reversion rate and mrna transcript level studies of the

University of Montana University of Montana

ScholarWorks at University of Montana ScholarWorks at University of Montana

Graduate Student Theses, Dissertations, & Professional Papers Graduate School

1998

Reversion rate and mRNA transcript level studies of the argH gene Reversion rate and mRNA transcript level studies of the argH gene

in Escherichia coli K-12 in Escherichia coli K-12

Steven J. McAllister The University of Montana

Follow this and additional works at: https://scholarworks.umt.edu/etd

Let us know how access to this document benefits you.

Recommended Citation Recommended Citation McAllister, Steven J., "Reversion rate and mRNA transcript level studies of the argH gene in Escherichia coli K-12" (1998). Graduate Student Theses, Dissertations, & Professional Papers. 6867. https://scholarworks.umt.edu/etd/6867

This Thesis is brought to you for free and open access by the Graduate School at ScholarWorks at University of Montana. It has been accepted for inclusion in Graduate Student Theses, Dissertations, & Professional Papers by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected].

https://scholarworks.umt.edu/

https://scholarworks.umt.edu/etd

https://scholarworks.umt.edu/etd

https://scholarworks.umt.edu/grad

https://scholarworks.umt.edu/etd?utm_source=scholarworks.umt.edu%2Fetd%2F6867&utm_medium=PDF&utm_campaign=PDFCoverPages

https://goo.gl/forms/s2rGfXOLzz71qgsB2

https://scholarworks.umt.edu/etd/6867?utm_source=scholarworks.umt.edu%2Fetd%2F6867&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

Maureen and MikeMANSFIELD LIBRARY

The University of IVIONTANA

Permission is granted by the author to reproduce this material in its entirety, provided that this material is used for scholarly purposes and is properly cited in published works and reports.

** Please check *'Yes" or "No" and provide signature **

Yes, I grant permission No, I do not grant permission

Author's S i g n a t u r e ^

Date

Any copying for commercial purposes or financial gain may be undertaken only with the author's explicit consent.

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

REVERSION RATE AND mRNA TRANSCRIPT LEVEL STUDIES

OF THE argH GENE IN

Escherichia coli K-I2

by

Steven J. McAllister

B.S. California State University, Northridge, 1983

presented in partial fulfillment of the requirements

for the degree of

Master of Science

The University of Montana

1998

Approved by;

Chairperson ^

Dean, Graduate School

Date


UMI Number: EP37668

All rights reserved

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed,

a note will indicate the deletion.

UMIDissertation RjMishing

UMI EP37668Published by ProQuest LLC (2013). Copyright in the Dissertation held by the Author.

Microform Edition © ProQuest LLC.All rights reserved. This work is protected against

unauthorized copying under Title 17, United States Code

ProQuestProQuest LLC.

789 East Eisenhower Parkway P.O. Box 1346

Ann Arbor, Ml 48106 - 1346


McAllister, Steven, J., M.S. December, 1998 Microbiology

Reversion Rate and mRNA Transcript Level Studies of the argH Gene in Escherichia coli K-12

Director: Barbara E Wright ^

Wright has proposed that selective gene activation directs evolution (Wright, 1997). According to this hypothesis, when some species of bacterial cells are starved the stringent response is triggered. This leads to increased levels of guanosine tetraphosphate which, in turn, leads to increased transcriptional activity for certain biosynthetic and catabolic pathways. This increased transcriptional activity causes higher mutation rates in the very genes that have been stimulated by the environment, leading to the creation o f more variation and thus more opportunities for natural selection to act in creating novel solutions to the environmental challenge.

Previous experiments have demonstrated that there is a positive correlation between reversion rates in a leuB auxotroph o f Escherichia coli K12 and ppGpp levels (Wright and Minnick, 1997) and that this correlation extends to leuB transcript levels, as well (Wright et al, submitted).

This research focused on the arginine biosynthetic pathway as a model for further study o f the Wright hypothesis. It had been previously demonstrated that for an arginine auxotroph there is a thirty-fold difference in reversion rates between relA ̂ (ppGpp^) and relA~ (ppGpp") strains (Wright, 1996). Additional reversion rate studies determined that starvation for histidine followed by starvation for arginine resulted in a twofold difference in reversion rates between the relA" ̂ and re/,4 “strains.

RNA hybridization assays were used to determine argH transcript levels during logarithmic growth and after fifteen minutes of starvation either for arginine only, histidine only, or histidine followed by arginine. For both strains, a tenfold difference in argH mRNA transcript levels was observed between logarithmic growth conditions and starvation for either arginine alone or histidine followed by arginine. There was no significant difference between logarithmic growth conditions and histidine starvation.No significant differences in argH mRNA levels the relA^ and rcM strains were detected regardless o f the growth condition. The finding that there was no difference in argH transcript levels after fifteen minutes o f arginine starvation supports a similar finding by Williams and Rogers (1987) for the argCBH operon.

11


Table of Contents

Title Page......................................................................................................................................... iAbstract........................................................................................................................................... iiTable o f Contents..........................................................................................................................iiiList o f Illustrations........................................... iv

C H A P T E R I. IN T R O D U C T IO N ....................................................................................... 1

C H A P T E R H. TH E W R IG H T H Y P O T H E SIS .........................................................................9

C H A P T E R m . THE ARG ININE M O D E L ..............................................................................20

A The Arginine B iosynthetic Pa th w a y ..............................................................................20B The argECBH Gene Cluster ...............................................................................................20C Research Pl a n ...........................................................................................................................23

C H A P T E R IV. M ATERIALS AN D M ETH O DS....................................................................25

A. M utation Ra t e s .......................................................................................................................25/. Strains..............................................................................................................................252. M edia ...............................................................................................................................253. Mutation Rate Determinations..................................................................................... 2<5

B Recom binant D N A Metho ds ...............................................................................................261. Sequencing......................................................................................................................262. Vector Construction....................................................................................................... 27

C M essenger RNA Transcript Level Determinations................................................ 34J. Collection o f mRNA....................................................................................................... 242. RNA~Biotin Probe Preparation.................................................................................... 343. argH mRNA levels......................................................................................................... 37

C H A P T E R V. R E SU L T S................................................................................................................. 39

A. M utation Rate D eterminations........................................................................................39B Sequencing ..................................................................................................................................39C ArgH MRNA Transcript Levels........................................................................................44D Su m m a ry of experimental results..................................................................................47

C H A P T E R VI. D ISC U SS IO N ......................................... 48

R E F E R E N C E S ..................................................................................................................................... 53

111


List of Illustrations

Figure 1. An algorithm for evolution proposed by Wright........................................ 11

Figure 2. Guanosine tetraphosphate levels after starvation for selected aminoacids................................................................................................................ 13

Figure 3, Reversion rates of leuB under different conditions plotted againstgeneration time and against ppGpp concentration during growth 18

Figure 4. pCAH plasmid construct.................................................................................28

Figure 5. pBAH plasmid construct.................................................................................30

Figure 6. pBAHOl plasmid construct............................................................................ 32

Figure 7. cirgH probe construct......................................................................................35

Figure 8. argH sequence indicating the location of the point mutation, the startand stop codons, and the primers used for PCR.........................................40

Figure 9. Reversion rates of an E. coli K-12 arginine auxotroph under differentstarvation conditions...................................................................................... 42

Figure 10. argH messenger RNA transcript levels under different starvationconditions........................................................................................................ 45

IV


CHAPTER I. Introduction

The controversy regarding the source o f the mutations that are so necessary for the

evolution o f biological organisms has been a long-standing one. Although the central

question o f the debate can be phrased simply — are mutations generated randomly without

regard to their potential utility or do organisms have the ability to direct them in some

manner? — a definitive answer has proven to be complex and elusive. The debate began

with the first modem proposals o f evolutionary theory in 1809 and has continued to the

present day.

Lamarck proposed the first modem theory o f evolution in 1809 (56). Although

primarily orthogenetic in nature, an important aspect o f the theory was based on the

inheritance o f acquired characters. According to Lamarck variation in organisms occurred

as a result o f the use and disuse o f body parts ("organs") as the organism interacted with

its local environment, and these variations could be inherited.

Darwin's theory, the next significant theory o f evolution, proposed in 1859

consisted o f three main points; 1) organisms produced more progeny than would survive

to reproduction, 2) there was variation in the offspring, and 3) natural selection acted to

ensure that only the fittest survived (12). According to Mayr, the source o f variation was

the weakest point in Darwin's hypothesis (44). This was because neither Darwin nor

Lamarck knew the mechanisms o f heredity or that the units o f heredity were discrete. It

was this lack o f understanding that led Darwin to invoke Lamarck’s theory o f acquired

characteristics in an attempt to account for the problem of "blending" o f characteristics

that was assumed to occur as a result o f mating. Darwin's emphasis, however, was on


natural selection as the primary evolutionary force in contrast to Lamarck's emphasis on

the environment.

Lamarck's theory was challenged by two events in the late 19th century (56).

First, the acceptance o f Mendelian genetics provided a mechanism for the transmission o f

discrete heritable characteristics thus eliminating the "blending o f characteristics" dilemma.

Second, Weismann made an important distinction between the germ plasm that carried

heritable mutations and the somatic cells, which were the cells that primarily interacted

with the environment. This separation meant that the environment, in most cases, did not

directly affect the germ line. The concept that mutations must occur randomly in the germ

line soon became the prevailing paradigm.

O f course Weismann's ideas could only be applied to sexually reproducing

metazoans with a separate germ cell line. Bacteria were still believed, however, to be

capable o f adapting in response to the environment. This was, in part, because at that time

it was unknown if bacteria had genetic mechanisms that operated on the same principles as

higher organisms.

The debate about bacteria is best framed by the bacteriophage research in the

1920's o f d'Herelle, Gratia and Burnet (15,23,4). d'Herelle and others performed

experiments that seemed to show that bacteria acquired immunity after exposure to certain

strains o f bacteriophage. Further, it appeared that immunity to increasingly virulent strains

o f the bacteriophage developed over time. d'Herelle strongly believed that bacteria

acquired resistance to bacteriophage after exposure and that this resistance could be

transferred to subsequent generations (15). On the other hand, Gratia’s and Burnet's


experiments, in which some bacteria survived exposure to bacteriophage, were interpreted

to show that bacteria possessed resistance prior to that exposure (23,4).

In the general scientific community the debate, now centered on bacteria only,

remained unresolved until the pivotal experiments o f Luria and Delbruck. In essence,

Luria and Delbruck used statistical analysis to show that mutations to bacteriophage

resistance occurred randomly prior to exposure (41). They postulated that if immunity to

bacteriophagy were acquired one would expect that the distribution o f resistant cells in a

growing culture would have a Poisson distribution (where the variance is equal to the

mean). This is because a few random cells in each culture would acquire resistance after

exposure. On the other hand, if the mutations to resistance occurred randomly before

exposure, and the cultures had time to go through several generations, some cultures

would have no resistant cells, some would have a few, and occasionally there would be

"jackpots" that contained a great many resistant cells. Luria and Delbruck's experimental

results supported the latter scenario. Lederberg and Lederberg later reinforced these

results (38). Using the newly-developed technique o f replica plating in which multiple

copies o f identical culture plates could be made, they showed that resistant cells existed

prior to exposure to a selective agent — in this case antibiotics. Cavalli-Sforza and

Lederberg provided yet further support through sib selection experiments in which

successive subcultures were made — each subculture representing a smaller percentage of

the original culture (8). Eventually, pure cultures o f cells resistant to a selective agent

were obtained without the cultures ever having been exposed to a selective agent. The

impact o f these experiments was far reaching. Random generation o f mutation as the only


means o f generating variation became the generally accepted paradigm of modem

evolutionary thought.

In 1989, however, Cairns et al. challenged that paradigm by pointing out that the

experiments demonstrating random mutation all used relatively rapid lethal selection. This

raised the possibility that if post-selected mutations did occur, their existence could be

obscured by the premature death o f the mutant organisms due to delayed phenotypic

expression o f newly arising resistant gene(s) (5).

Cairns et al. offered several examples o f apparently directed mutation (5). Other

investigators also reported results that they claimed supported directed mutation. First,

Cairns et al. offered the observation that the distribution o f lactose-positive revertants

(Lac ) o f a strain of Escherichia coli placed in a medium with lactose as the only carbon

source did not follow a Luria and Delbruck-type pattern. Rather, the distribution was

hybrid due to late-arising mutants whose distribution was Poisson-like, an observation that

confirmed earlier work by Ryan (53). By contrast the distribution o f valine-resistant

mutations, a phenotype whose expression was independent o f the lactose-ffee

environmental condition, declined over time. Cairns et al. interpreted these results to

suggest that the bacteria had "some way of producing (or selectively retaining) only the

most appropriate mutations."

Cairns et al. also pointed to the work o f Shapiro (54) whose work with E. coli

strain MCS2 they claimed provided support for their assertion. Strain MCS2 contains a

lac(ara)^ fusion that is normally separated by Mu prophage DNA giving it a lacT ara“

phenotype. With the prophage present, the strain cannot utilize lactose as a carbon


source. Shapiro observed that excision mutants only appeared on cultures starved for

lactose and that they were late arising, i.e. appearing after exposure to lactose-minus

conditions. Cairns et al extended these results by showing that excision mutants did not

appear when cultures were grown on rich media that did not contain lactose or arabinose.

Lastly, Cairns et al. proposed a possible mechanism for directed mutations. They

postulated that cells could produce "a highly variable set o f mRNA" and monitor the

success o f the variant proteins produced from these transcripts (5), The cell would then

reverse-transcribe the mRNA coding the most successful protein variant into genomic

DNA.

Hall advanced two further claims of directed mutation (24,25,26). First, in an E.

coli strain that requires two mutations in the P-glucosidase (bgT) operon to regain the

ability to utilize salicin. Hall noticed that one of the mutations, excision o f an insertion

sequence, occurred at a higher rate when plated on salicin. Even though the cells achieved

no immediate benefit from this action. Hall argued that the higher frequency o f these

excisions represented "anticipatory evolution" in advance o f the second (random) mutation

in the control region o f the operon Second, Hall advanced claims o f increased reversion

to prototrophy o f a tryptophan double mutant {trpA trpB) subjected to tryptophan

starvation. Over a period of two weeks, mutations in the trp operon continued to occur in

a time-dependent manner; mutations to valine-resistance did not, indicating there was no

increase in the background mutation rate o f the genome. Additionally, starvation for

cysteine did not increase the reversion rate to tryptophan prototrophy indicating that the

reversions were specific to tryptophan starvation. Significantly, for the trp system Hall did


not claim that the mutations that occurred were the result o f directed mutation (although

he still called them "Caimsian") (25). Rather, he proposed that some o f the cells entered a

hypermutable state with mutations occurring all across the genome. Amongst this small

subset o f cells, the elevated mutation rate would result in a greater number o f successful

reversions and the appearance o f directed mutation.

In response to these claims of directed, or apparently directed, mutations other

investigators advanced alternative explanations (40,56,57). Several points were raised

regarding the experiments by Caims et al. on the reversion o f the lac operon. For

example, it was shown that deviation from the Luria Delbruck distribution could not, in

and o f itself, be used as a proof for the existence o f directed mutation if the basic

assumptions such as growth conditions instead o f non-growth conditions are changed

(57). It was also shown that the control, mutation to valine-resistance, was flawed in that

the conditions used by Caims, et al inhibited those kinds o f reversions (56).

Shapiro's results were also challenged (56) by the finding that high numbers of

excision mutants are found when starved on media containing lactose and arabinose

indicating that the mutations occurred as a result of starvation. Sniegowski used replica

plating experiments to show that nearly all (99%) of the excision mutants had arisen

during carbon starvation prior to exposure to lactose and arabinose (55).

Lenski and Mittler challenged Halls' claims regarding the bgl system, as well (56).

They showed that in E. coli in which the insertion sequence in the bgl operon had been

excised could grow without salicin. These growth-related mutations greatly increased the

number o f E. coli available to undergo the second mutation and indicated they were not


anticipatory. The growth o f single-mutation intermediates was also the basis o f the

challenge to Hall's double mutant trp system (40).

In general, all o f the early claims of directed mutation have been refuted or

seriously questioned. Support for Cairns' model of directed mutation (reverse

transcription o f successful mRNA mutants) has not been found and Cairns admits it may

never be found (19). Cryptic growth, allowing Darwinian-type random mutation, has been

implicated in some o f the other models (56). Convincing evidence for a mechanism that

allows the environment to direct mutations to specific genes was lacking in all o f these

models.

In the absence o f evidence for directed mutation, attention turned to what has been

termed "adaptive" mutations. The primary model o f adaptive mutation currently under

investigation grew out o f a model originally reported by Caims and Foster (6,19). This

model was comprised o f E. coli with an F' episome containing a lacI-Z fusion with a +1

frameshifl in lac I polar to la c Z . When plated on a medium containing only lactose as a

carbon source, the usual lac^ revertants appear over time in the absence o f growth. In this

case, however, it appears that the mechanism of mutation may be known. Evidence is

accumulating that the mutations that occur involve the RecBCD pathway

(20,28,29,48,51). In Rosenberg's model (50,51), starvation-induced stress causes a

double strand break in DNA. Activation o f the RecBCD system to repair the break results

in introduced errors due to polymerase error coupled with depressed mismatch repair. If

the mutation results in Lac"̂ reversion the cell is able to survive and replicate; if not cell

death occurs. Hall's hypermutable state is invoked as it is proposed that only a few cells in


8

the starved culture enter this state. This model has breathed new life into adaptive

mutation research (1,10), despite the fact that Galitski and Roth have recently shown that

in an F“ system where the lacTTgene is located on the chromosome, reversion rates to

prototrophy correlate positively with increased leakiness o f the gene (21). In any case, it

is generally felt that Rosenberg's model does not fall into the arena o f "directed" mutation

and that Darwinian mechanisms are at play (10,18,39,50). The search for directed

mutations, however, is not yet over.


CHAPTER 11. The Wright Hypothesis

Wright has proposed a mechanism for directed evolution that draws a correlation

between starvation in bacteria, induction o f the stringent response, and elevated mutation

rates in specific opérons. Wright theorizes that environmental stress can increase mutation

rates in specific opérons o f bacterial populations and then positively select for resulting

mutants that relieve the same environmental stress (62). The metabolic activities that

occur in response to the stressful condition result in the accumulation of particular

transcription activation signals. These signals, in turn, activate specific opérons, thus

creating transcription “bubbles” in which single-stranded DNA is exposed. It has been

demonstrated that single-stranded DNA is more vulnerable to mutations than double

stranded DNA. It is proposed, therefore, that this increased transcription leads to

increased mutation rates in these opérons, possibly giving rise to mutants that can respond

to or relieve the environmental stress in some novel way. In Wright’s view, the directed

nature o f the mutations is due to the existence o f "independently controlled operon-

specific mechanisms" which continue to repress opérons that do not specifically respond

to the current environmental stress. The Wright hypothesis, therefore, links environmental

conditions to specific mutations by selective activation of genes that respond to the

original environmental stimulus (Figure 1 ).

The stringent response is the proposed key mediator between starvation and

mutations. In growing E. coli, the stringent response occurs as a response to a deficiency

in amino acids (7). Normally, uncharged tRNAs are unable access the A-site o f the


10

ribosome during protein synthesis. During amino acid deficiency, however, the uncharged

tRNA is able to bind mRNA at the A-site causing an idling reaction. This, in turn, causes

guanosine tetraphosphate (ppGpp) synthetase I to be produced. This enzyme catalyzes

the production o f ppGpp. There is also another gene which controls ppGpp levels. The

spoT gene produces a degradative enzyme that breaks down ppGpp. Carbon-source

starvation can increase ppGpp levels by inhibiting spoT.

Donini et al (16) has shown that the accumulation o f ppGpp in the cell is rapid,

that maximum levels are reached within five minutes o f the onset o f starvation, and that

the maximum levels o f ppGpp differ depending on the amino acid for which there is a

deficit. Arginine starvation produces the largest amount o f ppGpp, three times more than

for histidine (Figure 2).

Although a definitive understanding o f the mechanisms by which ppGpp acts

during the stringent response remains unclear, current theory holds that it acts primarily to

inhibit genes involved in growth including rRNA and tRNA genes, among others. On the

other hand, activation o f the amino acid biosynthetic genes and the stationary phase sigma

factor (a^) are enhanced (7).

There are two models (that are not necessarily mutually exclusive) that describe

how ppGpp effects this control (7). In the passive control model, ppGpp is believed to

inhibit mRNA transcription elongation resulting in the sequestration o f RNA polymerase

on growing RNA chains (33). As the concentration o f free RNA polymerase falls,

promoters that require maximum saturation, i.e. those that are stringently controlled, will


11

Figure 1. An algorithm for evolution proposed by Wright. From Wright, B. E., 1997.

FEES Letters. 402:4-8.


12

r ENVIRONMENTAL STRESS(amino acid starvation)

HIGH GROWTH RATE, REPRESSED GENES. LOW MUTATION RATE

UNCHARGED tRNA

tMUTANTS RELIEVING

STRESS SELECTED

HIGHER MUTATION RATES IN TRANSCRIBING GENES

\TRANSCRIPTION ACTIVATION

SIGNALS (ppGpp, GCN4)

ISPECIFIC OPERONS

ACTIVATED

NEW PATTERN OF TRANSCRIPTION

J


13

Figure 2. Guanosine tetraphosphate levels after starvation for selected amino acids.

Modified from Donini et al., 1978. Molec. Biol. Rep. 41:15-29.


14

(A 0.3 «aEo 6 .2 e(Oz

0.1

20 40 60 80 100

arginine

leucine threonine

histidine

Time in m inutes


15

show an apparent decline in initiation o f transcription compared to the other promoters.

For example, Vogel et al. showed that when exposed to isoleucine starvation, the

transcription elongation rate of lacZ mRNA decreased by 50%, a decrease that is mirrored

by an equal decline in protein chain elongation rates (59). The precise mechanism by

which ppGpp inhibits transcription elongation remains unknown. Vogel et al. indicated,

however, that it does not inhibit initiation o f transcription and Kingston et al. have

previously shown that high concentrations o f ppGpp causes RNA polymerase to pause

during RNA chain elongation (59,34).

In the other model, ppGpp is theorized to act directly to positively or negatively

control initiation o f transcription, perhaps by binding to and altering the properties o f

RNA polymerase (52). The polymerase then binds preferentially to promoters in which

the discriminator regions are AT rich as opposed to GC rich.

There have been several demonstrations that transcribed genes have higher

mutation rates than non-transcribed ones due to the exposure o f single-stranded DNA

during transcription. Most recently, Wright et al. modified a strain o f E. coli to contain a

point-mutated chromosomal leuB gene under the control of a tac promoter inducible by

isopropyl P-D-thiogalactoside (IPTG) (63). When induced by IPTG, the reversion rate

was three fold higher than when not induced. In yeast, Datta and Jinks-Robertson used a

frameshifl mutation, also chromosomally located, under artificial transcriptional control to

show a 35-fold increase in the reversion when transcribed at a high rate (13).

In other studies of E. coli, Beletski and Bhagwat have shown a four-fold increase

in cytosine to thymine mutations in the non-transcribed (single) strand of actively


16

transcribed genes (2). Following up on a study by Lindahl and Nyberg showing that

cytosines readily deaminate in single-stranded DNA (42), Fix and Glickman have shown

that the majority of guanosine:cytosine to adenine thymine transitions (77%) occur on the

non-transcribed strand, especially when preceded by three or more A:T base pairs on the

5' side (17). They attributed these findings to the single-stranded nature o f the non-

transcribed strand during transcription. The transcribed strand is thought to be protected

by the transient formation o f the DNAiRNA hybrid in the transcription bubble. Other

studies by Herman and Dworkin, Cordaro and Ballbinder, and Brock have all shown that,

in the presence of a mutagenic agents, mutation rates of transcriptionally induced genes is

higher than for non-induced genes (31,9,3). Davis invoked single-stranded mutability of

DNA when he proposed that the early cases of apparently directed mutation could be

explained by the transcription o f genes induced by the substrate (14).

Wright has linked the stringent response and transcriptionally induced mutation

rates in a series of experiments utilizing two specific isogenic strains o f Escherichia coli

K-12 (61,64). Both strains were auxotrophic for the following amino acids: leucine,

histidine, arginine, and threonine. The strains differed only in the relA gene that produces

guanosine tetraphosphate (ppGpp) synthetase I.

Reversion rates o f the leuB~mé argET mutant alleles were determined in these two

isogenic strains (61). As a further control, reversion rates of a pyrD" strain, unaffected by

the stringent response, were also measured (62), These experiments indicated that relA^

cells have higher reversion rates to prototrophy than relA~ cells in which the stringent

response does not occur. Specifically, there was an approximately seven-fold difference in


17

reversion rates between CP78 and CP79 when starved for leucine. When starved for

arginine, the difference between CP78 and CP79 was 28-fold while there was little

difference in the reversion rates of the pyrD~ strain (3 .7x10'^ for CP78 pyrD~ and

2.8 X 10'^ for CP79 pyrD~). In contrast, starvation o f the pyrD- strain for leucine

produced a five-fold higher reversion rate in CP79 than for CP78 (7.3 x 10'^ for CP79

pyrD~ and 1.6 x 10'^ for CP78 pyrD~).

The experiments also indicated that there is a positive relationship between

mutation rates and ppGpp concentration (64)(Figure 3). Further, it has also been

demonstrated that levels o f leucine mRNA during starvation correlate with reversion rates.

For example, the level o f leuB mRNA for CP78 and CP79 during logarithmic growth is

approximately 29 pg leuB RNA/pg total RNA. In CP78, under leucine starvation

conditions the level increases to 269 pg leuB RNA/pg total RNA while for CP79 it

remains at relatively low levels 17 pg leuB RNA/pg total RNA — a sixteen-fold difference.


18

Figure 3, Reversion rate o f leuB under different conditions plotted against

generation time (A ) and against ppGpp concentration (# ) during growth. From Wright,

B. and Minnick, M , 1997. Microbiology. 143:847-854.


19

400 800

pm oies ppGpp/OD or generation time


CHAPTER III. The Arginine Model

A. The Arginine Biosynthetic Pathway

This section gives some background on the arginine biosynthetic pathway since it

was the model used in this research. The arginine biosynthetic pathway consists o f eleven

genes (including carA and carB) scattered throughout the E. coli genome that code for

nine enzymes (reviewed in 22). A salient feature o f this pathway is its regulatory control

mechanism (43). All o f the genes are controlled through negative repression at the level

o f transcription — there is no evidence of attenuation control Arginine acts as a

corepressor and combines with the argR protein. This complex negatively represses the

genes o f the biosynthetic pathway by binding to palindromic sequences, called ARG

boxes, at the operator site. The normal intracellular concentration of the repressor is quite

high at a concentration o f 500-600 molecules per cell. Thus, it is able to exert strong

control over the scattered biosynthetic pathway. This type o f control in which scattered

opérons are controlled by a single regulatory mechanism has been labeled a regulon (43).

B. The argECBH Gene d u s te r

O f particular interest is a single cluster o f four arginine biosynthetic genes that

have been labeled argECBH. This gene cluster is bidirectional with transcription o f the

argE gene occurring in the opposite direction of argCBH. Interestingly, the promoters for

both wings o f this gene complex are overlapping (46). There is a leader sequence

preceding the argCBH wing that is not involved in attenuation. The terminal gene in the

20


21

pathway, argH, encodes for the enzyme argininosuccinase. This enzyme converts

L-argininosuccinate into L-arginine. The argE gene encodes for the acetylornithinase

enzyme.

Consistent reports o f a discrepancy between argECBH mRNA levels and rates o f

enzyme synthesis indicate that another level o f control of the argECBH opQvon exists in

addition to the arginine repressor (11,35,47,65). Using either whole cells or extracts, it

has been shown that during repression by added arginine, argECBH mRNA synthesis is

reduced two- to three-fold while synthesis of the argininosuccinase enzyme decreases 20-

to 60-fold. Synthesis o f the acetylornithinase enzyme decreases five- to 12-fold. Sucrose

gradient distribution assays indicate that, depending on the state o f the cell, two sizes of

argECBH message are formed as indicated by the occurrence o f a heavy (14S) and light

(8S) band in the gradient (37). Under repressed conditions (arginine present), the smaller

length (8S) message predominates. This message is untranslatable and no enzymes are

formed from it. Under derepressed conditions (no arginine) there is a shift with the ratio

o f heavy and light bands becoming almost equal. In a strain {E. coli D2) containing a

deletion o f argEC (and thus no control region) and a gene duplication of argH, high levels

o f the heavy message (and very little light message) are produced in the presence of

arginine. Formation o f the short message has been shown to be dependent on the

presence o f rho protein when transcription and translation are uncoupled (65) Thus,

during arginine deprivation, while there is an overall increase of approximately two- to

three-fold in the level o f argECBH transcripts, there is a much larger increase in the

amount o f translatable (14S) message.


22

Experiments by Zidwick et al. have shown that during arginine starvation ppGpp

was responsible for a thirty to 100% increase in the amount of hybridizable argECBH

mRNA (66). In addition, in a cell-free system, added ppGpp had no effect on the rate of

decay o f the argECBH mRNA or on enzyme activity. Zidwick et al. also concluded that

ppGpp acts at an early stage during transcription.

Other experiments by Williams and Rogers have shown that ppGpp is necessary

for translation o f argBCH mRNA (60). During arginine limitation, cells accumulate

untranslated mRNA. When arginine is added back there is a burst o f enzyme activity as

the accumulated mRNA is translated. Williams and Rogers observed the enzyme burst in

relA* cells and not in relA- cells. If high levels o f ppGpp were induced in the relA- cells,

however, then the enzyme bursts were seen.

Williams and Rogers also showed that maximum levels of argCBH mRNA are

achieved fifteen minutes after the onset of arginine starvation (60). Using dot blot

hybridization they showed that there was no difference in the levels o f argCBH mRNA

between a relA* strain and a relA- strain at that time point. This may indicate that ppGpp

levels have a minimal effect on mRNA levels, assuming turnover rates are not affected. It

should also be mentioned that the measurement o f mRNA levels was accomplished using

full-length argBCH probes and apparently no adjustment was made to account for the

different length messages (8S and 14S) that occur.

One relevant concern in determining mRNA levels is whether the observed change

is due to increased rates o f synthesis or if it simply reflects a change in stability due to the

onset o f starvation conditions. There have been several conflicting reports concerning the


23

stability o ïa rg mRNA Hall and Gallant, using the same strains as used by Wright (CP78

and CP79), determined that there was no difference between the rate decay o f ornithine

transcarbamylase (OTC) mRNA with and without arginine present (27). In their

experiments, however, the rate of mRNA decay was inferred by measuring OTC activity, a

questionable method due to the discrepancies between transcript and enzyme levels.

Using RNA-DNA hybridization methods, McLellan and Vogel showed that the

average half life o f argECBH mRNA exhibited a three-fold difference during arginine

starvation conditions where the cells had stopped growing, increasing from 1.5 minutes to

4 .3 minutes. I f the arginine supply was restricted but the cells were allowed to grow, then

the half-life increased approximately four-fold (45). Krzyzek and Rogers, however,

determined that the decay rate o f argEBCH mRNA increased twofold during arginine

deprivation (37). This was equal to the increase of total cell mRNA under the same

conditions indicating that mRNA stability is unaffected by specific starvation conditions.

C. Research Ptan

This research consisted of three parts. First, the effects of starvation for histidine

followed by starvation for arginine were compared to the effects of starvation for arginine

alone to determine if the type of starvation conditions had any differential effect on

reversion rates. Second, in order to determine the relationship between the reversion rates

o f the argH gene and its mRNA levels during starvation, the levels of argH mRNA

produced during starvation for arginine alone, histidine alone, and histidine followed by

arginine were examined to determine if a correlation existed. In addition, the levels o f


24

argH mRNA produced during logarithmic growth were determined. Finally, the nature of

the mutation in the argH gene for this particular strain of E. coli K-12 was examined to

determine if it might have any bearing in the rate of reversions of the mutant gene.


CHAPTER IV. Materials and Methods

A. Mutation Rates

1. Strains.For the mutation and mRNA transcription studies two strains o f E. coli K-12 were

used. Strain CP78 has the following genotype: F- thr-1 leuB6 his65 argH46 thi-1 ara-13

gal-3 m alA l xyl-7 mtl-2 tonA2 supE44?). Strain CP79 has the same genotype except

that in addition it is relA-. Both strains were obtained from the E. coli Genetic Stock

Center at Yale University.

2. Media.The yeast agar plates used for viable counts contained 1.0 g 1'̂ yeast extract, 10.0

g r ' glucose, 10 g r* peptone, 1.0 g f ' MgS0 4 *7 H2 0 , 0.98 g f 'K 2HP0 4 , 1.46 g

KH2PO4, and 15.0 g f* Bacto-agar. Minimal media used for overnight growth under

amino acid limiting conditions contained 40mM glycerol, 50mM sodium phosphate buffer,

pH 6.5, 1.0 g r ‘ (NH4)2S0 4 , 1.0 g MgS0 4 , 5.0 mg 1'̂ thiamine, 1.0 mM threonine, 0.3

mM leucine, 0.3 mM arginine and 0.3 mM histidine. For conditions where growth was

limited by histidine, the concentration o f histidine was 0.008 mM. Minimal media plates

used to measure reversions contained 23 mM glycerol, 50mM sodium phosphate buffer,

pH 6.5, 1.0 g (NH4)2S0 4 , 1.0 g MgS0 4 , 5.0 mg thiamine, 0.7 mM threonine, 0.3

mM leucine, 0.2 mM arginine, 0.2 mM histidine, and approximately 15.0 g 1* agar. For

conditions where reversion to arginine prototrophy was being measured, the arginine was

25


26

withheld from the media.

3. Mutation Rate Determinations.To detemiine mutation rates, cells of both strains, obtained from either frozen

stocks or laboratory cultures, were streaked onto yeast plates and grown overnight at

37® C. Cells from the overnight growth were used to inoculate minimal media containing

a limiting amount o f histidine to a density of about 5 x ml'V From this master

culture, 1.5 ml aliquots were made to forty 2 cm diameter test tubes which were loosely

capped. After incubation for 17-26 hours at a 45° angle at 37° C on a shaker, the 1.5 ml

cultures were washed with 10 ml buffered saline, resuspended in 1 ml of buffered saline to

remove the arginine, and then plated onto minimal media agar plates lacking arginine.

Plate counts o f viable bacteria were obtained by serially diluting two representative

cultures before plating onto yeast plates. Mutation rates were determined after 72 hours

o f incubation using the “zero method” of Luria and Delbruck according to the expression

MR = (-In 2) (In Po /N) where Po is the proportion of cultures with no revenants and N is

the total number of cells per culture (41).

B. Recombinant DNA Methods

1. Sequencing.The argH gene was amplified using the polymerase chain reaction (PCR)

technique (Promega kit). DNA from strain CP79 was used as the template. PCR was

accomplished at 30 cycles o f 92° C (1 nun), 60° C (30 sec), 72° C and a single extension

cycle at 72° C (15 min). The additional time in the last cycle left 3’ T overhangs on the


27

PCR product allowing for efficient ligation. The primers used for amplifying were based

upon the sequence o f Parsot et al. (GenBank accession no. M21446) and included

5’ TTCCGGCACTGTTTAACGGT (primer 1) and 5’ TGCGGATCTCCAGGATCCGC

(primer 2). Primers were synthesized with an Applied Biosystems (ABI) model 394 DNA

synthesizer at The University o f Montana Murdoch Molecular Biology Facility. PCR

products were cleaned using the Boehringer Mannheim High Pure PCR Purification kit.

Nucleotide sequence analysis was accomplished by the methods o f Tracy and Mulcahy

(58) on an ABI automated nucleic acid sequencer.

2. Vector Construction.The cleaned PCR product was cloned into the pCR®2.1-TOPO plasmid using the

TOPO TA Cloning kit (Invitrogen). Transformants were screened for recombinant DNA

by blue/white screening on Luria-Bertani agar plates containing 0.1 mg ml'* ampicillin

(Sigma) and spread with a mixture o f 40 pi of lOOmM IPTG (Gibco BRL) and 40 pi of

40 mg ml'* X-Gal (5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside) (Sigma). Plasmid

DNA from a single white colony was obtained using the Quantum Prep Plasmid Miniprep

kit (Bio Rad). The plasmids were analyzed for the presence of the argH insert using

restriction digests. The resulting plasmid construction was dubbed pCAH (Figure 4). The

argH insert was then cut out o f pCAH and subcloned into a new vector, pBluescript

(Figure 5). This new plasmid construct was named pBAH. This construct was further

modified by removing the transcription termination loops (Figure 6). This modified

plasmid was named pBAHOl.


27

PCR product allowing for efficient ligation. The primers used for amplifying were based

upon the sequence o f Parsot et al. (GenBank accession no. M21446) and included

5’ TTCCGGCACTGTTTAACGGT (primer 1) and 5’ TGCGGATCTCCAGGATCCGC

(primer 2). Primers were synthesized with an Applied Biosystems (ABI) model 394 DNA

synthesizer at The University o f Montana Murdoch Molecular Biology Facility. PCR

products were cleaned using the Boehringer Mannheim High Pure PCR Purification kit.

Nucleotide sequence analysis was accomplished by the methods o f Tracy and Mulcahy

(58) on an ABI automated nucleic acid sequencer.

2. Vector Construction.The cleaned PCR product was cloned into the pCR®2.1-TOPO plasmid using the

TOPO TA Cloning kit (Invitrogen). Transformants were screened for recombinant DNA

by blue/white screening on Luria-Bertani agar plates containing 0.1 mg ml'* ampicillin

(Sigma) and spread with a mixture of 40 pi of lOOmM IPTG (Gibco BRL) and 40 pi of

40 mg ml * X-Gal (5-bromo-4-chloro-3-indolyl-(3-D-galactopyranoside) (Sigma). Plasmid

DNA from a single white colony was obtained using the Quantum Prep Plasmid Miniprep

kit (Bio Rad). The plasmids were analyzed for the presence o f the argH insert using

restriction digests. The resulting plasmid construction was dubbed pCAH (Figure 4). The

argH insert was then cut out of pCAH and subcloned into a new vector, pBluescript

(Figure 5). This new plasmid construct was named pBAH. This construct was further

modified by removing the transcription termination loops (Figure 6). This modified

plasmid was named pBAHOl.


28

Figure 4. pCAH plasmid construct. A. Diagram of pCAH plasmid showing argH

insertion sites and restriction sites. B. Agarose gel of restriction digest o f pCAH.


29

A5474

294pCR2.1 plasmidcargH insert

pCR2.1 3908 + argH 1566

Idel 1423

1860

PstI 1877PstI 3044

BMW pCAH

digest

# r .


30

F igures. pB AH plasmid construct. A Diagram of pB AH plasmid showing

insertion sites and restriction sites. B Agarose gel of restriction digest of pBAH.


31

AXmnI 4304 4571

689argH insert

pBluescript

pBluescript 2961+ argH 1659 (1566 argH + 93 pCAH) - 49 (Hind III to Not I) XmnI 1042

XmnI 20232348

B MW pBAHOl digest pBAH

3000 __

2000 — 1550 _ 1400 — 1000 __


32

Figure 6. pBAHOl plasmid construct. A. Diagram of pBAHOl plasmid showing

insertion sites and restriction sites. B Agarose gel o f restriction digest o f pBAHOl.


33

AXmnI 3834

pBluescriptc4101

^EAHOrpBluescript 2961 + argH 1659 - 49 (Hind III to Not I)

470 (Nde I to Not I)

argH insert

XmnI 1042

B MW pBAHOl digest pBAH

3000 __

2000 — 1550 1400 — 1000 —

2792

1309


34

C. Messenger RNA Transcript Level Determinations

1. Collection of mRNA.Total RNA from cells of both strains was harvested after growth to logarithmic

phase in minimal media containing 40mM glycerol, 50mM sodium phosphate buffer,

pH 6.5, 1.0 g (NH4)zS0 4 , 1.0 g f* MgS0 4 , 5.0 mg f* thiamine, 1.0 mM threonine,

0.3 mM leucine, 0.3 mM arginine and 0.3 mM histidine. For conditions where growth

was limited by histidine, the concentration o f histidine was 0.15 mM; for arginine-limited

growth, the concentration o f arginine was 0.15 mM. Cultures were then exposed to

fifteen minutes o f starvation by incubation in minimal media lacking either arginine or

histidine before extraction o f RNA. In the case o f histidine starvation followed by arginine

starvation the cultures were briefly washed in minimal media lacking arginine.

RNA extraction was accomplished immediately at the end o f fifteen-minute

starvation period The Purescript RNA Isolation kit (Centra Systems) was used for the

extraction. The protocol was modified with the lysed cells incubated for 10 minutes at

65® C instead o f 5 minutes. Samples were stored at -70° C

2. RNA-Biotin Probe Preparation.To prepare ûrr^/f-specific biotin-labeled RNA probes, pBAHOl was cut overnight

with the restriction endonuclease Bgl II (New England Biolabs) to create a linearized

DNA template (Figure 7). The DNA was gel-purified (1% RNase-free agarose gel) and

cleaned. Antisense RNA probes were transcribed using the Ampliscribe T3 & T7 in vitro

transcription kit (Epicenter). In brief, a room temperature solution consisting o f 8 pi o f


35

Figure 7. a rg //P ro b e construct.


36

Bgl II T3 PromoterT7 Promoter

argH insert257 49

Digested probeFull length probe


37

0 .125(ig (J.1 ̂ linearized DNA template; 2.0 pi of lOX T3 reaction buffer; 1.5 pi each o f

100 mM ATP, CTP, GTP, and UTP; 2.0 pi 100 mM DTT; and 2.0 pi T3 enzyme was

incubated at 37® C for 2.75 hours. After removal of the DNA template with RNase-free

DNAse I, the RNA probe was cleaned with a phenol-chloroform extraction and

precipitated using 5M ammonium acetate and 70% ethanol. The cleaned RNA probe was

then diluted to approximately 0.05 pg pi * and boiled for 10 minutes to denature. After

immediate cooling, 50 pi o f the denatured RNA was mixed with 5 pi o f psoralen-biotin

reagent (Ambion) and exposed to 365 nm ultraviolet light for 45 minutes at 4° C. After

cleaning with butanol and ether extractions, precipitation with isopropanol, and a wash

with 70% ethanol, the probe was purified on a 0.75 mm thick, 5% polyacrylamide gel

containing 8 M urea. To remove the probe from the gel, it was visualized by illumination

with a 254 nm ultraviolet light against a TLC plate. After elution overnight in probe

elution buffer (Ambion), the probe was precipitated in 70% ethanol, dried at room

temperature and resuspended in TE.

3. araH mRNA levels.Levels o f argH mRNA were determined using the S1 Nuclease Protection Assay

(Ambion) which was modified by replacing S1 nuclease with T2 ribonuclease (Gibco

BRL). In brief, the total RNA samples and the argH biotinylated probe were hybridized at

42° C overnight. After T2 nuclease digestion o f unhybridized RNA, the remaining

hybridized RNA was precipitated and then loaded onto a denaturing (urea) polyacrylamide

gel electrophoresis. The isolated RNA was then electroblotted to a positively-charged

nylon membrane and exposed to X-ray film. The bands on the film were then quantified


38

using Onedscan densitometry software (Scanalytics) and a Umax 1200S scanner with

reflective attachment .


39

CHAPTER V. Results

A. Mutation Rate Determinations.

When starved first for histidine and then for arginine, the mean mutation rates

between CP78 and CP79 are significantly different (t=3.444 with 14 degrees of freedom,

p = 0.004) (Figure 8). The CP78 mean mutation rate under these conditions was

7.57 (± 2.91) X 10'^ (n=7) compared to 3.11 ± 1.92 x 10’® for CP79 (n=9), a 2 1/2-fold

difference. Nevertheless, this is much less than the previously reported is twenty-eight

fold difference between CP78 and CP79 when starved for arginine alone

(6.2 (± 1.1) X 10*̂ for CP78 versus 0.22 (± 0.08) x 10'^ for CP79).

B. Sequencing.

The sequencing o f the argH gene indicates that the mutation is a single base

substitution in the fourth codon (position 142 in Figure 9). The effect of this point

mutation is to turn the codon for tryptophan (UGA) into an opal stop codon. This is

significant because opal suppressors of a nonsense mutation are the rarest o f the three

nonsense suppressors (32). This is because UGA is the most common terminator codon.

The appearance of this class o f suppressors in a cell can lead to its death.


40

Figure 8. argH sequence indicating the location of the point mutation, the start and stop

codons, and the primers used for PCR. The mutation is shown italicized at position 142.

The primers and start and stop codons are underlined as indicated.


41

1 CTGGCGTCAT 41 ATGCCGATGG 81 CCGGAGGCGC 121 AAACAGAGTT 161 GCAGCAGATC 201 GCTTTGATTA 241 TGTGGCCTGG 281 ACCGCAGAAG 321 TGTTGCTGGA 361 TGAAAGCGAC 401 AAACTGATCG 441 ATACCGGGCG 481 GAAACTGTGG 521 GCTAACCGGC 561 AAAACAATCA 601 GCAACGCGCC 641 GCCTATGTTG 681 AGGATGCGCT 721 TGGCGCGCTG 761 CAGTTAGCAG 801 ACAGTCTCGA 841 ACTGCTTTCT 881 CGTTTTGCTG 921 CGGGGTTTGT 961 ATCATTAATG 1001 CTGATTCGCG 1041 CCGGCATGAT 1081 CAACAAAGAT 1121 GCGCTCGATA 1161 TGGTGCTGGA 1201 GGAAGCGGCT 1241 GCGGATTATC 1281 CGC ACC AT AT 1321 TCAGGGCAAA 1361 CAGAAATTCA 1401 TTCTGTCGCT 1441 AGGCGGCGTC 1481 TTTGCGCAGG 1521 AAATTTGAGC 1561 AAAAAAGCGG

GCGGAGCAGCGTACGCGGATAGCTTTCCGGATGGCACTTTAACGGTTCAACCGTCTGGCGTCCAAAGCCCAGCAGGCGCAAGATGTTCGCGCCGAAGATAACAAAGTGGGTAGCCGTAATTGCAAAGATAAGCTGCAATCGGACGCGGTACAGCCGGTGAAGATGCTGGCTAAGCGTCTGGCGGGAACGGGCTGGCTGGGCAGCGTTTCTGCTGCCGCTAAAGATCTGATGGAGCTTTCTCCGCAGAAGAGTAAATGCGGGATGACGCTGATGCAGGAAGCCTGGCTGGACGGCATTCAGCAGCAGGGTTTGGTGGCGAATGTTGGTGAACCGCTGGAAGGTCAGGTGATGCAATCGTGCTCACCGCAGCCTCGGTTAGGCTGGCTTATC

ATCCTGGAGA

TTCÇGGÇAÇTTTTAGCTTAACATTGAATTTGGGGCGGCGACAATTCAACGAGCAGGATATGGTCACGGTACTGGAAGAGGCCAGGCCACTCCATAGCTGCCAGTTAGGCGATCAGGTAGCCGTTAGCGAGGCGCTGGTGATGCCAGGTTCGTTCGCGCAGCGTGATGAAGATGTCAGCCCCTATGAAATCTTTGCTTCGGACCGTGACCTCGGCATGGTTTTCTTTAACGACCGCGTGAAAAACCCGGACCGGGTGCAGAAAGGTTTGCACAAAGAAGGCTGCCTGCATGTGAAACGTCACGCCAACGCAGGCGTACCGGCGGTGGTGGATCTGCCGCTTGACGAAGATCTCGACAAGCAGGTGGCGCAGTAAGAACATGCCGGGCTTT

TCCGCAAAAG

g t t t a a c g g tGTTTTGTTGGCAAAATAAGGTTTTACCCAGGACTCACTGCTTGTTGGCTCAGGCGTGTTAGCGCTGAACGAACAAATCCTGGTGGAGGC

AAAAAGCTGCCGACTGACCTGTTACTGACGGAAACCGCACACACTCACCTCTGGTGCCTGAGCCGTTTGCCGCTAGGCTGCGACCGTGAAGCGACCCGTAATGTGTTGGAGCATCTGTCGACCGGCGAAGCTTCCGGTTCTGCGCTGGAGGGGGCGTTAACGCTGGCTTATCTGTTCGACATGGCGGCGCCACGTTGCCACACCGAACTGTTCCGCGAGGAAGCCATTCGCAGTGAGTTGGTCTATCCGAGTGCGGCAAAGGCGATTGCTTTATATGTATTTTATGGCAATTCACGTTGG


42

Figure 9. Reversion rates of an E. coli K-12 arginine auxotroph under different starvation

conditions. Also shown for comparison is the reversion rate of a pyrD mutant under

arginine starvation conditions. Error bars indicate one standard deviation.


43

1.20E-08

1 .OOE-08 -

8.00E-09 -

6.00E-09 -

4.00E-09

2.00E-09

O.OOE+00

argH Reversion Rates

■ CP78 ICP79

Arg His-Arg Arg (pyrD~)

Starvation Condition


44

C. ArgH mRNA Transcript Levais.

The argH mRNA level studies indicate no significant difference between the levels

between CP78 and CP79 under the starvation conditions used in this study (Figure 10).

These results are not expected under the Wright hypothesis that predicts there should be

significant differences between mRNA levels, if these differences reflect differences in the

rate o f transcription.

Specifically, when starved for arginine only, CP 78 showed a slight, but not

significantly, higher level o f argH mRNA (0.226 pg argH mRNA/pg total RNA) than

CP78 (0.214 pg argH mRNA/pg total RNA). After histidine starvation followed by

arginine starvation there is no significant difference between CP78 (0.159 pg argH

mRNA/pg total RNA) and CP 79 (0.184 pg argH mRNA/pg total RNA).

As expected, the levels of argH mRNA for both strains during logarithmic growth

are significantly lower than under starvation conditions. For CP78, the level of

logarithmic-growth argH mRNA (0.022 pg argH mRNA/pg total RNA) is approximately

tenfold lower than for CP78 starved for arginine alone or starved for histidine followed by

arginine starvation. For CP79, the level o f logarithmic growth argH mRNA (0.036 pg

argH mRNA/pg total RNA) is approximately six times less than CP79 starved for arginine

alone. The magnitude o f difference between the levels o f logarithmic and starvation levels

indicate that the increased levels do represent increased expression of argH mRNA and is

not due solely to the general twofold increase in mRNA half-lives observed during carbon

or amino acid starvation.


45

Figure 10. argH messenger RNA transcript levels under different starvation

conditions. Each bar represents n=3 except for CP78 Log and CP79 His where n=2 and

CP78 His-Arg where n=4. Error bars indicate one standard deviation.


46

argH mRNA Transcript Levels0 .35-1

0 .3 -

0 .25 -

O)3 0 .2 -

o0 . 0 . 15 -

0.1 -

0 .05 -

0 -

I CP78 i CP79

His His-Arg

Starvation Condition


47

Interestingly, the levels of argH mRNA in CP78 (0.020 pg argH mRNA/pg total

RNA) and CP79 (0.022 pg argH mRNA/pg total RNA) that were starved for histidine

only are at the same levels for CP78 in logarithmic conditions. This indicates that the

elevated levels o f guanosine tetraphosphate during histidine starvation do not overcome

the effects o f arginine repression and thus do not affect argH mRNA expression.

D. Summary o f expérimentai resuits.

The experimental results can be summarized as follows:

1) There is a significant difference between CP78 and CP79 argH reversion rates

when starved for histidine followed by arginine. While it has been previously

demonstrated that the magnitude of the difference is about 30-fold when starved

for arginine only, this research shows it is approximately twofold when starved

first for histidine in the presence of arginine and then arginine alone.

2) The mutation in the strain used in the experiments is a point mutation that replaces

the normal codon with an opal stop codon.

3) Levels o f argH mRNA are higher when starved for arginine compared to

logarithmic growth. There is no significant difference between the argH mRNA

levels o f CP78 and CP79 when starved for arginine alone or for histidine followed

by arginine. Starvation for histidine alone results in low argH mRNA levels in

both strains, comparable to the results found during logarithmic growth.


CHAPTER VI. Discussion

This research tested specific predictions o f the Wright hypothesis using the

arginine regulon as a model. According to the Wright hypothesis, when some species of

bacterial cells are starved the stringent response is triggered. This leads to increased levels

o f guanosine tetraphosphate which, in turn, leads to increased transcriptional activity of

mRNA for certain biosynthetic pathways. This increased transcriptional activity causes

higher mutation rates in the very genes that have been stimulated by the environment,

leading to the creation o f more variation and thus more opportunities for natural selection

to act in creating novel solutions to the environmental challenge.

This research examined the arginine biosynthetic pathway to further test

predictions o f the hypothesis. Earlier investigation of the leucine model had provided

support for this hypothesis. Previous experiments had also indicated a significant

difference in the reversion rate o f an arginine auxotroph (some thirty-fold) between CP78

and CP79 when starved for arginine. This finding, coupled with the earlier observation by

Williams and Rogers o f comparable argCBH m RNA levels in relA^ and RelA~ strains

suggested an anomaly, and that an in depth study if this system might be especially

revealing.

One aspect o f the hypothesis, the link between a specific environmental condition,

such as amino acid starvation, and mutation rates is supported by the experimental results.

CP 78, which is re!A* and thus produces ppGpp, has a higher reversion rate when star\'ed

for the amino acids for which it is auxotrophic than CP79, which produces much smaller

levels o f ppGpp. There is a rough positive correlation between the previously measured

48


49

levels o f ppGpp by Donini and the reversion rates reported here and by Wright elsewhere.

Thus, when starved for leucine, the reversion rate for CP78 is 1.47 x 10'® compared to

0.22 X 10'® for CP79. When starved for arginine, the reversion rate for CP78 is 6.2 x 10' ̂

compared to 0.22 x 10'^ for CP79. And when starved for histidine, followed by starvation

for arginine, the reversion rate for CP78 is 7.6 x 10'^ compared to 3.1 x 10'^ for CP79. It

is noteworthy, however, that the reversion rate for CP79 when starved for histidine

followed by arginine is significantly higher compared to starvation for arginine alone — a

14-fold difference. The reason for this anomaly is not clear and bears further

investigation

Measurement o f transcript levels o f the argH gene afier fifteen minutes of

starvation indicates that there is a tenfold difference in argH levels when grown in

logarithmic conditions versus arginine starvation. This is considerably higher than the

three-fold difference reported by Zidwick et al. (65) and others for argBCH mRNA. It is

closer in agreement with the findings of Williams and Rogers (60) that appear to show an

approximately six- to twenty-fold difference in argCBH mRNA levels. One difference

between this and previous studies is in measurement techniques. Previous studies used

full-length hybridization o f the argCBH mRNA which meant that the level of both light

and heavy message were assayed. This study used a probe that was specific for the argH

gene. Thus, only heavy message was assayed. Therefore, a more accurate picture of the

changes in transcription o f (presumably) translatable argH could be obtained.

The mRNA studies also show there is no difference between CP78 and CP79 in

levels OÎ argH mRNA after fifteen minutes of arginine starvation, which is the period of


50

time at which Williams and Rogers previously demonstrated maximum transcript levels are

achieved. This lack of difference is evident whether the type of starvation induced is by

arginine only, histidine only, or histidine followed by arginine. By contrast, unpublished

experiments by Wright indicate that CP78 leuB mRNA levels are significantly higher than

for CP79 when starved for leucine.

An explanation o f this anomaly may be due to differences in the turnover rates of

the respective mRNA transcripts of CP78 and CP79. The assay used only measured the

amount o f transcript at a particular point in time. Turnover studies need to be performed

for a precise understanding of the actual rates of transcriptional synthesis and degradation

during the initial stages o f the stringent response. If ppGpp affects mRNA turnover, then

it is possible that the actual rate of transcription in strain CP78 could be higher than

appears from measuring mRNA levels alone.

The passive control model of Jensen and Pedersen might provide another

explanation. Recent work by Heinemann and Wagner (30), and by Krohn and Wagner

(35), provide strong support for a model that combines RNA polymerase modification and

ppGpp-induced transcriptional pausing. According to this model, ppGpp alters RNA

polymerase so that at stringently controlled promoters it is trapped due to tighter initial

binding. This serves to affect initiation and elongation through the secondary effect of

increased pausing o f the polymerase. The effect of this pausing is to increase the length of

time that transcription bubbles occur throughout the gene. As previously discussed this

increased exposure o f single-stranded DNA could lead to increased mutation rates. It is

further proposed that ppGpp-mediated binding of additional RNA polymerases would


51

continue further magnifying the effect. So, although there would be no observed

differences in total argH mRNA synthesis between CP78 and CP79, ppGpp could act to

cause transient increases in pausing in CP78 thus causing an increase in mutations that

strain compared to CP79.

The results indicate that starving for histidine alone does not increase the amount

o f argH mRNA transcript levels above logarithmic levels. Starvation for histidine

produces an amount o f ppGpp that is one third that of arginine starvation and is not

enough to overcome the effects o f arginine repression. These results support the

contention that the stringent response is specific for the type o f starvation regime imposed

by the environment. Thus, one would expect that starvation for arginine would

specifically cause mutations only in the arginine regulon.

So far, no revertants have been sequenced to determine the nature o f the reversion.

Therefore, the finding that the mutation in the argH gene is an opal stop codon is

significant. It can be argued that the perceived reversion rates may be affected in both

CP78 and CP79 by the appearance of a large number o f suppressor mutations. Although

suppressor mutations tend to grow more slowly, some fast-growing suppressors could be

counted as "true" reversions. The finding that the mutation in the argH gene is an opal

nonsense mutation, however, tends to diminish this possibility since the suppressors of this

mutation are extremely rare.

There are several areas of further research that are suggested by the present

studies. O f most interest is to determine if, in the absence of arginine, there are differences

in the amount o f pausing in the argH gene during transcription. This, coupled with the


52

previously suggested turnover studies would give a more accurate picture o f events during

the onset o f the stringent response. Mutation rate experiments with an argR strain would

shed light on the role, if any, o f the repressor-mediated derepression o f the argH gene.

Finally, the nature o f the argH reversions should be examined to determine the extent to

which opal suppressors may have increased the observed mutation rates in these studies.

The primary purpose of this research was to develop an additional model (the

arginine biosynthetic pathway) which could be compared and contrasted to the existing

leucine biosynthetic pathway in the study of the Wright hypothesis. Toward that end

further analyses of the reversion rates of an arginine auxotroph were performed, the nature

o f the mutation in that auxotroph was determined, and mRNA level studies were

performed. The data generated from this research indicate that there are significant

differences between the arginine and leucine models particularly in how their respective

transcriptional regulation mechanisms affect the generation of mutation rates during

derepression. The mRNA probe developed as a result of this research will be useful in

further studies of mRNA turnover during the early phases of the stringent response, in

RNA polymerase pausing studies, and in studies to determine the contribution o f

derepression o f the argR repressor protein in mutation rate generation.


53

References

1. Beardsley, T. Evolution Evolving: New findings suggest mutation is more complicated than anyone thought. Scientific American. September 1997. pp 15,18.

2. Beletskii, A. and Bhagwat, A. S. 1996. Transcription-induced mutations: Increase in C to T mutations in the nontranscribed strand during transcription in Escherichia co lt Genetics. 93:13919-13924.

3 . Brock, R. D. Differential Mutation of the P-Galactosidase Gene of Escherichia coli. Mutation Research. 11:181-186.

4. Burnet, F. M. 1929. "Smooth-rough" variation in its relation to bacteriophage. J. Path. Bact. 32:15-42.

5. Cairns, J ., Overbaugh, J ., and Miller, S. 1988. The origin o f mutants. Nature. 335:142-145.

6. Cairns, J . and Foster, P. L. 1991. Adaptive Reversion o f a Frameshift Mutation \n Escherichia coli. Genetics. 128:695-701.

7. Cashel, M., Gentry, D. R., Hernandez, V. J . and Vinella, D. 1996. The Stringent Response, p. 1458-1496. In F. C. Neidhardt, R. Curtis III, J. L. Ingraham, E. C. C. Lin, K. B. Magasanik, W. S. Reznikofi^ M Riley, M Schaechter and H. Umbarger (ed ), Escherichia coli and Salmonella typhimurium, vol 2. American Society o f Microbiology, Washington, DC.

8. Cavalli-Sforza, L. L. and Lederberg, J. 1956. Isolation of preadaptive mutants in bacteria by sib selection. Genetics. 41:142-145.

9. Cordaro, J . C. and Balbinder, E. 1967. An operator constitutive mutation in a mutant for the first structural gene of the tryptophane operon. Bacteriol. Proc. 15:51.

10. Culotta, E. 1994. A Boost for "Adaptive Mutation." Science. 265:318-319.


54

11 C unin , R ., Boyen, A., Pouwels, J ., Glansdorff, N. and Crabeel, M. 1975. Parameters of gene expression in the bipolar argECBH operon o f £. coli K-12; the question o f translational control. Mol. Gen. Genet. 140:51-60.

12. D arw in, C R. 1859. The Origin o f Species. London: John Murray.

13. D atta, A. and Jinks-Robertson, S. 1995. Association o f Increased Spontaneous Mutation Rates with High Levels of Transcription in Yeast. Science. 268:1616- 1618.

14. Davis, B. D. 1989. Transcriptional bias: A non-Lamarckian mechanism for substrate-induced mutations. Proc. Natl. Acad. Sci. (USA). 86:5005-5009.

15. d 'H erelle, F. 1926. The Bacteriophage and Its Behavior. Baltimore: Williams and Wilkins.

16. Donini, P. Santonastaso, V., Roche, J . and Cossone, A. J. 1978. The Relationship between Guanosine Tetraphosphate, Polysomes, and RNA Synthesis in Amino Acid Starved Escherichia coli. Molec. Biol. Rep. 4:15-29.

17. Fix, D, F. and Glickman, B. W, 1987 Asymmetric cytosine deamination revealed by spontaneous mutational specificity in an Ung- strain o f Escherichia coli. Mol. Gen. Genet. 209:78-82

18. Foster, P. L. 1992. Directed Mutation: Between Unicorns and Goats. J. Bact 174:1711-1716.

19. Foster, P. L. and Cairns, J . 1992. Mechanisms o f Directed Mutation. Genetics 131:783-789.

20. G alitski, T. and Roth, J . R. 1995. Evidence That F Plasmid Transfer Replication Underlies Apparent Adaptive Mutation. Science. 268:421-423.

21. G alitski, T. and Roth, J . R. 1996. A Search for a General Phenomenon of Adaptive Mutability. Genetics. 143:645-659

22. GlandsdorIT, N. 1996. Biosynthesis o f Arginine and Polyamines, p. 408-433. In F. C. Neidhardt, R Curtis 111, J. L. Ingraham, E. C. C. Lin, K. B. Magasanik, W. S. Reznikoff, M Riley, M. Schaechter and H. Umbarger (ed ), Escherichia coli and Salmonella typhimurium, vol 1. American Society o f Microbiology, Washington, DC


55

23. Gratia* A. 1921. Studies on the d'Herelle phenomenon. J. Exp. Med. 34:115- 131.

24. Hall* B. G. 1988. Adaptive Evolution That Requires Multiple Spontaneous Mutations. I. Mutations Involving an Insertion Sequence. Genetics. 120:887-897.

25. Hall* B. G. 1990. Spontaneous Point Mutations That Occur More Often When Advantageous Than When Neutral. Genetics. 126:82-86.

26. Hall, B. G. 1991. Increased Rates of Advantageous Mutations in Response to Environmental Challenges. ASM News. 57:82-86.

27. Hall* B. G. and Gallant, J. A. 1973. On the Rate o f Messenger Decay during Amino Acid Starvation. J. Mol. Biol. 73:121-124.

28. Harris, R. S.* Longerich, S.* and Rosenberg, S. M. 1994. Recombination in Adaptive Mutation. Science. 264:258-260.

29. Harris* R. S.* Ross* K. J.* and Rosenberg* S. M. 1996. Opposing Roles of the Holliday Junction Processing Systems of Escherichia coli in Recombination- Dependent Adaptive Mutation. Genetics. 142:681-691.

30 Heinemann* M. and Wagner* R. 1997. Guanosine 3',5'-bis(diphosphate) (ppGpp)-dependent inhibition of transcription from stringently controlled Escherichia coli promoters can be explained by an altered initiation pathway that traps RNA polymerase. Eur. J. Biochem. 247:990-999.

3 1. Herman* R. K. and Dworkin* N. B. 1971. Effect of gene induction on the rate o f mutagenesis by ICR-191 in Escherichia coli. J. Bact. 106:543-550.

32. Hutchinson* F. 1987. Mutagenesis, p. 2218-2235. 7w Neidhardt, F. C ,Ingraham, J , Low, K , Magasanik, B , Schaechter, M., and Umbarger, H E. (ed.), Escherichia coli and Salmonella typhimurium, vol 1. American Society of Microbiology, Washington, DC.

33. Jen sen * K. F. and Pedersen* S. 1990. Metabolic growth rate control in Escherichia coli may be a consequence of subsaturation of the macromolecular biosynthetic apparatus with substrates and catalytic components Microbiol. Reviews. 54:89-100.


56

34. K ingston, R. E., Nierm an, W. C., and Cham berlain, M. J . 1981. A direct effect o f guanosine tetraphosphate on pausing of Escherichia coli RNA polymerase during RNA chain elongation. J. Biol. Chem. 256:2787-2797.

35. K rohn , M. and W agner, R. 1996. Transcriptional Pausing of RNA Polymerase in the Presence o f Guansosine Tetraphosphate Depends on the Promoter and Gene Sequence. J. Biol. Chem. 271:23884-23894.

36. Krzyzek, R. and Rogers, P. 1976. Dual Regulation by Arginine o f the Expression of the Escherichia coli argECBH Operon. J. Bact. 126:348-364.

37. Krzyzek, R. and Rogers, P. 1976. Effect o f Arginine on the Stability and Size of argECBH Messenger Ribonucleic Acid in Escherichia coli. J. Bact. 126:365-376

38. Lederberg, J . and Lederberg, E. M. 1952. Replica plating and indirect selection o f bacterial mutants, J. Bact. 63:399-406.

39. Lenski, R. E. and M ittler, J . E. 1993. The Directed Mutation Controversy and Neo-Darwinism. Science. 29:188-194.

40. Lenski, R. E., Slatkin, M., and Ayala, F. J. 1989. Mutation and selection in bacterial populations: Alternatives to the hypothesis of directed mutation. Proc. Natl. Acad. Sci. (USA). 86:2775-2778.

41. L urla , S.E., and Delbriick, M. 1943. Mutations of bacteria from virus sensitivity to virus resistance. Genetics 28:491-511.

42. L indahl, T. and Nyberg, B. 1974. Heat-Induced Deamination o f Cytosine Residues in Deoxyribonucleic Acid. Biochemistry. 13:3405-3410.

43. M aas, W. K. 1994. The Arginine Repressor o îEscherichia coli. Microbiological Reviews. 58:631-640.

44. M ayr, E. 1997. This is Biology: The Science o f the Living World, Cambridge: Belknap Press.

45. M cLeilan, W. L. and Vogel, H. J. 1973. Stability of argECBH Messenger RNA Under Arginine Excess or Restriction. Biochem. Biophys. Res. Comm 55:1385- 1389.


57

46 Piettc, J., Cunin, R., Boyen, A., Charlier, D., Crabeel, M., Van Vliet, V,Glansdorff, N., Squires, C., and Squires, C. L. 1982. The regulatory region of the divergent argECBH operon in Escherichia coli K-12.

47. Rogers, P., Krzyzek, R., Kaden, T. M ., and Arfman, E. 1971 Effect of Arginine and Canavanine on Arginine Messenger RNA Synthesis. Biochem. Biophys. Res. Commun. 44:1220-1226.

48. Radicella, J. P, Park, P. U., and Fox, M. S. 1995. Adaptive Mutation in Escherichia coli. A Role for Conjugation. Science. 268:418-420.

49. Rogers, P., Krzyzek, R., Kaden, T. M. and Arfman, E. 1971. Effect of Arginine and Canavanine on Messenger RNA Synthesis. Biochem. Biophys. Res. Comm. 44:1220-1226.

50. Rosenberg, S. M. 1994. In pursuit of a molecular mechanism for adaptive mutation. Genome. 37:893-899,

51. Rosenberg, S. M., Reuben, R. S., Longerich, S., and Galloway, A. M. 1996. Recombination-dependent mutation in non-dividing cells. Mut. Res. 350:69-76.

52. Ryals, J., Little, R., and Bremer, H. 1982. Control o f rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate. J. Bact. 151:1261- 1268.

53. Ryan, F. J. 1952. Distribution of numbers of mutant bacteria in replicate cultures. Nature. 169:882-883.

54. Shapiro, J. A. 1984. Observations on the formation o f clones containing araB- lacZ cistron fusions. Mol. Gen. Genet. 194:79-90.

55. Sniegowski, P. D. 1995. A test of the Directed Mutation Hypothesis in Escherichia coli MCS2 Using Replica Plating. J. Bact. 177:1119-1120.

56. Sniegowski, P. D. and Lenski, R. E 1995. Mutation and Adaptation: The Directed Mutation Controversy in Evolutionary Perspective. Annu. Rev. Ecol. Syst. 26:553-578.

57. Stewart, F. M., Gordon, D. M., Levin, B. R. Fluctuation Analysis: The Probability Distribution o f the Number o f Mutants Under Different Conditions. Genetics. 124:175-185.


58

58. Tracey, T. E. and Mulcahy, L. S. 1991. A simple method for the direct automated sequencing o f PCR fragments. Bio Techniques. 11:68-75.

59. Vogel, U., Sorensen, M ., Pedersen, S., Jensen, K. F., and Kilstrup, M. 1992. Decreasing transcription elongation rate in Escherichia coli exposed to amino acid starvation. Molec. Microbiol. 6:2191-2200.

60. Williams, M. G. and Rogers, P. 1987. Expression of arg Genes o f Escherichia coli during Arginine Limitation Dependent upon Stringent Control o f Translation. J. Bact. 169:1644-1650.

61. Wright, B.E. 1996. The effect o f the stringent response on mutation rates in Escherichia coli K-12. Molec. Microbiol. 19:213-219.

62. Wright, B. E. 1997. Does selective gene activation direct evolution? FEES Letters. 402:4-8.

63. Wright, B. E., Longacre, A, and Reimers, J. Submitted. Specifically Induced Mutations in Derepressed opérons of Escherichia coli.

64. Wright, B E., and Minnick, M.F. 1997. Reversion rates in a leuB auxotroph of Escherichia coli K-12 correlate with ppGpp levels during exponential growth. Microbiol. 143:847-854.

65. Zidwick, M. J., Keller, G., and Rogers, P. 1984. Regulation and Coupling of argECBH mRNA and Enzyme Synthesis in Cell Extracts of Escherichia coli. J. Bact. 159:640-646.

66. Z id w ic k , M. J., Korshus, J., and Rogers, P. 1984. Positive Control of Expression of the argECBH Gene Cluster In Vitro by Guanosine 5'-Diphophate 3'- Diphosphate. J. Bact. 159:647-651


reversion rate and mrna transcript level studies of the

Documents