREST in
prometaphase cells (n ≥ 10).
53
IV. 8. Plk1-BubR1 binding remains intact despite loss of Plk1 hyperphosphorylation
Figure 21 Plk1 binds to all BubR1 cell line mutations.
A. The α-myc probing revealed relative BubR1 protein levels of mitotic stable cell line WCEs. Equal input
of WCEs were visualized by α- tubulin antibody.
B. Pull-downs from mitotic BubR1 mutant stable cell line lysates using 2 mg of cellular lysate were incubated
with 3 μg of immobilized GST-PBDWT and GST-PBDAA. The PBDAA mutation is a mutation of the H538
and K540 amino acids known to disrupt PBD ligand binding. The pull-downs were probed with α-myc to
differentiate the PBD binding of the BubR1 mutants expressed in the cell lines from the endogenous BubR1.
The Plk1 interaction with BubR1 is known to be responsible for the phosphorylation of
BubR1 S67651. To ensure that the loss of the BubR1 S676 phosphorylation was not due to
loss of Plk1 interactions, we performed pull-down experiments testing Plk1 binding to
BubR1. The three BubR1 stable cell lines BubR1WT, BubR1KD and BubR1731X were arrested
in mitosis and collected after nocodazole treatment. Equal total protein samples of each cell
line were used in the interaction assays, as seen by the loading controls (Figure 21A). The
pull-downs were performed for each cell line using either the GST-tagged PBDWT or the
GST-tagged PBDAA. The PBDAA contained mutations at residues important for PBD-ligand
binding54,58. All BubR1 mutants BubR1WT, BubR1KD, and BubR1731X are readily pulled down
by GST-PBDWT, while no BubR1 mutants were pulled down by the GST-PBDAA (Figure
21B).
54
IV. 9. Loss of BubR1-Bub3 interaction causes loss of S676 phosphorylation
Figure 22 Forced localization does not rescue the BubR1 S676 phosphorylation.
A. BubR1 mutants BubR1WT and BubR1E413K were transfected into HeLaS3 cells and the cells were arrested
in mitosis. Equal protein loading was confirmed for each condition with the α-tubulin antibody.
Immunoprecipitation of the transfected cells used equal amounts of cellular lysate and the phosphorylation
of the immunoprecipitates was detected with α-pS676 and α-pS670 homemade antibodies.
B. The experiment in A. was repeated with Mis-12 tagged BubR1WT and Mis-12 tagged BubR1E413K causing
forced localization of the BubR1 mutants to the KT. The immunoprecipitates were probed with the pS676
antibody. An empty vector was transiently transfected into HeLaS3 cells as a control.
Bub3 is a binding partner of BubR1 and localizes the BubR1 protein to the KT70. To
discover if BubR1’s Bub3 binding domain, GLEBS, was also important for alterations in
BubR1 phosphorylation, we performed transient transfection experiments with 3xMyc-
tagged BubR1 mutants BubR1WT and BubR1E413K. The BubR1E413K mutation has been shown
to be unable to bind to Bub3135. These mutations were transfected into HeLaS3 cells and
collected after nocodazole induced mitotic arrest. Equal amounts of total protein lysate were
used in immunoprecipitation as seen by the α-tubulin probing (Figure 22A). To avoid the
endogenous BubR1 phosphorylation obscuring BubR1 mutant protein phosphorylation
results immunoprecipitation was performed using α-myc antibodies. The S676
phosphorylation was lost in non-KT localized BubR1E413K and was retained in BubR1WT; by
contrast, there was no observable loss in S670 phosphorylation (Figure 22A).
We then desired to see if this loss of phosphorylation was due to the loss of KT association
and the spatial localization of mitotic kinases or loss of direct binding of Bub3 to BubR1.
Other BubR1WT and BubR1E413K mutant plasmids were created with the addition of a Mis-
12-tag. This Mis-12-tag forcefully localized the BubR1 mutants to the KT via the KMN
network scaffolding proteins. The assay was repeated using these Mis-12-tagged mutants.
55
Despite, being localized near active kinases in the KT during mitosis, the BubR1E413K was
still unable to be phosphorylated by Plk1 at S676 (Figure 22B). The BubR1WT still retained
this ability even with the Mis-12 tag localizes the BubR1 mutant to the KT.
57
V. Discussion
BubR1 is an intriguing pseudokinase, which retains highly conserved residues seen
predominantly in functional kinases. This protein plays important roles in both KT-MT
stabilization and SAC signalling21,47,51,135. PTMs are major regulators of protein functioning,
and the BubR1 protein is seen to have specific, mitotic phosphorylations47,51,135,146. Some of
these phosphorylations are known to be important for mitotic functions47. Following this line
of reasoning, the alterations of BubR1 domains that in turn alter BubR1 mitotic
phosphorylation may likely change the mitotic BubR1 activity. By comparing targeted
BubR1 mutations, in particular, BubR1KD and BubR1731X, to the original wild-type protein
model, it is then possible to uncover potential BubR1 domain functions.
In the literature, pseudokinase BubR1 was shown to have retained several highly
conserved residues found in functional kinases37,100. These conserved residues are observed
in BubR1 at K795, D882, and D911. Protein stability assays have shown that the BubR1
K795 residue was critical, as mutations such as BubR1K795A and BubR1K795R cause a loss of
protein stability and a subsequent loss of BubR1 protein levels100. When proteins are
unstable, they often misfolded; these misfolded proteins activate the protein degradation
pathway, which degrades the misfolded proteins and prevents an accumulation of protein
aggregates169. This loss of protein stability caused by the mutation of the K795 residue may
be the main factor for its importance in BubR1 functioning.
Figure 12 shows a severe reduction of protein levels in BubR1K795R, BubR1D911A, and
BubR1KD suggesting that these mutants are rapidly degraded due to instability and protein
misfolding. Not only is the stability lost, but there is also a reduction in BubR1K795R
hyperphosphorylation, which is absent in both the BubR1D911A and the BubR1KD mutants.
The loss of BubR1 hyperphosphorylation due to these point mutations suggests two potential
possibilities: 1) Either the loss of BubR1 protein stability results in the loss of BubR1
phosphorylation or 2) the mutations at these residues results in the loss of BubR1
phosphorylation, which causes a subsequent loss of BubR1 protein stability.
58
The BubR1K795A mutant is considered to have a more severe mutation than that of the
BubR1K795R and the former is suggested to be the more unstable100. We show that that both
BubR1K795A and BubR1K795R have a reduction in protein levels as compared to BubR1WT
(Figure 13B). While we do not see an observable difference in protein levels between
BubR1K795A and BubR1K795R, the BubR1K795A does show a marked reduction in mitotic
hyperphosphorylation as compared to BubR1K795R. This reduction in protein levels indicates
that both proteins are more unstable than BubR1WT. Also, there is a more severe reduction of
hyperphosphorylation in BubR1K795A, which suggests that BubR1K795A is the most unstable
of the two K795 mutants according to the literature164.
BubR1 mutations were discovered in patients exhibiting MVA157,158. Several of these
BubR1 mutants after testing with stability assays appeared to be highly unstable100.
Interestingly, many of these destabilizing mutations were caused by single point mutations
that occurred in or near the pseudokinase domain (Figure 10). Of the unstable mutations
chosen for study BubR1R727C, BubR1R814H, and BubR1L1012P show both loss of protein
stability and loss of hyperphosphorylation comparable to that of BubR1KD (Figure 13B).
These results suggest that the loss of stability is the cause of loss in hyperphosphorylation.
However, the BubR1L844F protein was also unstable (Figure 13B), yet, despite protein
instability the hyperphosphorylation was retained, showing that protein stability is a complex
issue. Thus, while stability can affect the hyperphosphorylation, hyperphosphorylation does
not seemingly rescue the stability. These facts allow for the possibility that loss of stability
affects hyperphosphorylation indirectly by interfering with BubR1 protein functions, thereby
altering the phosphorylation status of BubR1.
In pseudokinase BubR1, protein alignment reveals key positions in the conserved kinase
motif, which in an active kinase are important for catalytic activity (Figure 4)100. Certain of
these highly conserved positions in BubR1 appear to improve BubR1’s protein stability and
hyperphosphorylation (Figure 13B). Other residues of the conserved motif in BubR1’s
pseudokinase domain, D882, S884, and S913, may hold a similar importance in protein
stability. However, when tested none of these mutants showed neither loss of protein
stability, nor loss of hyperphosphorylation (Figure 14B). This finding supports the hypothesis
59
by Suijkerbuijk et al. that the human BubR1 is, indeed, a pseudokinase as these residues are
in positions important for kinase catalytic activity100.
Another BUB1B mutation found in MVA patients creates BubR1731X 100. When the
protein, BubR1731X, is expressed the pseudokinase domain is truncated. However, this protein
in MVA patients is seen in low quantities, as this mutation creates mRNA PTCs that are
recognized by the NMD pathway and are then quickly degraded. The BubR1731X protein
expressed from plasmid inserts do not produce PTCs and are found to be very stable in
vitro164. The absence of the BubR1 pseudokinase domain coupled with the protein’s stability
makes this mutant an excellent model to potentially isolate the function of the BubR1’s
pseudokinase domain.
We show that the loss of the pseudokinase domain in BubR1731X results in the loss of
mitotic hyperphosphorylation (Figure 14B). This loss of hyperphosphorylation in a highly
stable BubR1 mutant, indicating that it is not the instability of the BubR1 protein that causes
the loss of hyperphosphorylation, but the loss of the pseudokinase domain function. Thus, it
is apparent that the pseudokinase domain is important for more of the protein functioning
beyond protecting protein stability as was previously suggested100.
If the BubR1KD mutation destabilizes the BubR1 pseudokinase domain, it follows that the
domain would then not be able to function appropriately. In addition, removal of the
pseudokinase domain in the stable BubR1 mutants would cause a similar loss of domain
function, but without the reduction of cellular protein levels due to misfolded protein
degradation. The loss of the mitotic hyperphosphorylation being the resultant phenotype due
to pseudokinase domain dysfunction.
Three stable cell lines expressing mutant BubR1 proteins, BubR1WT, BubR1KD and
BubR1731X (Figure 15), were used to facilitate the study of BubR1 phosphorylation. It was
noted that the BubR1 protein becomes dephosphorylated upon mitotic exit146. Protein
phosphatases, PP1, and PP2A, have been suggested to work in relay to promote mitotic
progression85, with PP2A being directly recruited to the BubR1 protein through the KARD
domain47.
60
The loss of the hyperphosphorylation caused by the loss or mutation of the pseudokinase
domain seen in BubR1731X and BubR1KD, respectively, could be caused by one of two
potential explanations. One possibility is that the BubR1 mutants become phosphorylated,
but are then rapidly dephosphorylated without the regulation of the pseudokinase domain.
The second possibility is that the BubR1 mutants never become phosphorylated without the
pseudokinase domain regulation. An experiment was devised to test these possibilities on
BubR1KD and BubR1731X, using okadaic acid, a powerful inhibitor of both PP1 and PP2A.
We see that loss of phosphatase activity does not rescue the mitotic BubR1
hyperphosphorylation in either the BubR1KD or the BubR1731X mutants (Figure 16). These
results indicate that these pseudokinase domain mutants never become phosphorylated at the
sites that cause the mitotic BubR1 hyperphosphorylation, seen by electrophoresis.
Although mitotic phosphorylation is lost in BubR1KD and BubR1731X mutants, this does
not necessarily mean that all mitotic phosphorylation is lost. Previous research has shown
that mitotic protein kinases, Plk1 and Cdk1 phosphorylate BubR1 and are important for stable
KT-MT attachments and proper chromosome congression51,80,146,170. Two of the sites
identified as being phosphorylated by Plk1 and Cdk1 are S676 and S670,
respectively51,135,146. Another mitotic phosphorylation site identified by proteomic analysis is
S435171; however, the kinase responsible for S435 phosphorylation remains to be discovered.
The two phosphorylated residues, S670 and S676, are two of the three sites within the
KARD domain that are important for PP2A-B56 recruitment upon their phosphorylation47,
while the S435 is found in the GLEBS domain. Although the sites that cause
hyperphosphorylation are lost in both BubR1KD and BubR1731X, other mitotic BubR1 sites
may not be affected by the loss of BubR1’s pseudokinase function. To test if phospho-
specific, mitotic phosphorylation previously demonstrated to be lost in BubR1KD was also
lost in BubR1731X, equal levels of BubR1 mutant proteins were probed using mitotic
phospho-specific antibodies (Figure 18)51,135,146.
We show that both the phosphorylation of S676 and S670 is lost when the pseudokinase
domain is dysfunctional (Figure 18B). This result suggest that the KARD domain may rely
upon the BubR1 pseudokinase for the regulation of its phosphorylation. However, with the
varying amounts of BubR1 mutant protein expression seen between the cell lines, it was not
61
possible to appropriately quantify the level of BubR1 phosphorylation via Western blotting.
To remedy this issue an immunofluorescence assay was performed to confirm and quantify
this loss of BubR1 mutant phosphorylation. In the BubR1 mutant immunofluorescence assay
the prometaphase arrested cells exhibited a significant reduction in the phosphorylation of
both S676 and S670, confirming the results viewed by Western blot (Figure 20).
In contrast to the loss of phosphorylation seen in the BubR1 mutants at S676 and S670,
the phosphorylation of S435 does not appear to be as affected by BubR1 pseudokinase
dysfunction (Figure 18C). The residue S435 also occurs in a different region of the BubR1
protein than that of S676 and S670 residues. The phosphorylation of S435 in BubR1KD
suggests that despite the pseudokinase mutations at least a portion of the N-terminal BubR1
protein remains intact and functional as the mutant remains recognizable as a substrate for
kinase phosphorylation.
The loss of Plk1 activity causes a loss of BubR1 hyperphosphorylation170. The
phosphorylation of BubR1 by Plk1 requires Plk1 to bind to BubR1 through the PBD51. For
Plk1 to bind to a substrate, the substrate must be recognized by its PBD54. In both, BubR1731X
and BubR1KD, we see the loss of both the mitotic hyperphosphorylation and phosphorylation
of S676 (Figure 15 and 18B), indicating that the Plk1 may be unable to bind to either of the
pseudokinase domain mutants. To determine if the loss of Plk1 binding to BubR1 was
responsible for the loss of S676 phosphorylation, interaction studies between a GST
immobilized PBD wild-type sequence (GST-PBDWT) and a GST immobilized mutant PBD
sequence (GST-PBDAA), were performed. GST-PBDAA has two point mutations in the Plk1
binding sequence: H538A and L540A. These residues are critical for ligand binding, and
mutation of these residues prevents the PBD from interacting with its target substrate54,58.
Interestingly, despite the loss of both the hyperphosphorylation and the S676
phosphorylation seen in both BubR1KD and BubR1731X (Figure 15 and 18B), there is no loss
of Plk1 binding to either mutant in vitro. It has been shown that Plk1 binding to BubR1
requires prior BubR1 phosphorylation by Cdk1 at T62051. It follows that if all BubR1 mutants
can bind to PBDWT, then the BubR1 phosphorylation of T620 by Cdk1 remains unaffected
in all the cell line mutants.
62
In parallel to our research on the BubR1 phosphorylation due to pseudokinase domain
dysfunction, we also studied the alterations in phosphorylation due to a loss of function of
other conserved GLEBS domain. In the literature on BubR1, another BubR1 mutant
BubR1E413K was studied and the phosphorylation of both S670 and S676 were found to be
reduced and absent, respectively135. BubR1E413K is a GLEBS binding domain mutation,
which prevents the dimerization of Bub3 to BubR1. BubR1 requires Bub3 for proper
localization to the KT during mitosis68-70. To understand if this loss of phosphorylation at the
KARD domain was due to the lack of Bub3 interaction or of BubR1 localization to the KT,
transient transfections with BubR1 mutants were performed and analysed via Western
blotting (Figure 22).
We show that when the Bub3 protein is unable to bind to BubR1, there is a loss of S676
phosphorylation; however there does not appear to be any reduction of S670 phosphorylation
(Figure 22A). This contradicts previous findings for this same residue and antibody135. The
phosphorylation of S676 is not restored even when forcefully localized to the KT via the use
of a Mis-12 protein tag.
These results suggest that Bub3 binding to BubR1 is not necessary for BubR1 to be
phosphorylated by Cdk1; however, dimerization between Bub3 and BubR1 is required for
phosphorylation by Plk1. Previous research has suggested that Bub3 may alter the
conformation of those protein structures to which it binds172. This may be the mechanism
through which Bub3 dimerization with BubR1 facilitates the Plk1 phosphorylation at S676.
63
VI. Conclusion and Perspectives
In conclusion the BubR1 pseudokinase domain is seemingly important for the KARD
domain phosphatase recruitment functions by regulating the phosphorylation of both the
S670 and the S676. We believe that the loss of BubR1KD phosphorylation occurs through
instability of the pseudokinase domain, thereby causing a perturbation of pseudokinase
domain functioning and resulting in the loss of both S670 and S676 phosphorylation. The
stable BubR1731X protein by contrast directly loses its functioning by removal of the
pseudokinase domain, again resulting in the loss of S670 and S676 phosphorylation. The
mechanism by which the pseudokinase domain regulates these phosphorylations remains to
be explained.
Of the three residues important for recruitment PP2A-B56 to the BubR1 domain 80,100, we
show that at least two of those phosphorylations are lost upon pseudokinase dysfunction. The
recruitment of PP2A to BubR1 has also been noted not only to aid in KT-MT stabilization,
but also SAC silencing, which allows for mitotic exit79,90,93.
The GLEBS mutation, BubR1E413K, also loses the phosphorylation of the S676 in the
KARD domain. The BubR1 E413K S676 phosphorylation is not recovered even after forced
localization to the KT indicating that Bub3 binding is required, for this phosphorylation to
occur. Part of the SAC activity includes the stable formation of the BubR1-Bub3 heterodimer
70. The loss of this S676 phosphorylation due to loss of the BubR1-Bub3 interaction, would
therefore inhibit the PP2A-B56 recruitment to BubR1. The loss of the pseudokinase domain
function also inhibits two of these three key residues important for PP2A-B56
recruitment47,80.
In summary, these results indicate that the BubR1 KARD domain may be a major site of
signal integration, which is regulated by both the pseudokinase domain and GLEBS domain.
VI. 1. Perspectives
Several papers have suggested that BubR1 kinase activity exists, but that the activity is
CenpE dependent108,109,149,153. However, many of these experiments take place in non-human
cell models, which may have slightly different levels of pseudokinase degeneration, thus low
64
kinase activity may still persist in those models. However, in human BubR1 protein models
the evidence remains compelling that the BubR1 protein does not function as a kinase 100.
Although, that does not omit the possibility that both BubR1 and CenpE do interact through
the pseudokinase domain.
The human BubR1 protein was previously, shown to bind to CenpE via a yeast two-hybrid
assay148. To begin testing this BubR1-CenpE interaction hypothesis, experiments were
performed on HeLaS3 cells to knock-down endogenous CenpE and to view the alteration in
phosphorylation on endogenous BubR1 phosphorylation.
Figure 23 siCenpE reduces levels of BubR1 while increasing BubR1 phosphorylation.
A. HeLaS3 cells were transfected with siCenpE or Gl2i. The cells were released for 10 hours after thymidine
block and were treated either with or without nocodazole. The cells were fixed and stained with antibodies
against α-pS670 (TxRed), α-BubR1 (GFP) and α-CREST (blue). The DNA was visualized with Hoechst
33342. The images are representative of one experiment (n ≥ 10).
B. Dot-plot of relative levels of BubR1 protein, normalized to CREST, siCenpE and Gl2i transfected
cells treated with nocodazole.
C. Dot-plot of relative levels of BubR1 S670 phosphorylation relative to BubR1 levels, for the
siCenpE and Gl2i transfected cells treated with nocodazole.
65
Preliminary results show that loss of the endogenous CenpE causes an increase in mitotic
arrest, a decrease in endogenous BubR1 protein levels and causes a characteristic
chromosome alignment defect, where many of the chromosomes are aligned at the metaphase
plate with several chromosomes remaining near the spindle poles (Figure 24A). When the
siCenpE transfected cells are treated with nocodazole, they do not attach to the microtubules
and do not align at the metaphase plate, thus the cells appear to retain the standard
prometaphase phenotype (Figure 24A). When the HeLaS3 cells are transfected with siCenpE,
cells are not only depleted of CenpE, but the levels of BubR1 are severely reduced as well
(Figure 24B). Interestingly, remaining levels BubR1 have higher levels of S670
phosphorylation than normal endogenous BubR1 levels (Figure 24C). This preliminary data
may suggest that potentially CenpE causes an inhibition in BubR1 phosphorylation.
CenpE, as previously stated, was suggested to cause activation of pseudokinase BubR1’s
catalytic abilities108,109, which is not possible as the pseudokinase is non-functional in human
BubR1100. It would be relevant to identify were this BubR1-CenpE interaction takes place on
the BubR1 protein. To test these interactions, one method would use immunoprecipitation to
observe if the BubR1731X, loses the BubR1 protein’s ability to co-immunoprecipitate with the
CenpE protein. Another method would be to use a series of truncated BubR1 proteins in a
yeast two-hybrid assay to identify potential areas of interaction between the two proteins.
Once the sites of interaction are identified, possible mutations to isolate functions may
become available and viable avenues for further investigation.
Another interesting avenue to pursue is the potential loss of phosphorylation at other
regions of BubR1 due to loss of pseudokinase domain regulation beyond that of the KARD
domain. This question may be answered by protein phosphorylation analysis of mitotic
BubR1 mutant lysates via mass-spectrometry. This would aid in further understanding the
function of the pseudokinase domain and perhaps, help to better elucidate the overall BubR1
protein domain functions in both the KT-MT stabilization and SAC activity.
67
References
1 Bianconi, E. et al. An estimation of the number of cells in the human body. Annals of Human Biology 40,
463-471, doi:10.3109/03014460.2013.807878 (2013).
2 Hartl, D. L. & Jones, E. W. Essential genetics : Genomic perspective. 4th Edition edn, Vol. Fourth Ed.
(Jones & Bartlett Publishers, 2004).
3 Murray, A. W. & Kirschner, M. W. Dominoes and clocks: The union of two views of the cell cycle. Science
246, 614-621 (1989).
4 Hartwell, L. H. & Weinert, T. A. Checkpoints: Controls that ensure the order of cell cycle events. Science
246, 629-634 (1989).
5 Morgan, D. O. Cyclin-dependent kinases: engines, clocks, and microprocessors. Annual Review of Cell and
Developmental Biology 13, 261-291, doi:10.1146/annurev.cellbio.13.1.261 (1997).
6 Leicester, U. o.The cell cycle. (Univerisity of Leicester, Accessed: 16 September 2014).
7 Hartl, D. L. & Jones, E. W. Essential genetics : Genomic perspective. 4th Edition edn, Vol. Fourth Ed.
(Jones & Bartlett Publishers, 2004).
8 Pecorino, L. Molecular biology of cancer: Mechanisms, targets, and therapeutics. Vol. Third ed. 103-121
(Oxford University Press, 2012).
9 Massagué, J. G1 cell-cycle control and cancer. Nature 432, 298-306, doi:10.1038/nature03094 (2004).
10 Sherr, C. J. The pezcoller lecture: Cancer cell cycles revisited. Cancer Research 60, 3689-3695 (2000).
11 Giacinti, C. & Giordano, A. Rb and cell cycle progression. Oncogene 25, 5220-5227,
doi:10.1038/sj.onc.1209615 (2006).
12 Malumbres, M. & Barbacid, M. Mammalian cyclin-dependent kinases. Trends in Biochemical Sciences 30,
630-641, doi:10.1016/j.tibs.2005.09.005 (2005).
13 Murray, A. W. Recycling the cell cycle: cyclins revisited. Cell 116, 221-234 (2004).
14 Kelly, T. J. & Brown, G. W. Regulation of chromosome replication. Annual Review of Biochemistry 69,
829-880 (2000).
15 Welcker, M. & Clurman, B. E. Fbw7 ubiquitin ligase: A tumour suppressor at the crossroads of cell division,
growth and differentiation. Nature Reviews Cancer 8, 83-93 (2008).
16 Cuddihy, A. R. & O'Connell, M. J. Cell-cycle responses to DNA damage in g2. International Review of
Cytology 222, 99-140 (2002).
17 Lindqvist, A., Rodríguez-Bravo, V. & Medema, R. H. The decision to enter mitosis: feedback and
redundancy in the mitotic entry network. The Journal of Cell Biology 185, 193-202, doi:10.1083/jcb.200812045
(2009).
18 Leicester, U. o.The phases of mitosis. (Univerisity of Leicester, Accessed: 25 September 2014).
19 Morgan, D. O. The cell cycle: Principles of control. 87-109 (New Science Press Ltd., 2007).
68
20 Raven, P. H., Johnson, G. B., Losos, J. B. & Singer, S. R. Biology. 7th edn, 207-225 (McGraw-Hill, Higher
Education, 2005).
21 Musacchio, A. & Salmon, E., D. The spindle-assembly checkpoint in space and time. Nature Reviews
Molecular Cell Biology 8, 379-393, doi:10.1038/nrm2163 (2007).
22 Rieder, C. L., Schultz, A., Cole, R. & Sluder, G. Anaphase onset in vertebrate somatic cells is controlled by
a checkpoint that monitors sister kinetochore attachment to the spindle. The Journal of Cell Biology 127, 1301-
1310, doi:10.1083/jcb.127.5.1301 (1994).
23 Li, X. & Nicklas, R. B. Mitotic forces control a cell-cycle checkpoint. Nature 373, 630-632 (1995).
24 Kops, G. J. P. L. & Shah, J. V. Connecting up and clearing out: how kinetochore attachment silences the
spindle assembly checkpoint. Chromosoma 121, 509-525, doi:10.1007/s00412-012-0378-5 (2012).
25 Sudakin, V., Chan, G. K. & Yen, T. J. Checkpoint inhibition of the apc/c in hela cells is mediated by a
complex of bubr1, bub3, cdc20, and mad2. The Journal of Cell Biology 154, 925-936,
doi:10.1083/jcb.200102093 (2001).
26 Peters, J.-M. The anaphase promoting complex/cyclosome: a machine designed to destroy. Nature Reviews
Molecular Cell Biology 7, 644-656, doi:http://www.nature.com/nrm/journal/v7/n9/suppinfo/nrm1988_S1.html
(2006).
27 Choi, B. H., Pagano, M., Huang, C. & Dai, W. Cdh1, a substrate recruiting component of apc/c ubiquitin e3
ligase, specifically interacts with pten and promotes its removal from chromatin. Journal of Biological
Chemistry 289, 17951-17959, doi:10.1074/jbc.M114.559005 (2014).
28 Taylor, S. S., Shaw, A., Hu, J., Meharena, H. S. & Kornev, A. Pseudokinases from a structural perspective.
Biochemical Society Transactions 41, 981-986, doi:10.1042/bst20130120 (2013).
29 Krebs, E. G., Graves, D. J. & Fischer, E. H. Factors affecting the activity of muscle phosphorylase b kinase.
The Journal of Biological Chemistry 234, 2867-2873 (1959).
30 Krebs, E. G. & Fischer, E. H. The phosphorylase b to a converting enzyme of rabbit skeletal muscle.
Biochimica et Biophysica Acta 20, 150-157, doi:10.1016/0006-3002(56)90273-6 (1956).
31 Farley, A. R. & Link, A. J. in Methods in Enzymology Vol. 463 (eds R. Burgess Richard & P. Deutscher
Murray) 725-763 (Academic Press, 2009).
32 Khoury, G. A., Baliban, R. C. & Floudas, C. A. Proteome-wide post-translational modification statistics:
Frequency analysis and curation of the swiss-prot database. Scientific Reports 1,
doi:http://www.nature.com/srep/2011/110913/srep00090/abs/srep00090.html#supplementary-information
(2011).
33 Manning, G., Whyte, D. B., Martinez, R., Hunter, T. & Sudarsanam, S. The protein kinase complement of
the human genome. Science 298, 1912-1934, doi:10.1126/science.1075762 (2002).
34 Cozzone, A. J. Post-translational modification of proteins by reversible phosphorylation in prokaryotes.
Biochimie, 43-48 (1998).
35 Ubersax, J. A. & Ferrell, J. E. Mechanisms of specificity in protein phosphorylation. Nature Reviews
Molecular Cell Biology 8, 530-541, doi:10.1038/nrm2203 (2007).
36 Ptacek, J. et al. Global analysis of protein phosphorylation in yeast. Nature 438, 679-684,
doi:10.1038/nature04187 (2005).
69
37 Hanks, S., Quinn, A. M. & Hunter, T. The protein kinase family: Conserved features and deduced phylogeny
of the catalytic domains. Science 241, 42-52 (1988).
38 Zhu, H. et al. Analysis of yeast protein kinases using protein chips. Nature Genetics 26, 283-289 (2000).
39 Choudhary, C. & Mann, M. Decoding signalling networks by mass spectrometry-based proteomics. Nature
Reviews Molecular Cell Biology 11, 427-439, doi:10.1038/nrm2900 (2010).
40 Dou, Z. et al. Quantitative mass spectrometry analysis reveals similar substrate consensus motif for human
mps1 kinase and plk1. PLoS ONE 6, e18793, doi:10.1371/journal.pone.0018793 (2011).
41 Knighton, D. R. et al. Structure of a peptide inhibitor bound to the catalytic subunit of cyclic adenosine
monophosphate-dependent protein kinase. Science 253, 414-420 (1991).
42 Wierenga, R. K. & Hol, W. G. J. Predicted nucleotide-binding properties of p21 protein and its cancer-
associated variant. Nature 302, 842-844, doi:10.1038/302842a0 (1983).
43 Hanks, S. K. & Hunter, T. Protein kinases 6. The eukaryotic protein kinase superfamily: Kinase (catalytic)
domain structure and classification. Federation of American Societies for Experimental Biology 9, 576-596
(1995).
44 Nigg, E. A. Cell cycle regulation by protein kinases and phosphatases. Ernst Schering Research Foundation
workshop, 19-46 (2001).
45 Dephoure, N. et al. A quantitative atlas of mitotic phosphorylation. Proceedings of the National Academy
of Sciences of the United States of America 105, 10762-10767, doi:10.1073/pnas.0805139105 (2008).
46 Funabiki, H. & Wynne, D. J. Making an effective switch at the kinetochore by phosphorylation and
dephosphorylation. Chromosoma 122, 135-158, doi:10.1007/s00412-013-0401-5 (2013).
47 Suijkerbuijk, S. J., Vleugel, M., Teixeira, A. & Kops, G. J. Integration of kinase and phosphatase activities
by bubr1 ensures formation of stable kinetochore-microtubule attachments. Developmental Cell 23, 745-755,
doi:10.1016/j.devcel.2012.09.005 (2012).
48 Norbury, C. & Nurse, P. Animal cell cycles and their control. Annual Review of Biochemistry 61, 441-470
(1992).
49 Morgan, D. O. Cyclin-dependent kinases: Engines, Clocks, and Microprocessors. Cell and Developmental
Biology 13, 261-291, doi:10.1146/annurev.cellbio.13.1.261 (1997).
50 D'Angiolella, V., Mari, C., Nocera, D., Rametti, L. & Grieco, D. The spindle checkpoint requires cyclin-
dependent kinase activity. Genes and Development 17, 2520-2525, doi:10.1101/gad.267603 (2003).
51 Elowe, S., Hümmer, S., Uldschmid, A., Li, X. & Nigg, E. A. Tension-sensitive plk1 phosphorylation on
bubr1 regulates the stability of kinetochore–microtubule interactions. Genes and Development 21, 2205-2219,
doi:10.1101/gad.436007 (2007).
52 King, R. W., Deshaies, R. J., Peters, J.-M. & Kirschner, M. W. How proteolysis drives the cell cycle. Science
274, 1652-1659 (1996).
53 Archambault, V., Lepine, G. & Kachaner, D. Understanding the polo kinase machine. Oncogene, 1-9,
doi:10.1038/onc.2014.451 (2015).
54 Elia, A. E. H. et al. The molecular basis for phosphodependent substrate targeting and regulation of plks by
the polo-box domain. Cell 115, 83-95 (2003).
70
55 Seong, Y.-S. et al. A spindle checkpoint arrest and a cytokinesis failure by the dominant-negative polo-box
domain of plk1 in u-2 os cells. Journal of Biological Chemistry 277, 32282-32293,
doi:10.1074/jbc.m202602200 (2002).
56 Neef, R. et al. Phosphorylation of mitotic kinesin-like protein 2 by polo-like kinase 1 is required for
cytokinesis. Journal of Cell Biology 162, 863-875, doi:10.1083/job.200306009 (2003).
57 Neef, R. et al. Choice of plk1 docking partners during mitosis and cytokinesis is controlled by the activation
state of cdk1. Nature Cell Biology 9, 436-432, doi:10.1038/ncb1557 (2007).
58 Hanisch, A., Wehner, A., Nigg, E. A. & Silljé, H. H. W. Different plk1 functions show distinct dependencies
on polo-box domain-mediated targeting. Molecular Biology of the Cell 17, 448-459, doi:10.1091/mbc.E05-08-
0801 (2006).
59 Petronczki, M., Lénárt, P. & Peters, J.-M. M. Polo on the rise-from mitotic entry to cytokinesis with plk1.
Developmental Cell 14, 646-659, doi:10.1016/j.devcel.2008.04.014 (2008).
60 Plyte, S. & Musacchio, A. Plk1 inhibitors: Setting the mitotic death trap. Current Biology 17, R280-R283,
doi:10.1016/j.cub.2007.02.018 (2007).
61 London, N., Ceto, S., Ranish, J. A. & Biggins, S. Phosphoregulation of spc105 by mps1 and pp1 regulates
bub1 localization to kinetochores. Current Biology 22, 900-906, doi:10.1016/j.cub.2012.03.052 (2012).
62 Tipton, A. R. et al. Monopolar spindle 1 (mps1) kinase promotes production of closed mad2 (c-mad2)
conformer and assembly of the mitotic checkpoint complex. The Journal of Biological Chemistry 288, 35149-
35158, doi:10.1074/jbc.M113.522375 (2013).
63 Liu, X. & Winey, M. The mps1 family of protein kinases. Biochemistry 81, 561-585, doi:10.1146/annurev-
biochem-061611-090435 (2012).
64 Maciejowski, J. et al. Mps1 directs the assembly of cdc20 inhibitory complexes during interphase and
mitosis to control m phase timing and spindle checkpoint signaling. The Journal of Cell Biology 190, 89-100,
doi:10.1083/jcb.201001050 (2010).
65 Rischitor, P. E., May, K. M. & Hardwick, K. G. Bub1 is a fission yeast kinetochore scaffold protein, and is
sufficient to recruit other spindle checkpoint proteins to ectopic sites on chromosomes. PLoS ONE 2, e1342,
doi:10.1371/journal.pone.0001342 (2007).
66 Tang, Z., Sun, Y., Harley, S. E., Zou, H. & Yu, H. Human bub1 protects centromeric sister-chromatid
cohesion through shugoshin during mitosis. Proceedings of the National Academy of Sciences 101, 18012-
18017, doi:10.1073/pnas.0408600102 (2004).
67 Klebig, C., Korinth, D. & Meraldi, P. Bub1 regulates chromosome segregation in a kinetochore-independent
manner. The Journal of Cell Biology 185, 841-858, doi:10.1083/jcb.200902128 (2009).
68 Bailer, S. M. et al. Nup116p and nup100p are interchangeable through a conserved motif which constitutes
a docking site for the mrna transport factor gle2p. The EMBO Journal 17, 1107-1119,
doi:10.1093/emboj/17.4.1107 (1998).
69 Taylor, S. S., Ha, E. & McKeon, F. The human homologue of bub3 is required for kinetochore localization
of bub1 and a mad3/bub1-related protein kinase. The Journal of Cell Biology 142, 1-11 (1998).
70 Wang, X. et al. The mitotic checkpoint protein hbub3 and the mrna export factor hrae1 interact with gle2p-
binding sequence (glebs)-containing proteins. The Journal of Biological Chemistry 276, 26559-26567,
doi:10.1074/jbc.M101083200 (2001).
71
71 Shepperd, L. A. et al. Phosphodependent recruitment of bub1 and bub3 to spc7/knl1 by mph1 kinase
maintains the spindle checkpoint. Current Biology 22, 891-899, doi:10.1016/j.cub.2012.03.051 (2012).
72 Kiyomitsu, T., Obuse, C. & Yanagida, M. Human blinkin/af15q14 is required for chromosome alignment
and the mitotic checkpoint through direct interaction with bub1 and bubr1. Developmental Cell 13, 663-676,
doi:10.1016/j.devcel.2007.09.005 (2007).
73 Caldas, G. V., DeLuca, K. F. & DeLuca, J. G. Knl1 facilitates phosphorylation of outer kinetochore proteins
by promoting aurora b kinase activity. The Journal of Cell Biology 203, 957-969, doi:10.1083/jcb.201306054
(2013).
74 Kitagawa, K. & Niikura, Y. Caspase-independent mitotic death (cimd). Cell Cycle 7, 1001-1005,
doi:10.4161/cc.7.8.5720 (2014).
75 DeLuca, J. G. et al. Kinetochore microtubule dynamics and attachment stability are regulated by hec1. Cell
127, 969-982, doi:10.1016/j.cell.2006.09.047 (2006).
76 Cheeseman, I. M., Chappie, J. S., Wilson-Kubalek, E. M. & Desai, A. The conserved kmn network
constitutes the core microtubule-binding site of the kinetochore. Cell 127, 983-997,
doi:10.1016/j.cell.2006.09.039 (2006).
77 Ditchfield, C. et al. Aurora b couples chromosome alignment with anaphase by targeting bubr1, mad2, and
cenp-e to kinetochores. The Journal of Cell Biology 161, 267-280, doi:10.1083/jcb.200208091 (2003).
78 Kawashima, S. A., Yamagishi, Y., Honda, T., Ishiguro, K.-I. & Watanabe, Y. Phosphorylation of h2a by
bub1 prevents chromosomal instability through localizing shugoshin. Science 327, 172-177,
doi:10.1126/science.1180189 (2010).
79 Foley, E., Maldonado, M. & Kapoor, T. M. Formation of stable attachments between kinetochores and
microtubules depends on the B56-PP2A phosphatase. Nature Cell Biology 13, 1265-1216, doi:10.1038/ncb2327
(2011).
80 Kruse, T. et al. Direct binding between bubr1 and b56–pp2a phosphatase complexes regulate mitotic
progression. Journal of Cell Science 126, 1086-1092, doi:10.1242/jcs.122481 (2013).
81 Xu, P., Raetz, E. A., Kitagawa, M., Virshup, D. M. & Lee, S. H. Bubr1 recruits pp2a via the b56 family of
targeting subunits to promote chromosome congression. Biology Open 2, 479-486, doi:10.1242/bio.20134051
(2013).
82 Olsen, J. et al. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 127,
635-648, doi:10.1016/j.cell.2006.09.026 (2006).
83 Alonso, A. et al. Protein tyrosine phosphatases in the human genome. Cell 117, 699-711,
doi:10.1016/j.cell.2004.05.018 (2004).
84 Novak, B., Kapuy, O., Domingo-Sananes, M. R. & Tyson, J. J. Regulated protein kinases and phosphatases
in cell cycle decisions. Current Opinion In Cell Biology 22, 801-808, doi:10.1016/j.ceb.2010.07.001 (2010).
85 Grallert, A. et al. A pp1-pp2a phosphatase relay controls mitotic progression. Nature 517, 94-98,
doi:10.1038/nature14019 (2014).
86 Dohadwala, M. et al. Phosphorylation and Inactivation of protein phosphatase 1 by cyclin-dependent
kinases. Proceedings of the National Academy of Sciences of the United States of America 91, 6408-6412
(1994).
72
87 Kwon, Y.-G., Lee, S. Y., Choi, Y., Greengard, P. & Nairn, A. C. Cell cycle-dependent phosphorylation of
mammalian protein phosphatase 1 by cdc2 kinase. Proceedings of the National Academy of Sciences of the
United States of America 94, 2168-2173 (1997).
88 Wu, J. et al. Pp1-mediated dephosphorylation of phosphoproteins at mitotic exit is controlled by inhibitor-
1 and pp1 phosphorylation. Nature Cell Biology 11, 644-651, doi:10.1038/ncb1871 (2009).
89 Liu, D. et al. Regulated targeting of protein phosphatase 1 to the outer kinetochore by knl1 opposes aurora
b kinase. The Journal of Cell Biology 188, 809-820, doi:10.1083/jcb.201001006 (2010).
90 Nijenhuis, W., Vallardi, G., Teixeira, A., Kops, G., J. P. L. & Saurin, A., T. . Negative feedback at
kinetochores underlies a responsive spindle checkpoint signal. Nature Cell Biology 16, 1257-1264,
doi:10.1038/ncb3065 (2014).
91 Meadows, J. C. et al. Spindle checkpoint silencing requires association of pp1 to both spc7 and kinesin-8
motors. Developmental Cell 20, 739-750, doi:10.1016/j.devcel.2011.05.008 (2011).
92 Sents, W., Ivanova, E., Lambrecht, C., Haesen, D. & Janssens, V. The biogenesis of active protein
phosphatase 2a holoenzymes: A tightly regulated process creating phosphatase specificity. The Federation of
European Biochemical Societies Journal 280, 644-661, doi:10.1111/j.1742-4658.2012.08579.x (2012).
93 Espert, A. et al. Pp2a-b56 opposes mps1 phosphorylation of knl1 and thereby promotes spindle assembly
checkpoint silencing. The Journal of Cell Biology 206, 833-842, doi:10.1083/jcb.201406109 (2014).
94 Boudeau, J., Miranda-Saavedra, D., Barton, G. J. & Alessi, D. R. Emerging roles of pseudokinases. Trends
in Cell Biology 16, 443-452, doi:10.1016/j.tcb.2006.07.003 (2006).
95 Kannan, N. & Taylor, S. S. Rethinking pseudokinases. Cell 133, 204-205, doi:10.1016/j.cell.2008.04.005
(2008).
96 Kornev, A. P. & Taylor, S. S. Pseudokinases: Functional insights gleaned from structure. Structure 17, 5-7,
doi:10.1016/j.str.2008.12.005 (2009).
97 Zeqiraj, E. & van Aalten, D. Pseudokinases-remnants of evolution or key allosteric regulators? Current
Opinion In Structural Biology 20, 772-781, doi:10.1016/j.sbi.2010.10.001 (2010).
98 Min, X., Lee, B., Cobb, M. & Goldsmith, E. Crystal structure of the kinase domain of wnk1, a kinase that
causes a hereditary form of hypertension. Structure 12, 1303-1311, doi:10.1016/j.str.2004.04.014 (2004).
99 Mukherjee, K. et al. Cask functions as a mg2+-independent neurexin kinase. Cell 133, 328-339,
doi:10.1016/j.cell.2008.02.036 (2008).
100 Suijkerbuijk, S. J. et al. The vertebrate mitotic checkpoint protein bubr1 is an unusual pseudokinase.
Developmental Cell 22, 1321-1329, doi:10.1016/j.devcel.2012.03.009 (2012).
101 Hoyt, M. A., Totis, L. & Roberts, B. T. S. cerevisiae genes required for cell cycle arrest in response to
loss of microtubule function. Cell 66, 507-517, doi:10.1016/0092-8674(81)90014-3 (1991).
102 Li, R. & Murray, A., W. . Feedback control of mitosis in budding yeast. Cell 66, 519-531,
doi:10.1016/0092-8674(81)90015-5 (1991).
103 Hardwick, K. G., Weiss, E., Luca, F. C., Winey, M. & Murray, A. W. Activation of the budding yeast
spindle assembly checkpoint without mitotic spindle disruption. Science 273, 953-956 (1996).
104 Cahill, D. et al. Mutations of mitotic checkpoint genes in human cancers. Nature 392, 300-303 (1998).
73
105 Fang, G. Checkpoint protein bubr1 acts synergistically with mad2 to inhibit anaphase-promoting
complex. Molecular Biology of the Cell 13, 755-766, doi:10.1091/mbc.01-09-0437 (2002).
106 Tang, Z., Bharadwaj, R., Li, B. & Yu, H. Mad2-independent inhibition of apccdc20 by the mitotic
checkpoint protein bubr1. Developmental Cell 1, 227-237, doi:10.1016/S1534-5807(01)00019-3 (2001).
107 Chen, R.-H. BubR1 is essential for kinetochore localization of other spindle checkpoint proteins and its
phosphorylation requires mad1. The Journal of Cell Biology 158, 487-496, doi:10.1083/jcb.200204048 (2002).
108 Mao, Y., Abrieu, A. & Cleveland, D. W. Activating and silencing the mitotic checkpoint through cenp-
e-dependent activation/inactivation of bubr1. Cell 114, 87-98 (2003).
109 Guo, Y., Kim, C., Ahmad, S., Zhang, J. & Mao, Y. Cenp-e--dependent bubr1 autophosphorylation
enhances chromosome alignment and the mitotic checkpoint. The Journal of Cell Biology 198, 205-217,
doi:10.1083/jcb.201202152 (2012).
110 Kops, G. J., Foltz, D. R. & Cleveland, D. W. Lethality to human cancer cells through massive
chromosome loss by inhibition of the mitotic checkpoint. Proceedings of the National Academy of Sciences of
the United States of America 101, 8699-8704, doi:10.1073/pnas.0401142101 (2004).
111 Sczaniecka, M. et al. The spindle checkpoint functions of mad3 and mad2 depend on a mad3 ken box-
mediated interaction with cdc20-anaphase-promoting complex (apc/c). The Journal of Biological Chemistry
283, 23039-23047, doi:10.1074/jbc.M803594200 (2008).
112 Lampson, M. A. & Kapoor, T. M. The human mitotic checkpoint protein bubr1 regulates chromosome–
spindle attachments. Nature Cell Biology 7, 93-98, doi:10.1038/ncb1208 (2005).
113 Meraldi, P., Draviam, V. M. & Sorger, P. K. Timing and Checkpoints in the Regulation of Mitotic
Progression. Developmental Cell 7, 45-60, doi:10.1016/j.devcel.2004.06.006 (2004).
114 Rahmani, Z., Gagou, M. E., Lefebvre, C., Emre, D. & Karess, R. E. Separating the spindle, checkpoint,
and timer functions of bubr1. The Journal of Cell Biology 187, 597-605, doi:10.1083/jcb.200905026 (2009).
115 Lara-Gonzalez, P., Westhorpe, F., G. & Taylor, S. S. The spindle assembly checkpoint. Current Biology
22, R966-R980, doi:10.1016/j.cub.2012.10.006 (2012).
116 Bolanos-Garcia, V., M. & Blundell, T., L. . Bub1 and bubr1: Multifaceted kinases of the cell cycle.
Trends in Biochemical Sciences 36, 141-150, doi:10.1016/j.tibs.2010.08.004 (2011).
117 Chao, W., Kulkarni, K., Zhang, Z., Kong, E. & Barford, D. Structure of the mitotic checkpoint complex.
Nature 484, 208-214, doi:10.1038/nature10896 (2012).
118 Izawa, D. & Pines, J. The mitotic checkpoint complex binds a second cdc20 to inhibit active apc/c.
Nature 517, 631-634, doi:10.1038/nature13911 (2015).
119 Lara-Gonzalez, P., Scott, M. I. F., Diez, M., Sen, O. & Taylor, S. S. Bubr1 blocks substrate recruitment
to the apc/c in a ken-box-dependent manner. Journal of Cell Science 124, 4332-4345, doi:10.1242/jcs.094763
(2011).
120 Foley, E. & Kapoor, T. Microtubule attachment and spindle assembly checkpoint signalling at the
kinetochore. Nature Reviews Molecular Cell Biology 14, 25-37, doi:10.1038/nrm3494 (2013).
121 Yamagishi, Y., Yang, C.-H., Tanno, Y. & Watanabe, Y. Mps1/mph1 phosphorylates the kinetochore
protein knl1/spc7 to recruit sac components. Nature Cell Biology 14, 746-752, doi:10.1038/ncb2515 (2012).
74
122 Karess, R. E., Wassmann, K. & Rahmani, Z. New insights into the role of bubr1 in mitosis and beyond.
International Review of Cell and Molecular Biology 306, 223-273, doi:10.1016/B978-0-12-407694-5.00006-7
(2012).
123 Cheeseman, I. M. & Desai, A. Molecular architecture of the kinetochore-microtubule interface. Nature
Reviews Molecular Cell Biology 9, 33-46, doi:10.1038/nrm2310 (2008).
124 Santaguida, S. & Musacchio, A. The life and miracles of kinetochores. The EMBO Journal 28, 2511-
2531, doi:10.1038/emboj.2009.173 (2009).
125 Welburn, J. P. et al. Aurora b phosphorylates spatially distinct targets to differentially regulate the
kinetochore-microtubule interface. Molecular cell 38, 383-392, doi:10.1016/j.molcel.2010.02.034 (2010).
126 Zhang, G., Lischetti, T. & Nilsson, J. A minimal number of melt repeats supports all the functions of
knl1 in chromosome segregation. Journal of Cell Science 127, 871-884, doi:10.1242/jcs.139725 (2014).
127 Vleugel, M. et al. Sequential multisite phospho-regulation of knl1-bub3 interfaces at mitotic
kinetochores. Molecular Cell 57, 824-835, doi:10.1016/j.molcel.2014.12.036 (2015).
128 Meraldi, P. & Sorger, P. K. A dual role for bub1 in the spindle checkpoint and chromosome congression.
The EMBO journal 24, 1621-1633, doi:10.1038/sj.emboj.7600641 (2005).
129 Howell, B. et al. Spindle checkpoint protein dynamics at kinetochores in living cells. Current Biology
14, 953-964, doi:10.1016/j.cub.2004.05.053 (2004).
130 Johnson, V. L., Scott, M. I. F., Holt, S. V., Hussein, D. & Taylor, S. S. Bub1 is required for kinetochore
localization of bubr1, cenp-e, cenp-f and mad2, and chromosome congression. Journal of Cell Science 117,
1577-1589 (2004).
131 Kim, S. J., Sun, H., Tomchick, D., Yu, H. & Luo, X. L. Structure of human mad1 c-terminal domain
reveals its involvement in kinetochore targeting. Proceedings of The National Academy of Sciences 109, 6549-
6554, doi:10.1073/pnas.1118210109 (2012).
132 Perera, D. et al. Bub1 maintains centromeric cohesion by activation of the spindle checkpoint.
Developmental cell 13, 566-579, doi:10.1016/j.devcel.2007.08.008 (2007).
133 Sharp-Baker, H. & Chen, R. H. Spindle checkpoint protein bub1 is required for kinetochore localization
of mad1, mad2, bub3, and cenp-e, independently of its kinase activity. The Journal of Cell Biology 153, 1239-
1249 (2001).
134 Vigneron, S. et al. Kinetochore localization of spindle checkpoint proteins: Who controls whom?
Molecular Biology of The Cell 15, 4584-4596, doi:10.1091/mbc.E04-01-0051 (2004).
135 Elowe, S. et al. Uncoupling of the spindle-checkpoint and chromosome-congression functions of bubr1.
Journal of Cell Science 123, 84, doi:10.1242/jcs.056507 (2010).
136 Orr, B., Bousbaa, H. & Sunkel, C. E. Mad2-independent spindle assembly checkpoint activation and
controlled metaphase-anaphase transition in drosophila s2 cells. Molecular Biology of the Cell 18, 850-863,
doi:10.1091/mbc.E06-07-0587 (2007).
137 Pfleger, C. M. & Kirschner, M. The ken box: An apc recognition signal distinct from the d box targeted
by cdh1. Genes and Development 14, 655-665 (2000).
138 Burton, J. L. & Solomon, M. J. Mad3p, a pseudosubstrate inhibitor of apccdc20 in the spindle assembly
checkpoint. Genes and Development 21, 655-667 (2007).
75
139 King, E., van Der Sar, S. & Hardwick, K. Mad3 ken boxes mediate both cdc20 and mad3 turnover, and
are critical for the spindle checkpoint. PLoS ONE 2, e342, doi:10.1371/journal.pone.0000342 (2007).
140 Choi, E. et al. Bubr1 acetylation at prometaphase is required for modulating apc/c activity and timing of
mitosis. The EMBO journal 28, 2077-2089, doi:10.1038/emboj.2009.123 (2009).
141 Imami, K., Sugiyama, N., Kyono, Y., Tomita, M. & Ishirama, Y. Automated phosphoproteome analysis
for cultured cancer cells by two-dimensional nanolc-ms using a calcined titania/c18 biphasic column. Analytical
Sciences 24, 161-166 (2008).
142 Yekezare, M. & Pines, J. Escaping the firing squad: Acetylation of bubr1 protects it from degradation
in checkpoint cells. The EMBO Journal 28, 1991-1993, doi:10.1038/emboj.2009.149 (2009).
143 Park, I. et al. Loss of bubr1 acetylation causes defects in spindle assembly checkpoint signaling and
promotes tumor formation. The Journal of Cell Biology 202, 295-309, doi:10.1083/jcb.201210099 (2013).
144 D'Arcy, S., Davies, O. R., Blundell, T. L. & Bolanos-Garcia, V. M. Defining the molecular basis of
bubr1 kinetochore interactions and apc/c-cdc20 inhibition. The Journal of Biological Chemistry 285, 14764-
14776, doi:10.1074/jbc.M109.082016 (2010).
145 Bolanos-Garcia, V. M. et al. Structure of a blinkin-bubr1 complex reveals an interaction crucial for
kinetochore-mitotic checkpoint regulation via an unanticipated binding site. Structure 19, 1691-1700,
doi:10.1016/j.str.2011.09.017 (2011).
146 Huang, H. et al. Phosphorylation sites in bubr1 that regulate kinetochore attachment, tension, and mitotic
exit. The Journal of Cell Biology 183, 667-680, doi:10.1083/jcb.200805163 (2008).
147 Harris, L., Davenport, J., Neale, G. & Goorha, R. The mitotic checkpoint gene bubr1 has two distinct
functions in mitosis. Experimental Cell Research 308, 85-100, doi:10.1016/j.yexcr.2005.03.036 (2005).
148 Chan, G. K. T., Jablonski, S. A., Sudakin, V., Hittle, J. C. & Yen, T. J. Human bubr1 is a mitotic
checkpoint kinase that monitors cenp-e functions at kinetochores and binds the cyclosome/apc. The Journal of
Cell Biology 146, 941-954, doi:10.1083/jcb.146.5.941 (1999).
149 Putkey, F. R. et al. Unstable kinetochore-microtubule capture and chromosomal instability following
deletion of cenp-e. Developmental Cell 3, 351-365, doi:10.1016/S1534-5807(02)00255-1 (2002).
150 Schaar, B. T., Chan, G. K., Maddox, P., Salmon, E. D. & Yen, T. J. Cenp-e function at kinetochores is
essential for chromosome alignment. The Journal of Cell Biology 139, 1373-1382 (1997).
151 Wood, K., Sakowicz, R., Goldstein, L. & Cleveland, D. W. Cenp-e is a plus end-directed kinetochore
motor required for metaphase chromosome alignment. Cell 91, 357-366 (1997).
152 Abrieu, A., Kahana, J. A., Wood, K. W. & Cleveland, D. W. Cenp-e as an essential component of the
mitotic checkpoint in vitro. Cell Press 102, 817-826 (2000).
153 Chan, G., Schaar, B. & Yen, T. Characterization of the kinetochore binding domain of cenp-e reveals
interactions with the kinetochore proteins cenp-f and hbubr1. The Journal of Cell Biology 143, 49-63 (1998).
154 Baker, D. J. et al. Bubr1 insufficiency causes early onset of aging-associated phenotypes and infertility
in mice. Nature Genetics 36, 744-749, doi:10.1038/ng1382 (2004).
155 Bohers, E. et al. Gradual reduction of bubr1 protein levels results in premature sister-chromatid
separation then in aneuploidy. Human Genetics 124, 473-478, doi:10.1007/s00439-008-0572-y (2008).
76
156 Baker, D. J. et al. Increased expression of bubr1 protects against aneuploidy and cancer and extends
healthy lifespan. Nature Cell Biology 15, 96-102, doi:10.1038/ncb2643 (2012).
157 Hanks, S. et al. Constitutional aneuploidy and cancer predisposition caused by biallelic mutations in
BUB1B. Nature Genetics 36, 1159-1161, doi:10.1038/ng1449 (2004).
158 Matsuura, S. et al. Monoallelic bub1b mutations and defective mitotic‐spindle checkpoint in seven
families with premature chromatid separation (pcs) syndrome. American Journal of Medical Genetics Part A
140, 358-367, doi:10.1002/ajmg.a.31069 (2006).
159 Kajii, T. et al. Mosaic variegated aneuploidy with multiple congenital abnormalities: Homozygosity for
total premature chromatid separation trait. American Journal of Medical Genetics 78, 245-249,
doi:10.1002/(SICI)1096-8628(19980707)78:3<245::AID-AJMG7>3.0.CO;2-O (1998).
160 Limwongse, C., Schwartz, S., Bocian, M. & Robin, N. H. Child with mosaic variegated aneuploidy and
embryonal rhabdomyosarcoma. American Journal of Medical Genetics 82, 20-24, doi:10.1002/(SICI)1096-
8628(19990101)82:1<20::AID-AJMG4>3.0.CO;2-5 (1999).
161 Plaja, A. et al. Variegated aneuploidy related to premature centromere division (pcd) is expressed in
vivo and is a cancer‐prone disease. American Journal of Medical Genetics, doi:10.1002/1096-
8628(20010122)98:3<216::AID-AJMG1091>3.0.CO;2-0 (2001).
162 Kajii, T. et al. Cancer‐prone syndrome of mosaic variegated aneuploidy and total premature chromatid
separation: Report of five infants. American Journal of Medical Genetics 104, 57-64, doi:10.1002/ajmg.1580
(2001).
163 Hartl, D. L. & Jones, E. W. Essential genetics : Genomic perspective. 4th Edition edn, Vol. Fourth Ed.
(Jones & Bartlett Publishers, 2004).
164 Suijkerbuijk, S. J. et al. Molecular causes for bubr1 dysfunction in the human cancer predisposition
syndrome mosaic variegated aneuploidy. Cancer Research 70, 4891-4900, doi:10.1158/0008-5472.CAN-09-
4319 (2010).
165 Mao, Y., Desai, A. & Cleveland, D. W. Microtubule capture by cenp-e silences bubr1-dependent mitotic
checkpoint signaling. The Journal of Cell Biology 170, 873-880, doi:10.1083/jcb.200505040 (2005).
166 Harborth, J., Elbashir, S. M., Bechert, K., Tuschl, T. & Weber, K. Identification of essential genes in
cultured mammalian cells using small interfering RNAs. Journal of Cell Science 114, 4557-4565 (2001).
167 Elbashir, S. M. et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian
cells. Nature 411, 494-498 (2001).
168 Schneider, C., Rasband, W. & Eliceiri, K. Nih image to imagej: 25 years of image analysis. Nature
Methods 9, 671-675, doi:10.1038/nmeth.2089 (2012).
169 Goldberg, A. L. Protein degradation and protection against misfolded or damaged proteins. Nature 426,
895-899, doi:10.1038/nature02263 (2003).
170 Matsumura, S., Toyoshima, F. & Nishida, E. Polo-like kinase 1 facilitates chromosome alignment during
prometaphase through bubr1. Journal of Biological Chemistry 282, 15217-15227,
doi:10.1074/jbc.M611053200 (2007).
171 Steen, J. et al. Different phosphorylation states of the anaphase promoting complex in response to
antimitotic drugs: A quantitative proteomic analysis. Proceedings of the National Academy of Sciences of the
United States of America 105, 6069-6074, doi:10.1073/pnas.0709807104 (2008).
77
172 Han, J. S., Vitre, B., Fachinetti, D. & Cleveland, D. W. Bimodal activation of bubr1 by bub3 sustains
mitotic checkpoint signaling. Proceedings of the National Academy of Sciences of the United States of America
111, e4185-e4193, doi:10.1073/pnas.1416277111 (2014).