Restriction Enzyme Digestion & Restriction Enzyme Digestion & Southern Blotting Southern Blotting

of DNAof DNA

Experiment GoalsExperiment Goals

Digestion of DNA by restriction enzymeDigestion of DNA by restriction enzyme

Analyze digested DNA by electrophoresisAnalyze digested DNA by electrophoresis

Transfer digested DNA to nitrocellulose Transfer digested DNA to nitrocellulose filters (Southern blotting)filters (Southern blotting)– Procedure of setting up a Southern blottingProcedure of setting up a Southern blotting

Restriction EnzymesRestriction Enzymes

Definition: • A restriction enzyme (or restriction endonuclease) is

an enzyme that cuts double-stranded DNA at specific sites that it recognizes.

• The enzyme makes two incisions, one through each of the sugar-phosphate backbones (i.e., each strand) of the double helix without damaging the nitrogenous bases.

The enzyme EcoRI cutting DNA at its recognition sequence

• Different restriction enzymes have different recognition sequences.

• This makes it possible to create a wide variety of different gene fragments.

Restriction enzyme

Function of Restriction Enzymes in Function of Restriction Enzymes in microorganismsmicroorganisms

Provide microorganisms with resistance to Provide microorganisms with resistance to invading organisms or foreign DNA.invading organisms or foreign DNA.Endonucleases in bacterial cells resist infections Endonucleases in bacterial cells resist infections by viruses, by destroying foreign DNA by viruses, by destroying foreign DNA molecules.molecules.

consist of a related pair of enzymesconsist of a related pair of enzymes

– Endonuclease – cuts foreign DNAEndonuclease – cuts foreign DNA

– Methylase – protects host DNAMethylase – protects host DNA

Methylase EnzymesMethylase Enzymes

Restriction enzymes usually occur in combination with Restriction enzymes usually occur in combination with one or two modification enzymes (DNA-one or two modification enzymes (DNA-methyltransferases) methyltransferases) Protect the cell’s own DNA from cleavage by the Protect the cell’s own DNA from cleavage by the restriction enzyme. restriction enzyme. Modification enzymes recognize the same DNA Modification enzymes recognize the same DNA sequence as the restriction enzyme that they sequence as the restriction enzyme that they accompany, accompany, Instead of cleaving the sequence, they methylate one of Instead of cleaving the sequence, they methylate one of the bases in each of the DNA strands. the bases in each of the DNA strands. The methyl groups protrude into the major groove of The methyl groups protrude into the major groove of DNA at the binding site and prevent the restriction DNA at the binding site and prevent the restriction enzyme from acting upon it. enzyme from acting upon it.

NamingNaming

Restriction enzymes are named based on Restriction enzymes are named based on the bacteria in which they are isolated in the bacteria in which they are isolated in the following manner: example “the following manner: example “EcoRIEcoRI””

EE EEscherichia scherichia (genus)(genus)

coco ccoli oli (species)(species)

R R RRY13(strain)Y13(strain)

I I First identified Order First identified Order

Restriction EnzymeRestriction Enzyme

There are hundreds of different REs from There are hundreds of different REs from different microorganismsdifferent microorganisms

Each RE cuts DNA at a specific “recognition Each RE cuts DNA at a specific “recognition sequence” of nucleotides. sequence” of nucleotides. Examples:Examples:

EcoRI-- GAATTC; EcoRI-- GAATTC; AluI -- AGCTAluI -- AGCT

Each recognizes its Each recognizes its specific “recognition sequence” specific “recognition sequence” and cuts both and cuts both strands of DNA wherever that sequence is found, strands of DNA wherever that sequence is found, but nowhere else. but nowhere else.

Restriction Enzyme UsesRestriction Enzyme Uses

Recombinant DNA technologyRecombinant DNA technology

CloningCloning– Replicates a sequence inserted into a host Replicates a sequence inserted into a host

cellcell

DNA restriction mappingDNA restriction mapping– A rough map of a DNA fragmentA rough map of a DNA fragment

DNA fingerprintsDNA fingerprints

Types of Restriction EnzymesTypes of Restriction Enzymes

Restriction enzymes are traditionally Restriction enzymes are traditionally classified into three types on the basis ofclassified into three types on the basis of

– subunit composition, subunit composition, – cleavage position, cleavage position, – sequence-specificity sequence-specificity – and cofactor-requirements and cofactor-requirements

Types of Restriction EnzymesTypes of Restriction EnzymesType I - Recognize specific sequences and cut Type I - Recognize specific sequences and cut DNA at a nonspecific site > than 1,000 bp awayDNA at a nonspecific site > than 1,000 bp away

Type II - Recognize palindromic sequences and Type II - Recognize palindromic sequences and cut within the palindromecut within the palindrome

Type III - Recognize specific 5-7 bp sequences Type III - Recognize specific 5-7 bp sequences and cut 24-27 bp down stream of the site.and cut 24-27 bp down stream of the site.

Type II restriction enzymes are the most useful Type II restriction enzymes are the most useful class as they recognize specific palindomic class as they recognize specific palindomic sequences in DNA and cut the sugar phosphate sequences in DNA and cut the sugar phosphate backbone within the palindromebackbone within the palindrome

Restriction Enzymes and DNA fragmentsRestriction Enzymes and DNA fragments

A restriction enzyme functions by "A restriction enzyme functions by "scanningscanning" the length " the length of a DNA molecule. of a DNA molecule.

Once it encounters its particular specific recognition Once it encounters its particular specific recognition sequence, sequence, – it will bind to the DNA molecule it will bind to the DNA molecule

– and makes one cut in each of the two sugar-phosphate and makes one cut in each of the two sugar-phosphate backbones of the double helix. backbones of the double helix.

Endonucleases and DNA fragmentsEndonucleases and DNA fragments

Blunt endsBlunt ends

Sticky endsSticky ends

Unit Determination AssayUnit Determination Assay

One unit of restriction endonuclease is One unit of restriction endonuclease is defined as the amount of enzyme required defined as the amount of enzyme required to digest one microgram of the appropriate to digest one microgram of the appropriate substrate DNA completely in 60 minutes substrate DNA completely in 60 minutes under the conditions specified for that under the conditions specified for that enzyme. enzyme.

Set up of a restriction enzyme Set up of a restriction enzyme reactionreaction

A RE reaction contains the DNA to be A RE reaction contains the DNA to be analyzed,analyzed,

A restriction enzyme, A restriction enzyme,

A restriction enzyme buffer mix. A restriction enzyme buffer mix. – contains a buffering agent to maintain contains a buffering agent to maintain

constant pH, constant pH, – and Mg++ (from MgCl2) as a necessary and Mg++ (from MgCl2) as a necessary

cofactor for enzyme activity.cofactor for enzyme activity.

HinfI Restriction EnzymeHinfI Restriction Enzyme

Recognition Site:Recognition Site:

Electrophoresis of Genomic DNA

Odd numbered lanes contain undigested genomic DNA

Even numbered lanes contain digested genomic DNA

Southern BlottingSouthern Blotting

Southern BlottingSouthern Blotting

The technique was developed by The technique was developed by E.M. Southern in 1975.E.M. Southern in 1975.

What Is Southern Blotting?What Is Southern Blotting?

A technique used in molecular biology A technique used in molecular biology to check for the presence of a to check for the presence of a particular particular DNA sequence in a DNA sample. DNA sequence in a DNA sample.

Southern BlotSouthern Blot

The Southern Blot takes advantage of the fact that The Southern Blot takes advantage of the fact that DNA fragments will stick to a nylon or nitrocellulose DNA fragments will stick to a nylon or nitrocellulose membrane. membrane. The membrane is laid on top of the agarose gel and The membrane is laid on top of the agarose gel and absorbent material (e.g. paper towels or a sponge) absorbent material (e.g. paper towels or a sponge) is placed on top. is placed on top. With time, the DNA fragments will travel from the gel With time, the DNA fragments will travel from the gel to the membrane by capillary action as surrounding to the membrane by capillary action as surrounding liquid is drawn up to the absorbent material on top. liquid is drawn up to the absorbent material on top. The membrane is now a mirror image of the The membrane is now a mirror image of the agarose gel.agarose gel.

Uses of Southern Blotting Uses of Southern Blotting

Identify mutations, deletions, and gene Identify mutations, deletions, and gene rearrangementsrearrangements

Used in prognosis of cancer and in prenatal Used in prognosis of cancer and in prenatal diagnosis of genetic diseasesdiagnosis of genetic diseases

diagnosis of Leukemiasdiagnosis of Leukemias

detect variations in gene structuredetect variations in gene structure

identify homologous genes among different identify homologous genes among different speciesspecies

Performing Southern BlottingPerforming Southern Blotting

1.1. DNA DigestionDNA Digestion with an appropriate restriction with an appropriate restriction enzyme. enzyme.

2.2. Gel ElectrophoresisGel Electrophoresis run the digest on an run the digest on an agarose gel. agarose gel.

3.3. Denature the DNADenature the DNA (usually while it is still on the (usually while it is still on the gel).gel).

4.4. Transfer the denatured DNA to the membrane Transfer the denatured DNA to the membrane (blotting)(blotting)

5.5. Preparing the probePreparing the probe6.6. HybridizationHybridization Probe the membrane with Probe the membrane with

labeled ssDNA.labeled ssDNA.7.7. DetectionDetection VisualizeVisualize your radioactively labeled your radioactively labeled

target sequence.target sequence.

1- DNA Digestion1- DNA Digestion

Cut the DNA into different sized Cut the DNA into different sized pieces.pieces.HinfI restriction enzyme is usedHinfI restriction enzyme is used

2- Gel Electrophoresis2- Gel Electrophoresis

Sorts the DNA pieces by sizeSorts the DNA pieces by size

Agarose or polyacrimideAgarose or polyacrimide

Electrophoresis of Genomic DNA

Odd numbered lanes contain undigested genomic DNA

Even numbered lanes contain digested genomic DNA

3- Denature the DNA3- Denature the DNA

DNA is then denatured with an alkaline DNA is then denatured with an alkaline solution such as NAOH.solution such as NAOH.

This causes the double stranded to This causes the double stranded to become single-stranded.become single-stranded.

4- Blotting4- Blotting

Transfer the DNA from the gel to a Transfer the DNA from the gel to a solid support.solid support.

The blot is usually done on a sheet of The blot is usually done on a sheet of nitrocellulose paper or nylon.nitrocellulose paper or nylon.Transferred by either electrophoresis or Transferred by either electrophoresis or capillary blotting.capillary blotting.

4- Blotting4- Blotting1) Electrophoresis- takes advantage of the 1) Electrophoresis- takes advantage of the

molecules negative charge.molecules negative charge.

4- Blotting4- Blotting

2) Capillary blotting-fragments are eluted from the gel and 2) Capillary blotting-fragments are eluted from the gel and deposited onto the membrane by buffer that is drawn deposited onto the membrane by buffer that is drawn

through the gel by capillary actionthrough the gel by capillary action..

Buffer

Wick (filter paper) Filter paper

Agar gel with DNA

Membrane

Weight

Paper towel stack

4- 4- Blot FixationBlot Fixation

The blot is made permanent by:The blot is made permanent by:– Drying at ~80°CDrying at ~80°C

– Exposing to UV irradiationExposing to UV irradiation

5- Preparing the probe5- Preparing the probe

It is a fragment of DNA of variable length It is a fragment of DNA of variable length (usually 100-1000 bases long), which is used to (usually 100-1000 bases long), which is used to detect in DNA the presence of nucleotide detect in DNA the presence of nucleotide sequences that are complementary to the sequences that are complementary to the sequence in the probe sequence in the probe

Must be labeled to be visualizedMust be labeled to be visualized

Usually prepared by making a radioactive copy Usually prepared by making a radioactive copy of a DNA fragment. Probing is often done with of a DNA fragment. Probing is often done with 3232P labeled ATP, biotin/streptavidin or a P labeled ATP, biotin/streptavidin or a bioluminescent probe. bioluminescent probe.

6- Hybridization6- Hybridization

Hybridization-process of forming a double-Hybridization-process of forming a double-stranded DNA molecule between a single-stranded DNA molecule between a single-stranded DNA probe and a single-stranded stranded DNA probe and a single-stranded target patient DNA.target patient DNA.

6- Hybridization6- Hybridization

Steps for hybridizationSteps for hybridization1. The labeled probe is added to the matrix incubated 1. The labeled probe is added to the matrix incubated

for several hours to allow the probe molecules to for several hours to allow the probe molecules to find their targetsfind their targets

2. Any unbound probes are then removed.2. Any unbound probes are then removed.

3. The place where the probe is connected 3. The place where the probe is connected corresponds to the location of the immobilized corresponds to the location of the immobilized

target moleculetarget molecule..

probesprobes

3’ – *ATCTCGGGAATC – 5’add probe

5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’ * ATCTCGGGAATC

hybridization

7- Detection7- Detection

Visualize your labeled target sequence.Visualize your labeled target sequence.

If radiolabeled If radiolabeled 3232P probe is used, then you P probe is used, then you would visualize by autoradiography.would visualize by autoradiography. Biotin/streptavidin detection is done by Biotin/streptavidin detection is done by colorimetric methods, colorimetric methods, and bioluminescent visualization uses and bioluminescent visualization uses luminescence. luminescence.

Steps in Southern BlottingSteps in Southern Blotting

Denaturation of patient’s DNA in gel

Fragments ofDNA appearas a smear

cassettefilter filter

DNA extraction

DNA digestion

Gel electrophoresis

Blot dismantled

Hybridisation:Stringency washes

Autoradiography

Disease gene

Gel inNaOHSouthern blot

Radioactive probeadded to filter

Nylon filter

Paper towels

Gel10x SSC

Chromatographypaper support

X ray film

Southern Blot of same DNA (final result on x-ray film)

Southern Blotting AnimationSouthern Blotting Animation