removal of tetracycline and tetracycline resistance genes

11

［Japanese Journal of Water Treatment Biology Vol.53 No.1 11－21 2017］

Removal of Tetracycline and Tetracycline Resistance Genes from Municipal Wastewater

in Microcosm Fill-and-Drain Constructed WetlandsPHAM THANH HIEN1, TOYAMA TADASHI2, and MORI KAZUHIRO2

1Integrated Graduate School of Medicine and Engineering, University of Yamanashi / 4－3－11 Takeda, Kofu, Yamanashi 400－8511, Japan

2Graduate Faculty of Interdisciplinary Research, University of Yamanashi / 4－3－11 Takeda, Kofu, Yamanashi 400－8511, Japan

Abstract This study investigated the capacity of fill-and-drain constructed wetlands (CWs) for removal of a commonantibiotic, tetracycline (TC), and tetracycline resistance genes (tet genes) frommunicipalwastewater.TC (230 µg/L) containingwastewaterwas treated inthe CWs planted or non-planted with common reed (Phragmites australis). TC wasremovedsignificantly in theplanted (95.4%removal)andnon-planted (87.2%removal) CWswithatreatmenttimeof1day.BothCWs,withlongertreatmenttimes,completelyremovedTCfromthewastewater.AdsorptionofTCtosoilmaterialsmightbethemajormechanismofremovalbytheCWsovertheshort-term.BiodegradationofTCbynativemicroorganisms present in wastewater also contributed in TC removal in CWs. Inaddition,theplantedCWsshowedhigherTCremovalefficiencythandidthenon-plantedones.Thepresenceoffivetet genes (tetC,tetM,tetO,tetQ,andtetW)wasmonitoredintheplantedCWs.Theinfluentwastewaterhad1.7×102‒2×104copies/mLofthesegenes.Allthe tet geneswerecompletelyremoved fromwastewaterby theplantedCWswith1daytreatment.In28dayssequencingbatchexperimentsusingplantedandnon-plantedCWstreatingTCcontainingwastewater(250 µg/L)withtreatmenttimeof2days,theplantedCWs completely and repeatedly removedTC from thewastewater.TC removalbynon-plantedCWswas98.9‒99.8%,andlowconcentrationofTCpersistedintheeffluents.Thepresence of plants provided the effective TC removal in the CWs for a long-term.TheplantedCWsalsomaintainedabout3 logreductionof tet genes fromwastewaterduringthesequencingbatchexperiments.TheseresultssuggestthepotentialofplantedCWsforuseintheremovalTCand tetgenesfrommunicipalwastewater.

Keywords: constructed wetland, common reed (Phragmites australis), tetracycline, tetracycline resistance genes

INTRODUCTION Tetracycline (TC) is a common antibiotic, widely used in the therapy of human and veterinary infection. Besides, it is usually added at sub-therapeutic levels to animal feeds for growth promoting purpose1). The intensive and extensive uses of TC result in its release to aquatic environments where

this antibiotic can cause acute and chronic toxicities to aquatic organisms1),2). Moreover, the presence of TC, even at very low concen-trations, can facilitate the emergence and spread of tetracycline resistance genes (tet genes)3). Tet genes reduce the therapeutic potential of TC against human and animal pathogens and, thereby, increase the risk to public health. TC and tet genes are frequently

12 Japanese J. Wat. Treat. Biol. Vol.53 No.1

detected in various types of aquatic envi-ronments, including surface water, ground water, sediment, and drinking water1),4)－6). For these reasons, TC and tet genes are considered as emerging pollutants, responsible for public health problems. Conventional wastewater treatment plants (WWTPs) continuously receive wastewater from various sources, such as homes, hospitals, and livestock industries, which contains antibiotics and antibiotic resistance genes (ARGs), particularly TC and tet genes. However, these treatment plants are usually not able to adequately remove the antibiotics and ARGs before discharging the water into the environment7). Moreover, some studies have suggested that biological wastewater treatment processes, such as activated sludge, can provide suitable conditions for the development of ARGs and their spread because bacteria are continuously mixed with antibiotics or ARGs7),8). WWTPs are considered a “hotspot” for the release of antibiotics and ARGs into the environment7),9). Therefore, additional advanced treatment processes to remove both antibiotics and ARGs from wastewater effluent are highly desired. Constructed wetlands (CWs) are engineered wetland systems designed to stimulate the natural processes based on interactions among soil, microorganisms, and plants for the treatment of wastewaters. CWs are low-cost, low-energy consuming, easy-operable, and environment-friendly option and have high potential for application in developing countries and small rural communities. CWs can efficiently remove organic compounds (biochemical oxygen demand (BOD) and chemical oxygen demand (COD)), total suspended solids, and nutrients from wastewaters10),11). Some researchers have also demonstrated the removal of xenobiotic chemicals, such as phenols12) and pesticides13). The mechanisms for removal of these pollutants are microbial degradation, microbial transformation, soil-adsorption, plant uptake, and degradation by plants (phytodegradation)14). Some recent studies have assessed the removal of TC and/or tet genes from wastewater using different types of CWs

including subsurface horizontal flow CW15),16), vertical flow CW15),17), vertical up-flow CW18), integrated CW19). Vertical subsurface flow CWs showed the highly-efficient removal of TC and tet genes from wastewaters. For example, Huang et al. (2015)18) reported removal efficiency of 69.0－99.7% of TC and about 0.26 to 3.3 log unit of tet genes (tetA, tetO, tetM, tetW, and tetX ) while Liu et al. (2014)15) reported that 97－99% of TC and about 1 log unit of tet genes (tetM, tetO, and tetW ) were removed from wastewater by vertical flow CWs. These studies suggested that adsorption to soil materials might be the primary mechanism for TC removal in CWs15),17). Nevertheless, the contributions of each of the CW components — soil, micro-organisms, and plants —, especially micro-organisms and plants, in removal of TC by CWs are still not clear. Identification of the mechanisms underlying the TC and tet gene removal in CWs is essential for designing a highly-effective CWs for removal of them from wastewaters. In this study, we set up microcosm-scale CWs and operated them in a fill-and-drain batch mode. The present study was taken up with the following objectives: (i) to assess the removal efficiency of TC and tet genes by CWs in microcosm-scale CW experiments for short and long terms and (ii) to understand the mechanisms and the contributions of microorganisms, soil, and plants in TC removal by CWs in the small-scale CW experiments.

MATERIALS AND METHODSChemical TC was purchased from

Kanto-Chemical Co., Japan and its stock solution (250 mg/L in pure sterilized water) was made and used in the experiments.

Plant samples Young potted seedlings of common reed (P. australis) (50 to 70 cm tall; 12 to 16 seedlings per pot; pot diameter, 6 cm) were purchased from the ESPEC MIC Corporation (Aichi, Japan) and used for microcosm-scale CWs. To obtain sterile (bacteria-free) P. australis plants for the experiment in TC removal mechanisms, we sterilized the seeds by washing for 5 min in a solution of 0.5% sodium hypochlorite and 0.02% Tween 80; this was followed by a 1－

13Removal of Tetracycline and Tetracycline Resistance Genes from Municipal Wastewater in Microcosm Fill-and-Drain Constructed Wetlands

min wash in 70% ethanol and rinses with sterilized water thrice, for 1 min each. The sterilized seeds were then grown aseptically in a fl ask containing sterile Murashige-Skoog’s (MS) medium (Duchefa, The Netherlands). The seedlings were grown in a growth chamber at 28 ± 1℃ under fl uorescent lamps (at a photosynthetic photon fl ux density of 80 µmol/m2/s and a photoperiod of 16L: 8D).

Wastewater sample Secondary effl uent sample was collected from a municipal wastewater treatment plant in Kofu, Yamanashi, Japan, and was used as the wastewater sample in this study. The average values for the chemical properties of the effl uent samples (n=10) were as follows: pH 7.4 ± 0.5; 4.2 ± 1.4 mg/L ammonium－N; 0.41 ± 0.09 mg/L nitrite－N; 5.7 ± 2.6 mg/L nitrate－N; 2.2 ± 0.7 mg/L phosphate－P; 16.2 ± 4.1 mg/L total dissolved organic carbon (TOC); 8.6 ± 3.7 mg/L suspended solid (SS); 2.6 × 106 － 5.7 × 107 colony-forming units/mL of total heterotrophic bacteria. The bacterial counts were performed using 0.1 × LB agar plates (1.0 g/L Bacto Peptone, 0.5 g/L yeast extract, 1.0 g/L NaCl, pH 7.0, and 2.0% agar (w/v). TC in the wastewater sample was under detection limit (0.0025 µg/L). The wastewater samples were collected weekly and stored at 4℃ until used.

Setup of microcosm-scale constructed wetlands Microcosm-scale CWs (Fig. 1) were set up in 1－L plastic pots (100 mm diameter and 150 mm height), of which half were planted with young seedlings of native P. australis and the remains were not planted. The CWs were fi lled with 100 g pumice rock (grain size, 10－20 mm) from bottom to 20 mm height and with 200 g red soil (5－10 mm) from 20 to 130 mm height. The subsurface parts of CWs were wrapped in black plastic sheets to prevent the effect of sunlight. All the CWs were set up on March 15th 2016. CWs were operated in a fi ll-and-drain batch mode. The preparation period was set for 6 weeks before starting experiment on May 10th 2016 in order to construct a microbial community in CW. In this preparation period, each CW was fi lled with 400 mL wastewater sample to the soil level. The wastewater sample was maintained for 2

days, then, all the wastewater was drained from the bottom drainage port. In the preparation and experimental periods, the CWs were kept in a greenhouse without any air heating and artifi cial lighting. The daily average temperature during the experimental period was 21－29℃.

Experiment for the assessment of the removal of TC and tet genes by the microcosm-scale CWs over a short-term Experiment for assessing the effect of treatment time on TC removal were conducted in the planted and non-planted CWs in parallel. Four different treatment times of 1, 2, 3, and 4 days were set for each planted and non-planted CWs. Just before the experiment beginning, the TC-polluted wastewater sample was prepared by dissolving 230 µg/L TC into the previously described wastewater sample. Each CW was fi lled with 400 mL wastewater containing 230 µg/L TC and was maintained for the each treatment time. After each treatment period, all the wastewater was collected from the CW pots for TC analysis. The collected effl uent water volume was measured. And then, the TC concentration in the effl uent sample was normalized to the initial water

Fig. 1 Schematic diagram of microcosm-scale CW.


volume (400 mL). Also, the influent wastewater and collected effluent samples were subjected to DNA extraction and quantification of tet genes. The tet gene quantification was conducted only for the planted CWs.

TC removal experiments using wastewater, soil, or plant materials in flasks To examine the contribution of microorganisms present in waste water, soil materials, and plant materials in TC removal in CWs, three types of TC removal experiments were conducted. To examine the biodegradation of TC by microorganisms present in wastewater, 100 mL wastewater or autoclaved (121℃, 30 min) wastewater was added into a flask, and then TC was dissolved at a final concentration of 250 µg/L. The flasks were statically incubated at 28℃ under dark conditions. TC adsorption by soil material and biodegradation by microorganisms attached to the soil material were examined as follows: the soil materials were collected from the planted CWs, and 100 g (wet weight) of the soil or the autoclaved (121℃, 60 min) soil were added in a flask, and 300 mL of sterile deionized water was supplemented with 250 µg/L TC. The flasks were statically incubated at 28℃ under dark conditions. The uptake, degradation, and adsorption of TC by P. australis were examined as follows: the entire 2－month-old sterile P. australis plant (leaves and shoots having a wet weight of about 1.6 g and the roots having a wet weight of about 0.9 g) was rinsed thrice with sterile water to remove any root exudates available in the flask. In addition, the roots (about 0.9 g-wet weight) of 2－month-old sterile plant were cut off from the upper part, autoclaved (121℃, 30 min), and the autoclaved root was placed in the flask. Thereafter, 100 mL of MS medium containing 250 µg/L TC was added into the flask. These flasks were statically incubated in a growth chamber at 28 ± 1℃, under fluorescent lamps at a photosynthetic photon flux density of 80 µmol/m2/s and a photoperiod of 16L: 8D. In these experiments, 1－mL water samples were collected at different times for TC analysis. All the experiments were conducted in triplicates.

TC and tet gene removal experiment in

microcosm-scale CWs in the long-term To examine the sustainable removal of TC and tet genes by CWs, sequencing batch experiments were conducted. The CW pot was filled with 400 mL wastewater containing 250 µg/L TC and was incubated for 2 days. After 2 days, all the wastewater was discharged from the CW pot. This sequencing batch experiment at 2－day treatment time was repeated 14 times for 28 days. The effluent samples from both the planted and non-planted CWs collected in each batch were subjected to TC analysis, but only planted CW effluents were used for tet gene quantification. The sequencing batch ex-periments were conducted in a greenhouse in duplicate.

TC analysis TC in the collected water samples (300 mL for microcosm-scale CW experiments; 1 mL for flask experiments) were extracted following the USA EPA Method 1694 (2004)22), with some modifications. In brief, the collected water sample was filtered through 0.22－µm pore size membrane filters (Millipore, Ireland) immediately after collection. The filters withheld the microorganisms in the effluent sample and were used in DNA extraction and for the quantification of tet genes. The filtrates were acidified to a pH of 2.5 with HCl and were spiked with 200 mg/L EDTA・Na2. Thereafter, they were passed through Oasis HLB extraction cartridges (6 cc, 200 mg) at a flow rate of 5 mL/min. TC was eluted from the cartridge with 1 mL mixture of acetonitrile/75 mM oxalic acid solution (45: 55, v/v) and was quantified by high performance liquid chromatography using a UV detector (HPLC/UV). The HPLC/UV analyses were performed using a mixture of acetonitrile/0.01M phosphate buffer (20: 80, v/v) as the mobile phase. The wavelength for UV detection was 365 nm. The recovery in the method employed was in the range of 89－95%, and the limit of detection was 0.0025 µg/L.

DNA extraction and quantification of tet and 16S rRNA genes The membrane filters (0.22 µm pore size) from the above TC analysis method were used for DNA extraction using the NucleoSpin Soil Kit (TakaraBio, Shiga, Japan), according to the manufacturer’s


instructions. In this study, we assessed the expression of five tet genes, belonging to two groups: the efflux pump gene tetC and the ribosome protected genes tetM, tetO, tetQ, and tetW. The five tet genes were chosen for monitoring because they are commonly found in wastewater and aquatic environments1),4)－6). The five tet genes and 16S rRNA gene were quantified by quantitative PCR (qPCR) using Thermal Cycler Dice RealTime System II, model TP900/960 (TakaraBio). The qPCRs were conducted in 25－µL reaction mixture, which consisted of 12.5 µL SYBR Green Master Mix (TakaraBio), 0.5 µL of each primer (Table 1), 1 µL template DNA, and 10.5 µL ddH2O. The qPCR temperature program included an initial denaturation at 95℃ for 1 min, followed by 40 cycles of 95℃ for 10s, annealing at different temperatures (Table 1) for 30s, and an extension at 72℃ for 20s. After each qPCR, a melt curve analysis was conducted by increasing the temperature from 65 to 95℃ to verify the specificity of amplification. A standard curve for each gene was created by using custom synthesized plasmid carrying the target sequence. All the qPCRs were performed in triplicate.

Statistical analysis The averages and standard deviations (SD) of all data were calculated, and all the results are expressed as mean ± SD. Significance (P < 0.05) was assessed using the t-test.

RESULTS AND DISCUSSIONPotential for TC removal by CWs To

examine the TC removal abilities of CWs, TC removal experiments with planted and non-planted CWs were conducted for different treatment times of 1, 2, 3, and 4 days. The concentrations of TC in the influent and effluent waters from each CW are summarized in Table 2. In CWs with 1 day treatment, 95.4 (remaining TC in the effluent, 10.55 µg/L) and 87.2% (remaining TC in the effluent, 29.52 µg/L) of TC were removed from the contaminated wastewater in the planted and non-planted CWs, respectively. In CWs with longer treatment times from 2 to 4 days, almost all the TC was removed from the contaminated wastewater in both the planted and non-planted CWs. The results indicate that TC was rapidly and significantly removed by planted and non-planted CWs. There was a significant difference (P < 0.05) between the planted and non-planted CWs with 1 day treatment. Their removal efficiency became comparable with those having longer treatment times. These results indicate that P. australis plants enhanced the TC removal from wastewater in CWs, but their effect was limited to short treatment time and might not be major in TC removal in CWs. These results agree with previous studies. The presence of aquatic plants, such as P. australis15),23) and Hybrid Pennisetum17), can be beneficial the effective CWs for TC removal from wastewaters.

Table 1 Target genes used for real time PCR (qPCR) analysis, their primer sequences, and annealing temperatures

Target genes Primer sequence (3'－5')AnnealingTemperature (℃)

Reference

16S rRNA 341F534R

5'－CCTACGGGAGGCAGCAG－3'5'－TACCGCGGCTGCTGGCAC－3' 60 Bru et al., 200820)

tetC TetC－FWTetC－RV

5'－GCGGGATATCGTCCATTCCG－3'5'－GCGTAGAGGATCCACAGGACG－3' 68 Aminov et al., 200421)

tetM TetM－FWTetM－RV

5'－ACAGAAAGCTTATTATATAAC－3'5'－TGGCGTGTCTATGATGTTCAC－3' 57 Aminov et al., 200421)

tetO TetO－FWTetO－RV

5'－ACGGARAGTTTATTGTATACC－3'5'－TGGCGTATCTATAATGTTGAC－3' 60 Aminov et al., 200421)

tetQ TetQ－FWTetQ－RV

5'－AGAATCTGCTGTTTGCCAGTG－3'5'－CGGAGTGTCAATGATATTGCA－3' 63 Aminov et al., 200421)

tetW TetW－FWTetW－RV

5'－GAGAGCCTGCTATATGCCAGC－3'5'－GGGCGTATCCACAATGTTAAC－3' 65 Aminov et al., 200421)


Mechanisms of TC removal by CWs Organic chemicals flowing into CWs can be removed by several factors, such as through biodegradation by microorganisms, by ad-sorption to solid matrix, through phytodegra-da tion and/or through uptake by plants14). However, little is known about the mechanism for removal of antibiotics, including that for TC, by CWs. There is no report describing the comparative evaluation of each factor for TC removal. To completely examine the contribution of each factor, i.e. microorganisms, soil, and plants in the TC removal in CWs, a series of flask experiments was performed using sterile/unsterile wastewater samples, sterile/unsterile CW soils, and sterile plant materials. The results are shown in Fig. 2a, b, c. In the tests with unsterile/sterile waste-water sample, removal of TC from unsterile wastewater was gradual but significantly more than that from sterile wastewater (P < 0.05), corresponding to 36 and 16% of the TC removed in unsterile or sterile wastewater, respectively, within 3 days (Fig. 2a). TC removal in sterile wastewater might result from TC adsorption to SS in wastewater sample. Although TC persisted in wastewater after 3 days, the biodegradation of TC by native microorganisms in wastewater was significant. In the tests using soil materials, TC was rapidly and completely removed within 6 h in both the sterile and unsterile soil material tests (Fig. 2b). The results clearly indicate

the strong adsorption affinity of red soil materials for TC. Bao et al. (2008)24) and Guler and Sarioglu (2014)25) have also revealed the high adsorption ability of red soil and pumice stone for TC. In this flask experiments, TC removal by soil material was more rapid compared to microcosm-scale CW experiments (Table 2). This might result from the differences in experimental/operation conditions between flask and CW experiments. In the TC removal tests using sterile plant materials, the TC concentration was reduced slowly and slightly by both the whole plant and the roots alone; 19 and 20% of TC was removed by whole plant and root materials, respectively, within 3 days. The results indicate that the uptake and degradation of TC by whole P. australis plant and adsorption of TC on the root material have small effects on TC removal in CWs. The TC removal process in a CW system is regulated by various components, such as by microorganisms, soils, and plants. In our experiments, we isolated and evaluated each of these components. The adsorption of TC to soil materials was the main mechanism for TC removal over a short-term. In addition biodegradation of TC by native microorganisms present in wastewater was observed in the CW. On the other hand, uptake/phyto-degradation/adsorption by P. australis plant had a small effect on TC removal over a short-term. The results suggest that TC was initially adsorbed to soil material, and was

Table 2 Concentrations of TC in planted and unplanted CWs with different TREATMENT TIMEs

Type of CWs and conditionsTetracycline concentration (µg/L) Tetracycline

removalb (%)Influent Effluenta

Planted CW 1 daytreatment 230

10.55 ± 0.8 95.7Unplanted CW 29.52 ± 0.47 87.1Planted CW 2 days

treatment 230n.d. 100

Unplanted CW 0.05 ± 0.001 99.9Planted CW 3 days


Unplanted CW 0.26 ± 0.007 99.9Planted CW 4 days


Unplanted CW n.d. 100n.d., not detecteda Data are the mean of values obtained in duplicate experiments (n=2)b Tetracycline removal was calculated using the mean values of tetracycline concentration in influent

and effluent.


subsequently removed by microorganisms and plant effects. Liu et al. (2013)17) have also reported that soil materials play a main role in the removal of antibiotics from wastewater in CWs. On the other hand, better removal of TC by planted CW compared with that by non-

planted CW (Table 2) might be a result of the enhanced biodegradation supported with plant. Plants are believed to sustain large rhizosphere associated-microbial populations, and facilitate their growth and metabolism by providing oxygen and organic compounds released from plant roots26),27). Previous researches reported that planted CWs perform better removal of phenol28), bisphenol A and 4－tert-butylphenol29) than the non-planted CWs because of enhanced bio-degradation by plants. Further studies are desired to clarify the effects of enhanced biodegradation supported by plants on TC removal in CWs.

Removal potential of tet genes by CWs The absolute abundances of 16S rRNA and tet genes (tetC, tetM, tetO, tetQ, and tetW genes) in the infl uent wastewater and effl uents of planted CWs with 1 day treatment are shown in Fig. 3. All the genes were detected in the infl uent wastewater; the copy numbers of 16S rRNA, tetC, tetM, tetO, tetQ, and tetW genes were 1.2 × 108, 2 × 104, 1.8 × 102, 3.4 × 102, 9.2 × 103, and 1.7 × 102 copies/mL, respectively. The results confi rmed that secondary treated waste water of municipal wastewater treat-ment plant was a source of the tet genes7)－9). After the planted CW treatment for 1 days, none of the tet genes were detected in the effl uent samples. The removal effi ciencies of

Fig. 2 Changes in TC concentrations in original waste-water/autoclaved wastewater experiments (A), in original soil/autoclaved soil material experi-ments (B), and in sterile whole plant/root material experiments (C). Data are the means of values obtained in triplicate experiments, and error bars indicate the standard deviations.

Fig. 3 Absolute abundances of 16S rRNA and fi ve tet genes (tetC, tetM, tetO, tetQ, and tetW) in infl uent (wastewater sample) and effl uent in planted CWs with treatment time of 1 day. Data are the means of values obtained in duplicate experiments, and error bars indicate the standard deviations.


tetC, tetM, tetO, tetQ, and tetW genes were about > 4.3, > 2.2, > 2.5, > 3.9, or > 2.2 log units. In contrast, the 16S rRNA gene (1.3 × 108) was detected in the effl uent samples at the same level found in the infl uent wastewater. In planted CWs with longer treatment times from 2 to 4 days, none of tet genes were detected in the effl uent samples. The results confi rmed that the planted CW signifi cantly and selectively removed these tet genes from the wastewater. A few researchers have reported signifi cant removal of tet genes and other ARGs by CWs. Liu et al. (2013)17) have reported about one log units removal of tet genes in vertical fl ow CWs. Chen et al. (2015)19) have reported about 2－3 log units removal of tet genes in integrated CWs. Huang et al. (2015)18) have reported 0.26－3.3 log units removal of tet genes in vertical up-fl ow CWs. Removal effi ciency of tet genes in our planted CWs was comparable to those reported in the previous researches. The removal effi ciencies of tet genes by our CWs and those of the previous CWs are comparable to the removal effi ciencies of ARGs, such as tetG, by chlorination (3.24 log reductions), ultraviolet (2.48 log reductions), and ozonation (2.55 log reductions) proc-esses30). The results clearly indicated that CWs appear to be an advanced treatment process to prevent the discharge of large amount of tet genes from the wastewater treatment plants. Chen et al. (2016)16) reported that the removal of tet genes in CWs was likely due to several factors including microbial activities, soil adsorption, and plant uptake like that of antibiotics. However, the results of the present as well as previous studies do not clearly reveal the removal mechanisms of tet genes in CWs. Further research is needed to explore the fate and removal mechanism of ARGs in CWs.

TC and tet genes removal by CWs in the long-term experiments To examine a stable long-term removal of TC and tet genes from wastewater by CWs, sequencing batch experiments to treat wastewater containing TC (250 µg/L) were conducted. The concen-trations of TC in the effl uent samples from the planted and non-planted CWs are shown in Fig. 4. During the 28－days experimental period, the TC concentrations in the effl uent

of the planted CWs were signifi cantly lower than those of the non-planted CWs. In the planted CWs, TC was completely and repeatedly removed from wastewater during the 28 days. In contrast, the TC concentration in the effl uent of non-planted CWs increased from 0.54 to 2.67 µg/L with the passage of time; the TC removal effi ciency in non-planted CWs generally decreased from 99.8 to 98.9% with time. The results suggest that TC removal effi ciency in non-planted CWs can decline over a relatively short period. The presence of plants in CWs can support complete TC removal for the long-term. These results provide new and valuable insights into the removal of TC in the planted CWs. That is, the planting of P. australis will be benefi cial to the highly-effective and stable long-term CWs for TC removal from wastewaters. Additionally, 16S rRNA and fi ve tet genes in infl uent wastewater and effl uent samples from the planted CWs were monitored. The abundance of 16S rRNA and tetC genes in infl uent wastewater and the effl uent samples are shown in Fig. 5 because other four tet genes (tetM, tetO, tetQ, and tetW ) were removed completely in the effl uent samples. The copy number of 16S rRNA gene in the effl uent of planted CW varied between 3 ×

Fig. 4 TC concentrations in the effl uent of planted CWs during a month of long-term experiments under sequencing batch mode. The TC concentration in the infl uent was 250 μg/L. Data are the means of values obtained in duplicate experiments, and error bars indicate the standard deviations. Day 0 = May 23, 2016 and Day 28 = Jun 20, 2016.


108 and 1.2 × 109 during the 28 days. The copy number of tetC gene in the effl uent of planted CW remained between 2.6 × 10 and 5.3 × 10 during the 28 days. The removal of tetC gene was about 3 log unit. The tetC gene removal effi ciency in the long-term CW experiment was lower than that in the short-term CW experiment (3.9 log unit removal, Fig. 3). The short-term experiment was conducted using 6 weeks-old CW pots at the beginning of summer (May 10th to 14th 2016). The long-term experiment was conducted using 8 weeks-old CW pots at the beginning of summer (May 21st to Jun 20th 2016). These differences in experimental conditions and CW growth might provide the difference in tetC gene removal effi ciencies between short-term and long-term experiments. On the other hand, the complete removal of four tet genes (tetM, tetO, tetQ, and tetW ) was maintained during 28 days. The results demonstrated that planted CWs can remove simultaneously TC and tet genes from wastewater with high effi ciency over the long-term. Therefore, the use of planted CWs would be a good option for an advanced treatment process for removing TC and tet genes after municipal wastewater treatment. However, for a fully competent performance, further studies on the removal of them in the

Fig. 5 Absolute abundance and relative abundance of 16S rRNA and tetC genes in planted CWs during a month of long-term experiments under sequencing batch mode. Data are means of values obtained in duplicate experiments, and error bars indicate the standard deviations. Day 0 = May 23, 2016, Day 14 = Jun 6, 2016, and Day 28 = Jun 20, 2016.

full-scale CWs are necessary.

CONCLUSION This study clearly demonstrated that CWs, whether planted with P. australis or not, can remove TC effectively. The major role in TC removal by CWs was of soil absorption to TC. Biodegradation also contributed to TC removal in CWs. In addition, the presence of plants supported the complete removal of TC for a long-term. The planted CWs exhibited a signifi cant removal of tet genes (about 3 log unit) from wastewater that was comparable to the removal by other advanced treatment methods, like ultraviolet, ozonation, and chlorination. The simultaneously effective removal of both tet genes and TCs by CWs as observed in this research supports CWs as a promising treatment technology for removing TC and tet genes from wastewaters.

ACKNOWLEDGEMENTS This research was supported in part by the Advanced Low Carbon Technology Research and Development Program of Japan Science and Technology Agency.

REFERENCES

　1　）Daghrir, R., and Drogui, P.: Tetracycline antibiotics in the environment: a review. Environ. Chem. Lett., 11, 209－227 (2013)

　2　）Ji,K.,Kim,S.,Han,S.,Seo,J.,Lee,S.,Park,Y.,Choi,K.,Kho,Y.L.,Kim,P.G,Park,J.,and Choi, K.: Risk assessment of chlortetracycline, oxytetracycline, sulfa-meth a zine, sulfathiazole, and erythro-mycin in aquatic. Ecotoxicology, 21, 2031－2050 (2012)

　3　）Gullberg, E., Cao, S., Berg, O. G., Ilbäck,C.,Sandegren,L.,Hughes,D.,andAndersson,D. I.: Selection of resistant bacteria at very low antibiotic concentrations. PLoS Pathog., 7(7), e1002158 (2011)

　4　）Chee-Sanford,J.C.,Aminov1,R.I.,Krapac,I. J.Garrigues-Jeanjean,N., andMackie,R.I.: Occurrence and diversity of tetracycline resistance genes in lagoons and ground-water underlying two swine production facilities. Appl. Environ. Microbiol., 67, 1494－1502 (2001)

　5　）Thomas Schwartz, T., Kohnen, W., Jansen,


B., and Obst, U.: Detection of antibiotic-resistant bacteria and their resistance genes in wastewater, surface water, and drinking water biofilms. FEMS Microbio. Ecol., 43, 325－335 (2003)

　6　）Kümmerer, K.: Resistance in the environment. J. Antimicrob. Chemother., 54, 311－320 (2004)

　7　）Rizzo, L.,Manaia,C.,Merlin,C., Schwartz,T., Dagot, C., Ploy, M. C., Michael, I., andFatta-Kassinos, D.: Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: A review. Sci. Total Environ., 447, 345－360 (2013)

　8　）Gao, P., Munir, M., and Xagoraraki, I.: Correlation of tetracycline and sulfonamide antibiotics with corresponding resistance genes and resistant bacteria in a conventional municipal wastewater treatment plant. Sci. Total Environ., 421－422, 173－183 (2012)

　9　）Michael, I., Rizzo, L., McArdell, C. S.,Manaia, C. M., Merlin, C., Schwartz, T.,Dagot, C., and Fatta-Kassinos, D.: Urban wastewater treatment plants as hotspots for the release of antibiotics in the environment: A review. Water Res., 47, 957－995 (2013)

10）Karathanasis,A.D.,Potter,C.L.,andCoyne,M.S.: Vegetation effects on fecal bacteria, BOD, and suspended solid removal in constructed wetlands treating domestic wastewater. Ecol. Eng., 20, 157－169, (2003)

11）Vymazal, J.: Removal of nutrients in various types of constructed wetlands. Sci. Total Environ., 380, 48－65 (2007)

12）Kurzbaum,E.,Zimmels,Y.,Kirzhner,F.,andArmon, R.: Removal of phenol in a constructed wetland system and the relative contribution of plant roots, microbial activity and porous bed. Water Sci. Technol., 62, 1327－1334 (2010)

13）Vymazal, J., and Březinová, T.: The use of constructed wetlands for removal of pesticides from agricultural runoff and drainage: A review. Environ. Int., 75, 11－20 (2015)

14）Imfeld,G.,Braeckevelt,M.,Kuschk, P., andRichnow,H.H.: Monitoring and assessing processes of organic chemicals removal in constructed wetlands. Chemosphere, 74,

349－362 (2009)15）Liu, L., Liu, Y. H., Wang, Z., Liu, C. X.,

Huang, X., and Zhu, G. F.: Behavior of tetracycline and sulfamethazine with corresponding resistance genes from swine wastewater in pilot-scale con-structed wetlands. J. Hazard. Mater., 278, 304－310 (2014)

16）Chen, J.,Wei,X.D.,Liu,Y.S.,Ying,G.G.,Liu, S. S., He, L. Y., Su, H. C., Hu, L. X.,Chen, F. R., and Yang, Y. Q.: Removal of antibiotics and antibiotic resistance genes from domestic sewage by constructed wetlands: Optimization of wetland sub-strates and hydraulic loading. Sci. Total Environ., 565, 240－248 (2016)

17）Liu,L.,Liu,C.,Zheng,J.,Huang,X.,WangZ, Liu, Y., and Zhu G.: Elimination of veterinary antibiotics and antibiotic resistance genes from swine wastewater in the vertical flow constructed wetlands. Chemosphere, 91, 1088－1093 (2013)

18）Huang,X.,Liu,C.,Li,K.,Su,J.,Zhu,G.,andLiu, L.: Performance of vertical up-flow constructed wetlands on swine wastewater containing tetracyclines and tet genes. Water Res., 70, 109－117 (2015)

19）Chen, J., Liu,Y. S., Su, H. C.,Ying, G. G.,Liu,F.,Liu,S.S.,He,L.Y.,Chen,Z.F.,Yang,Y.Q.,andChen,F.R.: Removal of antibiotics and antibiotic resistance genes in rural wastewater by an integrated constructed wetland. Environ. Sci. Pollut. Res. Int., 22, 1794－803 (2015)

20）Bru,D.,Martin-Lauren,F.,andPhilippot,L.: Quantification of the detrimental effect of a single primer-template mismatch by Real-Time PCR using the 16S rRNA gene as an example. Appl. Environ. Microbiol., 74, 1660－1663 (2008)

21）Aminov,R.I.,Chee-Stanford,J.C.,Garrigues,N.,Mehboob,A.,andMackie,R.I.: Detection of tetracycline resistance genes by PCR methods. Methods Mol. Biol., 263, 3－13 (2004)

22）U. S. Environmental Protection Agency,Method 1694: Pharmaceuticals and personal care products in water, soil, sediment, and biosolids by HPLC/MS/MS: USEPA, Washington, DC, EPA-821-R- 08-008, 77 p. (2007)

23）Carvalho,P.N.,Araújo, J.L.,Mucha,A.P.,Basto,M.C.,andAlmeida,C.M.: Potential


of constructed wetlands microcosms for the removal of veterinary pharmaceuticals from livestock wastewater. Bioresour. Technol., 134, 412－416 (2013)

24）Bao,Y.J.,Ding,H.S.,andBao,Y.Y.: Effects of temperature on the adsorption and desorption of tetracycline in soils. Adv. Mat. Res., 726－731, 344－347 (2013)

25）Guler, U.A. and Sarioglu, M.: Removal of tetracycline from wastewater using pumice stone: equilibrium, kinetic and thermodynamic studies. J. Environ. Health Sci. Eng., 12, 79－90 (2014)

26）Anderson,T.A.,Guthrie,E.A.,andWalton,B.T.: Bioremendiation in the rhizosphere: plant roots and associated mirobes clean contaminated soil. Environ. Sci. Technol., 27, 2630－2636 (1993)

27）Shaw,L.J.,andBurns,R.G.: Biodegradation of organic pollutants in the rhizosphere. Adv. Appl. Microbiol., 53, 1－60 (2003)

28）Tee,H.C.,Seng,C.E.,Noor,A.M.,andLim,P. E.: Performance comparison of con-structed wetlands with gravel- and rice husk-based media for phenol and nitrogen removal. Sci. Total Environ., 407, 3563－3571 (2009)

29）Dan,A., Fujii, D., Soda, S., Machimura, T.,andIke,M.: Removal of phenol, bisphenol A, and 4－tert-butylphenol from synthetic landfill leachate by vertical flow constructed wetlands. Sci. Total Environ., 578, 566－576, (2017)

30）Zhuang, Y., Ren, H., Geng, J., Zhang, Y.,Zhang,Y.,Ding,L.,andXu,K.: Inactivation of antibiotic resistance genes in municipal wastewater by chlorination, ultraviolet, and ozonation disinfection. Environ. Sci. Pollut. Res. Int., 22, 7037－7044 (2015)

(Submitted 2017. 1. 12)(Accepted 2017. 2. 23)

removal of tetracycline and tetracycline resistance genes

Documents