report on the verification of the performance of a simplex...

European Union Reference Laboratory for Genetically Modified Food and Feed

Report on the Verification of the Performance of a Simplex Endpoint Event-specific Method for the Detection of Event MON71800 in Wheat Using Real-time PCR

2016

This publication is a Validated Methods, Reference Methods and Measurements report by the Joint Research

Centre (JRC), the European Commission’s science and knowledge service. It aims to provide evidence-based

scientific support to the European policy-making process. The scientific output expressed does not imply a policy

position of the European Commission. Neither the European Commission nor any person acting on behalf of the

Commission is responsible for the use which might be made of this publication.

Contact information

Food and Feed Compliance Unit

Address: Joint Research Centre, Via Enrico Fermi 2749, TP 201, 21027 Ispra (VA), Italy

E-mail: [email protected]

Tel.: +39 0332 78 5165

Fax: +39 0332 78 9333

JRC Science Hub

https://ec.europa.eu/jrc

JRC103356

Ispra, Italy: European Commission, 2016

© European Union, 2016

Reproduction is authorised provided the source is acknowledged.

How to cite: European Union Reference Laboratory for GM Food and Feed; Report on the Verification of the

Performance of a Simplex Endpoint Event-specific Method for the Detection of Event MON71800 in Wheat Using

Real-time PCR; JRC103356

All images © European Union 2016

EUROPEAN COMMISSION DIRECTORATE-GENERAL JOINT RESEARCH CENTRE

Directorate F – Health, Consumers and Reference Materials Food & Feed Compliance

EU-RL GMFF: MON71800 event-specific method verification report 3 1 of 20 JRC Publication JRC103356

Report on the Verification of the Performance of a Simplex Endpoint Event-specific Method for the

Detection of Event MON71800 in Wheat Using Real-time PCR

6 October 2016

European Union Reference Laboratory for GM Food and Feed

Executive Summary

Following the United States Department of Agriculture's (USDA) Animal and Plant Health Inspection

Service (APHIS) announcement that test results confirmed the finding of unauthorised GM glyphosate-

resistant wheat volunteers harbouring the event MON71800 on a farm in Oregon, the European Union

Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF) was requested to provide

the GMO National Reference Laboratories (NRLs) of the EU Member States with a method for

detecting this genetically modified organism (GMO) in wheat consignments.

In response, the EURL GMFF designed a testing strategy, based on readily available screening tests,

that was published in June 2013 on the respective web page (http://gmo-

crl.jrc.ec.europa.eu/GM_wheat.htm). In July 2013 the EURL GMFF also published a ‘Report on the

Verification of the Performance of a Testing Strategy’ at the same URL address.

In May 2013 Monsanto had provided to the EURL GMFF a duplex endpoint TaqMan® PCR procedure

for detection of “Roundup Ready® Wheat MON71800 and the acetyl-coenzyme A carboxylase Acc-1

reference gene that had previously been made available to and used by USDA. The method provided

is an event-specific assay spanning the 5’ insert-to-plant junction. The EURL GMFF verified the method

on positive control samples consisting of MON71800 crude lysate, also provided by Monsanto, and

published a report in December 2013. The assay had a sensitivity no lower than 0.5% (expressed as

ratio between GM- and target taxon-specific DNA copy numbers) and was therefore not in line with

the method acceptance criteria established by the ENGL (http://gmo-

crl.jrc.ec.europa.eu/GM_wheat.htm).

A second event-specific simplex endpoint TaqMan® PCR method spanning the 3’ insert-to-plant

junction of wheat MON71800 and a new taxon-specific simplex method for the Acc-1 control were

made available by Monsanto. The EURL GMFF tested this method in September 2013 with the

following results:

1. The method is event-specific, i.e. can reliably differentiate between the MON71800 and a wide

selection of GM events.

http://gmo-crl.jrc.ec.europa.eu/GM_wheat.htm




EURL-EM-02/13 VR3

EURL GMFF: MON71800 event-specific method verification report 3 2 of 20 JRC Publication JRC103356

2. The method detects MON71800 event at concentrations of 0.03-0.06% expressed as copy

number ratio of GM-wheat/non-GM wheat.

The sensitivity of this event-specific method is therefore within the same range of the testing strategy

proposed by the EURL GMFF in June 2013 and verified in July 2013 (http://gmo-

crl.jrc.ec.europa.eu/GM_wheat.htm). That strategy, based on readily available screening methods, has

a relative LOD between 0.03% and 0.06%, expressed as ratio between GM and target taxon-specific

DNA copy numbers.

For detection of GM glyphosate-resistant wheat (MON71800) in wheat grain or in food/feed products

containing wheat flour originating or consigned from the US, the EURL GMFF suggests following the

testing strategy proposed in June 2013 or the present event-specific method, provided DNA of

acceptable quality can be obtained.



EURL-EM-02/13 VR3


Note

This report is published for information purposes only. It contains intellectual property and

information owned or controlled by Monsanto Company and covered by one or more patents. Consent

is not granted or implied by publication of the MON71800 event-specific detection method for any

other use or application by any party or entity other than the European institutions and Member

States official control laboratories, nor is any right or license granted or implied to the information,

material, or intellectual property contained or referenced therein.

EURL-EM-02/13 VR3


Quality assurance

The EURL GMFF is accredited ISO 17025:2005 [certificate number: ACCREDIA 1172, (Flexible Scope

for DNA extraction and qualitative/quantitative PCR) - Accredited tests are available at http://gmo-

crl.jrc.ec.europa.eu/accredited_methods.html.

The original version of the document containing evidence of internal checks and authorisation for

publication is archived within the EURL GMFF quality system.

Address of contact laboratory:

European Commission

Directorate-General Joint Research Centre (JRC)

Directorate F – Health, Consumers and Reference Materials

Food & Feed Compliance

European Union Reference Laboratory for GM Food and Feed

Via E. Fermi 2749, 21027 Ispra (VA) – Italy

Mail: [email protected]

http://gmo-crl.jrc.ec.europa.eu/accredited_methods.html

http://gmo-crl.jrc.ec.europa.eu/accredited_methods.html

mailto:[email protected]

EURL-EM-02/13 VR3


Content

1. Introduction........................................................................................................................... 6

2. Experimental design, materials and methods ............................................................................... 6

2.1. Control samples, DNA extraction and DNA concentration ....................................................... 6

2.2. Description of the event-specific method for MON71800 wheat as provided by MONSANTO

(ESM71800) and adapted for verification by the EURL GMFF ........................................................ 7

2.2.1. Primers and probes ...................................................................................................... 8

2.2.2. Reaction set up ............................................................................................................ 8

2.2.3. Cycling parameters ...................................................................................................... 9

2.3. Specificity..........................................................................................................................10

2.3.1. Bioinformatics analysis ................................................................................................10

2.3.2. Experimental ..............................................................................................................10

2.4. Estimation of the sample size in the determination of the limit of detection ...........................10

2.5. Limit of Detection ..............................................................................................................11

3. Results ..................................................................................................................................12

3.1 Quality of the extracted DNA ...............................................................................................12

3.2. Specificity of the method ....................................................................................................12

3.2.1. Bioinformatics analysis ................................................................................................12

3.2.2. Verification of the amplicon size in the MON71800-specific system .................................15

3.2.3. Experimental testing of specificity ................................................................................16

3.2 Limit of detection ................................................................................................................18

4. Conclusions ...........................................................................................................................18

ANNEX 1. Estimation of the sample size in the determination of the Limit of Detection ....19

EURL-EM-02/13 VR3


1. Introduction

Following the United States Department of Agriculture's (USDA) Animal and Plant Health Inspection

Service (APHIS) announcement that test results confirmed the finding of unauthorised GM glyphosate-

resistant wheat volunteers harbouring the event MON71800 in a farm in Oregon, the European Union

Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF) was requested to provide

National Reference Laboratories (NRLs) of the EU Member States with a method for detecting this

genetically modified organism (GMO) in wheat consignments.

In response the EURL GMFF developed and published in June 2013 a testing strategy, based on

readily available screening methods (http://gmo-crl.jrc.ec.europa.eu/GM_wheat.htm). The

experimental verification of this strategy, published in July 2013 at the same URL address, showed an

approximate limit of detection (LOD) of 0.03%, expressed in terms of copy numbers.

In December 2013, the EURL GMFF published the verification of the performance of an event-specific

method, submitted by Monsanto, spanning the 5’ insert-to-plant junction of MON71800. The company

also provided control samples consisting of crude lysate from MON71800 wheat and sequence

information on the event. The method was confirmed to be event-specific but displayed an

approximate LOD of 0.5%, expressed as ratio between GM- and target taxon-specific DNA copy

numbers (Report on the Verification of the Performance of a Method for the Detection of Event

MON71800 in Wheat Using Real-Time PCR, http://gmo-crl.jrc.ec.europa.eu/GM_wheat.htm) which is

not in line with the method acceptance criteria established by the ENGL.

A second event-specific method spanning the 3’ insert-to-plant junction of event MON71800 was

made available by Monsanto. This document reports on the in-house verification of this method

carried out by the EURL GMFF.

2. Experimental design, materials and methods

2.1. Control samples, DNA extraction and DNA concentration

Control samples

The EURL GMFF tested the event specific method spanning the 3’ insert-to-plant junction of event

MON71800 on positive control sample provided by Monsanto and consisting of crude lysate from

MON71800 seeds. The lysates were re-suspended by the EURL GMFF in 0.1x TE buffer to a final

volume of 500 L.

According to information provided by Monsanto, the MON71800 control sample should be considered

homozygous. The EURL GMFF did not perform zygosity tests by digital PCR to verify this information.

DNA extraction

In addition to the control samples provided by Monsanto, the EURL GMFF prepared suitable DNA from

other sources:

Genomic DNA extracted from certified seeds of T. aestivum, variety Apache, using the

NucleoSpin food kit (MACHEREY-NAGEL catalogue number: FC140945).



EURL-EM-02/13 VR3


Genomic DNA used in the specificity tests (section 2.3.3) was extracted either with Nucleospin

food kit or with a CTAB procedure modified from ISO2157 A.3 from IRMM1 or AOCS2 certified

reference materials, with the exception of LLCotton25xGHB614 genomic DNA.

Conventional DNA of cotton, rice, maize, soybean and oilseed rape was extracted from control

samples stored at EURL GMFF or purchased from local retailers.

DNA extracts were checked for integrity using DNA agarose gel electrophoresis. DNA was quantified

and assessed for absence of inhibitory compounds.

Inhibition runs were carried out as described in the ENGL guidance document “Verification of

analytical methods for GMO testing when implementing interlaboratory validated methods”a

a http://gmo-crl.jrc.ec.europa.eu/guidancedocs.htm

using the respective taxon-specific validated reference systems to rule out possible inhibitory effects.

The inhibition runs on conventional wheat genomic DNA were performed using a published wheat

reference system (primers Wx012F/Wx012R and probe Wx-Taq 1)3.

DNA concentration

The concentration of the extracted DNA was determined by fluorescence detection, using the

PicoGreen dsDNA Quantitation Kit (Molecular Probes). The respective DNA concentrations were

determined as the arithmetic mean of 10 readings on the basis of a five-point standard curve using a

VersaFluor Fluorometer (Bio-Rad) as fluorescence detector.

2.2. Description of the event-specific method for MON71800 wheat as

provided by MONSANTO (ESM71800) and adapted for verification by the

EURL GMFF

The method “Roundup Ready Wheat MON71800 3’-Junction Event Specific endpoint TaqMan® PCR

with acc Control for Seed Pools of 200” developed by Monsanto makes use of a simplex endpoint PCR

system coupled with the use of labelled oligonucleotides (probes) for event-specific detection of

MON71800 and of the acetyl-coenzyme A carboxylase, Acc-1, reference target (Genebank:

AF029897.1). The procedure is designed for detection of the MON71800 event in genomic DNA

extracted from wheat seed pools of 200 seeds. The method is optimised for 96-well or 384-well

format using an Applied Biosystems GeneAmp PCR System 9700 or MJ Research DNA Engine PTC-

225. After PCR amplification the fluorescence is detected via a specific plate reader or via an “Allelic

discrimination” assay (e.g. ABI real-time series instruments)4.

Since plate readers or allelic discrimination analysis are not standard procedures in EU control

laboratories, the EURL GMFF ran the method on real-time PCR equipment ABI 7900HT, a widely used

type of instrument in GMO testing laboratories, under the conditions described by the method

developer and analysed the data in the modality ‘Absolute Quantification’ (AQ) assay.

Limitations of the “Allelic Discrimination“ assay have been already described in the EURL GMFF report

on the verification of an event-specific method for detection of MON71800 based on the 5’ insert-to-

http://gmo-crl.jrc.ec.europa.eu/guidancedocs.htm

EURL-EM-02/13 VR3


plant junction, previously proposed by Monsanto (http://gmo-crl.jrc.ec.europa.eu/GM_wheat.htm). In

the present study two parameters were investigated: specificity and limit of detection (LOD).

For the event-specific detection of MON71800, a 97-bp fragment of the 3’ region spanning the insert-

to-plant junction in wheat event MON71800 is amplified using specific primers. PCR products are

detected during each cycle (real-time) by means of a target-specific oligonucleotide probe labelled

with the fluorescent dye FAM (6-carboxyfluorescein), as reporter dye at its 5 end, and TAMRA

(carboxytetramethylrhodamine) as quencher at its 3’ end. A second potential amplification site

covering the same portion of the 3’ insert-to-plant junction and a longer segment of the genomic

flanking region identified by bioinformatics analysis (see section 3.2.1) was shown not to be amplified

(see section 3.2.2).

For the taxon-specific detection of wheat, a reference-specific system amplifies a 94-bp fragment of

the Triticum aestivum Acc-1 gene, by means of specific primers and a probe labelled with FAM as

reporter dye at its 5’ end, and TAMRA as quencher at its 3’ end.

2.2.1. Primers and probes

Primers and probes for the two simplex PCR, as defined by Monsanto, used in the EURL GMFF in-

house verification, are reported in Table 1.

Table 1. Oligonucleotide sequences for detection of event MON71800 and Acc-1 reference gene

Oligonucleotides Name DNA Sequence (5’ to 3’) Length (nt)

MON71800 3’ - insert-to-plant junction

Forward primer SQ50540 5’-CGC CTT CAG TTT AAA CTA TCA G-3’ 22

Reverse primer SQ50541 5’-CGA CGT GAT GCC TAT GTA TTG-3’ 21

Probe PB50160

5’-6FAM™-CAG TGC CTG GAC ATC GTC ATA ATT ATT

TGA GGT TC -TAMRA™ -3’ 35

Acc-1

Forward primer SQ50542 5’- GCC TAC CCC CTT CAA CAA GA -3’ 20

Reverse primer SQ50543 5’- ATG TAC GCG CTT GAA CCC TT-3’ 20

Probe PB50161

5’- 6FAM™-CCA CCG ACG AGT TAA AAC CAA AGA TAC

ACG -TAMRA™ -3’ 30

2.2.2. Reaction set up

Final concentrations for reagents of event-specific and wheat specific amplification systems used in

the in-house verification are shown in Table 2 and 3.


http://en.wikipedia.org/wiki/Rhodamine

EURL-EM-02/13 VR3


Table 2. Amplification reaction mixture in final volume/concentration per reaction well for the

MON71800 method

Component Final concentration µL/reaction

TaqMan® Universal PCR Master Mix (2x)*

SQ50540/SQ50541 (20 µM each primer)

PB50160 (10 µM)

DNase free water

DNA

1x

0.5 µM

0.125 µM

#

#

5

0.25

0.125

2.15

2.475

Total reaction volume: 10 µL

* Applied Biosystems Cat. # 4304437

Table 3. Amplification reaction mixture in final volume/concentration per reaction well for the Acc-1

method

Component Final concentration µL/reaction

TaqMan® Universal PCR Master Mix (2x)*

SQ50542/SQ50543 (20 µM each primer)

PB50161 (10 µM)

DNase free water

DNA

1x

0.5 µM

0.125 µM

#

#

5

0.25

0.125

2.15

2.475

Total reaction volume: 10 µL

* Applied Biosystems Cat. # 4304437

2.2.3. Cycling parameters

The reaction was run by the EURL GMFF in a touchdown mode, with starting annealing and extension

temperature at 64 °C and final annealing and extension temperature at 54 °C (Table 4).

Table 4. Cycling program for the MON87701/Acc-1 simplex system used by the EURL GMFF.

Step Stage T°C Time (sec) Acquisition Cycles

1 UNG* 50oC 120 No 1x

2 Initial denaturation 95oC 600 No 1x

3 Amplification/Touch

down

Denaturation 95oC 15 No

10x Annealing & Extension

64oC -1 oC/cycle

60 Yes

4 Amplification Denaturation 95oC 15 No

40x Annealing &

Extension 54oC 60 Yes

*UNG: Uracil-N-glycosylase

EURL-EM-02/13 VR3


2.3. Specificity

2.3.1. Bioinformatics analysis

Bioinformatics analyses were conducted on sequence data provided by Monsanto for the event

MON71800 wheat. Similarity searches with BLASTN 2.2.155 were performed against the GMO

sequence database maintained at the JRC (CCSIS), the NCBI nt nucleotide sequence database, the

NCBI patent nucleotide sequence database, as well as the whole genomes of Brassica rapa, Glycine

max, Oryza indica, Oryza sativa, Solanum lycopersicum and Zea mays using the e-PCR prediction tool.

Results of the analyses are reported in chapter 3.

2.3.2. Experimental

Specificity tests were conducted to evaluate the cross-reactivity of the method against genomic DNA

extracted from the following GMOs: soybean CV127 (AOCS 0911-D), MON87701 (AOCS 0809-A),

MON87705 (AOCS 0210-A), MON89788 (AOCS 0906-B), A2704-12 (AOCS 0707-B4), A5547-127 (AOCS

0707-C3), FG72 (AOCS 0610-A2); oilseed rape Ms1 (AOCS 0711-A), Ms8 (AOCS 0306-F3), Rf1 (AOCS

0711-B), Rf2 (AOCS 0711-C), Rf3 (AOCS 0306-G3), T45 (AOCS 0208-A4), Topas 19/2 (AOCS 0711-D),

GT73 (AOCS 0304-B); maize MON87460 (AOCS 0709-A), MIR162 (AOCS 1208-A), MON88017 (AOCS

0406-D), MON89034 (AOCS 0906-E), MON810 (ERM-BF413-5), GA21 (ERM-BF414-5), Bt176 (ERM-

BF411R-5), NK603 (ERM-BF415-5), MIR604 (ERM-BF423d), Bt11 (ERM-BF412R-5); cotton GHB119

(ERM-BF428c), GHB614xLLCotton25, conventional wheat, maize, soybean, rice, oilseed rape and

cotton (ERM-BF428a).

Reactions were conducted in triplicate with 2,500 genome copies of GM DNA per reaction.

2.4. Estimation of the sample size in the determination of the limit of detection

The optimal sample size to determine the absolute or relative LOD was determined by estimating the

number n of replicates per GM level that would generate a 95% confidence interval around the

proportion of GM-negative samples with an upper boundary not exceeding 5%.

For an accurate estimate of the 95% confidence interval (depending on the degrees of freedom used

to compute p), the F-distribution was used based on the relationship between such distribution and

the binomial distribution6. This method, derived from Bliss

7 and recently re-proposed by Zar8, leads to

an estimate of n = 100. Additionally, the standard approach based on the normal approximation was

also considered, as suggested by Cochran9. This alternative method returns an estimate of n = 60.

Further details are provided in Annex 1.

Given the experimental design for a LOD study where it is required to test a large number of

replicates in each sample characterised by defined analyte content (DNA copy number content) over a

linearly decreasing series of concentrations, the Cochran approach was accepted as the most feasible.

Hence, every sample (GM concentration level) was tested in 60 replicates.

In accordance with the Plant DNA C-values Database of the Royal Botanic Garden10

the weight of the

1-C value of wheat genome was considered to be equivalent to 17.33 pg.

EURL-EM-02/13 VR3


2.5. Limit of Detection

In official controls in the EU it is necessary to test for presence of MON71800 in grains or food and

feed samples, quantifying the amount of the GM event in relation to the total wheat DNA in the

sample. According to standard ISO (21569:2005) the LOD shall be provided with reference to a

relative value based on a specified matrix, ‘preferably a given amount of genomic DNA solution’.

Accordingly the EURL GMFF carried out tests to estimate the limit of detection of the method relatively

to a defined amount of wheat genomic DNA, extracted at EURL GMFF (LODrel). For the estimation of

the LODrel, respectively 10, 5, 1 and 1/10 of a solution containing 1 haploid genome copy of

MON71800 (corresponding to a theoretical value of 0.1 MON71800 haploid genome per reaction) were

added to 17,311 wheat haploid genome copies (corresponding to 300 nanograms of non-GM wheat

DNA) and analysed as described above (2.2.2 and 2.2.3) and detailed in Table 5. Each GM level was

tested in 60 replicates following the statistical model outlined above. No template controls and positive

controls were included.

Table 5. Experimental set-up for the estimation of the Limit of Detection

MON71800 haploid genome copies per

reaction

Added background Wheat haploid genome copies

GM% in haploid genome copies

10 17,311 0.06

5 17,311 0.03

1 17,311 0.01

0.1 17,311 -

EURL-EM-02/13 VR3


3. Results

3.1 Quality of the extracted DNA

Extracted genomic DNA showed acceptable DNA concentrations and passed inhibition tests. The

concentration of the MON71800 crude lysate was estimated at 1.4 ng/µL further to re-suspension as

previously described; given the low concentration this DNA was not subjected to inhibition tests.

3.2. Specificity of the method

3.2.1. Bioinformatics analysis

Molecular structure of MON71800

The characterised insertion site for event MON71800 contains two copies of the chloroplast transit

peptide linked to the 5-enolpyruvyl shikimate-3-phosphate synthase, one copy for the promoter P-35S

and two copies of the T-nos terminator. The molecular structure of the MON71800 insert in the wheat

genome is shown in Figure 1. The P-35S promoter contains an internal duplication of the enhancer

region. Therefore, event MON71800 can be detected with specific methods targeting these respective

elements (see ‘Report on the Verification of the Performance of a Testing Strategy for the Detection of

Wheat MON71800 Event Using Real-Time PCR’, http://gmo-crl.jrc.ec.europa.eu/GM_wheat.htm).

Annealing sites for primers and probe of the MON71800 event-specific system targeting the 3’ insert-

to-plant junction

According to bioinformatics analysis performed on the sequence of the MON71800 event provided by

Monsanto, the method spans the junction between the transgenic insert and the 3' genomic region.

The first method for event-specific detection of MON71800 in wheat provided by the company was

designed instead on the 5’ insert-to-plant junction as previously verified by the EURL GMFF

(http://gmo-crl.jrc.ec.europa.eu/GM_wheat.htm).

The SQ50540 primer binds in the transgenic insert, in a region corresponding to the T-DNA border

region while the SQ50541 primer and the PB50160 probe bind in the genomic flanking region.

However, the SQ50541 primer and the PB50160 probe have additional perfect binding sites on

neighbouring genomic DNA sequence. Therefore, this set of primers could theoretically produce two

amplicons of 97 bp and 252 bp. A third binding site for the primer and probe was identified, but on

the 5' genomic border, and in an orientation that should not produce additional PCR amplicons (See

Figure 1).



EURL-EM-02/13 VR3


Figure 1. Position and orientation of the binding sites found for the primers SQ50540 and SQ50541 and for

the probe PB50160 in MON71800. Blue: binding in the sense orientation, Orange: binding in the antisense

orientation

Verification of specificity

The sequences of the largest (252 bp) and shortest (97 bp) amplicons were analysed by similarity

searches using the BLAST algorithm against the "patents" and NCBI "nt" databases. Significant

similarities were only found with sequences from Monsanto patents. In the 'nt' database, fragments of

wheat family genomes show similarity with the genomic part of the amplicon, but none of the

fragments include both primers binding sites.

In addition, the primers were assessed against other GM events present, as well as against local

copies of the whole genomes of Brassica rapa, Glycine max, Oryza indica, Oryza sativa, Solanum

lycopersicum and Zea mays, downloaded from Ensembl11 No potential amplicon was identified using

the e-PCR prediction tool12.

Wheat-specific reference system

The described taxon-specific method targets the Triticum aestivum (common wheat) acetyl-coenzyme

A carboxylase (Acc-1) gene (GenBank N. AF029897.1). The primers and probe sequences used in this

method are different from the ones previously submitted by Monsanto for the Acc-1 reference system

and already evaluated by the EURL GMFF for verification of the duplex endpoint PCR method targeting

the 5’ insert-to-plant junction. The current simplex Acc-1 assay targets an intron region of the gene

with an expected amplicon size of 94 bp, instead of an exon as with the previous system (according to

the annotations of AF029897.1).

EURL-EM-02/13 VR3


The genome of the wheat family is complex, with four types of genomes, symbolised by the letters A,

B, D and G. Triticum aestivum has an AABBDD genome configuration, produced by hybridization of

tetraploid emmer wheat (AABB, T. dicoccoides) with Aegilops tauschii (DD).

For the analyses, the genome assemblies for the three individual sub-genomes (from the International

Wheat Genome Sequencing Consortium, IWGSC) were downloaded individually from the Institute of

Bioinformatics and Systems Biology ftp site13.

Alignments of the amplicon sequence with these sub-genomes identify three regions with significant

similarity, one per sub-genome (Figure 2).

Figure 2. Alignment of the amplicon sequence of the acetyl-coenzyme A carboxylase detection method

proposed by Monsanto with the regions of significant sequence similarity found in the wheat genome. The

sequences of the primers and probes are shown in green; differences at binding sites are highlighted.

Genomic region 1:

Amplicon GCCTACCCCCTTCAACAAGATGACCGAACACCACCGACGAGTTAAAACCAAAGATACACG

Genomic region 1 GCCTACCCCCTTCAACAAGATGACCGAACACCACCGACGAGTTAAAACCAAAGATACACG

************************************************************

Amplicon GGACCTGCC-AAAAAAAGGGTTCAAGCGCGTACAT

Genomic region 1 GGACCTGCCAAAAAAAAGGGTTCAAGCGCATACAT

********* ******************* *****

Genomic region 2: Amplicon GCCTACCCCCTTCAACAAGATGACCGAACACCACCGACGAGTTAAAACCAAAGATACACG

Genomic region 2 GCCTACCCCCGTCAACAAGATGACCGAACACCACCGGCGACTTAAAACCAAAGATGCACA

********** ************************* *** ************** ***

Amplicon GGACCTGCCAAAAAAAGGGTTCAAGCGCGTACAT

Genomic region 2 GAACGCGCAAAACAAAGGGCTCAAGCGTGTACAG

* ** ** *** ****** ******* *****

Genomic region 3: Amplicon GCCTACCCCCTTC-AACAAGATGACCGAACACCACCGACGAGTTAAAA-CCAAAGATACA

Genomic region 3 GCCTACCCCTTTTTAACAAGATGATCGAACACCATCGACGAGTTAAAAACCAAAGATGCA

********* ** ********** ********* ************* ******** **

Amplicon CGGGACCTGCC---AAAAAAAGGGTTCAAGCGCGTACAT

BAC CCTGACCTGCCAAAAAAAAAAGGGTTCAAGCGCGTACAC

* ******** ************************

Consistent with these analyses, the genomic region from subgenomes A and B were also found,

identical, in bacterial artificial chromosomes (BACs) from Triticum durum (also AABB) while the

genomic region from subgenome D was found, identical, in the Ensembl sequence for Aegilops

tauschii

EURL-EM-02/13 VR3


As shown on Figure 2, according to the current version of the wheat genome, there is a discrepancy

between the genomic sequence of that region and one base of the reverse primer. In addition, the

amplicon size from region A would be one nucleotide base shorter (93 bp).

The size difference is caused by a stretch of seven or eight adenines (A), and most probably

represents a sequencing error in one of the two sequences (genomic or AF029897). For this, as for

the difference in the primer sequence, it is therefore not possible to know which sequence is correct,

i.e. whether the amplicon size is 93 bp or 94 bp, and whether there is a mismatch in the suggested

reverse primer binding region.

BLAST analysis of the amplicon sequence against the Ensembl genomes of other cereals, such as B.

dystachion, H. vulgare (barley), S. italica (millet) and S. bicolor (sorghum) did not recognise any

additional region of significant similarity.

The primers were also tested against local copies of the whole genomes of more than 80 plants

(including Brassica rapa, Glycine max, Oryza sativa, Solanum lycopersicum and Zea mays). Using the

e-PCR prediction tool (as referenced in ‘Bioinformatics verification of the GM-assay specificity’), no

potential amplicon was identified.

In conclusion, bioinformatics analyses suggest that the three highly similar regions found in the

Ensembl genomic sequence of T. aestivum may represent the target Acc-1 genes from the A, B and D

genomic backgrounds of T. aestivum; the first region, almost identical to AF029897.1 and to the

primers and probe sequences of the current Acc-1 system, seems to be present in both T. aestivum

and T. durum genomes. The method therefore should not be able to differentiate between these two

species. A mismatch may be present between the proposed reverse primer (SQ50543) and the

corresponding binding site in the genome.

No other potential amplification sites were identified in other plant species.

3.2.2. Verification of the amplicon size in the MON71800-specific system

Bioinformatics analyses showed (3.2.1) that the SQ50541 primer and the PB50160 probe have an

additional binding site in the neighbouring flanking genome sequences. It is expected that this set of

primers can produce two amplicons, of sizes 97 bp and 252 bp. To verify whether in the experimental

conditions described in the protocol (sections 2.2.2 and 2.2.3) amplicons are generated, the following

experiment was conducted: 180 copies of MON71800 in two replicates were tested with MON71800-

specific system and loaded on a 2% agarose gel electrophoresis. Figure 3 shows that only one

amplicon is produced, whose band is aligned to the bands at about 100 bp from both molecular

weight markers run in parallel. Therefore, it can be concluded that the amplicon at 97 bp is the only

or largely predominant MON71800-specific amplicon in reaction.

EURL-EM-02/13 VR3


Figure 3. Agarose gel electrophoresis of MON71800 samples amplified with the MON71800-specific system

Legend: 1 = 50 bp ladder; 2 and 3 = 180 copies of MON71800; 4 = No template control; 5 = 100 bp ladder

3.2.3. Experimental testing of specificity

In addition to the bioinformatics analysis, a number of GM events were tested with the MON71800

method to verify its specificity. The reference system Acc-1 was also tested on conventional DNA

extracted from crops commonly used as food or feed: maize, soybean, oilseed rape, cotton, rice and

wheat.

Each specificity test was run in triplicate with 2,500 GM- or conventional-DNA genome copies per

reaction. Detection was recorded when the amplification curve crossed the threshold within the

number of cycles described in the method. Results indicating the outcome of tests and the relative

quantification cycle (Cq) are shown in Tables 6 and 7.

Table 6 shows that the MON71800 method does not cross-react with any of the GMOs tested and

confirms the bioinformatics analysis previously described (section 3.2.1).

1 2 3 4 5

50 bp

100 bp 100 bp

EURL-EM-02/13 VR3


Table 6. Specificity of the MON71800 detection method. The Cq number is the mean of

three replicates.

Event Name Cq values event-specific

MON71800 system

CV127 n.d.

MON87701 n.d. MON87705 n.d. MON89788 n.d. A2704-12 n.d. A5542-127 n.d. FG72 n.d. GHB119 n.d. GHB614xLLCotton25 n.d. MON87460 n.d. MIR162 n.d. MON88017 n.d. MON89034 n.d. MON810 n.d. GA21 n.d. Bt176 n.d. NK603 n.d. MIR604 n.d. Bt11 n.d. MS1 n.d. MS8 n.d. RF1 n.d. RF2 n.d. RF3 n.d. T45 n.d. Topas 19/2 n.d. GT73 n.d. Conventional cotton n.d. NTC n.d. Positive Control* 28.1

n.d.: not detected, i.e. no amplification observed when the method is applied to the specified analyte NTC: no template control * Positive Control: 100 genome copies of MON71800 DNA

Similarly, the Acc-1 method did not show cross-reactivity with genomic DNA from any of the species

tested at 2,500 haploid genome copies (Table 7). No template controls (NTCs) were added for each

test. All NTCs tested negative.

Table 7. Specificity of the Acc-1 wheat reference method. The Cq number is the mean of

three replicates.

Crop Name Cq values* Acc-1 reference system

Cq values/ taxon specific reference system

Cotton n.d. 26.4 / AdhC

Maize n.d. 26.1 / HMG

Oilseed rape n.d. 27.2 / FatA

Rice n.d. 26.2 / PLD

Soybean n.d. 25.8 / Le1

Wheat 18.9 Acc-1

NTC n.d. Acc-1, CruA, HMG, FatA, PLD,

Le1 n.d.: not detected, i.e. no amplification observed when the method is applied to the specified analyte

EURL-EM-02/13 VR3


3.2 Limit of detection

For the estimation of the LODrel, known quantities of MON71800 were added to 300 nanograms of

non-GM wheat genomic DNA and tested in 60 replicates. The levels investigated are shown in Table 8.

Table 8. Results of the determination of the LODrel of the MON71800 method

MON71800 haploid

genome copies Mean Cq for MON71800/

Standard Deviation Positive / total amplifications

10 32.6 / 1.34 60/60

5 34.1 / 1.42 58/60

1 31.2 / 1.42 17/60

0.1 29.1 / 1.52 4/60

As shown in Table 8, samples containing 10 and 5 MON71800 copies resulted positive respectively in

60 and 58 replicates out of 60. According to the statistical approach described in section 2.4 the LOD

is defined as the GM level where the target is detected in 59 out of 60 replicates. Therefore, for

samples containing 300 nanograms of wheat genomic DNA the LODrel is estimated to be between 5

and 10 copies of MON71800 event. This corresponds to a LODrel between 0.03% and 0.06%

expressed as ratio between GM and target taxon-specific DNA copy numbers.

4. Conclusions

Based on the above described results, the EURL GMFF concludes the following:

3. The wheat MON71800 endpoint TaqMan® PCR method spanning the 3’ insert-to-plant junction

provided by Monsanto is event-specific, i.e. can differentiate between the MON71800 and a

wide selection of GM events.

4. The method is reliably able to detect the MON71800 event at concentrations of 0.03-0.06%

expressed as copy number ratio of GM-wheat/non-GM wheat.

The sensitivity of this event-specific method is therefore in the same range of the testing strategy

proposed by the EURL GMFF in June 2013 (http://gmo-crl.jrc.ec.europa.eu/GM_wheat.htm). That

strategy, which is based on readily available screening methods, has a relative LOD between 0.03%

and 0.06%, expressed as ratio between GM- and target taxon-specific DNA copy numbers.


EURL-EM-02/13 VR3


ANNEX 1. Estimation of the sample size in the determination of the Limit of Detection

According to the method from Bliss7 and Zar

8, in a sample of (n) data, (X) of which showing the

character of interest, confidence limits (L1: lower limit, L2: upper limit) of a proportion (p) are

computed as follows:

2,1,2/

11 FXnX

XL

2',1',2/

2',1',2/

21

1

FXXn

FXL

where the degrees of freedom ν1 and ν2 are:

121 Xn

X 22

and the degrees of freedom ‘ν1 and ‘ν2 are:

221'

212'

Based on this method, with X = 1, α= 0.05, and L2 = 0.05, (n) is equal to 100.

According to Cochran9 the simplest approach to estimate the confidence interval of a sample

proportion (p), is the use of the normal distribution (z) and its standard deviation p (1 - p):

1

12/1

n

ppzpL

1

12/2

n

ppzpL

Based on this simplified approach, with X = 1 and α= 0.05, L2 = 0.05 (n) would be equal to 60, thus

resulting for determining the absolute LOD in an experimental set at 59 positive tests (n - X) over 60

replicates.

EURL-EM-02/13 VR3


5. References

1. Institute for Reference Materials and Measurements (IRMM). http://irmm.jrc.ec.europa.eu/

2. American Oil Chemists’ Society. https://secure.aocs.org/crm/index.cfm

3. S. Imai et al. (2012) An Endogenous Reference Gene of Common and Durum Wheat for Detection

of Genetically Modified Wheat. Food Hyg. Saf. Sci. 204 Vol. 53 203-210

4. Applied Biosystems. Allelic discrimination. Getting started guide. Part Number 4364015 rev. b

08/2005 5. Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignment search

tool." J. Mol. Biol. 215:403-410

6. Fisher R.A., Yates F. (1963) Statistical tables for biological, agricultural and medical research, 6th

edition. Hafner, New York, USA, 146 pp.

7. Bliss C.I. (1967) Statistical biology, Vol. 1. McGraw-Hill, New York, USA, 558 pp.

8. Zar J.H. (1999) Biostatistical analysis, 4th edition. Prentice Hall, New Jersey, 663 pp.

9. Cochran W.G. (1977) Sampling techniques, 3rd edition. John Wiley, New York, 428 pp.

10. Royal Botanic Garden. Plant DNA C-values Database. http://data.kew.org/cvalues/

11. EnsemblPlants, http://plants.ensembl.org/

12. Electronic PCR, http://www.ncbi.nlm.nih.gov/projects/e-pcr/

13. ftp://ftpmips.helmholtz-

muenchen.de/plants/wheat/IWGSC/genome_assembly/genome_arm_assemblies_CLEANED,

versions 16 July 2014

http://irmm.jrc.ec.europa.eu/

https://secure.aocs.org/crm/index.cfm

http://data.kew.org/cvalues/

ftp://ftpmips.helmholtz-muenchen.de/plants/wheat/IWGSC/genome_assembly/genome_arm_assemblies_CLEANED

ftp://ftpmips.helmholtz-muenchen.de/plants/wheat/IWGSC/genome_assembly/genome_arm_assemblies_CLEANED

Europe Direct is a service to help you find answers to your questions about the European Union

Free phone number (*): 00 800 6 7 8 9 10 11

(*) Certain mobile telephone operators do not allow access to 00 800 numbers or these calls may be billed.

A great deal of additional information on the European Union is available on the Internet.

It can be accessed through the Europa server http://europa.eu

How to obtain EU publications

Our publications are available from EU Bookshop (http://bookshop.europa.eu),

where you can place an order with the sales agent of your choice.

The Publications Office has a worldwide network of sales agents.

You can obtain their contact details by sending a fax to (352) 29 29-42758.

http://bookshop.europa.eu/

XX-N

A-x

xxxx-E

N-N

1JR

C103356

report on the verification of the performance of a simplex...

Documents