regulation of plant gene expression

8/12/2019 Regulation of Plant Gene Expression

1/22

REGULATION OF PLANT GENE

EXPRESSION


2/22

Multigene families

Many plant genes isolated so far are members ofmultigene families, eg; storage protein, rbcS,leghemoglobin etc.

Evolution from single ancestral gene by duplication andamplification through unequal crossing over andchromosomal mutations.

Plants tolerant to the accumulation mutations in genes,especially when multiple copies are present.

High incidence of polyploidy leads to natural increase ingene or allele number .

Gene clusters and the dispersed genes may be physicallylinked on the same chromosome or reside in differentchromosome


3/22


4/22

Individual genes accumulate mutations in

their 5 and 3 which affect specific cis acting

seq required for normal regulation of

expression.

Degree of homology of flanking regions vary

at sequence level both in the no: and size of

point mutations.


5/22

Dispersed genes by how they have arisen(translocations introgressions from otherspecies integration as pseudogenes) may be

located in the areas of genome with varyingactivity where expression is expediated ordepressed from normal levels.

Nothing much is known about the mode ofaction ,stability or availability of trans actingfactors in the nucleus.


6/22

Classical genetic studies have identified a no: ofloci which regulate storage protein expressionon chromosomes than those on which are

located the zein strl genes which they affect. If the products of these regulatory loci are not

available to the promoters of structural geneson a regular basis, because of chromosomal

organisation within the nucleus or unevendiffusion in the nuclear matrix, differentstructural gene loci may be expressed indifferent levels.


7/22

Accumulation of mutated or truncated geneswhich though nonfunctional are observed ashybridizing seq in Southern analysis.

Eg: one of the maize zein genes, basesubstitution changes the ATG to CTG so, mRNAis not translated. In others, stop codon in codingregion, so transcription normal but translated astruncated polypeptides

Processed pseudogenes where reversetranscripts of the mRNA are incorporated in tothe genome are seen in potato actin gene


8/22

STORAGE PROTEIN GENES

Expressed in a tissue specific manner

Expressed at high levels in a coordinated

fashion,have conserved DNA motifs at 5region

Eg:prolamin box (-300 box) found in maize,barley, wheat etc.

Legumin box:

TCCATAGCCATGCATGCTGAAGAATGTC Vicillin box:GCCACCTCaattt

Zein:CACATGTGTAAAGGT

Anaerobic response: CGGTTT---TGGTTT


9/22

LIGHT REGULATED GENE S

cab genes, rbcS gene families

Mediated by light receptors like the

phytochrome and recognition of the light

quality and quantity

First element upstream TATA box, the iind

Light responsive element(LRE) between the

first and 410 nt upstream of trans start siteLRE reacts with other 5 reg seq.


10/22

Some genes contain multiple TATA boxes,where as there are others(house keepinggenes gen) which lack TATA.

Other motifs compensate for the lack of TATAbox.(nuc genes inv in photosynthesis)

Core or minimal promoters. : do not initiate

transcription by themselves, instead,contribute to the binding of RNA pol to thepromoter.


11/22

REGULATION DIFFERENT LEVELS

Chromatin conformation

Gene transcription

Nuclear RNA modification, splicing, turn over,

transport, Cytoplasmic RNA turnover Translation

Post translational modification

Protein localization Protein turnover


12/22

Accessibility of DNA in the nucleosome to

RNA polymerase is regulated by the

acetylation of lysine residues in the core

histones.

Methylation blocks transciption by alterring

the chromatin conformation.

Post transcriptional regulation


13/22

ALTERNATIVE SPLICING

Important control mechanism in higher organisms.

eg: Rubisco activase,FCA genes

Ribulose 1,5-bisphosphatecarboxylase/oxygenase

activase

Nuclear encoded gene for a chloroplast protein that

regulates Rubisco activity in response to light

induced changes in the redox potential andchanges in the ADP/ATP ratio


14/22

2 isoforms are formed, the larger one having more

aminoacids in the C terminus, sensitive to ADP

inhibition, redox regulated.

The smaller one can also regulate Rubisco activity. The sensitivity to ADP in the larger isoform

depends on the presence of 2 cysteine residues in

the C terminus, which disulphide bonds is involved

in the redox regulation of Rubisco.

Larger one influences the activity of the smaller

one.


15/22


16/22

Alternative splicing was first observed in 1977 in

adenoviruses.

Adenoviruses produce two different primary transcripts, one

early in the life cycle and one later, after DNA replication.

Researchers found that the primary RNA transcript

produced by adenovirus type 2 in the late phase was spliced

in different ways, resulting in mRNAs encoding different viral

proteins.

Both 5 and 3 splice sites varied, and in addition, thetranscript contained multiple poly A sites, giving different 3

ends for the processed mRNAs.


17/22

Five basic modes of alternative splicing are generallyrecognized.

Exon skippingor cassette exon: in this case, an exon

may be spliced out of the primary transcript or retained.

This is the most common mode in mammalian pre-

mRNAs.

Mutually exclusive exons: One of two exons is retained

in mRNAs after splicing, but not both.

Alternative donor site: An alternative 5' splice junction

(donor site) is used, changing the 3' boundary of the

upstream exon.

Alternative acceptor site: An alternative 3' splice

junction (acceptor site) is used, changing the 5'

boundary of the downstream exon.


18/22

Intron retention: A sequence may be spliced outas an intron or simply retained.

This is distinguished from exon skipping becausethe retained sequence is not flanked by introns.

If the retained intron is in the coding region, theintron must encode amino acids in frame with theneighboring exons, or a stop codon or a shift in thereading frame will cause the protein to be non-functional.

This is the rarest mode in mammals.


19/22

In addition to these primary modes of alternative splicing, there are two

other main mechanisms by which different mRNAs may be generated

from the same gene; multiple promoters and multiple polyadenylation

sites.

Use of multiple promoters is properly described as transcriptional

regulation mechanism rather than alternative splicing.

By starting transcription at different points, transcripts with different 5'-

most exons can be generated.

At the other end, multiple polyadenylation sites provide different 3' end

points for the transcript.

Both of these mechanisms are found in combination with alternative

splicing and provide additional variety in mRNAs derived from a gene.


20/22


21/22

Splicing is regulated by trans acting proteins(repressors and activators), correspondingcis -acting regulatory sites (silencers and

enhancers) on the RNA, and other RNAfeatures that influence how splicing willoccur, such as secondary structures.

Together, these elements form a "splicingcode" that governs how splicing will occurunder different cellular conditions


22/22

There are two major types of cis acting RNA sequence elements

present in pre-mRNAs and they have corresponding trans acting RNA

binding proteins.

Splicing silencersare sites to which splicing repressor proteins bind,

reducing the probability that a nearby site will be used as a splice

junction.

These can be located in the intron itself (intronic splicing silencers, ISS)

or in a neighboring exon (exonic splicing silencers, ESS).

Vary in sequence, as well as in the types of proteins that bind to them.

The majority of splicing repressors are heterogenous nuclearribonuclear proteins (hnRNPs) such as hnRNPA1 and polypyrimidine

tract binding protein (PTB).

regulation of plant gene expression

Documents