research article feeding patterns and xenomonitoring of

Research ArticleFeeding Patterns and Xenomonitoring of Trypanosomes amongTsetse Flies around the Gashaka-Gumti National Park in Nigeria

Solomon Ngutor Karshima1 Idris A Lawal2 and Oluseyi Oluyinka Okubanjo2

1Department of Animal Health Federal College of Animal Health and Production Technology PMB 001 Vom Nigeria2Department of Veterinary Parasitology and Entomology Ahmadu Bello University PMB 1045 Zaria Nigeria

Correspondence should be addressed to Solomon Ngutor Karshima torkarshimayahoocouk

Received 22 September 2015 Accepted 17 January 2016

Academic Editor Bernard Marchand

Copyright copy 2016 Solomon Ngutor Karshima et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

In order to understand the epidemiology of trypanosomoses in Gashaka-Gumti National Park Nigeria we determined the densityinfection rates and feeding patterns of tsetse flies using biconical traps ITS and mitochondrial cytochrome b PCRs A total of 631tsetse flieswere captured ofwhich 531 (842) and 100 (158)were analyzed for trypanosomes and bloodmeals respectively Tsetsedistribution varied significantly (119901 lt 005) across study sites with average trap and daily catches of 439 and 2634 respectivelyOverall tsetse infection rate was 508 and ranged between 303 and 684 across study sites We identified 10 T brucei 3T congolense savannah 2 T congolense forest and 2 mixed infections among the 13 pools made from the 27 flies positive fortrypanosomes with light microscopy The distribution of vertebrate blood meals in tsetse flies varied significantly (119901 lt 005) andranged between 60 and 45 across hosts We also observed dual feeding patterns involving at least 2 hosts in 24 and multiplefeeding involving at least 3 hosts in 17 of the flies We observed predominance of G palpalis which also recorded higher infectionrate T brucei was more prevalent among tsetse flies Tsetse flies fed predominantly on cattle and less frequently on humans andalso showed mixed feeding habits

1 Introduction

Tsetse flies are large biting and blood-feeding flies of greateconomic veterinary and medical importance due to theirability to transmit African animal and human trypanoso-moses Tsetse-transmitted trypanosomoses occur in 38 sub-Saharan African countries with averages of 15000 humancases and one million cattle deaths reported yearly exposingover 70 million people and 160 million cattle to the riskof infection in the region [1] These vectors are distributedover wide range of habitats covering about 10 million squarekilometers of potential grazing and farming lands in sub-Saharan Africa [2]

Tsetse abundance and feeding behaviours determine thedegree of vector-host contact and may have a serious impacton the risk of pathogen transmission The degree of contactsbetween vectors and vertebrate hosts is an important deter-minant of their vectoral capacity and is determined by thevector feeding patterns on its hosts As vectors of human and

animal trypanosomoses the epidemiology of these diseases isdetermined largely by their abundance density and feedingbehaviours [3]

The importance of vector feeding patterns in the epidemi-ology of diseases has been recognized for quite a long timeHowever majority of the traditional approaches used earlierwere serologically based and included haemagglutinationcrystallization agglutination reactions passive haemaggluti-nation test immunohistochemical methods [4 5] precipitintest [6 7] and enzyme linked immunosorbent assay [8ndash10]Despite the level of successes achieved by these traditionalapproaches limitations ranging between high percentage offalse positives low sensitivity species cross infectivity theneed for producing specific antibodies to several species andthe inability to discover unpredicted hosts were reported [11]

The development of molecular based techniques for theidentification of vertebrate host blood meals provides moreconvenient approaches and has already been employed inthe detection of host blood meals in several arthropod

Hindawi Publishing CorporationJournal of Parasitology ResearchVolume 2016 Article ID 1591037 6 pageshttpdxdoiorg10115520161591037

2 Journal of Parasitology Research

Table 1 Primer names and sequences for the amplification of mitochondrial cytochrome b in tsetse blood meals [16]

Host Primer Sequence 51015840-31015840 119879119898

Amplicon sizeHuman Human741-F GGCTTACTTCTCTTCATTCTCTCCT 6608 334Dog Dog368F GGAATTGTACTATTATTCGCAACCAT 6230 680Cattle Cow121-F CATCGGCACAAATTTAGTCG 5835 561Pig Pig573-F TTAGTCGCCTCGCAGCCGTA 6448 453Universal reverse UNREV1025 GGTTGTCCTCCAATTCATGTTA 5895 mdash

vectors including tsetse flies [12] ticks [13 14] triatominebugs [15] and mosquitoes [16 17] In order to understandthe epidemiology of trypanosomosis in the Gashaka-GumtiNational Park in Nigeria we trapped and studied the feedingpatterns of tsetse flies using the mitochondrial cytochrome bPCR and xenomonitored trypanosomes in tsetse flies usingITS PCR

2 Materials and Methods

21 Study Area The study was carried out in Gashaka-GumtiNational Park which is located in Taraba State NortheasternNigeria between latitudes 6∘551015840 and 6∘171015840N and longitudes11∘131015840 and 11∘211015840E It is the largest national park in Nigeriacovering 6402 km2 and consisting of both savannah grasslandand montane forest vegetation Altitude ranges from 457meters (1499 ft) to 2419 meters (7936 ft) It is an importantwater catchment area for the Benue River with abundant riverflow even during the markedly dry season Enclaves for localFulani pastoralists exist within the parkrsquos boundary allowingfor farming and grazing The reserve also contains a widerange of wild fauna of over 103 different species [18] Themajor occupation of the inhabitant is agriculture

22 Study Design We conducted a cross-sectional study infour randomly selected villages (Burto Gindin Dutse Gojeand Serti) located at least 5ndash10 km apart around the Gashakacommunity taking cognisance of their relationship with theGashaka-Gumti National Park which is a tourist centre Weidentified forested and riverine areas where 6 traps weremounted 100 meters apart two times weekly for four monthsin each of the four villages

23 Tsetse Trapping Identification andDissection Tsetse flieswere trapped by the use of biconical traps as described byCharllier and Laveissiere [19] Six traps were mounted 100meters apart along streams twice every week between Julyand October 2014 Traps were emptied every 24 hours andthe flies were identified using morphological characteristicsas described by Murray et al [20] Following identificationa proportion of the collected tsetse flies were dissectedusing dissection microscope to check for vector stages oftrypanosomes on the field while the most engorged wereselected for bloodmeal identification Flies that were positivefollowing dissection and the engorged were all preserved atminus80∘C until needed for PCR

24 DNA Extractions Blood meal DNA extraction was doneusing the modified salt procedure earlier described by Norris

et al [21] Tsetse abdomen was detached from the thoraxand head and homogenized in 100 120583L of extraction buffercontaining 01MNaCl 02M sucrose 01M Tris-HCl 005MEDTA pH 91 and 05 sodium dodecyl sulfate (SDS) andincubated at 65∘C for one hour Extracted DNA was thenstored at minus20∘C until needed for polymerase chain reaction

Trypanosome DNA was extracted using GeneJETgenomic DNA extraction kit (Thermo Scientific Germany)Midguts of positive tsetse flies were pooled together in twosand homogenized and 200120583L of the homogenate was lysedby adding 400 120583L of lyses solution and 20120583L of proteinase Kas recommended by the manufacturer Extracted DNA wasstored at minus20∘C until needed for PCR

25 PCR Identification of Blood Meals We conducted multi-plex PCR with four forward primers and a universal reverseprimer to identify mitochondrial cytochrome b of vertebratehosts in blood meals of tsetse flies (Table 1) Cycling condi-tions were as follows denaturation at 98∘C for 10 seconds toactivate the phusion flash II DNA polymerase followed by36 cycles at 98∘C for 1 second annealing for 50 seconds attemperatures of 585∘C 595∘C 620∘C and 625∘C for cattledog pig and human primers respectively Extension was at72∘C for 40 seconds and final extension at 72∘C for 5 minutesaccording to the manufacturersrsquo instructions All amplifiedproducts were analyzed by electrophoresis in a 2 agarose geland UV illumination after ethidium bromide staining

26 PCR Identification of Trypanosomes ITS-1 PCRwas usedto identify the species of trypanosomes in the tsetse flies usingprimer sets with the sequences 51015840-CCGGAAGTTCACCGA-TATTG-31015840 (forward) and 51015840-TTGCTGCGTTCTTCAACG-AA-31015840 (reverse) designed by [22] PCR conditions were asfollows an initial denaturation step for 10 seconds at 98∘C toactivate the phusion flash II DNA polymerase four cycles ofamplification with 1-second denaturation at 98∘C 5-secondhybridization at 58∘C and 15-second elongation steps at72∘C eight cycles of amplificationwith 1-second denaturationat 98∘C 5-second hybridization at 56∘C and 15-secondelongation steps at 72∘C 23 cycles of amplification with 1-second denaturation at 98∘C 5-second hybridization at 54∘Cand 15-second elongation steps at 72∘C and a final extensionstep of 5 minutes at 72∘C as described by the manufacturer

27 Data Analysis Data collated were analyzed using Graph-Pad Prism 40 Infection rates were calculated by dividingthe number of infected tsetse flies by the total number offlieswe dissected and expressed as percentages Average tsetsecatch per day was determined by summing the daily catch

Journal of Parasitology Research 3

Table 2 Tsetse density and light microscopy infection rates in relation to study sites

Study sites Total catch Average catchtrap Average catchday Total dissected Number infected Infection rate ()Burto 142 099 594 117 8 684Gindin Dutse 111 078 468 86 4 465Goje 91 063 378 66 2 303Serti 287 199 1194 262 13 496Total 631 439 2634 531 27 508

Table 3 Tsetse infection rates in relation to Trypanosoma species identified

Tsetse species Total catch Number dissected Number infected Number of pools T brucei () T congolense () Mixed infectionsG palpalis 408 (647) 347 (653) 19 (55) 9 5 (556) 2 (222) 2 (222)G tachinoides 223 (353) 184 (347) 8 (43) 4 3 (750) 1 (250) 0 (00)Total 631 (100) 531 (100) 27 (51) 13 8 (615) 3 (231) 2 (154)1205942 mdash mdash 03168 mdash 04424 00120 10510119901 value mdash mdash 05735 mdash 05060 09126 03054

Table 4 Distribution of Trypanosoma species in relation to study sites

Study sites Number of tsetse infected Number of pools T brucei T congolenseBurto 8 4 3 1Gindin Dutse 4 2 2 1Goje 2 1 1 1Serti 13 6 4 2Total 27 13 10 5

per week and dividing by the number of days traps weremounted for the week while average catch per trap wasdetermined by summing daily catch and dividing by thenumber of traps We employ the Chi square (1205942) and Fishersexact test where appropriate to determine variations ininfection rates and the distribution of Trypanosoma speciesThe Analysis of Variance (ANOVA) was also employed todetermine variations in the distribution of mammalian bloodin tsetse blood meals and values of 119901 lt 005 were consideredsignificant

3 ResultA total of 631 tsetse flies were captured with average trap anddaily catches of 439 and 2634 respectively We dissected531 (842) of the flies to check for the vector stages oftrypanosomes while the remaining 100 (158) were analyzedfor vertebrate sources of tsetse blood meals Overall tsetseinfection rate was 508 while those in relation to study siteswere 684 465 303 and 496 for Burto GindinDutse(GDutse) Goje and Serti respectively (Table 2)

Of the 2 species of tsetse flies captured 408 (647)were Glossina palpalis while 223 (353) were G tachinoidesTsetse infection rates of 55 (19347) and 43 (8184)were revealed by G palpalis and G tachinoides respectively(Table 3) The 27 tsetse flies positive for trypanosomes usinglight microscopy were distributed into 12 pools of two flieseach and a pool of three flies yielding 13 pools whichwere subjected to the ITS PCR We identified Trypanosomabrucei in 10 Trypanosoma congolense savannah in 3 and

Trypanosoma congolense forest in 2 of the pools Two of thepools revealed mixed infections of Trypanosoma brucei andTrypanosoma congolense (Table 4)

Of the 100 engorged tsetse flies subjected to themitochon-drial cytochrome b PCR to identify sources of tsetse bloodmeals 45 17 6 and 32 fed on cattle dog man and pigrespectively (Table 5) In addition 24 of the flies fed on atleast 2 vertebrate hosts 17 fed on at least 3 vertebrate hostsand 1 5 22 and 31of the flies fed onman dog pig andcattle respectively (Table 5) The distribution of dual feedingamong the 24 tsetse flies that fed on at least 2 vertebrate hostswas 15 7 20 and 24 for flies that fed on cattle-dogcattle-man cattle-pig and dog-pig respectively Of the 17tsetse flies that fed on at least 3 vertebrate hosts 27 5 and2 fed on cattle-dog-pig cattle-man-pig and dog-man-pigrespectively (Figure 1)

4 DiscussionThespecies of tsetse flies we reported in our studywere earlierreported in the same region by Karshima et al [23] andin other parts of Nigeria [24 25] and were among the firsteleven species of tsetse flies reported in Nigeria [26]Glossinapalpaliswas predominantly higher than G tachinoides in linewith earlier reports [25 27 28] Glossina palpalis usually haspreference for thick forested areas with high temperaturesand humidity for efficient breeding Considering the site westudied which has similar kind of vegetation we presume thatthe vegetation may be a reason for the predominance of thisspecies of tsetse fly


Table 5 Distribution of mammalian blood in tsetse blood meals

Study sites Number of tsetse analyzed Cattle () Dog () Man () Pig () Dual feeding () Multiple feeding ()Burto 25 13 (520) 6 (240) 0 (00) 6 (240) 6 (240) 7 (280)GDutse 25 12 (480) 4 (160) 2 (80) 7 (280) 2 (80) 2 (80)Goje 25 6 (240) 5 (200) 3 (120) 11 (440) 4 (160) 3 (120)Serti 25 14 (560) 2 (80) 1 (40) 8 (320) 12 (480) 5 (200)Total 100 45 (450) 17 (170) 6 (60) 32 (320) 24 (240) 17 (170)

C + D 6

C + M 3

C + P 8

D + P 10

C + D + P 11

C + M + P 2 D + M + P 1

Figure 1 Distribution ofmammalian blood in tsetse flies that fed onat least 2 hosts [C + D (cattle and dog mixed blood) C + M (cattleand man mixed blood) C + P (cattle and pig mixed blood) D + P(dog and pig mixed blood) C + D + P (cattle dog and pig mixedblood) C + M + P (cattle man and pig mixed blood) and D +M +P (dog man and pig mixed blood)]

We observed an overall average daily tsetse catch pertrap of 439 which falls within the range of 061ndash81 reportedby other workers [29ndash31] We expected a higher averagedaily catch considering the game reserve terrain in whichwe conducted our study and reports that confirm tsetseabundance during the rainy season [31] We attributed oursize of catch to the consecutive rainfall we observed duringthe trapping as tsetse activities are grossly reduced during rainand cold weather

The location of Gashaka-Gumti National Park in Sertiand its close proximity to Burto may explain the higher tsetsecatch we recorded in these two areas considering the factthat the park may serve as suitable habitat for tsetse flies andprovide sources of blood meals for these flies This may alsoexplain the higher infection rates in these two areas especiallywith the expected increased tsetse animal contact with over103 wildlife species and livestock grazing in the area [18]The mixed infections of T brucei and T congolense observedmay be due to tsetse acquiring the infection from animalscarrying the mixed infection in nature from two differentanimal sources during feeding or even from the pools wemade in our study

Tsetse flies that were positive for trypanosomes by the useof light microscopy were pooled together before being sub-jected to PCR to increase the quantity of DNA in the samples

and thus increase the chances of PCR detectionThe 2 speciesof trypanosomes identified in tsetse flies are not reportedfor the first time in this region suggesting that they areendemic Of the Trypanosoma species identified T bruceiwasmost prevalent among tsetse flies indicating that they maybe the commonest species infective to the domestic animalsand wildlife species in the region as earlier documented [2332 33] Majority of trypanosome infections were observedamong Glossina palpalis contrary to earlier reports by Destaet al [31]This variationmay not be unconnected with factorssuch as differences in tsetse feeding frequencies feedingpatterns and vectoral capacity

The feeding pattern of tsetse vector is an importantinstrument in understanding the epidemiology of humanand animal trypanosomoses [3] In our study we detachedengorged tsetse abdomens from the thorax and head beforePCR to reduce contamination of blood meal DNA by tsetseDNA Selection of only engorged tsetse flies for the identifica-tion of host blood meals was to ensure the availability of hostDNA in the bloodmeals since tsetse digestion of bloodmealswhich usually occurs few days after ingestion may denaturehostDNAand impair its detection [16]We also included onlyfour species of vertebrate hosts in our assay because they werethe commonest animals in the region where this work wasconducted

Tsetse feeding preference for cattle based on cattle sizehas been reported by Torr et al [34] Of all the vertebratehosts included in our assay cattle were the largest and thismay explain why majority of the tsetse flies fed on themTheinfluence of host availability on tsetse feeding habits has alsobeen documented [35] This may also be a probable reasonfor the large proportion of pig blood identified by our studyHunting dogs would have contributed to the number of tsetseflies that fed on dogs while activities like hunting fishingfarming and visit to rivers and streams would have exposedhumans to the tsetse bites amounting to the number of tsetsethat fed on humans

Of particular concern are the dual and multiple feedingpatterns involving more than one species of vertebrate hostsbecause this may be of great epidemiological importance inthe area of spreading tsetse-borne infections between differ-ent vertebrate hosts includingman in the region Consideringthe proximity of this game reserve with the Fonten sleepingsickness focus of the Republic of Cameroon there is the riskof trans-boundary tsetse flies acquiring Trypanosoma bruceigambiense and spreading the infection among humans andanimal reservoirs in the region

We concluded that Glossina palpalis is predominant andhad higher infection rates Trypanosoma brucei was more


prevalent among tsetse flies Tsetse flies fed predominantly oncattle and less frequently on humans and also showed mixedfeeding habits The risk of tsetse flies transmitting tsetse-borne infection between humans and other vertebrate hostsexists in the region

Conflict of Interests

There is no conflict of interests regarding the publication ofthis paper

References

[1] OIE ldquoStandardized techniques for the diagnosis of tsetsetransmitted trypanosomiasisrdquo in OIE Terrestrial Manual p 49OIE Rome Italy 2008

[2] F A S Kuzoe ldquoCurrent situation of African trypanosomiasisrdquoActa Tropica vol 54 no 3-4 pp 153ndash162 1993

[3] E Ducheyne C Mweempwa C De Pus et al ldquoThe impact ofhabitat fragmentation on tsetse abundance on the plateau ofeastern Zambiardquo Preventive Veterinary Medicine vol 91 no 1pp 11ndash18 2009

[4] L AM Gomes R Duarte D C Lima B S DinizM L Serraoand N Labarthe ldquoComparison between precipitin and ELISAtests in the bloodmeal detection ofAedes aegypti (Linnaeus) andAedes fluviatilis (Lutz) mosquitoes experimentally fed on felinecanine and human hostsrdquoMemorias do Instituto Oswaldo Cruzvol 96 no 5 pp 693ndash695 2001

[5] J M Mwangangi C M Mbogo J G Nzovu J I GithureG Yan and J C Beier ldquoBlood-meal analysis for anophelinemosquitoes sampled along the Kenyan coastrdquo Journal of theAmerican Mosquito Control Association vol 19 no 4 pp 371ndash375 2003

[6] M M D S Afonso A C Gomes C R V Meneses andE F Rangel ldquoStudies on the feeding habits of Lutzomyia(N) intermedia (Diptera Psychodidae) vector of cutaneousleishmaniasis in Brazilrdquo Cadernos de Saude Publica vol 21 no6 pp 1816ndash1820 2005

[7] R S Fonteles G C e Vasconcelos P C B Azevedo et alldquoBlood feeding preference of Lutzomyia whitmani (DipteraPsychodidae) in a transmission area for American cutaneousleishmaniasis in the State of Maranhao Brazilrdquo Revista daSociedade Brasileira deMedicina Tropical vol 42 no 6 pp 647ndash650 2009

[8] E Rossi G Bongiorno E Ciolli et al ldquoSeasonal phenologyhost-blood feeding preferences and natural Leishmania infec-tion of Phlebotomus perniciosus (Diptera Psychodidae) in ahigh-endemic focus of canine leishmaniasis in Rome provinceItalyrdquo Acta Tropica vol 105 no 2 pp 158ndash165 2008

[9] M M dos Santos Afonso R Duarte J C Miranda L Caranhaand E F Rangel ldquoStudies on the feeding habits of Lutzomyia(Lutzomyia) longipalpis (Lutz amp Neiva 1912) (Diptera Psy-chodidae Phlebotominae) populations from endemic areasof American visceral leishmaniasis in North-eastern BrazilrdquoJournal of Tropical Medicine vol 2012 Article ID 858657 5pages 2012

[10] A M Marassa E A B Galati D P Bergamaschi and CA Consales ldquoBlood feeding patterns of Nyssomyia intermediaand Nyssomyia neivai (Diptera Psychodidae) in a cutaneousleishmaniasis endemic area of the Ribeira Valley State of Sao

Paulo Brazilrdquo Revista da Sociedade Brasileira de MedicinaTropical vol 46 no 5 pp 547ndash554 2013

[11] K G da Silva Sales P L Costa R C S de Morais et alldquoIdentification of phlebotomine sand fly blood meals by real-time PCRrdquo Parasites amp Vectors vol 8 no 1 article 230 2015

[12] S Steuber A Abdel-Rady and P-H Clausen ldquoPCR-RFLPanalysis a promising technique for host species identificationof blood meals from tsetse flies (Diptera Glossinidae)rdquo Para-sitology Research vol 97 no 3 pp 247ndash254 2005

[13] A Estrada-Pena J J Osacar B Pichon and J S Gray ldquoHostsand pathogen detection for immature stages of Ixodes ricinus(Acari Ixodidae) in North-Central Spainrdquo Experimental andApplied Acarology vol 37 no 3-4 pp 257ndash268 2005

[14] B Pichon D Egan M Rogers and J Gray ldquoDetection andidentification of pathogens and host DNA in unfed host-seeking Ixodes ricinus L (Acari Ixodidae)rdquo Journal of MedicalEntomology vol 40 no 5 pp 723ndash731 2003

[15] M-F Bosseno L S Garcıa F Baunaure et al ldquoShort reportidentification in triatomine vectors of feeding sources andTrypanosoma cruzi variants by heteroduplex assay and a mul-tiplex miniexon polymerase chain reactionrdquo American Journalof Tropical Medicine and Hygiene vol 74 no 2 pp 303ndash3052006

[16] R J Kent and D E Norris ldquoIdentification of mammalianblood meals in mosquitoes by a multiplexed polymerase chainreaction targeting cytochrome Brdquo American Journal of TropicalMedicine and Hygiene vol 73 no 2 pp 336ndash342 2005

[17] R J Kent M Coetzee S Mharakurwa and D E Norris ldquoFeed-ing and indoor resting behaviour of the mosquito Anopheleslongipalpis in an area of hyperendemic malaria transmission insouthern ZambiardquoMedical and Veterinary Entomology vol 20no 4 pp 459ndash463 2006

[18] H M Chapman S M Olson and D Trumm ldquoAn assessmentof changes in the montane forests of Taraba State Nigeria overthe past 30 yearsrdquo ORYX vol 38 no 3 pp 282ndash290 2004

[19] A Charllier and C Laveissiere ldquoA new trap for capturingGlossina (Diptera Muscidae) description and field trialsrdquoCahiers de IrsquoORSTOM Serie EntomologieMedicale et Parasitolo-gie vol 11 pp 251ndash262 1973

[20] MMurray J CM Trail D A Turner andYWissocq LivestockProductivity and Trypanotolerance Network Training ManualILCA Addis Abba Ethiopia 1983

[21] D E Norris A C Shurtleff Y T Toure and G C LanzakoldquoMicrosatellite DNA polymorphism and heterozygosity amongfield and laboratory populations of Anopheles gambiae ss(Diptera Culicidae)rdquo Journal ofMedical Entomology vol 38 no2 pp 336ndash340 2001

[22] Z K Njiru C C Constantine S Guya et al ldquoThe use of ITS1rDNA PCR in detecting pathogenic African trypanosomesrdquoParasitology Research vol 95 no 3 pp 186ndash192 2005

[23] N S Karshima I Ajogi G Mohammed and A I Lawal ldquoAsurvey for biting flies in three local government areas of TarabaState Nigeriardquo Sokoto Journal of Veterinary Sciences vol 9 no1 pp 36ndash38 2011

[24] A B Ahmed ldquoA peridomestic population of the tsetse flyGlossina palpalis palpalis Robineau-Desvoidy 1830 (DipteraGlossinidae) at Kontagora town Niger state Nigeriardquo Ento-mologıa y Vectores vol 11 no 4 pp 599ndash610 2004

[25] C C Ohaeri and M C Eluwa ldquoThe population structure andphysiological status of tsetse flies in Abia State Nigeriardquo Journalof Animal and Veterinary Advances vol 6 no 4 pp 513ndash5162007


[26] D A T Baldry ldquoSpecies list of the tsetse flies genus Glossina(Diptera Muscidae) in Nigeriardquo Nigerian Entomologistsrsquo Maga-zine vol 1 p 44 1967

[27] R Oluwafemi ldquoPrevalence and distribution of tsetse fly (mainlyGlossina palpalis palpalis and Glossina tachinoides) in BICOTProject area in Lafia Local Government of Nassarawa StateNigeriamdashimplication for sustainable agricultural developmentrdquoThe Internet Journal of Parasitic Diseases vol 4 no 1 pp 1ndash32008

[28] V P Alibu J C K Enyaru E Matovu et al ldquoMolecularxenomonitoring of trypanosomes in tsetse fliesrdquo Journal ofParasitology and Vector Biology vol 7 no 6 pp 108ndash114 2015

[29] J Bekele K Asmare G Abebe G Ayelet and E GelayeldquoEvaluation of Deltamethrin applications in the control oftsetse and trypanosomosis in the southern rift valley areas ofEthiopiardquo Veterinary Parasitology vol 168 no 3-4 pp 177ndash1842010

[30] T Ayele D Ephrem K Elias et al ldquoPrevalence of bovinetrypanosomosis and its vector density in Daramallo DistrictSouthWestern Ethiopiardquo Journal of Veterinary Advances vol 2no 6 pp 266ndash272 2012

[31] M Desta S Menkir and A Kebede ldquoThe study on tsetse fly(Glossina species) and their role in the trypanosome infec-tion rate in Birbir valley Baro Akobo River system westernEthiopiardquo Journal of Veterinary Medicine and Animal Healthvol 5 no 7 pp 186ndash194 2013

[32] A O Majekodunmi A Fajinmi C Dongkum K Picozzi M VThrusfield and S CWelburn ldquoA longitudinal survey of Africananimal trypanosomiasis in domestic cattle on the Jos PlateauNigeria prevalence distribution and risk factorsrdquo Parasites ampVectors vol 6 no 1 article 239 2013

[33] O G Fasanmi U P Okoroafor O C Nwufoh O M Bukola-Oladele and E S Ajibola ldquoSurvey for Trypanosoma species incattle from three farms in Iddo Local Government Area OyoStaterdquo Sokoto Journal of Veterinary Sciences vol 12 no 1 pp57ndash61 2014

[34] S J Torr A Prior P JWilson and S Schofield ldquoIs there safety innumbers The effect of cattle herding on biting risk from tsetsefliesrdquoMedical and Veterinary Entomology vol 21 no 4 pp 301ndash311 2007

[35] L F Chaves L C Harrington C L Keogh A M Nguyen andU D Kitron ldquoBlood feeding patterns of mosquitoes random orstructuredrdquo Frontiers in Zoology vol 7 article 3 2010

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Primer names and sequences for the amplification of mitochondrial cytochrome b in tsetse blood meals [16]

Host Primer Sequence 51015840-31015840 119879119898

Amplicon sizeHuman Human741-F GGCTTACTTCTCTTCATTCTCTCCT 6608 334Dog Dog368F GGAATTGTACTATTATTCGCAACCAT 6230 680Cattle Cow121-F CATCGGCACAAATTTAGTCG 5835 561Pig Pig573-F TTAGTCGCCTCGCAGCCGTA 6448 453Universal reverse UNREV1025 GGTTGTCCTCCAATTCATGTTA 5895 mdash

vectors including tsetse flies [12] ticks [13 14] triatominebugs [15] and mosquitoes [16 17] In order to understandthe epidemiology of trypanosomosis in the Gashaka-GumtiNational Park in Nigeria we trapped and studied the feedingpatterns of tsetse flies using the mitochondrial cytochrome bPCR and xenomonitored trypanosomes in tsetse flies usingITS PCR

2 Materials and Methods

21 Study Area The study was carried out in Gashaka-GumtiNational Park which is located in Taraba State NortheasternNigeria between latitudes 6∘551015840 and 6∘171015840N and longitudes11∘131015840 and 11∘211015840E It is the largest national park in Nigeriacovering 6402 km2 and consisting of both savannah grasslandand montane forest vegetation Altitude ranges from 457meters (1499 ft) to 2419 meters (7936 ft) It is an importantwater catchment area for the Benue River with abundant riverflow even during the markedly dry season Enclaves for localFulani pastoralists exist within the parkrsquos boundary allowingfor farming and grazing The reserve also contains a widerange of wild fauna of over 103 different species [18] Themajor occupation of the inhabitant is agriculture

22 Study Design We conducted a cross-sectional study infour randomly selected villages (Burto Gindin Dutse Gojeand Serti) located at least 5ndash10 km apart around the Gashakacommunity taking cognisance of their relationship with theGashaka-Gumti National Park which is a tourist centre Weidentified forested and riverine areas where 6 traps weremounted 100 meters apart two times weekly for four monthsin each of the four villages

23 Tsetse Trapping Identification andDissection Tsetse flieswere trapped by the use of biconical traps as described byCharllier and Laveissiere [19] Six traps were mounted 100meters apart along streams twice every week between Julyand October 2014 Traps were emptied every 24 hours andthe flies were identified using morphological characteristicsas described by Murray et al [20] Following identificationa proportion of the collected tsetse flies were dissectedusing dissection microscope to check for vector stages oftrypanosomes on the field while the most engorged wereselected for bloodmeal identification Flies that were positivefollowing dissection and the engorged were all preserved atminus80∘C until needed for PCR

24 DNA Extractions Blood meal DNA extraction was doneusing the modified salt procedure earlier described by Norris

et al [21] Tsetse abdomen was detached from the thoraxand head and homogenized in 100 120583L of extraction buffercontaining 01MNaCl 02M sucrose 01M Tris-HCl 005MEDTA pH 91 and 05 sodium dodecyl sulfate (SDS) andincubated at 65∘C for one hour Extracted DNA was thenstored at minus20∘C until needed for polymerase chain reaction

Trypanosome DNA was extracted using GeneJETgenomic DNA extraction kit (Thermo Scientific Germany)Midguts of positive tsetse flies were pooled together in twosand homogenized and 200120583L of the homogenate was lysedby adding 400 120583L of lyses solution and 20120583L of proteinase Kas recommended by the manufacturer Extracted DNA wasstored at minus20∘C until needed for PCR

25 PCR Identification of Blood Meals We conducted multi-plex PCR with four forward primers and a universal reverseprimer to identify mitochondrial cytochrome b of vertebratehosts in blood meals of tsetse flies (Table 1) Cycling condi-tions were as follows denaturation at 98∘C for 10 seconds toactivate the phusion flash II DNA polymerase followed by36 cycles at 98∘C for 1 second annealing for 50 seconds attemperatures of 585∘C 595∘C 620∘C and 625∘C for cattledog pig and human primers respectively Extension was at72∘C for 40 seconds and final extension at 72∘C for 5 minutesaccording to the manufacturersrsquo instructions All amplifiedproducts were analyzed by electrophoresis in a 2 agarose geland UV illumination after ethidium bromide staining

26 PCR Identification of Trypanosomes ITS-1 PCRwas usedto identify the species of trypanosomes in the tsetse flies usingprimer sets with the sequences 51015840-CCGGAAGTTCACCGA-TATTG-31015840 (forward) and 51015840-TTGCTGCGTTCTTCAACG-AA-31015840 (reverse) designed by [22] PCR conditions were asfollows an initial denaturation step for 10 seconds at 98∘C toactivate the phusion flash II DNA polymerase four cycles ofamplification with 1-second denaturation at 98∘C 5-secondhybridization at 58∘C and 15-second elongation steps at72∘C eight cycles of amplificationwith 1-second denaturationat 98∘C 5-second hybridization at 56∘C and 15-secondelongation steps at 72∘C 23 cycles of amplification with 1-second denaturation at 98∘C 5-second hybridization at 54∘Cand 15-second elongation steps at 72∘C and a final extensionstep of 5 minutes at 72∘C as described by the manufacturer

27 Data Analysis Data collated were analyzed using Graph-Pad Prism 40 Infection rates were calculated by dividingthe number of infected tsetse flies by the total number offlieswe dissected and expressed as percentages Average tsetsecatch per day was determined by summing the daily catch

















C + D 6

C + M 3

C + P 8

D + P 10

C + D + P 11

C + M + P 2 D + M + P 1














References













































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

















C + D 6

C + M 3

C + P 8

D + P 10

C + D + P 11

C + M + P 2 D + M + P 1














References













































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





References













































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



















Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article feeding patterns and xenomonitoring of

Documents