research focus: searching for novel riboswitches in newly sequenced genomes

of 12 /12
Ben-Gurion University Research focus on riboswitches Bioinformatics Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes Danny Barash† Department of Computer Science Ben-Gurion University †email: [email protected] Biological Application: RNA

Author: medea

Post on 13-Feb-2016

30 views

Category:

Documents


0 download

Embed Size (px)

DESCRIPTION

Biological Application: RNAs. Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes. Danny Barash † Department of Computer Science Ben-Gurion University † email: [email protected]. Why RNAs?. Classical Picture: DNA RNA PROTEINS - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Danny Barash†

Department of Computer ScienceBen-Gurion University

†email: [email protected]

Biological Application: RNAs

Page 2: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Why RNAs? Classical Picture:

DNA RNA PROTEINS

Transcription Translation

New Picture: RNA*

DNA PROTEINSRNA* : RiboNucleic Acid

Page 3: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

“Riboswitches”: RNA genetic control elements that influence transcription termination or translation initiation by conformation rearrangement of the RNA in response to direct metabolite binding.

Since the mid-90’s, Breaker has been trying to artificially design RNA switches that respond to metabolite binding (Soukup and Breaker, Trends. Biotechnol., 1999).

In 2002, both R. Breaker’s lab (Yale) and E. Nudler’s lab (NYU medical school) discovered these RNA genetic control elements in bacteria (Winkler et al., Nature, 2002); (Mironov et al., Cell, 2002).

These RNA regulatory systems are widespreadin bacteria and are speculated to date back toearly times in evolution (perhaps belonging tothe RNA World).

What are Riboswitches?

Page 4: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Prokaryotic Transcription Termination by Riboswitches

Nudler and coworkers (Mironov et al., Cell, 2002)TPP-mediatedAttenuation

Control(TPP=thiamin

Pyrophosphate):

Terminator

Anti-terminator

TPP

Page 5: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

With TPP

Vitamin B1 biosynthesis in bacteria:

TPP-mediated attentuation control:

E. Nudler and coworkers:

(Mironov et al., Cell, 2002)

Thiamine pyrophosphate are the metabolites that alter conformation.

What are Riboswitches?

Terminator

Aptamer

Page 6: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Without TPP

What are Riboswitches?

Anti-terminator

Aptamer

Vitamin B1 biosynthesis in bacteria:

TPP-mediated attentuation control:

E. Nudler and coworkers:

(Mironov et al., Cell, 2002)

Thiamine pyrophosphate are the metabolites that alter conformation.

Page 7: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Prokaryotic TranslationInitiation by Riboswitches

Breaker and coworkers (Winkler et al., Nature, 2002)TPP-mediatedAttenuation

Control(TPP=thiamin

Pyrophosphate):

Sequestor

Anti-sequestor

TPP

Page 8: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Deleterious mutation prediction inTPP riboswitch using RNAMute

(Barash., Nucleic Acids Res., 2003)

Single point mutation

A158U

GCAGAACAATTCAATATGTATTCGTTTAA…

Predict conformationalswitching mutations

RNAMute

Page 9: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Successful Computer Predictionsof Deleterious Mutations

(Barash and Gabdank, RNA Biology, 2010): special focus review

TPP-mediatedAttenuation

Control(TPP=thiamin

Pyrophosphate):

Terminator

Anti-terminator

TPP

Page 10: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Searching for riboswitches inSearching for riboswitches ineukaryotes by their aptamereukaryotes by their aptamer

Sequence is not enough, need structure considerations!

Page 11: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

Searching for riboswitches inSearching for riboswitches ineukaryotes by their aptamereukaryotes by their aptamer

(Cohen et al., In Silico Biology, 2008) – a riboswitch in plants?

Our 3-stem junction candidate in plants

Known consensusin bacteria

Page 12: Research Focus: Searching for Novel Riboswitches in Newly Sequenced Genomes

Ben-Gurion University

Research focus on riboswitches Bioinformatics

III. “Evolution Canyon”: Analyzing Bacillus Subtilis Strains to Examine How Riboswitches Adapt to Extreme Environments.

Riboswitches in Evolution Canyon