Petriman Narcis-Adrian

Handelstrasse 20, 448

79104 Freiburg

Mail: narcispetriman@yahoo.com

Report of activity AG KOCH, Biochemistry Freiburg, Stefan Meier Strasse 19

Contents1. Introduction.........................................................................................................................2

2. Sec Translocase complex....................................................................................................2

3. YidC insertase.....................................................................................................................3

4. SecYEG - YidC Complex...................................................................................................4

5. Material and methods..........................................................................................................6

PCR........................................................................................................................................6

In vivo photo crosslinking......................................................................................................6

SDS-PAGE...........................................................................................................................10

Western Blot.........................................................................................................................10

6. Result and discutions........................................................................................................10

7. Legend Figures.................................................................................................................11

Acknowledgements..................................................................................................................14

References................................................................................................................................15

1. Introduction

The delivery and insertion of proteins to cell compartments is a crucial condition for

vitality an function of every cell, both prokaryotes and eukaryotes. Proteins can be

transported across or inserted into the plasma membrane. These tasks can be peformed by a

largely overlapping set of proteins.

Among others, the Sec-translocon is one of the most important translocase for protein

insertion into or transport of proteins across membranes. Transport via the Sec translocon can

occur co-translational or post-translational. Transport can be divided in three steps:

1. Recognition of proteins destined for transport,

2. Delivery of proteins to the plasma membrane,

3. Transport of proteins across the plasma membranes.

The delivery pathway and the components controlling the steps above are determinate

by a signal sequence the freshly synthetised protein bears (Marrichi, Camacho et al. 2008).

Important part of the signal sequence are hydrophobic amino acid residues, wich can be bond

by the cytosolic Factor initiating protein transport. This hydrophobic signal sequence marking

proteins for transport across or insertion into the plasma membrane is conserved in

prokaryotes and eukaryotes (Dyrløv Bendtsen, Nielsen et al. 2004). To facilitate protein

insertion into lipid membranes, efficient transport systems have evolved which include the

membrane-embedded SecYEG translocon and the YidC insertase (Pohlschröder, Hartmann et

al. 2005). The SecYEG translocon is the major protein conducting channel in the bacterial

cytoplasmatic membrane. It is involved in both membrane protein insertion and in secreting

proteins across the membrane into the periplasm (Rapoport 2007).

2. Sec Translocase complex

Bacterial membrane protein insertion into inner membrane is tipically catalyzed by

the Sec translocase (Fig 1). The Sec translocase is composed of the membrane-embedded

SecYEG and SecDFyajC complexes, as well as peripherical membrane component SecA

(Dalbey, Wang et al. 2011). SecYEG provides the protein-conducting channel (Veenendaal,

van der Does et al. 2004), wich is essential for translocation and membrane proteins insertion.

In the cristal structure, the SecY channel is in a closed state with the pore ring

plugged by a helix on the luminal side. When the SecY channel opens upon signal peptide

binding to the SecY transmembrane domains 2 and 7 region, the plug moves out of the

channel center to a site located 20 A away near the SecE helix (Robson, Carr et al. 2009).

SecY protein consist in 8 transmembrane domains which form translocation pore and a lateral

gate formed by TM2, TM3 and TM7, TM8. During translocation of a polypeptide chain, the

lateral gate opens (du Plessis, Berrelkamp et al. 2009). This opening is important for

translocation as locking the lateral gate by disulfide cross-linking prevents SecA-mediated

preprotein translocation in E.coli (du Plessis, Berrelkamp et al. 2009).

Fig.1 - Function of translocases in membrane protein insertion (Dalbey, Wang et al. 2011).

3. YidC insertase

In prokaryotes and eukaryotes, the YidC/Oxa1/Alb3 family of proteins mediates

membrane protein insertion. In bacteria YidC mediates the membrane insertion of a number

of small proteins like M13 procoat, Pf3 procoat etc. (Jiang, Chen et al. 2003). YidC has been

found associated with the SecYEG/DF-YajC complex and to interact with Sec dependent

membrane during membrane insertion (Jiang, Chen et al. 2003).

The membrane topology of E.coli YidC protein is different from that of Oxa1 and

Alb3. Unlike Oxa1 and Alb3, which spans the membrane five times with an N-terminal

luminal tail of 100 residues or less (Schünemann 2004), YidC spans the membrane six times

and, following the first transmembrane region, has a large N-domain of 319 residues in the

periplasm (Fig 2).

The second, third, fifth, and sixth membrane-spanning regions of YidC contain

conserved residues in the YidC/Oxa1/Alb3 family (2004). In addition, cytoplasmic loop C1

and periplasmic loop P2 of E. coli YidC (see Fig. 2) contain conserved hydrophilic regions

that have been proposed to be important for substrate recognition (2004). SecYEG complex

and was cross-linked to Sec-dependent membrane proteins that were stalled in their insertion

(Scotti, Urbanus et al. 2000).

Fig.2 – Membrane topology of E. coli YidC (Jiang, Chen et al. 2003).

Several experimental results point to YidC playing a direct role during the insertion of

Sec-independent substrates (Fig. 1c). First, photocross-linking studies using a cell-free

system showed membrane proteins that were trapped at various stages of membrane protein

insertion contact YidC (Chen, Samuelson et al. 2002).

Second, lipid vesicles containing YidC are sufficient to insert the Sec-independent Pf3

coat protein and the ATP synthase subunit c (Serek, Bauer-Manz et al. 2004). The Pf3 coat

protein directly binds to YidC, and this binding results in a substantial conformational change

within the YidC protein (Winterfeld, Imhof et al. 2009).

At the present time, YidC has been shown to insert the Sec-independent proteins, the

M13 phage procoat protein, the Pf3 phage coat protein, subunit c of ATP synthase, and MscL

(Winterfeld, Imhof et al. 2009). It is not clear what makes a membrane protein go by the

YidC pathway versus the Sec pathway. However, one common characteristic among these

substrates is that they possess short translocated regions.

4. SecYEG - YidC Complex

In addition to operating alone, YidC was found in close proximity to the SecYEG

channel, and it can cooperate with the Sec translocase to mediate membrane protein insertion.

YidC forms a complex with SecDF-YajC, which is thought to join YidC to the SecYEG

channel (Nouwen and Driessen 2002). YidC, along with the Sec machinery, is strictly

required for insertion of subunit a of ATP synthase (Kol, Majczak et al. 2009), CyoA (subunit

2 of cytochrome bo oxidase) (van Bloois, Haan et al. 2006), and NuoK of NADH reductase

(Price and Driessen 2010). In some cases, such as CyoA, YidC can insert the N-terminal

domain of the protein, whereas the SecYEG inserts the C-terminal domain of CyoA (Fig. 1d).

In addition to its insertase function, YidC also functions as an integrase orchestrating

the lateral partitioning of hydrophobic segment into the bilayer after the hydrophobic

segments have inserted into the SecYEG translocation channel (Fig. 1d). Photocross-linking

studies have shown that the hydrophobic segments of membrane proteins that require the Sec

apparatus are cross-linked first to SecY and then to YidC (Price and Driessen 2010). On the

basis of its ability to interact with hydrophobic segments of membrane proteins, YidC has

been proposed to be a foldase involved in packing the TM segments of the membrane protein

(Chen, Samuelson et al. 2002).

5. Material and methods

PCR

Folowing E. coli strains were used: DH5α (Kulajta, Thumfart et al. 2006), BL21

(Novagen, Bad Soden, Germany). The plasmid PTRC99a (Svend Petersen-Mahrt) was used

to construct fusion proteins. The fusion proteins were constructed using the following

primers:

For SecY mutants in TM (transmembrane domain) 8 domain:

L316_for: CAACCGTAGTATGTGTTACTC TM: 60°C

L316_rev: CCCAGGCTGCAAATACAG TM: 63°C

L320_for: CAACCGCTTTATGTGTTATAGTATGCG TM: 69°C

For YidC mutants in TM 3 domain were used 5 position , one at N-terminus (423) and

four in the center on TM 3 (435, 436, 437, 438) taken from Thomas Welte (unpublished

data).

For YidC mutants in TM 6 domain:

L522_for: AGCAACTAGGTAACCATTATT TM: 54°C

V523_for: AGCAACCTGTAGACCATT TM: 55°C

T524_for: AGCAACCTGGTATAGATTATT TM: 57°C

I525_for: AGCAACCTGGTAACCTAGATTCAG TM: 64°C

DNA preparation was performed using the Quiagen QIAprep Spin Miniprep Kit,

QIAprep Spin PCR Purification Kit, QIAprep Spin Gel Extraction Kit. DNA was stored in

double distillated water, pH 8.

In vivo photo crosslinking

Major challenge in understanding the networks of interactions that control cell and organism function is the definition of protein interactions.

Solid-phase peptide synthesis has allowed the photo-crosslinkable amino acid p-benzoyl-L-phenylalanine (pBpa) to be site-specifically incorporated into peptide chains, to facilitate the definition of peptide ligand complexes.

This method, however, is limited to the in vitro study of peptides and small proteins. An innovative development allows the incorporation of a site-specific photo-cross-linker into virtually any protein that can be expressed in Escherichia coli, thereby promoting in vivo or in vitro cross-linking of proteins (Farrell, Toroney et al. 2005).

The method relies on an orthogonal aminoacyl tRNA synthetase–tRNA CUA pair that incorporates pBpa at the position encoded by the amber codon (TAG) in any gene transformed into E. coli .

To produce the photocross- linker–containing protein, cultures of E. coli carrying two plasmids (ampicilin and chloramphenicol resistant) are grown in the presence of the unnatural amino acid. To photo-cross-link the protein to its binding partner in vivo or in vitro, cells or

purified proteins, respectively, are exposed to UV light (Farrell, Toroney et al. 2005).

Inoculate overnight 15 ml LB media ( with ampicillin and chloramphenicol) with SecY stop

codon mutants Y332 and F328 (in BL21 pSup + pTrc99a) and also the wild type SecY.

In vivo photo-cross-linking protocol

Prepare a preculture from the interest mutant and incubate in LB medium at 37°C

overnight.

Early morning, inoculate the minimal media cultures for in vivo crosslinking.

Minimal media composition (200 ml media in 1 L flask)

1,25% Glycerol (15,76 g/l) 160 ml (autoclaved) 5 x M9 Salz 40 ml from stock (autoclaved) L-Leucin (4mg/ml) 2 ml (sterile filtrated) CaCl2 x 2H2O (20mg/ml) 200µl (autoclaved) MgSO4 x 7H2O (250mg/ml) 200µl (autoclaved) D-Biotin (5mg/ml – 25mg+ 40µl (sterile filtrated)4ml H2O + 1ml NaOH)

Thiamin (5mg/ml) 40µl (sterile filtrated) Heavy Metal Stock Solution 200µl (sterile filtrated) Ampicillin (50mg/ml in H2O 40µl (sterile filtrated) Chloramphenicol (35mg/ml in EtOH) 40µl (sterile filtrated) pBpA (421mg/2ml in 1M NaOH) 220µl (sterile filtrated)

Note: add first the pBpA in the flask!

5 x M9 Salz

Na2HPO4 x 7H2O 64g KH2PO4 15g NaCl 2,5g NH4Cl 5g H2O 1L

Heavy Metal Stock Solution

MoNa2O4 x 2H2O 500mg CoSO4 540mg CoSO4 x 5H2O 175mg MnSO4 x H2O 1g MnSO4 x 7H2O 8,75g ZnSO4 x 7H2O 1,25g FeCl2 x 4H2O 1,25g

CaCl2 x 2H2O 2,5g H3BO3 1g In 1L 1M HCl solution, steer over night, filtrate through 0,22µm filter and store at RT

Inoculate each flask with 4 ml of preculture (for each mutant inoculate 2 flasks):

- 2 x 2ml tubes, spin down the cells and resuspend in 100µl LB.Incubate the cultures at 30°C in dark conditions.

Measure the optical density of the cultures in the morning:

100µl culture + 300µl 50mM TeaOAc buffer => OD600nm

If the OD is ~ 1, induce the cultures with 100µl IPTG / 200ml culture and incubate 4h

at 30°C.

Harvesting the cells:

o Cool down the cultures 10 min. on ice;o Harvest them with SLA3000 rotor, 5000rpm for 10 min. at 4°C and remove SN;o Resuspend the cells in 2 x 10ml 50mM TeaOAc;o Centrifuge cells in SS-34 rotor, 5000rpm, 10 min, 4°C and remove SN;o Resuspend the cells in 5 ml 50mM TeaOAc + 30% Glycerol, freeze in liquid nitrogen

and store at -80°C until usage.

1. keep the cells on ice until defreeze; spin them down 5 min., 7000rpm, 4°C and remove SN;

2. resuspend the cells in PBS buffer up to 2ml and distribute them in the plate (Multiwell): 1 plate +UV, on ice for 30 min.; 1 plate –UV, on ice for 30 min (RT, covered with aluminium foil).PBS buffer – 1L

Salt Conc(mmol/l) Conc. (g/l)

NaCl 137 8.00

KCl 2.7 0.2

Na2HPO4 10 1.44

KH2PO4 1.76 0.24

pH 7.8 7.8

Add up to 800 ml distilated H2O, ajust the pH with HCl, fill with H2O up to 1L and

autoclave.

3. collect the cells from the plates in the same 2ml tubes, centrifuge them 7 min., 5000rpm, 4°C and remove SN.

4. resuspend the cells in EPTX buffer up to 2ml (cells from 2 tubes -> in one) add 20µl/2ml PMSF and French press 4x.

EPTX buffer (500 ml):

50mM Hepes 25ml stock

1M NH4Ac 38,5g

20mM MgAc 10ml stock

35µl 2-Mercaptoethanol (add just before crosslinking)

PMSF (protein inhibitor)

Dissolve 0,176g PMSF in 10ml 2-Propanol

5. centrifuge the lysate – SS-34, 15800rpm, for 30 minutes. 6. after centrifugation, take the SN for ultracentrifugation – Ti50,2, 40000rpm, 4°C, 1h.7. equilibrate the TALON – 2 tubes with 750µl TALON for each sample – add EPTX

buffer up to 2ml and incubate at 4°C on the wheel for 30 min.8. purifying membrane-associated proteins with standard TALON:

Add 1ml/100ml EPTX buffer of Triton x 100 (for solubilisation of membrane proteins);

Spin down the TALON – centrifuge 4 min., at 7000rpm, 4°C and remove SN; Resuspend the membranes in 1ml EPTX buffer (with Triton) and mix with the

TALON. Add 20µl PMSF in each 2ml tube and incubate for 1h at 4°C (on the wheel);

Centrifuge the samples 4 min. , 7000rpm, 4°C, remove SN, fill the tubes with EPTX buffer and incubate them 20 min. – 4°C – on the wheel;

Centrifuge the samples 4 min. , 7000rpm, 4°C, remove SN, fill the tubes with 5mM Imidazol and incubate them 20 min. – 4°C – on the wheel;

Centrifuge the samples 4 min. , 7000rpm, 4°C, remove SN, fill the tubes with 5mM Imidazol and incubate them 20 min. – 4°C – on the wheel;

Apply the samples on the column, wash 5x with 5mM Imidazol and elute 2x with 400µl 200mM Imidazol. Store the purified proteins in -20°C freezer.

5mM Imidazol

0,068g Imidazol + 200 ml EPTX buffer (with Triton)

200mM Imidazol

0,68gImidazol + 50ml EPTX buffer (with Triton)

Run a 5-15% SDS page overnight (20mA) with 15µl from each mutant (membranes

or purified protein) to quantify the proper amount of protein used for western-blotting.

Coomassie Blue from protein purifications:

To stain, immerse gel in above solution. Bands will begin to appear within 15 minutes. Intensity and sensitivity will continue to improve in 3 hours.

Destain for 1 - 4 hours in 5% MeOH, 7.5% HoAC, 87.5% H2O. Bands will begin to appear in 1 - 2 hours. Destain until background is clear.

Store in H2O and scan.

SDS-PAGE

Western Blot

6. Result and discutions

To evaluate the interaction between SecY and YidC, I tried to perform an crosslink

between those proteins from SecY side and after that from Yidc side to SecY.

In order to accomplish this objective I made two mutants in TM8 domain at lateral

gate of SecY: L316 and L320 Fig 3.

Fig 3. – Cristalographical structure of SecY with L316 and L320 aminoacid residues.

Results revealed that is no interaction between SecY and YidC at C-terminus tail of

TM 8 domain (see Figure Legends).

Under direct observation of Professor Koch I start to study SecY-YidC interaction

from YidC side. I analyzed 5 mutans from TM3 domain of YidC on Western Blot after in

vivo photo-cross-linking, I didn’t get nothing UV dependent. This means that SecY isn’t in

contact with TM3 of YidC (see Figure Legends). Analyzed mutants of YidC were: K249

from periplasmic loop used like positive control, 423 situated close to N-terminus of YidC

and 435, 436, 437, 438 in the center on TM3.

7. Legend Figures

Fig. 4 – Western Blot with TM3 mutants of YidC. Blot membrane was incubated with αYidC

antibodies 1:3000 for 20 minutes and αRabbit conjugated antibodies 1:5000 for 10 minutes. Detection

was performed 25 minute at High sensitivity.

Fig. 5 – Western Blot with TM3 mutants of YidC. Blot membrane was incubated with αYidC

antibodies 1:3000 for 20 minutes and αRabbit conjugated antibodies 1:5000 for 10 minutes. Detection

was performed 25 minute at High sensitivity. K249 from periplasmic loop one of YidC was used like

positive control (Thomas Welte, masspectrometry, unpublished data).

Fig. 6 - Western Blot with TM3 mutants of YidC. Blot membrane was incubated with αHis

conjugated antibodies 1:5000 for 60 minutes. Detection was performed 25 minute at High sensitivity.

Fig. 7 - Western Blot with TM3 mutants of YidC. Blot membrane was incubated with αHis

conjugated antibodies 1:5000 for 60 minutes. Detection was performed 25 minute at High sensitivity.

Fig. 8 – Western Blot with TM3 mutants of YidC. Blot membrane was incubated with αSecy

antibodies 1:3000 for 60 minutes and αRabbit conjugated antibodies 1:5000 for 60 minutes. Detection

was performed 25 minute at High sensitivity.

Fig. 8 – Western Blot with TM3 mutants of YidC. Blot membrane was incubated with

αSecy antibodies 1:3000 for 60 minutes and αRabbit conjugated antibodies 1:5000 for 60 minutes.

Detection was performed 25 minute at High sensitivity.

Acknowledgements

The techniques were performed under guidance of Ilie Sachelaru and

Professor Koch. The mentoring was very helpful and informative. The working

atmosphere in the lab was very comfortable. The work in the lab is being

sustained.

References

1. (2004). "The archaeal Sec–dependent protein translocation pathway." Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1446): 919-927.

2. Chen, M., J. C. Samuelson, et al. (2002). "Direct Interaction of YidC with the Sec-independent Pf3 Coat Protein during Its Membrane Protein Insertion." Journal of Biological Chemistry 277(10): 7670-7675.

3. Dalbey, R. E., P. Wang, et al. (2011). "Assembly of Bacterial Inner Membrane Proteins." Annual Review of Biochemistry 80(1): 161-187.

4. Dyrløv Bendtsen, J., H. Nielsen, et al. (2004). "Improved Prediction of Signal Peptides: SignalP 3.0." Journal of Molecular Biology 340(4): 783-795.

5. Farrell, I. S., R. Toroney, et al. (2005). "Photo-cross-linking interacting proteins with a genetically encoded benzophenone." Nat Meth 2(5): 377-384.

6. Jiang, F., M. Chen, et al. (2003). "Defining the Regions of Escherichia coli YidC That Contribute to Activity." Journal of Biological Chemistry 278(49): 48965-48972.

7. Kol, S., W. Majczak, et al. (2009). "Subunit a of the F1F0 ATP Synthase Requires YidC and SecYEG for Membrane Insertion." Journal of Molecular Biology 390(5): 893-901.

8. Kulajta, C., J. O. Thumfart, et al. (2006). "Multi-step Assembly Pathway of the cbb3-type Cytochrome c Oxidase Complex." Journal of Molecular Biology 355(5): 989-1004.

9. Marrichi, M., L. Camacho, et al. (2008). "Genetic Toggling of Alkaline Phosphatase Folding Reveals Signal Peptides for All Major Modes of Transport across the Inner Membrane of Bacteria." Journal of Biological Chemistry 283(50): 35223-35235.

10. Nouwen, N. and A. J. M. Driessen (2002). "SecDFyajC forms a heterotetrameric complex with YidC." Molecular Microbiology 44(5): 1397-1405.

11. Pohlschröder, M., E. Hartmann, et al. (2005). "DIVERSITY AND EVOLUTION OF PROTEIN TRANSLOCATION." Annual Review of Microbiology 59(1): 91-111.

12. Price, C. E. and A. J. M. Driessen (2010). "Conserved Negative Charges in the Transmembrane Segments of Subunit K of the NADH:Ubiquinone Oxidoreductase Determine Its Dependence on YidC for Membrane Insertion." Journal of Biological Chemistry 285(6): 3575-3581.

13. Rapoport, T. A. (2007). "Protein translocation across the eukaryotic endoplasmic reticulum and bacterial plasma membranes." Nature 450(7170): 663-669.

14. Robson, A., B. Carr, et al. (2009). "Synthetic peptides identify a second periplasmic site for the plug of the SecYEG protein translocation complex." FEBS Letters 583(1): 207-212.

15. Schünemann, D. (2004). "Structure and function of the chloroplast signal recognition particle." Current Genetics 44(6): 295-304.

16. Scotti, P. A., M. L. Urbanus, et al. (2000). "YidC, the Escherichia coli homologue of mitochondrial Oxa1p, is a component of the Sec translocase." EMBO J 19(4): 542-549.

17. Serek, J., G. Bauer-Manz, et al. (2004). "Escherichia coli YidC is a membrane insertase for Sec-independent proteins." EMBO J 23(2): 294-301.

18. van Bloois, E., G.-J. Haan, et al. (2006). "Distinct Requirements for Translocation of the N-tail and C-tail of the Escherichia coli Inner Membrane Protein CyoA." Journal of Biological Chemistry 281(15): 10002-10009.

19. Veenendaal, A. K. J., C. van der Does, et al. (2004). "The protein-conducting channel SecYEG." Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1694(1–3): 81-95.

20. Winterfeld, S., N. Imhof, et al. (2009). "Substrate-Induced Conformational Change of the Escherichia coli Membrane Insertase YidC." Biochemistry 48(28): 6684-6691.