rights / license: research collection in copyright - non ...2858/eth... · chapter 4. chd3 proteins...
TRANSCRIPT
![Page 1: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/1.jpg)
Research Collection
Doctoral Thesis
Mechanisms of polycomb group-mediated gene regulation inArabidopsis thaliana
Author(s): Villar, Corina Belle R.
Publication Date: 2010
Permanent Link: https://doi.org/10.3929/ethz-a-006523012
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.
ETH Library
![Page 2: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/2.jpg)
Diss. ETH Nr. 19413
Mechanisms of Polycomb group-mediated gene regulation in Arabidopsis thaliana
A dissertation submitted to the
ETH ZURICH
For the degree of
Doctor of Sciences
Presented by
Corina Belle R. Villar
Master of Science, Leibniz Universität Hannover, Hannover, Germany
Born on June 1, 1980
Citizen of the Philippines
Accepted on the recommendation of
Prof. Dr. Claudia Köhler, examiner
Dr. Daniel Schubert, co-examiner
2010
![Page 3: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/3.jpg)
1
Acknowledgments
My utmost gratitude goes to all the people who made this thesis possible.
First and foremost, thanks to my doctoral supervisor, Prof. Dr. Claudia Köhler, for
taking me in as one of her students and guiding me throughout these four years. It has
been a privilege to work with you.
Thanks also go to Dr. Daniel Schubert and Lars Hennig for being part of my doctoral
committee and giving me advice. Thanks to Prof. Dr. Wilhelm Gruissem for sharing
lab and office facilities, without which I would not have been able to do the work.
Thanks to everyone with whom I worked in my projects, especially to the Köhler
group (past and present) who have always been helpful and supportive. This work
would not have been possible without the excellent and helpful atmosphere in the lab,
as well as the friendly atmosphere outside the lab. Thanks for the tips and tricks on
how to get experiments going, as well as the discussions about work, life and
everything else. I have learned a lot from these wonderful people. And I will miss
Switzerland moreso because I will miss them. And of course thanks for all the nice
gifts (tangible and intangible) they’ve given me these last four years – I treasure them
all.
Thanks to my family for always being there, by text, email, snail mail, phone or
messenger, whenever I needed them. No need to mention them all by name, but I
would like to dedicate this thesis to my Lolo Agoy, the best grandfather anyone can
ever hope to have. As Emily Dickinson once wrote, “Unable are the loved to die, for
love is immortality.”
![Page 4: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/4.jpg)
2
Table of Contents Acknowledgments..........................................................................................................1 Table of Contents...........................................................................................................2 Summary ........................................................................................................................4 Zusammenfassung..........................................................................................................6 Chapter 1. Introduction ..................................................................................................8
1.1 Chromatin structure .............................................................................................8 1.2 Chromatin structure modifications ......................................................................9
1.2.1 Histone variants ............................................................................................9 1.2.2 Nucleosome positioning variability depending on species and chromosome position.................................................................................................................12 1.2.3 Nucleosome positioning variability depending on activity of chromatin remodelers............................................................................................................12 1.2.4 Histone modifications .................................................................................17 1.2.5 DNA methylation........................................................................................19
1.3 Polycomb group proteins ...................................................................................22 1.3.1 Polycomb group protein recruitment ..........................................................22 1.3.2 Gene repression by Polycomb group complexes ........................................24 1.3.3 Polycomb group complexes in plant development .....................................24
Chapter 2. Objectives of the study...............................................................................27 Chapter 3. Control of PHERES1 imprinting in Arabidopsis by direct tandem repeats28
3.1 Abstract ..............................................................................................................28 3.2 Introduction........................................................................................................29 3.3 Results................................................................................................................31
3.3.1 PHE2 Is a Direct Target Gene of the FIS PcG Complex and Is Biallelically Expressed .............................................................................................................31 3.3.2 Presence of PHE1 Repeat Sequences Is Conserved in Different Arabidopsis Accessions............................................................................................................34 3.3.3 Tandem Repeats in PHE1 3’ Regions Are Required for PHE1 Imprinting35
3.4 Discussion ..........................................................................................................37 3.5 Materials and Methods.......................................................................................39
3.5.1 Plant Material and Growth Conditions .......................................................39 3.5.2 Plasmid Constructs and Generation of Transgenic Plants ..........................39 3.5.3 RNA Extraction and qPCR Analysis ..........................................................39 3.5.4 Allele-Specific Expression Analysis...........................................................40 3.5.5 GUS Expression Analysis...........................................................................40 3.5.6 Chromatin Immunoprecipitation.................................................................40 3.5.7 Repeat Identification and Bisulfite Sequencing..........................................40
3.6 Supplementary Data...........................................................................................42 3.7 Funding ..............................................................................................................46 3.8 Acknowledgments..............................................................................................46 3.9 References..........................................................................................................46
Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis .........................................................................................51
4.1 Abstract ..............................................................................................................51 4.2 Introduction........................................................................................................52 4.3 Results................................................................................................................55
![Page 5: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/5.jpg)
3
4.3.1 PICKLE and PICKLE RELATED2 Act Redundantly in Suppressing Embryonic Identity ..............................................................................................55 4.3.2 Up- and Down-Regulated Genes in pkl Are Enriched for H3K27me3 ......56 4.3.3 PKL Binds Directly to Genes with Reduced Expression in pkl Mutants ...58 4.3.4 pkl pkr2 Mutants Have Reduced Expression of PcG Genes and Reduced H3K27me3 Levels ...............................................................................................62 4.3.5 PKL and PcG Proteins Act Antagonistically on a Similar Set of Target Genes....................................................................................................................65
4.4 Discussion ..........................................................................................................68 4.4.1 PKL Acts as Transcriptional Activator.......................................................68 4.4.2 PKL Has a trxG-like Function ....................................................................69 4.4.3 PKL Is Required for Expression of PcG Proteins that Are Subject of Autoregulation .....................................................................................................69 4.4.4 PKL Represses Embryonic Traits Via Maintaining PcG Protein Activity .70
4.5 Materials and Methods.......................................................................................72 4.5.1 Plant Material and Growth Conditions .......................................................72 4.5.2 Transcript Level Analysis ...........................................................................72 4.5.3 Anti–PKL Antibodies and Protein Immunoblot Analysis ..........................73 4.5.4 Chromatin Immunoprecipitation.................................................................73 4.5.5 Localization of Triacylglycerols .................................................................74 4.5.6 Microarray Analysis....................................................................................74
4.6 Acknowledgements............................................................................................75 4.7 Footnotes............................................................................................................75 4.8 Supporting Information......................................................................................76 4.9 References..........................................................................................................93
Chapter 5. The chromatin remodeler PICKLE and Polycomb group proteins act together to time seed germination................................................................................99
5.1 Abstract ..............................................................................................................99 5.2 Introduction......................................................................................................100 5.3 Results..............................................................................................................103
5.3.1 Expression of CLF is inversely correlated with expression of ABI3 and ABI5 during germination....................................................................................103 5.3.2 Levels of H3K27me3 at the ABI3 locus increase during germination......104 5.3.3 PcG proteins regulate seed germination ...................................................105 5.3.4 Loss of PICKLE enhances the PcG mutant phenotype ............................107 5.3.5 PKL is required for H3K27me3 at the ABI3 locus during germination ...110
5.4 Discussion ........................................................................................................112 5.5 Materials and Methods.....................................................................................115
5.5.1 Chemical and plant materials....................................................................115 5.5.2 Arabidopsis seed surface sterilization.......................................................115 5.5.3 Plant growth conditions ............................................................................116 5.5.4 Germination time course..........................................................................116 5.5.5 Chromatin immunoprecipitation...............................................................116 5.5.6 Standard molecular biology procedures....................................................118
5.6 References........................................................................................................121 Chapter 6. Conclusions ..............................................................................................125 Chapter 7. References ................................................................................................129 Curriculum Vitae .......................................................................................................143
![Page 6: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/6.jpg)
4
Summary
Inside the nucleus, DNA is associated with proteins called histones to form chromatin.
Aside from compacting DNA, chromatin structure regulates access to the DNA by
proteins and other macromolecules, thereby also regulating gene expression, among
other DNA-related processes. Regulating gene expression is especially important
during the development of multicellular organisms, as different cells at different
stages of the life cycle require the expression of different genes. Chromatin structure
can be altered by modifying the histones, modifying the DNA itself, and/or by the
action of chromatin remodeling factors. Polycomb group (PcG) proteins are
evolutionarily conserved proteins that establish gene repression by modifying histones.
They act in concert with other chromatin modifiers to regulate expression of specific
genes. Arabidopsis thaliana has different PcG proteins that control different aspects
of its development.
The FERTILIZATION INDEPENDENT SEED (FIS) PcG complex functions during
seed development in the female gametophyte and the endosperm to repress specific
genes. One of its targets is the PHERES1 (PHE1) gene, which codes for a
transcription factor. The FIS complex controls PHE1 expression by genomic
imprinting, the monoallelic expression of specific genes dependent on the parent-of-
origin. PHE1 is maternally imprinted and paternally expressed. Binding of the FIS
complex is not sufficient to establish PHE1 imprinting. PHE1 imprinting also requires
the presence of tandem repeats at a differentially methylated region downstream of
the PHE1 coding region. These results support the model that the unmethylated
regions of the maternal PHE1 allele block transcription either by formation of a
repressive intrachromosomal loop or by acting as an insulator. In contrast, in the
paternal allele where this region is methylated, either loop formation is inhibited or
the region fails to act as an insulator.
In roots, lack of PcG function results in the formation of embryonic roots that can
form somatic embryos. Similarly, lack of the putative chromatin remodeling factor
PICKLE (PKL) causes cells to de-differentiate and to form somatic embryos. PKL
targets in the roots include PcG genes SWINGER and EMBRYONIC FLOWER 2.
![Page 7: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/7.jpg)
5
SWN and EMF are part of a PcG complex that is responsible for trimethylating
histone H3 at lysine 27 (H3K27me3). Therefore, lack of PKL and its close homolog
PICKLE-RELATED 2 (PKR2) resulted in reduced PcG activity and lower
H3K27me3 levels and increased expression of some PcG target genes. Furthermore,
PKL and PKR2 were shown to activate some PcG target genes. Therefore PKL and
PKR2 counteract PcG repressive activities and have Trithorax group (trxG)-like
functions during development.
This study also reavealed that PcG proteins regulate seed germination. Transition to
germination is controlled by the relative levels of the hormones gibberrellic acid (GA)
and abscisic acid (ABA). Under normal germination conditions, GA levels increase
while ABA levels drop rapidly. This drop in ABA also correlates with a drop in the
expression of the ABA-induced genes ABSCISIC ACID INSENSITIVE 3 (ABI3) and
ABI5. This study showed that ABI3 repression determines the timing of seed
germination, and that decrease in ABI3 expression levels is accompanied by an
increase in Polycomb group (PcG) gene expression as well as an increase in PcG
activity as shown by increased level of H3K27me3 at the ABI3 locus during
germination. These results suggest that ABI3 repression during seed germination is
due to PcG activity at the ABI3 locus. The study also showed that PKL likely
facilitates PcG-mediated ABI3 repression during germination.
![Page 8: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/8.jpg)
6
Zusammenfassung
Chromatin ist eine hochmolekulare Struktur aus DNA, DNA-bindenden Histonen und
anderen Chromatin-assoziierten Proteinen. Neben der Kompaktierung der DNA spielt
das Chromatin auch eine Rolle in der Zugänglichkeit der DNA für Proteine und
andere Makromoleküle und reguliert auf diese Weise dieGenexpression. Die
Regulation der Genexpression ist besonders wichtig während der Entwicklung von
multizellulären Organismen, da die verschiedenen Zellen während den einzelnen
Entwicklungsstufen die Expression verschiedener Gene benötigen. Die
Chromatinstruktur kann durch Modifikationen der Histone, der DNA selber und/oder
durch die Aktivität von Chromatin „Remodeling Factors“ verändert werden.
Polycomb Gruppen (PcG) Proteine sind evolutionär konservierte Proteine, die die
Genexpression unterdrücken indem sie Histone modifizieren. Diese Proteine agieren
zusammen mit anderen Chromatin Modifikationen, um die Expression spezifischer
Gene zu regulieren. Arabidopsis thaliana besitzt verschiedene PcG Proteine die
unterschiedliche Aspekte der Entwicklung kontrollieren.
Der FERTILIZATION INDEPENDENT SEED (FIS) PcG Komplex ist im weiblichen
Gametophyten und dem Endosperm aktiv und reprimiert spezifische Gene. Eines
dieser Zielgene ist das Gen PHERES1 (PHE1), das für einen Transkriptionsfaktor
kodiert. Der FIS Komplex kontrolliert die Expression von PHE1 durch genomische
Prägung. Genomische Prägung ist ein epigenetisches Phänomen, bei welchem nur ein
Allel eines Gens aktiv ist. Die Aktivität des Alleles wird dabei massgeblich davon
bestimmt, von welchem Elter es vererbt wird. PHE1 ist maternal inaktiv und
väterlich aktiv, wobei die Bindung des FIS Komplexes alleine nicht ausreicht, um die
Prägung von PHE1 zu verursachen. Die Inaktivierung von PHE1 erfordert auch die
Anwesenheit von unterschiedlich methylierten Sequenzen, die sich im Tandem
wiederholen und sich hinter der kodierenden Region von PHE1 befinden. Diese
Ergebnisse unterstützen ein Modell, in dem die unmethylierten Regionen des
mütterlichen PHE1 Allels durch Bildung einer intrachromosomalen Schleife oder
durch Isolatorwirkung die Transkription blockieren. Im Gegensatz dazu kann das
väterliche Allel keine Schleife bilden oder eine isolierende Wirkung ausüben, da die
Region mit den Tandemsequenzen methyliert ist.
![Page 9: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/9.jpg)
7
In Wurzeln führt das Fehlen von PcG Proteinen zur Bildung von embryonischen
Wurzeln, die somatische Embryos formen können. Das Fehlen des mutmasslichen
Chromatin „Remodeling Factor“ PICKLE (PKL) verursacht einen ähnlichen Effekt,
Zellen re-differenzieren und bilden somatische Embryos. Zielgene von PKL in den
Wurzeln sind die PcG Gene SWINGER und EMBRYONIC FLOWER 2, die für PcG
Proteine kodieren, die wiederum für die Trimethylierung von Histon H3 am Lysin 27
(H3K27me3) verantwortlich sind. Aus diesem Grund führt ein Fehlen von PKL und
einem sehr ähnlichen Protein, PICKLE-RELATED 2 (PKR2) zu einem niedrigeren
H3K27me3-Gehalt und erhöhter Aktivität einiger PcG Zielgene. Ausserdem konnte
gezeigt werden, dass PKL und PKR2 bestimmte PcG Zielgene aktivieren. Folglich
wirken PKL und PKR2 der unterdrückenden Aktivität der PcG Proteine entgegen und
zeigen eine ähnliche Funktion wie Trithorax Gruppen (TrxG) Proteine während der
Entwicklung.
In dieser Studie konnte auch gezeigt werden, dass PcG Proteine massgeblich die
Keimung regulieren. . Der Übergang zur Keimung wird durch die relative Menge der
Hormone Gibberellinsäure (GA) und Abscisinsäure (ABA) kontrolliert. Unter
normalen Keimungsbedingungen steigt der GA-Gehalt an während der ABA-Gehalt
rapide abnimmt. Dieser Abfall im ABA-Gehalt korreliert mit einer sinkenden
Aktivität der ABA-induzierten Gene ABSCISIC ACID INSENSITIVE 3 (ABI3) und
ABI5. Experimente haben gezeigt, dass der Zeitpunkt der Keimung durch den ABI3-
Gehalt bestimmt wird und dass die sinkende ABI3-Aktivität während der Keimung
sowohl mit steigenden mRNA levels der PcG Gene CLF und SWN als auch mit einer
erhöhten PcG Aktivität (H3K27me3-Gehalt) am ABI3 Locus nach der Keimung
korreliert. Ausserdem konnte gezeigt werden, dass PKL wahrscheinlich die Bindung
der PcG Proteine an den ABI3 Locus erleichtert.
![Page 10: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/10.jpg)
8
Chapter 1. Introduction
During the life of a higher eukaryotic organism, it undergoes various developmental
processes, involving cell division and cell differentiation. And during these processes
the organism has to be able to specifically “know” which genes should be active and
which genes should be repressed. How the DNA is packaged is crucial to this
complex process of gene regulation. Within the nucleus, DNA is not “naked”, rather it
is associated with proteins called histones, to make up the structure called chromatin.
Chromatin structure serves to compact DNA, as well as to regulate access to DNA by
proteins and other macromolecules present in the nucleus. Therefore chromatin
structure directly affects DNA-related processes such as replication, transcription and
repair.
1.1 Chromatin structure
Every roughly 147 base pairs of DNA is wrapped in 1.7 turns around an octamer of
histone proteins – two of each of the “core” histones H2A, H2B, H3 and H4 (Arents
et al., 1991) – to form the chromatin’s repeating unit called the nucleosome. Adjacent
nucleosomes are linked to each other by variable stretches of DNA (called linker
DNA).
The core histones are arranged as a globular octamer, where the H3-H4 tetramer and
the H2A and H2B dimer core histones are present in all eukaryotes, so the structure
and sequence of core histones is quite conserved (Bash and Lohr, 2001). They contain
N-terminal tails that protrude outside the nucleosome core and are subject to various
post-translational modifications that affect gene regulation.
Eukaryotes also produce other histone proteins (H1 and its variants), called linker
histones because they associate with linker DNA (Ramakrishnan et al., 1993), but the
exact location of linker histone within the nucleosome is a subject of debate (Izzo et
al., 2008). However, it does not play an essential role in lower eukaryotes since
deletion of the H1 gene in Tetrahymena (Shen et al., 1995), yeast (Hellauer et al.,
2001) and Aspergillus (Ramon et al., 2000) did not affect growth or viability. In
![Page 11: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/11.jpg)
9
higher eukaryotes, it is known that histone H1 plays a role in the stabilization of
chromatin structure, nucleosome spacing, and regulation of specific genes through
DNA methylation (Fan et al., 2005; Hashimoto et al., 2010). It is also important in
organism viability, as loss of H1 in Drosophila through RNAi resulted in cell lethality
(Lu et al., 2009), and similarly, loss of H1 in Caenorhabditis produced severe
phenotypes such as infertility (Jedrusik and Schulze, 2001).
1.2 Chromatin structure modifications
Chromatin structure can be altered in several ways: nucleosome positioning,
modifications of histones, modifications of DNA and histone substitutions. These
factors are by no means independent of each other, so in many cases there is interplay
among these factors during gene regulation.
1.2.1 Histone variants
“Canonical” histone genes are present within genomes in repeat arrays and their
transcription is tightly coupled to DNA replication, whereas other histone genes are
found in single copies, are constitutively expressed and encode histone variants that
differ in amino acid sequence from their canonical counterparts. Canonical histones
function primarily in genome packaging and gene regulation, non-canonical histone
variants function in a range of processes that include DNA repair, chromosome
segregation and promoter insulation (Table 1; reviewed in Talbert and Henikoff,
2010). Differences in nucleosome structure caused by different histone variants are
shown in Figure 1 (Campos and Reinberg, 2009).
![Page 12: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/12.jpg)
10
![Page 13: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/13.jpg)
11
Figure 1. Structural differences among nucleosomes composed of different histone variants. Campos and Reinberg, 2009.
![Page 14: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/14.jpg)
12
1.2.2 Nucleosome positioning variability depending on species and chromosome position
Nucleosomes are not evenly or randomly distributed within the genome. Nucleosome
positioning varies depending on the organism, the location within the chromosome,
and the presence and activity of ATP-dependent chromatin remodelers.
The length of linker DNA, and therefore spacing between nucleosomes, varies
according to species, cell type and location in the chromosome. Yeast has ~20 bp of
linker DNA (Mavrich et al., 2008a) while Drosophila has ~30 bp (Mavrich et al.,
2008b) and humans have ~40 bp (Schones et al., 2008). It has been observed that
there are more nucleosomes in coding regions than in intergenic regions or non-
coding regions (Lee et al., 2007; Chodavarapu et al., 2010), that there are more
nucleosomes in centromeres than in telomeres (Mavrich et al., 2008a, Segal et al.,
2006), and that nucleosomal DNA is more highly methylated than flanking DNA
(Chodavarapu et al., 2010). Within nucleosome-bound DNA, there has been observed
a 10-bp periodicity of methylated DNA, suggesting that nucleosomes dictate access to
the DNA by methyltransferases (Chodavarapu et al., 2010).
1.2.3 Nucleosome positioning variability depending on activity of chromatin remodelers
During DNA-related processes, nucleosomes need to be moved, ejected, replaced and
properly spaced. And it is through the actions of different chromatin remodelers to do
this (Figure 2; Clapier and Cairns, 2009). Chromatin remodelers can move already
deposited histone octamers so that additional octamers can be deposited (Figure 2A).
Chromatin remodelers can expose certain DNA sequences to DNA-binding proteins
(DBP) by repositioning, ejection or unwrapping (Figure 2B). Chromatin remodelers
can also alter histone composition (Figure 2C) through exchanging histones with
variants or ejecting the histones.
Chromatin remodelers use their ATPase domain to hydrolyze ATP and produce
energy to break DNA-histone associations. There are four classes of chromatin
remodelers: SWI/SNF (switching defective/sucrose non-fermenting), ISWI (imitation
switch), INO80 (inositol-requiring 80) and CHD (chromodomain, helicase, DNA-
![Page 15: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/15.jpg)
13
binding). Each class has different domains in its ATPase catalytic site (Figure 3;
Clapier and Cairns, 2009). SWI/SNF, CHD and ISWI classes each have a short
insertion within the ATPase domain, whereas the INO80 remodelers contain a long
insertion. Each family has a distinct combination of flanking domains: bromodomains
and HSA (helicase-SANT) for SWI/SNF remodelers, SANT-SLIDE for ISWI
remodelers, tandem chromodomains for CHD remodelers and HSA domain for
INO80 remodelers. Different chromatin remodeling complexes have been suggested
to functionally interact with each other (Lindstrom et al., 2006; Xella et al., 2006;
Erkina et al., 2010).
Figure 2. Action of chromatin remodelers. Clapier and Cairns, 2009.
1.2.3.1 SWI/SNF chromatin remodelers
First discovered in Saccharomyces cerevisiae mutants defective in mating type
switching (swi) and sucrose fermentation (sucrose non-fermenting, snf), SWI/SNF
proteins were subsequently shown to alter chromatin structure in the presence of ATP
(Cote et al., 1994). The catalytic ATPase includes a HSA (helicase-SANT) domain, a
post-HSA domain and a C-terminal bromodomain. SWI/SNF proteins act in
complexes with 8 to 14 subunits. SWI/SNF remodelers have been shown to promote
proper kinetochore function and chromosome segregation (Hsu et al., 2003; Huang et
al., 2004), homologous recombination (Chai et al., 2005), transcription initiation
(Armstrong et al., 2002) and transcription elongation (Brown et al., 1996).
![Page 16: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/16.jpg)
14
Figure 3. Different classes of chromatin remodelers. Clapier and Cairns, 2009.
In the Arabidopsis thaliana genome, there are at least 42 putative chromatin
remodelers, named CHR1 to CHR42 (CHROMATIN REMODELING)
(http://www.chromdb.org/). Three of the putative SWI/SNF-related genes that have
been identified in screens have been studied in detail and given alternative names
according to their mutant phenotypes – DECREASED DNA METHYLATION 1
(DDM1; also known as CHR1), BRAHMA (BRM, also known as CHR2) and
SPLAYED (SYD, also known as CHR3).
DDM1 was discovered in a mutant screen for deregulated DNA methylation (Vongs
et al., 1993) and was then later discovered to have sequence homology to SWI/SNF
chromatin remodelers (Jeddeloh et al., 1999) and to remodel nucleosomes in vitro
(Brzeski and Jerzmanowski, 2003). Loss of DDM1 causes a massive decrease in
normal DNA methylation, which causes morphological abnormalities in subsequent
generations of self-pollination (Kakutani et al., 1996). DDM1 was also shown to be
required for the deacetylation of lysine 16 of histone H4 (Soppe et al., 2002).
Arabidopsis BRM is closest in sequence to Drosophila BRM, and has been shown to
bind nucleosomes in vitro (Farrona et al., 2007). BRM loss-of-function mutants are
viable but exhibit abnormalities such as dwarfism, early flowering and male sterility
(Farrona et al., 2004; Hurtado et al., 2006). Furthermore, BRM activates flower
homeotic genes (Hurtado et al., 2006), and represses seed storage genes in leaves
![Page 17: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/17.jpg)
15
(Tang et al., 2008). BRM has been shown to bind to ATSWI3B and ATSWI3C, an
Arabidopsis homolog of the yeast SWI3 subunit in vitro (Farrona et al., 2004;
Hurtado et al., 2006).
syd loss-of-function mutants also show dwarfism and floral homeotic transformations
like brm mutants, but do not show root developmental defects or complete male
sterility (Wagner and Meyerowitz, 2002). And whereas brm and syd single mutants
are viable, brm syd double mutants arrest at heart stage (Wagner and Meyerowitz,
2002). Like BRM, SYD was also shown to interact with ATSWI3B and ATSWI3C,
but only SYD can interact with ATSWI3A (Hurtado et al., 2006; Bezhani et al., 2007).
This suggests that BRM and SYD act redundantly in regulating some targets but not
others.
1.2.3.2 ISWI chromatin remodelers
ISWI chromatin remodelers were first studied in Drosophila (Elfring et al., 1994).
This class of chromatin remodelers is distinguished by the SANT and SLIDE domains
in the C-terminal region (Figure 3). ISWI proteins also act in complexes, some of
which (e.g. ACF, CHRAC, RSF, WICH) act in chromatin assembly (Ito et al., 1997;
Varga-Weisz et al., 1997), others like the NURF, NoRC, Isw1 and Isw2 complexes,
regulate various aspects of transcription (Zhou et al., 2002; Goldmark et al., 2000;
Morillon et al., 2003).
So far Arabidopsis has 2 putative ISWI-class chromatin remodelers that have been
described, PHOTOPERIOD-INDEPENDENT EARLY FLOWERING 1 (PIE1),
which corresponds to CHR13, and CHR11. As its name implies, PIE1 was discovered
in a screen for early flowering mutants in short days but was later found to be early
flowering independent of photoperiod (Noh and Amasino, 2003). Although it is
similar to both SWI/SNF and ISWI classes of remodelers, but because of its SANT
domain in the C-terminal region, it was classified as an ISWI protein. PIE1 was
shown to regulate flowering time independently of FLC. In RNAi studies with
CHR11, it has been shown to be necessary for normal cell expansion and female
gametophyte development (Huanca-Mamani et al., 2005).
![Page 18: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/18.jpg)
16
1.2.3.3 INO80 chromatin remodelers
INO80 class of chromatin remodelers were first isolated from Saccharomyces
cerevisiae in a mutant screen for yeast defective in transcription response to inositol
depletion (Ebbert et al., 1999), and then was subsequently shown to be part of a
complex that induces ATP-dependent nucleosome sliding in vitro (Shen et al., 2003).
They contain a long insertion within the ATPase domain (Figure 3). INO80 was
shown to function in transcriptional regulation of its target genes in yeast (Jonsson et
al., 2004), double-stranded DNA break repair (van Attikum et al., 2004; Bao and Shen,
2007), and DNA replication (Papamichos-Chronakis and Peterson, 2008; Vincent et
al., 2008).
An INO80 homologous gene has been characterized in Arabidopsis, INO80, which
corresponds to CHR21. In the study by Fritsch et al. (2004), loss of function of INO80
results in homologous recombination deficiency. In the same study INO80 was also
shown to bind to mononucleosomes in vitro.
1.2.3.4 CHD chromatin remodelers
CHD chromatin remodelers possess 2 N-terminal chromodomains, a centrally located
SNF2-like ATPase domain and a C-terminal DNA-binding domain (Figure 3). CHD
proteins were first characterized in mice (Delmas et al., 1993). CHD proteins have
been shown to function in transcriptional regulation (Simic et al., 2003), RNA
splicing (Tai et al., 2003), and chromatin assembly (Lusser et al., 2005).
Arabidopsis has three CHD homologs: PICKLE/GYMNOS (PKL/GYM), PICKLE-
RELATED 1 (PKR1) and PICKLE-RELATED 2 (PKR2), which correspond to CHR6,
CHR4 and CHR7, respectively. PKR1 has been described to have a role in DNA
damage repair (Shaked et al., 2006). PKL/GYM was discovered in two independent
mutant screens. In the screen by Baker et al. (1997) for Arabidopsis mutants showing
carpel defects, it was named GYM, while in the screen by Ogas et al. (1997) for
mutants showing abnormal root development, it was named PKL. gym mutants have
shorter and narrower carpels than wild-type, and the cells of the the valves and the
![Page 19: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/19.jpg)
17
style mature later than wild-type (Eshed et al., 1999). Although gym single mutants do
not show ectopic ovule formation or cell fate alterations, gym does enhance the crabs
claw (crc) phenotype and the gym crc mutants show ectopic ovule formation (Eshed
et al., 1999). PKL has been shown to repress embryonic genes (Ogas et al., 1997;
Rider et al., 2004). pkl mutants have swollen, greenish roots that look like pickled
cucumbers, hence the name. When placed on normal growth media, roots with the
pickle phenotype form callus-like structures that eventually form somatic embryos.
Furthermore, pkl plants are bushy, have dark green leaves, and have reduced apical
dominance (Ogas et al., 1997; Eshed et al., 1999), much similar to plants that are
mutants in giberellic acid (GA) biosynthesis or signaling. When sprayed with GA, the
pkl mutant phenotype is partially rescued (Ogas et al., 1997). pkl mutants not only
showed overexpression of embryonic trait regulators LEAFY COTYLEDON 1 (LEC1),
LEC2 and FUSCA3, but also of PHERES1 (PHE1), which is a target of Polycomb
group proteins (to be discussed in section 1.3).
1.2.4 Histone modifications
Post-translational modifications of histones are reversible covalent modifications of
amino acids such as serine and threonine phosphorylation, lysine acetylation, and
lysine and arginine methylation.
1.2.4.1 Histone acetylation
Histone acetylation and deacetylation is controlled by histone acetyltransferases
(HATs) and histone deacetylases (HDACs), respectively. Acetylation of the lysine
resides removes positive charges, which reduces the affinity between histones and
DNA, making the DNA more accessible to polymerases and other transcription
factors (Roth et al., 2001). In plants histone hyperacetylation is associated with gene
activity (Chua et al., 2003). The Arabidopsis genome encodes for at least 12 HATs
and 17 HDACs (Hsieh and Fischer, 2007). HDA6, for example, was shown to be
involved in transgene silencing (Murfett et al., 2001) and RNA-induced transgene
methylation (Aufsatz et al., 2002).
![Page 20: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/20.jpg)
18
1.2.4.2 Histone phosphorylation
Histone H3 at serine 10 is phosphorylated by many different kinases (reviewed in Oki
et al., 2007), including mitogen and stress-activated protein kinases 1 and 2 (MSK1
and MSK2), cAMP-dependent protein kinase A (PKA), NIMA kinase and Aurora B
kinase.
Early studies in Chinese hamster cells showed that histone H3 phosphorylation
increases during mitosis (Gurtley et al., 1975), initiating at the pericentromere during
late G2 phase and then spreads throughout the chromatin up to the end of mitosis
(Hendzel et al., 1997). The same pattern of histone phosphorylation was also shown in
plants (Houben et al., 1999). But whereas phosphorylation of serine residues 10 and
28 at histone H3 spreads from the pericentromere in animals, the same modifications
in plants is restricted to the position of the pericentromere during mitosis and meiosis
II (Houben et al., 2007). Histone phosphorylation has been linked to transcriptional
activation in Drosophila (Nowak and Corces, 2000) and plants (Li et al., 2001).
Some studies have shown that there is crosstalk between phosphorylation of histone
H3 serine 10 (H3S10) with other histone modifications. H3S10 phosphorylation
enhances acetylation of histone H3 lysine 14 (Lo et al., 2000), removes acetylation of
H3 lysine 9 (Edmondson et al., 2002) and inhibits methylation of H3 lysine 9 (Rea et
al., 2000).
1.2.4.3 Histone methylation
Several lysine residues in histones H3 and H4 can be methylated. Mono- and
dimethylation of H3 at lysine 9 (H3K9me1/me2) and trimethylation of lysine 27
(H3K27me3), as well as monomethylation of H4 at lysine 20 (H4K20me1) have been
shown to be associated with silenced chromatin, while methylation of H3K4 and
H3K36 and trimethylation of H3K9 (H3K9me3) are associated with active chromatin
(Hsieh and Fischer, 2005).
![Page 21: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/21.jpg)
19
Histones are methylated by the action of SET (SU(VAR)3-9, E(Z) and Trithorax)
domain proteins (Rea et al., 2000). The Arabidopsis genome encodes 41 SET domain
proteins, of which only a few have been studied. The first plant histone
methyltransferase KRYPTONITE (KYP) was shown to methylate H3K9 in vitro.
MEDEA (MEA), CURLY LEAF (CLF) and SWINGER (SWN) are homologs of the
Drosophila Polycomb group protein ENHANCER OF ZESTE (E(Z)) which is
associated with trimethylated H3K27. Polycomb group proteins will be discussed in
detail in section 1.3.
1.2.5 DNA methylation
DNA methylation involves the covalent addition of a methyl group to the 5-position
of the cytosine pyrimidine ring by DNA methyltransferases. DNA methylation has
been linked to gene silencing and is present in transposable elements. In mammals,
DNA methylation modulates chromatin structure through recruitment of methylated-
DNA binding domain (MBD) proteins that in turn recruit histone deacetylases and
other proteins that contribute to gene silencing (Bird and Wolffe, 1999). In plants,
DNA methylation also plays a role in transposon and transgene silencing
(Martienssen and Colot, 2001). In both plants and mammals, DNA methylation also
plays a key role in genomic imprinting, the differential expression of parental alleles
depending on the parent of origin.
In mammals, DNA methylation occurs mostly in the CG context (a cytosine adjacent
to a guanidine), while in plants it occurs in contexts: CG, CHG and CHH, where H
can be A, C or T (Cokus et al., 2008; Table 2). In mammals, de novo DNA
methylation is established by the DNA METHYLTRANSFERASE 3 (DNMT3)
enzymes and maintained by DNMT1. In plants, de novo DNA methylation is
established by the DNMT3 homolog DOMAINS REARRANGED
METHYLTRANSFERASE 2 (DRM2) and maintained by three different enzymes
depending on the methylation pattern – DNA METHYLTRANSFERASE 1 (MET1)
maintains CG methylation, CHROMOMETHYLASE 3 (CMT3) maintains CHG
methylation, and the persistent de novo methylation by DRM2 maintains CHH
methylation.
![Page 22: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/22.jpg)
20
Table 2. Methylation patterns and enzymes known in plants and animals.
Mammals Arabidopsis Methylation pattern CG CG, CHG, CHH Maintenance DNA methylation enzymes
DNMT1 MET1, CMT3
De novo DNA methylation enzymes
DNMT3A, DNMT3B DRM1, DRM2
Demethylation enzymes MBD4, TDG, AID, APOBEC
DME, ROS1, DML2, DML3
1.2.5.1 Establishing DNA methylation
DNA methylation in mammals covers up to 90% of the genome, except for clusters
known as CpG islands (Ehrlich et al., 1982). This is established during early embryo
development at implantation stage, through the activity of DNMT3A and DNMT3B
(Sasaki and Matsui, 2008). After implantation, epigenetic reprogramming occurs in
the germ cells and all DNA methylation established in the previous generation is
erased. Therefore, DNA methylation patterns need to be re-established.
In plants, it was discovered by Wassenegger et al. (1994) that DNA methylation can
be guided by RNA in a process called RNA-directed DNA methylation (RdDM). In
this process, small RNAs target homologous DNA sequences for cytosine methylation.
In the current model for RdDM (Matzke et al., 2009), RNA POLYMERASE IV (Pol
IV) transcribes single-stranded RNA, which are converted to double-stranded RNA
by RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and then processed into
short interfering RNA (siRNA) by DICER-LIKE 3 (DCL), which are then methylated
by HUA ENHANCER 1 (HEN1) prior to loading into the RNA-induced silencing
complex (RISC), whose catalytic component is ARGONAUTE 4 (AGO4). Then the
siRNA/RISC bind to transcripts of RNA POLYMERASE V (Pol V), guiding the
DNA methyltransferase DRM2 and chromatin remodelers to the target loci.
1.2.5.2 Maintaining DNA methylation
Once established, DNA methylation patterns need to be stably maintained. In
mammals DNA methylation is maintained by DNMT1, which interacts with other
![Page 23: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/23.jpg)
21
proteins such as ubiquitin-like plant homeodomain and RING finger domain 1
(UHRF1) which may recruit DNMT1 to DNA (Bostick et al., 2007).
In plants, CG DNA methylation is maintained by the DNMT1 homolog MET1
(Ronemus et al., 1996; Bartee and Bender, 2001), CHG methylation is largely
maintained by CMT3 (Lindroth et al., 2001), and CHH methylation is controlled by
CMT3 and DRM2 in some loci (Cao and Jacobsen, 2002).
1.2.5.3 Erasing DNA methylation
DNA methylation can be lost either passively by successive replications in the
absence of DNA methylation maintenance, or actively by removing methylated
cytosines.
Active demethylation in animals occurs in primordial germ cells and on the paternal
genome of the zygote. Several proteins, including the thymine glycosylase
METHYLATED DNA BINDING DOMAIN 4 (MBD4), as well as deaminases
ACTIVATION-INDUCED CYTOSINE DEAMINASE (AID) and
APOLIPOPROTEIN B MRNA-EDITING ENZYME 1 (APOBEC1) are involved in
DNA demethylation (Zhu, 2009). Recent studies in mouse (Okada et al., 2010) also
suggest that proteins from the elongator complex, namely ELONGATOR COMPLEX
PROTEIN 1 (ELP1), ELP3 and ELP4, also play critical roles.
In plants, active demethylation is achieved by a family of DNA glycosylases -
DEMETER (DME), REPRESSOR OR SILENCING 1 (ROS1), DEMETER-LIKE
2(DML2) and DML3 (Choi et al., 2002; Gong et al., 2002; Ortega-Galisteo et al.,
2008). These glycosylases remove methylated cytosines regardless of context. DME
acts in the central cell of the female gametophyte and globally demethylates the
maternal genome (Hsieh et al., 2009; Gehring et al., 2009), while the other
glycosylases function in vegetative tissues (Zhu et al., 2007). This difference in
methylation levels between maternal and paternal genomes in the endosperm leads to
establishment of genomic imprinting of specific genes. Genomic imprinting is the
phenomenon by which specific genes are differentially expressed from the paternal or
![Page 24: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/24.jpg)
22
maternal allele, depending on its parent of origin. So far, ten genes have been
identified to be imprinted in Arabidopsis, and all of them are expressed preferentially
in the endosperm (Gehring et al., 2009).
1.3 Polycomb group proteins
Polycomb group proteins were originally identified in a screen for mutants with extra
sex combs in Drosophila. The second mutant, identified by Lewis (1947), was called
polycomb. Since then several other Polycomb group (PcG) mutants have been
characterized and their corresponding genes identified. PcG proteins are required to
repress homeotic (Hox) genes and other developmental regulators in cells where they
must remain inactive (Schwartz and Pirrotta, 2007). Later on it was discovered that
this group of proteins are also present in other animals, plants and fungi.
1.3.1 Polycomb group protein recruitment
PcG complexes in Drosophila are recruited to their target genes by cis-acting
Polycomb response elements (PREs). PREs have also been recently discovered in
mammals, named PRE-kr, which regulate the expression of the MafB/Kreisler
segmentation gene (Sing et al., 2009). PRE-kr was able to recruit PcG proteins in flies
and mouse F9 cell lines. While precise PREs have not yet been identified in plants,
promoter and non-coding region studies of some Arabidopsis PcG target genes such
as PHERES1 (PHE1) (Köhler et al., 2003) and AGAMOUS (AG) (Sieburth and
Meyerowitz, 1997) have shown that these DNA regions are necessary for PcG-
mediated regulation.
![Page 25: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/25.jpg)
23
![Page 26: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/26.jpg)
24
1.3.2 Gene repression by Polycomb group complexes
PcG proteins function in multi-subunit complexes. In Drosophila, so far there are four
PcG complexes that have been characterized (Schwartz and Pirrotta, 2007;
Scheuermann et al., 2010). Different complexes have distinct functions depending on
the biochemical activities of their subunits (Table 3).
Drosophila PRC1 and PRC2 catalyze histone modification marks ubiquitination of
lysine 119 of histone H2A (H2AK119ub) and trimethylation of lysine 27 of histone
H3 (H3K27me3), respectively. Both marks are associated with transcriptional
repression. PRC1 was shown to compact nucleosomal arrays in vitro, suggesting that
formation of a compact chromatin structure is involved in the PcG-mediated
repression (Francis et al., 2004). However, studies in Arabidopsis have shown that in
some cases, H3K27me3 by itself is not sufficient for target gene repression (Schubert
et al., 2006; Makarevich et al., 2008).
1.3.3 Polycomb group complexes in plant development
Homologs to the PRC1 and PRC2 complexes have been identified in animals, with
multiple homologs found in mice and human (Morey and Helin, 2010). In plants,
there are three known complexes homologous to the Drosophila PRC2 complex
(Table 3). There are currently 12 known homologs to Drosophila PRC2 subunits in
Arabidopsis: FERTILIZATION INDEPENDENT ENDOSPERM (FIE),
MULTICOPY SUPPRESSOR OF IRA 1 – 5 (MSI1 – 5), EMBRYONIC
FLOWERING 2 (EMF2), FERTILIZATION INDEPENDENT SEED 2 (FIS2),
VERNALIZATION 2 (VRN2), CURLY LEAF (CLF), MEDEA (MEA) and
SWINGER (SWN). The Arabidopsis PcG complexes were named after the subunit
unique to each one – FIS complex from FIS2, EMF complex from EMF2 and VRN
complex from VRN2. These complexes control different aspects of plant development
(Figure 4; Hennig and Derkatcheva, 2009). And recently, plant homologs to
Drosophila PRC1 proteins have been identified (Sanchez-Pulido et al., 2008) – three
are similar to mouse B lymphoma Mo-MLV insertion region 1 BMI1 (AtBMI1A,
AtBMI1B, AtBMI1C), and two are similar to RING1 (AtRING1A, AtRING1B).
AtBMI1A and AtBMI1B have been shown to also catalyze histone H2A
![Page 27: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/27.jpg)
25
monoubiquitination (Bratzel et al., 2010), similar to its homologs in Drosophila.
AtRING1A was shown to bind to itself, AtRING1B, LIKE HETEROCHROMATIN
PROTEIN 1 (LHP1) and CLF (Xu and Shen, 2008).
The FIS complex is composed of FIS2, MEA, MSI1 and FIE. Loss-of-function
mutants of these components are characterized by the ability to start seed
development without fertilization (Grossniklaus et al., 1998; Köhler et al., 2003). In
the absence of fertilization fis (fertilization independent seed) mutants, develop seed-
like structures without an embryo. However, if fertilized, fis mutant embryos develop
normally until they abort at the heart stage (5 – 6 days after pollination).
Figure 4. Polycomb complexes in the plant life cycle. Hennig and Derkatcheva, 2009.
The FIS complex is also involved in genomic imprinting. Genomic imprinting is the
phenomenon by which one allele of the gene is differentially expressed depending on
the parent of origin. One target of the FIS complex is the putative MADS-box
transcription factor PHE1 (Köhler et al., 2003), which is a maternally imprinted gene
expressed in the endosperm. The maternal allele is repressed, while the paternal allele
is active. However it was shown that although FIS complex is necessary for PHE1
imprinting, it is not sufficient (Makarevich et al., 2008). Aside from encoding PcG
![Page 28: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/28.jpg)
26
proteins, MEA and FIS2 are also imprinted genes. While FIS2 imprinting depends
more on DNA methylation (Jullien et al., 2006), imprinting of MEA depends on an
autoregulatory mechanism with the action of the DNA glycosylase DME (Xiao et al.,
2003; Baroux et al., 2006; Gehring et al., 2006). DME, acts on the central cell to
hypomethylate the maternal allele, allowing MEA to be expressed maternally.
Meanwhile, the paternal MEA allele is silenced by the action of PcG proteins
(including MEA) that are expressed maternally. Thus, MEA is able to regulate its own
imprinting. From the different mechanisms that establish imprinting, it is clear that
imprinting is not a one-size-fits-all mechanism, but rather can have different
mechanisms for different targets.
The EMF and VRN complexes play important roles during the sporophytic phase of
plant development. Loss of function of CLF causes pleiotropic phenotype such as
early flowering; formation of small, narrow and curled leaves; and homeotic
transformations in the flower (Goodrich et al., 1997). Loss of function of the homolog
SWN does not cause any abnormal morphology, but swn was shown to enhance the
clf mutant phenotype (Chanvivattana et al., 2004). A swn clf double mutant forms a
callus-like structure that eventually forms somatic embryos, therefore, suggesting that
CLF and SWN act redundantly in regulating target genes important for plant cell
differentiation. In a recent study by Schatlowski et al. (2010) identified an interacting
partner for CLF in regulating cell differentiation – BLISTER (BLI), a novel protein
sharing similarity to STRUCTURAL MAINTENANCE OF CHROMOSOMES
(SMC) proteins that are essential for nuclear division. Similar to the swn clf mutant,
the bli mutant also shows loss of cellular identity. BLI physically interacts with CLF,
represses some of its target genes (SEPALLATA 2 (SEP2), SEP3 and PISTILLATA
(PI)) as well as activate others (FLC).
![Page 29: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/29.jpg)
27
Chapter 2. Objectives of the study
The objective of this study was to elucidate the mechanisms by which Polycomb
group proteins regulate gene expression during different stages of the Arabidopsis
thaliana life cycle, specifically:
1. genomic imprinting of PHERES1 in the endosperm during seed development,
2. cellular differentiation in the root, and
3. timing of seed germination.
![Page 30: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/30.jpg)
28
Chapter 3. Control of PHERES1 imprinting in Arabidopsis
by direct tandem repeats
Corina Belle R. Villar, Aleksandra Erilova, Grigory Makarevich, Raphael Trösch and Claudia Köhler
Published in Molecular Plant (2009) 2 (4): 654-660. doi: 10.1093/mp/ssp014 First published online: May 7, 2009
3.1 Abstract
Genomic imprinting is an epigenetic phenomenon that causes monoallelic expression
of specific genes dependent on the parent-of-origin. Imprinting of the Arabidopsis
gene PHERES1 requires the function of the FERTILIZATION INDEPENDENT
SEED (FIS) Polycomb group complex as well as a distally located methylated region
containing a tandem triple repeat sequence. In this study, we investigated the
regulation of the close PHERES1 homolog PHERES2. We found that PHERES2 is
also a direct target gene of the FIS Polycomb group complex, but, in contrast to
PHERES1, PHERES2 is equally expressed from maternal and paternal alleles. Thus,
PHERES2 is not regulated by genomic imprinting, correlating with the lack of tandem
repeats at PHERES2. Eliminating tandem repeats from the PHERES1 locus abolishes
PHERES1 imprinting, demonstrating that tandem repeats are essential for PHERES1
imprinting. Taking these results together, our study shows that the recently duplicated
genes PHERES1 and PHERES2 are both target genes of the FIS Polycomb group
complex but only PHERES1 is regulated by genomic imprinting, which is likely
caused by the presence of repeat sequences in the proximity of the PHERES1 locus.
![Page 31: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/31.jpg)
29
3.2 Introduction
Genomic imprinting is an epigenetic phenomenon in animals and plants that results in
the monoallelic expression of specific genes dependent on the parent-of-origin. In
plants, imprinting is confined to the endosperm, a terminally differentiated tissue that
develops after fertilization of the central cell (Feil and Berger, 2007). So far, five
imprinted genes have been identified in Arabidopsis. Four of them (MEDEA (MEA),
FWA, FERTILIZATION INDEPENDENT SEED 2 (FIS2), and MATERNALLY
EXPRESSED PAB C-TERMINAL (MPC) are maternally expressed and paternally
silenced (Vielle-Calzada et al., 1999; Kinoshita et al., 2004; Jullien et al., 2006a;
Tiwari et al., 2008). PHERES1 (PHE1) is the only known paternally expressed,
maternally silenced imprinted gene (Köhler et al., 2005; Makarevich et al., 2008).
Paternal imprinting of MEA as well as maternal imprinting of PHE1 requires the
FERTLIZATION INDEPENDENT SEED (FIS) Polycomb group (PcG) complex that
specifically trimethylates lysine 27 of histone H3 (H3K27me3) (Baroux et al., 2006;
Gehring et al., 2006; Jullien et al., 2006; Makarevich et al., 2008). Activation of MEA
as well as other known paternally imprinted genes in the female gametophyte requires
the 5-methylcytosine-excising activity of the DNA glycosylase DEMETER (DME).
As DME-mediated demethylation is confined to the endosperm, imprinted genes
remain methylated throughout the lifecycle of the plant (Xiao et al., 2003; Jullien et
al., 2006b; Kinoshita et al., 2004).
Imprinted genes are often associated with natural parasitic elements such as
transposon-derived sequences and tandem repeat sequences (Cao and Jacobsen, 2002;
Reinhart and Chaillet, 2005; Suzuki et al., 2007; Kinoshita et al., 2007; Makarevich et
al., 2008). As DNA methylation acts as a defense mechanism against parasitic DNA,
it has been suggested that genomic imprinting evolved as a consequence of this
defense mechanism (Barlow, 1993). However, whereas the presence of tandem
repeats is essential for imprinting establishment at some loci (Yoon et al., 2002), in
several cases, imprinting could be functionally disconnected from the presence of
repeat sequences (Lewis et al., 2004; Spillane et al., 2004; Fujimoto et al., 2008).
![Page 32: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/32.jpg)
30
Imprinting of PHE1 depends on a distantly located region downstream of the PHE1
locus. This downstream region must be DNA methylated for PHE1 expression and
unmethylated for PHE1 repression (Makarevich et al., 2008). Within this region, we
identified a triple tandem repeat that is missing in the closely related PHE1 homolog,
PHE2. We asked the question whether PHE2 is also regulated by genomic imprinting
and whether the presence of the tandem repeats is essential for imprinting
establishment at the PHE1 locus. In this study, we show that PHE1 and PHE2 are
differentially regulated and that the presence of the repeats is essential for imprinting
establishment at the PHE1 locus. Based on these data, we propose a model explaining
how the different modes of PHE1 and PHE2 regulation evolved.
![Page 33: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/33.jpg)
31
3.3 Results
3.3.1 PHE2 Is a Direct Target Gene of the FIS PcG Complex and Is Biallelically Expressed
PHE1 has been shown to be a direct target gene of the FIS PcG complex and to be
regulated by genomic imprinting (Köhler et al., 2003, 2005; Makarevich et al., 2008),
but the mechanistic connection between PcG targeting and genomic imprinting is not
fully understood. Therefore, we tested whether the close PHE1-homolog PHE2
(At1g65300) is also a direct target gene of the FIS complex. PHE1 and PHE2 share
high sequence similarity in their promoter and coding regions (Figure 1), but a small
deletion within PHE2 makes it distinguishable from the slower migrating PHE1
fragment in a PCR-based assay (Figure 2A). We performed chromatin
immunoprecipitation (ChIP) assays with anti-MEA antibodies and tested for MEA
enrichment at the PHE1 and PHE2 loci in closed flowers. As shown in Figure 2B,
both PHE1 and PHE2 sequences were enriched. We also tested whether PHE2
chromatin contains H3K27me3 and detected a significant enrichment for this mark
(Figure 2B). From these results, we conclude that PHE2 is a direct target gene of the
FIS PcG complex.
Figure 1. Structure of the PHE1 and PHE2 Loci. Numbers indicate position relative to the translational start sites.
![Page 34: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/34.jpg)
32
Figure 2. PHE2 Is a Direct Target Gene of the FIS PcG Complex. (A) Schematic diagram of the PHE1 and PHE2 loci indicating the regions probed by PCR after ChIP. The numbers indicate the position relative to the translational start sites. (B) ChIP analysis of MEA and H3K27me3 enrichment at the PHE1 and PHE2 (corresponding to the faster migrating band) loci in closed flowers. ChIP PCR was performed in triplicate, indicated by the numbers on top of the panel. Quantification of the results as relative enrichment over ACTIN is shown in the right panel. I, input; ACT, ACTIN.
FIS-mediated repression is necessary for imprinting at the PHE1 and MEA loci
(Köhler et al., 2005; Gehring et al., 2006). Therefore, we asked whether the newly
identified FIS target gene PHE2 is regulated by genomic imprinting as well. We made
use of a single nucleotide polymorphism (SNP) in the PHE2 sequence between the
Columbia (Col) and Landsberg erecta (Ler) Arabidopsis accessions. We compared
expression levels of maternally and paternally derived PHE2 alleles in siliques from
Ler × Col crossings at 1–4 d after pollination (DAP). In contrast to the preferential
paternal expression of PHE1 (Figure 3A), PHE2 was clearly biallelically expressed
(Figure 3B). These results suggest that PcG-mediated gene targeting and genomic
imprinting can be uncoupled. Since FIS-mediated imprinting is confined to the
endosperm (Feil et al., 2007), we tested whether PHE2 is expressed in the endosperm.
We detected expression of PHE2 in the endosperm but not in sporophytic tissues
(Figure 3C and data not shown). Thus, we conclude that imprinting is not a necessary
consequence of FIS PcG regulation.
![Page 35: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/35.jpg)
33
Figure 3. PHE2 Is Biallelically Expressed. (A) Allelic expression analysis of PHE1 after crosses of the Col-0 and C24 accessions. Analysis was performed at 1–4 d after pollination (DAP). (B) Allelic expression analysis of PHE2 in wild-type and mea mutant plants after crosses of Ler and mea plants with the Col-0 accession. Analysis was performed at 1–4 d after pollination. (C) Expression analyses of PHE2::GUStransgene in seeds at 3 DAP. Scale bar, 100 μm. (D) Relative PHE2 messenger RNA levels in wild-type and mea flowers before fertilization (0 DAP) and siliques harvested at different DAP. Numbers in all panels correspond to DAP. wt, wild type; g, genomic DNA; ACT, ACTIN.
We then asked whether binding of the FIS complex and H3K27me3 confer PHE2
repression. To this end, we analyzed allele-specific expression of PHE2 in a mea
mutant background. MEA is the subunit of the FIS complex that has H3K27
trimethylation activity, and, if this complex is also responsible for PHE2 repression,
up-regulation of PHE2 in a mea mutant is expected. In contrast to this prediction and
to our previous preliminary results (Köhler et al., 2003), PHE2 was not significantly
up-regulated in mea × Col crossings (Figure 3B). Similarly, we did not detect
significantly higher PHE2 expression levels in self-fertilized mea mutant plants than
in wild-type (Figure 3D). Taken together, our results suggest that MEA targeting is
not in all cases sufficient to confer gene silencing, implying that additional
mechanisms are required for PcG-mediated silencing.
![Page 36: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/36.jpg)
34
Figure 4. Two Copies of Repeat Sequences Are Sufficient for DNA-Methylation. Cytosine methylation profiles of the PHE1 downstream region in the Col-0, Br-0, Bur-0, and Var2-1 accessions analyzed by bisulfite sequencing. Cytosine positions within CG contexts relative to the translational stop codon are indicated on the x-axis. Numbers refer to the Col-0 accession. For corresponding locations in other accessions, see Supplemental Figure 1. Asterisks indicate the lack of CG sites within a particular accession.
3.3.2 Presence of PHE1 Repeat Sequences Is Conserved in Different Arabidopsis Accessions
Based on our previous results demonstrating that a distantly located region in the 3’
region of the PHE1 locus is required for PHE1 imprinting (Makarevich et al., 2008),
we asked which elements within this region are necessary for PHE1 imprinting
establishment. Within this region, a triple tandem repeat sequence is located, each
repeat being 54 bps in length (Supplemental Figure 1). We detected significant
sequence similarity between PHE1 and PHE2 within the first 100 bps downstream of
the stop codon (Figure 1); however, there is no homology beyond this region and
there are also no other repeat sequences located within 4 kbps of the PHE2 3’ region.
Therefore, we asked whether the presence of triple tandem repeats is necessary for
PHE1 imprinting. We developed a PCR-based assay that allowed us to search for
Arabidopsis accessions lacking these repeats. We assayed 80 accessions and obtained
PCR products for 63 accessions (Supplemental Table 1). Among these 63 accessions,
we identified 18 accessions with only two repeats (Supplemental Table 1); however,
we failed to identify any accession with one or no copy of this repeat sequence. We
randomly sequenced three out of the 18 accessions with only two repeats and found in
all three cases the first repeat deleted (Supplemental Figure 1). Next, we addressed the
![Page 37: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/37.jpg)
35
question of whether the presence of double repeats is sufficient to recruit DNA
methylation. To this end, we analyzed the DNA methylation pattern at the repeat
region and the regions adjacent to the repeats of three accessions by bisulfite
sequencing. In all three accessions, these regions are methylated at a comparable level
as in Col-0 (Figure 4). We conclude that the presence of PHE1 repeat sequences and
methylation of these sequences are conserved among many Arabidopsis accessions.
3.3.3 Tandem Repeats in PHE1 3’ Regions Are Required for PHE1 Imprinting
To directly address the question of which elements within the PHE1 3’ region are
required for PHE1 imprinting, we generated PHE1 reporter constructs containing
parts of the 3’ region including or excluding the repeat region (Figure 5A). We
established transgenic plant lines containing these constructs and analyzed PHE1
imprinting in three independent lines for each construct. A reporter construct
containing 3 kbps of the PHE1 promoter, the PHE1 coding region, and 3.5 kbps of
PHE1 3’ region (‘Full-length’ in Figure 5) is only paternally expressed and maternally
silenced, reflecting the endogenous PHE1 expression pattern (Makarevich et al.,
2008). In contrast, constructs lacking the repeat region lost their imprinted expression
and became biallelically expressed (Figure 5D and 5E). However, a construct that
contained the repeats but lacked the DNA methylated region immediately downstream
of the repeats was biallelically expressed as well (Figure 5C), indicating that the
repeats as well as the region downstream of the repeats are essential for PHE1
imprinting.
![Page 38: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/38.jpg)
36
Figure 5. Deletion of the PHE1 Repeats Abolishes PHE1 Imprinting. (A) Schematic diagram of PHE1 reporter constructs containing parts of the 3’ region with or without the repeat region. (B–E) Percent of GUS-positive seeds after reciprocal crosses of wild-type plants with plants heterozygous for the full-length PHE1::GUS_3’ construct (B), for the PHE1::GUS_3’ construct including the tandem repeats but lacking the region after the repeats (construct 1) (C), for the PHE1::GUS_3’ construct lacking only the repeats (construct 2) (D), and for the PHE1::GUS_3’ construct lacking the repeats and the 3’ region after the repeats (construct 3) (E). Numbers on the x-axis refer to different transgenic lines. n, number of seeds analyzed.
![Page 39: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/39.jpg)
37
3.4 Discussion
The FIS PcG complex acts specifically in the female gametophyte during seed
development, and two of its direct target genes, MEA and PHE1, are regulated by
genomic imprinting (Köhler and Makarevich, 2006). Therefore, we addressed the
question of whether genomic imprinting is a direct consequence of FIS PcG
regulation. We identified PHE2 as a novel direct FIS target gene. PHE2 is targeted
and methylated by the FIS PcG complex before fertilization and, given that FIS genes
are expressed after fertilization in the endosperm (Luo et al., 2000), it is likely that the
FIS complex is targeting PHE2 also after fertilization in the endosperm. However,
PHE2 was substantially expressed from both maternal and paternal alleles. Thus,
genomic imprinting and gene silencing are not necessary consequences of FIS PcG
targeting. Indeed, also, Schubert and colleagues (2006) observed that an AGAMOUS
(AG) transgene lacking regulatory regions is able to recruit CURLY LEAF-mediated
H3K27me3, but is de-repressed in leaves. Studies in Drosophila also support the view
that PcG proteins do not only act as a binary ON/OFF switch, but are also used to
dynamically modulate transcription levels of certain target genes (Oktaba et al., 2008).
PHE1 and PHE2 are closely related genes and likely arose from a recent duplication
event (Martinez-Castilla et al., 2003). However, both genes are regulated by different
mechanisms and, based on the results of this study, we hypothesize that this
difference is mediated by the presence of tandem triple repeats in the PHE1 3’ region.
The repeat region as well as a close neighboring region of the full-length PHE1
transgene is de-novo methylated by DRM1/DRM2 methyltransferases, and
methylation of this region is necessary for PHE1 imprinting (Makarevich et al., 2008).
Interestingly, among 63 Arabidopsis accessions, we did not identify a single accession
with fewer than two copies of the PHE1 3’ repeat sequence; however, we identified
18 accessions with only two instead of three copies. The presence of two copies is
sufficient to recruit DNA methylation to this region, suggesting that double repeats
might produce sufficient amounts of small RNAs to target de-novo methylation to this
region. Similarly, tandem repeats in the promoter of FWA are necessary and sufficient
for de-novo DNA methylation (Chan et al., 2006). Although even the non-repeated
SINE-related sequence itself is sufficient for epigenetic silencing of FWA by DNA
![Page 40: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/40.jpg)
38
methylation, it is likely to have a reduced stability of DNA methylation (Fujimoto et
al., 2008). Therefore, we hypothesize that the presence of double or triple repeats in
the PHE1 3’ region provides a selective advantage, enforcing their maintenance
during evolution.
We did not detect significant sequence similarity between PHE1 tandem repeats and
other defined repeat sequences in plant genomes (Ouyang and Buell, 2004). However,
we detected significant sequence similarity of the PHE1 repeat sequence with
sequences located on other Arabidopsis chromosomes (data not shown), suggesting
that repeat formation might have arisen by independent duplication events from an
ancestral unrepeated sequence. Once formed, tandem repeats appear to be preferential
targets for de-novo DNA methylation (Chan et al., 2006). We found DNA
methylation spreading into regions downstream of PHE1 repeats (Makarevich et al.,
2008) and the results of this study show that this methylated region is important for
PHE1 imprinting. Our new data support our previously proposed model (Makarevich
et al., 2008) that the unmethylated regions of the maternal PHE1 alleles block
transcription, either by forming a repressive loop or by acting as silencer elements. In
contrast, when this region becomes methylated on the paternal allele, it either fails to
act as insulator or inhibits loop formation. This model would predict that in the
absence of the differentially methylated region, transcription is not blocked anymore
and the unmethylated maternal alleles become expressed. In contrast, the absence of
the differentially methylated region should not change expression of the paternal
allele. These predictions are indeed supported by the findings presented in our
manuscript. By which mechanism the differentially methylated region interacts with
the promoter localized FIS PcG complex will be subject to later investigations.
The FIS PcG complex binds the PHE1 locus close to the transcriptional start site
(Makarevich et al., 2006). This region is highly similar between PHE1 and PHE2,
suggesting that expression of the ancestral PHE gene was controlled by the FIS PcG
complex. If tandem repeat formation occurred before PHE duplication, the ancestral
gene was likely to be imprinted and imprinting of PHE2 was lost after duplication.
Alternatively, if tandem repeat formation occurred after PHE duplication, imprinting
of PHE1 is likely to have evolved after duplication of the ancestral gene. Future
![Page 41: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/41.jpg)
39
investigations will address the evolutionary history of the PHE1 and PHE2 loci and
tandem repeat formation.
3.5 Materials and Methods
3.5.1 Plant Material and Growth Conditions
The mea mutant used in this study was the mea-1 allele (Ler accession) described by
Grossniklaus et al. (1998). Plants were grown in a growth chamber at 70% humidity
and daily cycles of 16 h light at 21°C and 8 h darkness at 18°C. Developed gynoecia
were emasculated and hand-pollinated 1 d after emasculation. For RNA expression
analysis, three gynoecia or siliques were harvested at the indicated time points.
Arabidopsis accessions used in this study were obtained by the Nottingham
Arabidopsis stock center and are specified in Supplemental Table 1.
3.5.2 Plasmid Constructs and Generation of Transgenic Plants
The PHE13000::GUS_3’ construct has been described before (Makarevich et al., 2008).
This plasmid was opened using NcoI and SbfI sites and PHE1 3’ PCR fragments were
introduced by ligation, resulting in construct 1 and construct 3. Construct 3 was
opened using XbaI and SbfI sites and a PHE1 3’ PCR fragment was introduced by
ligation, resulting in construct 2. To generate the PHE2::GUS construct, 3000 bp
sequences upstream of the PHE2 translational start site were amplified by PCR
introducing EcoRI and NcoI restriction sites and ligated into pCAMBIA1381z
(CISRO, City, Australia). Primers used to amplify the PHE1 3’ region and the PHE2
promoter region are specified in Supplemental Table 2.
The PHE13000::GUS_3’ construct and derivatives were introduced into the Ws
accession; the PHE2::GUS construct was introduced into the Col-0 accession.
3.5.3 RNA Extraction and qPCR Analysis
RNA extraction and generation of cDNAs were performed as described previously
(Köhler et al., 2005). Quantitative PCR was done on an ABI Prism 7700 Sequence
![Page 42: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/42.jpg)
40
Detection System (Applied Biosystems) using SYBR Green PCR master mix
(Applied Biosystems) according to the supplier's recommendations. The mean value
of three replicates was normalized using ACTIN11 as control. The primers used in this
study are specified in Supplemental Table 2.
3.5.4 Allele-Specific Expression Analysis
Allele-specific PHE1 expression was analyzed using the assay described by Köhler et
al. (2005). The amplified products were digested with HphI and analyzed on a 2.5%
agarose gel. Allele-specific PHE2 expression was tested by digesting PCR products
with TaqI and analyzed on a 2.5% agarose gel. All primers are specified in
Supplemental Table 2.
3.5.5 GUS Expression Analysis
Staining of seeds to detect GUS activity was done as described previously (Köhler et
al., 2003).
3.5.6 Chromatin Immunoprecipitation
We followed the ChIP protocol of Johnson et al. (2002). Anti-MEA antibodies were
described in Köhler et al. (2003). Antibodies against H3K27me3 were purchased from
Upstate (Charlottesville, USA) and Abcam (Cambridge, UK). ChIP results were
quantified using ImageJ. All primers used for ChIP analysis are specified in
Supplemental Table 2. For immunoprecipitation and input fractions, the ratio of
absolute levels of PHE1 and PHE2 to ACT7 was calculated. Relative enrichments
were calculated as the ratio of the obtained values in immunoprecipitation and input
fractions, according to Geisberg and Struhl (2004). Quantification of
immunoprecipitated material of all ChIP experiments was repeated at least twice.
3.5.7 Repeat Identification and Bisulfite Sequencing
To identify the number of PHE1 repeats in different Arabidopsis accessions, we
performed nested PCR using primers specified in Supplemental Table 2 and indicated
in Supplemental Figure 1. Primers anneal outside the repeat region and the number of
![Page 43: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/43.jpg)
41
repeats could be estimated based on the lengths of the PCR products. Bisulfite
sequencing was performed as described by Makarevich et al. (2008) using primers
specified in Supplemental Table 2.
![Page 44: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/44.jpg)
42
3.6 Supplementary Data
Supplementary Table 1. Number of PHE1 tandem repeats in different Arabidopsis accessions. NASC stock number Accession Repeat number N22614 Cvi-0 - N22615 Lz-0 - N22616 Ei-2 3 N22617 Gu-0 3 N22619 Nd-1 3 N22620 C24 3 N22622 Wei-0 3 N22623 Ws-0 3 N22624 Yo-0 3 N22625 Col-0 3 N22629 Est-1 3 N22634 Ga-0 3 N22638 Kas-2 3 N22642 Mt-0 3 N22643 Nok-3 3 N22652 Sakhdara 3 N22654 Kin-0 3 N22564 RRS-7 3 N22650 Ll-0 - N22640 Mr-0 3 N22641 Tsu-1 3 N22656 Bur-0 2 N22612 Uod-1 3 N22626 An-1 3 N22627 Van-0 - N22592 Pu2-7 3 N22605 Tamm-27 3 N22632 Ra-0 - N22631 Gy-0 3 N22602 CIBC5 3 N22598 NFA-8 3 N22606 KZ1 - N22644 Wa-1 3 N22658 Oy-0 2 N22645 Fei-0 - N22580 Var2-1 2 N22574 Lov-1 3 N22651 Kondara 3 N22628 Br-0 2 N22657 Edi-0 - N22566 Knox-10 3 N22567 Knox-18 2 N22568 Rmx-A02 3 N22569 RmxA180 3 N22570 Pna-17 3
![Page 45: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/45.jpg)
43
N22571 Pna-10 3 N22573 Eden-2 2 N22572 Eden-1 2 N22576 Fab-2 3 N22577 Fab-4 2 N22578 Bil-5 2 N22579 Bil-7 2 N22582 Spr1-2 2 N22583 Spr1-6 3 N22584 Omo2-1 3 N22585 Omo2-3 2 N22586 Ull2-5 3 N22587 Ull2-3 3 N22588 Zdr-1 - N22589 Zdr-6 - N22590 Bor-1 2 N22591 Bor-4 2 N22594 Lp2-2 3 N22595 Lp2-6 3 N22596 HR-5 3 N22597 HR-10 - N22600 Sq-1 2 N22601 Sq-8 3 N22608 Got-7 2 N22609 Got-22 2 N22610 Ren-1 - N22611 Ren-11 3 N22618 Ler-1 - N22630 Ag-0 - N22633 Bay-0 3 N22635 Mrk-0 - N22636 Mz-0 3 N22637 Wt-5 - N22648 Ts-5 - N22649 Pro-0 2
-, no PCR product obtained
![Page 46: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/46.jpg)
44
Supplementary Table 2. List of primers used in this study.
Experiment Gene Primers ChIP PHE1
(At1g65330)/ PHE2 (At1g65300)
Fwd: CACATGCCTACACGTAAG Rev: TCCAACACCGAAAACTCCAT
ChIP ACT7 (AT5G09810)
Fwd: CGTTTCGCTTTCCTTAGTGTTAGCT Rev: AAATCGGCATAGAGAATCAA
Allele-specific RT-PCR
PHE1 (At1g65330)
Fwd: CGCATGTGCGGTCATCC Rev: CGTCTCTTGATCCACCATCTTCTTGGTCC
Allele-specific RT-PCR
PHE2 (At1g65300)
Fwd: CTGCATTCGCAACAATAGGAAG Rev: GGAAGGCGTTGAAGACGT
RT-PCR ACT11 (At3g12110)
Fwd: GGAACAGTGTGACTCACACCATC Rev: AAGCTGTTCTTTCCCTCTACGC
RT-PCR PHE2 (At1g65300)
Fwd: GCCAAAGAAAAAGAGCAGCTG Rev: TGCATTCGCAACAATAGGAAG
Cloning of PHE2::GUS
PHE2 (At1g65300)
Fwd: TTGAATTCGGTGCTAAAGGTCTTTGCTTG Rev: TTCCCCATGGATCTATTGTTTTTGTTATATGTGTTTTG
Repeat analysis 1st PCR 2nd PCR
PHE1 (At1g65330)
Fwd: GGATCCTTTTACGGATGATTTTAGTCACCA Rev: TCTCCAAAGAGTAAACCGTA Fwd: CCATATTAAGAGAATAAACTAAAAGCG Rev: TTTTACGGATGATTTTAGTCAC
Bisulfite sequencing
PHE1 (At1g65330) 3' region
Fwd1: GTATGGAAGGTATTTGTATAAG Rev1: CTCTTAATATAAATAATTTAATCACCATATC Fwd2: GATAATATGATTATGATATGGTGA Rev2: TAACTCATCATAATTTCTTTACTGT Fwd3: TATTTATATTAAAGAATTAAAAATAGTAAA Rev3: TCAATTATAAATAACACCAATTCAATATAA
Cloning of Construct 1
PHE1 (At1g65330)
Fwd: TAGTCGAAGGGATGTATTTCG Rev: TTTTACGGATGATTTTAGTCACCA
Cloning of Construct 2
PHE1 (At1g65330)
Fwd: CCTGCAGGGACGTATCTTATGTGTACTT Rev: TCTAGATGGTGACTAAAATCATCCG
Cloning of Construct 3
PHE1 (At1g65330)
Fwd: TAGTCGAAGGGATGTATTTCG Rev: CGCTTTTAGTTTATTCTCTTAATATGG
![Page 47: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/47.jpg)
45
Supplementary Figure 1. Sequence of tandem repeats at the 3’ region of the PHE1 locus in accessions Var2-1, Br-0, Bur-0 and Col-0. Blue arrows, repeat sequences. Red arrows, position of primers used in the first PCR. Green arrows, position of primers used in nested PCR.
![Page 48: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/48.jpg)
46
3.7 Funding
This research was supported by the Swiss National Science Foundation to C.K.
(PP00A-106684/1), and by the ETH Research Grant TH-12 06-1 to C.K. C.K. is
supported by an EMBO Young Investigator Award.
3.8 Acknowledgments
We thank Dr L. Hennig for helpful comments on the manuscript. We are grateful to
Dr W. Gruissem for sharing laboratory facilities. No conflict of interest declared.
3.9 References
Barlow DP. (1993). Methylation and imprinting: from host defense to gene regulation?
Science 260, 309-310.
Baroux C, Gagliardini V, Page DR, Grossniklaus U. (2006). Dynamic regulatory
interactions of Polycomb group genes: MEDEA autoregulation is required for
imprinted gene expression in Arabidopsis. Genes Dev 20, 1081-1086.
Cao X, Jacobsen SE. (2002). Locus-specific control of asymmetric and CpNpgG
methylation by the DRM and CMT3 methyltransferase genes. Proc Natl Acad Sci U S
A 99 Suppl 4, 16491-16498.
Chan SW, Zhang X, Bernatavichute YV, Jacobsen SE. (2006). Two-step recruitment
of RNA-directed DNA methylation to tandem repeats. PLoS Biol 4, 1923-1933.
Feil R, Berger F. (2007). Convergent evolution of genomic imprinting in plants and
mammals. Trends Genet 23, 192-199.
![Page 49: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/49.jpg)
47
Fujimoto R, Kinoshita Y, Kawabe A, Kinoshita T, Takashima K, Nordborg M,
Nasrallah ME, Shimizu KK, Kudoh H, Kakutani T. (2008). Evolution and control of
imprinted FWA genes in the genus Arabidopsis. PLoS Genet 4, e1000048.
Gehring M, Huh JH, Hsieh TF, Penterman J, Choi Y, Harada JJ, Goldberg RB,
Fischer RL. (2006). DEMETER DNA glycosylase establishes MEDEA Polycomb
gene self-imprinting by allele-specific demethylation. Cell 124, 495-506.
Geisberg JV, Struhl K. (2004). Quantitative sequential chromatin
immunoprecipitation, a method for analyzing co-occupancy of proteins at genomic
regions in vivo. Nucleic Acids Res 32, e151.
Grossniklaus U, Vielle-Calzada JP, Hoeppner MA, Gagliano WB. (1998). Maternal
control of embryogenesis by MEDEA a Polycomb group gene in Arabidopsis. Science
280, 446-450.
Johnson L, Cao X, Jacobsen S. (2002) Interplay between two epigenetic marks: DNA
methylation and histone H3 lysine 9 methylation. Curr Biol 12, 1360-1367.
Jullien PE, Katz A, Oliva M, Ohad N, Berger F. (2006a). Polycomb group complexes
self-regulate imprinting of the Polycomb group gene MEDEA in Arabidopsis. Curr
Biol 16, 486-492.
Jullien PE, Kinoshita T, Ohad N, Berger F. (2006b). Maintenance of DNA
methylation during the Arabidopsis life cycle is essential for parental imprinting.
Plant Cell 18, 1360-1372.
Kinoshita T, Miura A, Choi Y, Kinoshita Y, Cao X, Jacobsen SE, Fischer RL,
Kakutani T. (2004). One-way control of FWA imprinting in Arabidopsis endosperm
by DNA methylation. Science 303, 521-523.
Kinoshita Y, Saze H, Kinoshita T, Miura A, Soppe WJ, Koornneef M, Kakutani T.
(2007). Control of FWA gene silencing in Arabidopsis thaliana by SINE-related direct
repeats. Plant J 49, 38-45.
![Page 50: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/50.jpg)
48
Köhler C, Makarevich G. (2006). Epigenetic mechanisms governing seed
development in plants. EMBO Rep 7, 1223-1227.
Köhler C, Hennig L, Spillane C, Pien S, Gruissem W, Grossniklaus U. (2003). The
Polycomb-group protein MEDEA regulates seed development by controlling
expression of the MADS-box gene PHERES1. Genes Dev 17, 1540-1553.
Köhler C, Page DR, Gagliardini V, Grossniklaus U. (2005). The Arabidopsis thaliana
MEDEA Polycomb group protein controls expression of PHERES1 by parental
imprinting. Nat Genet 37, 28-30.
Lewis A, Mitsuya K, Constancia M, Reik W. (2004). Tandem repeat hypothesis in
imprinting: deletion of a conserved direct repeat element upstream of H19 has no
effect on imprinting in the Igf2-H19 region. Mol Cell Biol 24, 5650-5656.
Luo M, Bilodeau P, Dennis ES, Peacock WJ, Chaudhury A. (2000). Expression and
parent-of-origin effects for FIS2, MEA, and FIE in the endosperm and embryo of
developing Arabidopsis seeds. Proc Natl Acad Sci U S A 97, 10637-10642.
Makarevich G, Leroy O, Akinci U, Schubert D, Clarenz O, Goodrich J, Grossniklaus
U, Köhler C. (2006). Different Polycomb group complexes regulate common target
genes in Arabidopsis. EMBO Rep 7, 947-952.
Makarevich G, Villar CB, Erilova A, Köhler C. (2008). Mechanism of PHERES1
imprinting in Arabidopsis. J Cell Sci 121, 906-912.
Martinez-Castilla LP, Alvarez-Buylla ER. (2003). Adaptive evolution in the
Arabidopsis MADS-box gene family inferred from its complete resolved phylogeny.
Proc Natl Acad Sci U S A 100, 13407-13412.
Oktaba K, Gutierrez L, Gagneur J, Girardot C, Sengupta AK, Furlong EE, Müller J.
(2008). Dynamic regulation by Polycomb group protein complexes controls pattern
formation and the cell cycle in Drosophila. Dev Cell 15(6), 877-889.
![Page 51: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/51.jpg)
49
Ouyang S, Buell CR. (2004). The TIGR Plant Repeat Databases: a collective resource
for the identification of repetitive sequences in plants. Nucleic Acids Res 32, D360-
D363.
Reinhart B, Chaillet JR. (2005). Genomic imprinting: cis-acting sequences and
regional control. Int Rev Cytol 243, 173-213.
Schubert D, Primavesi L, Bishopp A, Roberts G, Doonan J, Jenuwein T, Goodrich J.
(2006). Silencing by plant Polycomb-group genes requires dispersed trimethylation of
histone H3 at lysine 27. EMBO J 25, 4638-4649.
Spillane C, Baroux C, Escobar-Restrepo JM, Page DR, Laoueille S, Grossniklaus U.
(2004).Transposons and tandem repeats are not involved in the control of genomic
imprinting at the MEDEA locus in Arabidopsis. Cold Spring Harb Symp Quant Biol
69, 465-475.
Suzuki S, Ono R, Narita T, Pask AJ, Shaw G, Wang C, Kohda T, Alsop AE, Marshall
Graves JA, Kohara Y, Ishino F, Renfree MB, Kaneko-Ishino T. (2007).
Retrotransposon silencing by DNA methylation can drive mammalian genomic
imprinting. PLoS Genet 3, e55.
Tiwari S, Schulz R, Ikeda Y, Dytham L, Bravo J, Mathers L, Spielman M, Guzmán P,
Oakey RJ, Kinoshita T, Scott RJ. (2008). MATERNALLY EXPRESSED PAB C-
TERMINAL, a novel imprinted gene in Arabidopsis, encodes the conserved C-
terminal domain of polyadenylate binding proteins. Plant Cell 20, 2387-2398.
Vielle-Calzada JP, Thomas J, Spillane C, Coluccio A, Hoeppner MA, Grossniklaus U.
(1999). Maintenance of genomic imprinting at the Arabidopsis MEDEA locus
requires zygotic DDM1 activity. Genes Dev 13, 2971-2982.
Xiao W, Gehring M, Choi Y, Margossian L, Pu H, Harada JJ, Goldberg RB, Pennell
RI, Fischer RL. (2003). Imprinting of the MEA Polycomb gene is controlled by
![Page 52: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/52.jpg)
50
antagonism between MET1 methyltransferase and DME glycosylase. Dev Cell 5, 891-
901.
Yoon BJ, Herman H, Sikora A, Smith LT, Plass C, Soloway PD. (2002). Regulation
of DNA methylation of Rasgrf1. Nat Genet 30, 92-96.
![Page 53: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/53.jpg)
51
Chapter 4. CHD3 Proteins and Polycomb Group Proteins
Antagonistically Determine Cell Identity in Arabidopsis
Ernst Aichinger,# Corina B. R. Villar,# Sara Farrona, José C. Reyes, Lars Hennig, and Claudia Köhler # Contributed equally
Published in PLoS Genetics 2009 August; 5(8): e1000605. doi: 10.1371/journal.pgen.1000605. Published online 2009 August 14
4.1 Abstract
Dynamic regulation of chromatin structure is of fundamental importance for
modulating genomic activities in higher eukaryotes. The opposing activities of
Polycomb group (PcG) and trithorax group (trxG) proteins are part of a chromatin-
based cellular memory system ensuring the correct expression of specific
transcriptional programs at defined developmental stages. The default silencing
activity of PcG proteins is counteracted by trxG proteins that activate PcG target
genes and prevent PcG mediated silencing activities. Therefore, the timely expression
and regulation of PcG proteins and counteracting trxG proteins is likely to be of
fundamental importance for establishing cell identity. Here, we report that the
chromodomain/helicase/DNA–binding domain CHD3 proteins PICKLE (PKL) and
PICKLE RELATED2 (PKR2) have trxG-like functions in plants and are required for
the expression of many genes that are repressed by PcG proteins. The pkl mutant
could partly suppress the leaf and flower phenotype of the PcG mutant curly leaf,
supporting the idea that CHD3 proteins and PcG proteins antagonistically determine
cell identity in plants. The direct targets of PKL in roots include the PcG genes
SWINGER and EMBRYONIC FLOWER2 that encode subunits of Polycomb
repressive complexes responsible for trimethylating histone H3 at lysine 27
(H3K27me3). Similar to mutants lacking PcG proteins, lack of PKL and PKR2 caused
reduced H3K27me3 levels and, therefore, increased expression of a set of PcG protein
target genes in roots. Thus, PKL and PKR2 are directly required for activation of PcG
![Page 54: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/54.jpg)
52
protein target genes and in roots are also indirectly required for repression of PcG
protein target genes. Reduced PcG protein activity can lead to cell de-differentiation
and callus-like tissue formation in pkl pkr2 mutants. Thus, in contrast to mammals,
where PcG proteins are required to maintain pluripotency and to prevent cell
differentiation, in plants PcG proteins are required to promote cell differentiation by
suppressing embryonic development.
4.2 Introduction
Dynamic regulation of chromatin structure is the underlying scheme for modulating
genome activities in higher eukaryotes. There are two major classes of proteins with
enzymatic activities directed at chromatin - histone modifying enzymes and ATP
dependent chromatin remodelers. Histone modifying enzymes add or remove
posttranslational modifications such as acetylation, methylation, phosphorylation and
ubiquitinylation on histones. These modifications are recognized and bound by factors
that cause changes in chromatin structure by not well understood mechanisms
(Ruthenburg et al., 2007). ATP dependent chromatin remodelers modify chromatin
structure by altering interactions between DNA and histone octamers, resulting in
changes of nucleosome position or composition associated with changes in
nucleosomal DNA accessibility (Henikoff, 2008).
CURLY LEAF (CLF) and PICKLE (PKL) are examples of these two enzyme classes
in plants. CLF is a Polycomb group (PcG) protein with histone methyltransferase
activity (Blee and Joyard, 1996; Schubert et al., 2006), and PKL is a predicted ATP-
dependent chromatin remodeling factor of the chromodomain/helicase/DNA-binding
domain (CHD3) subfamily (Esched et al., 1999; Ogas et al., 1999).
Members of the CHD3 subfamily are characterized by the presence of two tandemly
arranged chromodomains as well as the presence of one or two PhD (plant-homeo-
domain) zinc fingers preceding the chromodomains (Bouazoune and Brehm, 2006).
CHD3 family members of flies and mammals are part of the NuRD (nucleosome
remodeling and deacetylase) multiprotein complex that is implicated to couple ATP-
dependent chromatin remodeling and deacetylation resulting in transcriptional
repression (Bouazoune and Brehm, 2006). However, several studies also implicate a
![Page 55: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/55.jpg)
53
function of CHD3 family members in transcriptional activation (Shimono et al., 2003;
Srinivasan et al., 2005; Murawska et al., 2008).
CLF is a homolog of the metazoan SET domain protein Enhancer of zeste, and similar
to animal PcG proteins CLF is part of a multiprotein Polycomb repressive complex 2
(PRC2)-like complex that trimethylates histone H3 on lysine 27 (H3K27me3)
(Schubert et al., 2006; Wood et al., 2006; De Lucia et al., 2008). This modification is
recognized by the chromodomain containing protein LIKE HETEROCHROMATIN
PROTEIN 1 (LHP1) that together with the RING finger domain proteins AtRING1a
and AtRING1b causes gene repression by not yet understood mechanisms (Zhang et
al., 2007b; Turck et al., 2007; Xu and Shen, 2008). Lack of CLF function causes
reduced H3K27me3 levels associated with pleiotropic developmental aberrations like
formation of curled leaves, homeotic transformations of flowers and early flowering
(Schubert et al., 2006; Goodrich et al., 1997; Bouveret et al., 2006). CLF acts partially
redundant with its homolog SWINGER (SWN), and lack of both proteins causes cells
to de-differentiate and to form callus-like tissues that give rise to somatic embryos
(Chanvivattana et al., 2004). Similarly, lack of PKL function causes derepression of
embryogenic traits in seedling roots, accumulation of seed storage reserves and
formation of somatic embryos; albeit this pickle root phenotype only occurs with very
low penetrance (Ogas et al., 1997). The embryonic master regulator gene LEAFY
COTYLEDON1 (LEC1) is activated in both, pkl and clf swn double mutants (Ogas et
al., 1999),(Makarevich et al., 2006). Overexpression of LEC1 causes somatic
embryogenesis (Lotan et al., 1998; Mu et al., 2008), suggesting that LEC1 is critically
responsible for somatic embryogenesis in pkl and clf swn mutants. Thus, lack of PcG
proteins CLF and SWN as well as lack of PKL causes cell dedifferentiation and
somatic embryogenesis, however, the underlying molecular mechanisms for this
common phenotype remain unclear. Recent studies observed an overlap of genes
being up-regulated in pkl mutants and genes enriched for H3K27me3, suggesting a
functional connection of PKL and PcG pathways (Zhang et al., 2008). This idea was
supported by the finding that lack of PKL caused reduced H3K27me3 levels at
selected loci, whereas histone acetylation levels remained largely unaffected in pkl
mutants (Zhang et al., 2008). Thus it seemed unlikely that PKL is part of a NuRD-like
complex in plants but rather assumes an as yet unidentified role in gene regulation.
![Page 56: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/56.jpg)
54
We set out to identify the functional connection of PKL and PcG proteins and found
that in contrast to its anticipated role as a repressor, PKL has trithorax group (trxG)-
like functions and is required for the activation of PcG target genes. Among its direct
targets we identified the genes for the PcG proteins SWN and EMF2. Lack of PKL as
well as its close homolog PKR2 caused reduced expression of genes for PcG proteins
in primary roots, concomitantly with reduced H3K27me3 levels. This in turn is likely
responsible for increased LEC1 expression and derepression of embryonic traits in pkl
pkr2 primary roots. Expression of PcG genes is independent of PKL in aerial plant
tissues and pkl can partly suppress the clf leaf and flower phenotype, supporting the
idea that PKL and PcG proteins antagonistically determine cell identity in plants.
![Page 57: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/57.jpg)
55
4.3 Results
4.3.1 PICKLE and PICKLE RELATED2 Act Redundantly in Suppressing Embryonic Identity
Investigations of the underlying molecular mechanism of the pickle root phenotype
have been hampered by the very low penetrance of this phenotype. Therefore, we
tested whether double mutants of pkl with mutants in close PICKLE homologs
PICKLE RELATED1 (PKR1) and PKR2 (Ogas et al., 1999) had an increased
penetrance of this phenotype. We isolated mutant alleles for both genes, located in
exon 9 in pkr1-1 and in exons 9 and 5 in pkr2-1 and pkr2-2, respectively (Figure 1A).
Based on the expression of PKR1 and PKR2 in isolated homozygous mutant alleles,
we concluded that all three alleles are likely to be null alleles (Figure 1B). Neither
pkr1 nor pkr2 homozygous mutants exhibited significant phenotypic differences to
wild-type plants under standard growth conditions (data not shown). However,
whereas pkl pkr2 had a strongly increased penetrance of the pkl root phenotype, no
increase was observed in the pkl pkr1 double mutant (Figure 1C). This suggests that
PKR2 acts redundantly with PKL in suppressing cell dedifferentiation in the seedling
root. This idea is supported by the finding that PKR2 expression was induced in pkl
roots (Figure 1D). The pkr2 mutant did not enhance other aspects of the pkl
phenotype (data not shown); consistent with lack of PKR2 expression in other
vegetative plant organs (Figure 1D). PKR2 was strongly expressed in flowers and
siliques; however, reproductive development was not disturbed in pkr2 single and pkl
pkr2 double mutants (data not shown).
![Page 58: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/58.jpg)
56
Figure 1. PKL and PKR2 act redundantly to maintain root cell identity. (A) Genomic organization of the PKL, PKR1 and PKR2 loci. The pkl-1 mutation (asterisk) is a described EMS allele (Li et al., 2005). T-DNAs (black triangles) are inserted in the 9th exon in the pkr1-1 and in the 9th and 5th exons in pkr2-1 and pkr2-2 mutants, respectively. Black boxes represent exons, connecting lines introns. Analyzed regions tested by RT-PCR are marked by a line below the genomic loci. (B) Transcript accumulation in wild-type pkr1-1, pkr2-1, and pkr2-2 flower buds was tested by RT-PCR. (C) pickle root formation was assayed in five-day-old wild-type, pkl, pkr1-1, pkl pkr1-1, pkr2-1, pkl pkr2-1, pkr2-2, and pkl pkr2-2 seedling roots. Numbers on top of bars represent total number of scored seedlings. Experiments were performed in triplicates. Error bars, SEM. (D) RT–PCR analysis of PKL, PKR1 and PKR2 in different plant tissues. wt, wild-type.
4.3.2 Up- and Down-Regulated Genes in pkl Are Enriched for H3K27me3
To investigate the molecular basis of the pickle root phenotype, we profiled
transcriptomes of pkl and pkl pkr2 roots at five days after germination. Consistent
with the strongly increased penetrance of the pickle root phenotype in the pkl pkr2
double mutant, we observed a synergistic increase in the number of up- and down-
![Page 59: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/59.jpg)
57
regulated genes in the double mutant (Figure 2A, Table S1). Next we used principal
components analysis (PCA) to visualize the relation of pkl and pkl pkr2 mutant roots
to wild-type roots, leaves and seeds. PCA was performed on the 4 samples from this
study and 11 samples from the AtGenExpress developmental reference data set
(Schmid et al., 2005) using expression data of the 611 genes with altered expression
in pkl or pkl pkr2 (Figure S1). The primary principle component accounted for 45% of
the variation in the data and differentiated between seeds containing embryos and
non-embryonic tissue such as roots or leaves. The second principle components
accounted for 29% of the variation in the data and differentiated between
photosynthetic active (leaves) and inactive (root) samples. Leaf, root and seed
samples all clustered tightly in the PCA plot (Figure S1). The pkl and pkl pkr2
samples did not cluster tightly with wild-type or pkr2 roots but were located between
the root and seed clusters indicating a partial change in cell identity from non-
embryonic to embryonic fate. The positions of pkl and pkl pkr2 in the PCA plot were
consistent with the hypothesis that the pkr2 mutation enhances the pickle root
phenotype. Previous studies revealed that expression of LEC1 is critically important
for cell dedifferentiation and embryonic fate (Lotan et al., 1998; Mu et al., 2008;
Kagaya et al., 2005); consistent with this idea we found that LEC1 as well as
embryonic regulators FUS3 and ABI3 and other seed-specific genes were
synergistically up-regulated in the pkl pkr2 double mutant (Figure 2B and Figure S2A,
S2B).
To explore the connection between PcG proteins and PKL, we tested whether genes
that had altered expression in the pkl and pkl pkr2 double mutant were enriched for
H3K27me3 (Zhang et al., 2007a). We found a significant overlap with both, up- as
well as down-regulated genes in pkl and in pkl pkr2 mutants (Figure 2C, Table S1). It
has been reported previously that up-regulated genes in the pkl mutant are enriched
for H3K27me3 (Zhang et al., 2008), however, the strong enrichment for H3K27me3
among down-regulated genes was unexpected.
![Page 60: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/60.jpg)
58
Figure 2. pkr2 synergistically increases deregulated genes in pkl and deregulated genes are marked by H3K27me3. (A)Venn diagrams of up-regulated and down-regulated genes in pkl, pkr2, and pkl pkr2 roots. Numbers in parenthesis represent total numbers of up-regulated and down-regulated genes in the respective genotypes. (B) Quantitative RT-PCR analysis of LEC1, FUS3 and ABI3 expression in roots of wild-type, pkl, pkr2 and pkl pkr2 five-day-old seedlings. Error bars, SEM. (C) Venn diagrams of up-regulated and down-regulated genes in pkl and pkl pkr2 and genes marked by H3K27me3 (Zhang et al., 2007a). p-values are based on the hypergeometric test. wt, wild-type.
4.3.3 PKL Binds Directly to Genes with Reduced Expression in pkl Mutants
The strong enrichment for H3K27me3 among down-regulated genes prompted us to
ask whether PKL was directly required for gene repression, gene activation or
whether it had dual function. To address this question we performed chromatin
![Page 61: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/61.jpg)
59
immunoprecipitation (ChIP) using PKL-specific antibodies (Figure S3) and tested
binding of PKL to the promoter region of genes with altered expression in pkl and pkl
pkr2 mutants. We detected significant PKL binding to three genes that we picked
from the top seven down-regulated genes (Figure 3); however, we did not detect
significant PKL binding to the up-regulated genes LEC1, FUS3 and ABI3 (Figure 3),
suggesting that PKL is directly required for the activation, but not repression of
defined genes.
Consistent with results showing reduced H3K27me3 levels at several up-regulated
genes in the pkl mutant (Zhang et al., 2008), we detected significantly reduced
H3K27me3 amounts at LEC1 and ABI3 promoter regions in pkl pkr2 mutants. No
reduction in H3K27me3 levels was observed at the FUS3 locus (Figure 3), suggesting
increased FUS3 expression is mediated by LEC1 that was previously shown to
activate expression of FUS3 and ABI3 (Kagaya et al., 2005). However, we also
detected significantly reduced H3K27me3 levels in the promoter region of one of the
genes with reduced expression in pkl and pkl pkr2 mutants (Figure 3), suggesting that
loss of H3K27me3 is not sufficient for gene activation in pkl and pkl pkr2 mutants.
To test this hypothesis, we analyzed expression of confirmed PKL target genes and
other genes with reduced expression in the pkl mutant in clf and pkl clf double
mutants. It was known that lack of CLF causes strong reductions in H3K27me3
(Schubert et al., 2006). We found that lack of CLF in a PKL+/+ background led to
increased expression for three of five tested genes with decreased expression in pkl or
pkl pkr2 (Figure 4A). In contrast, lack of CLF in a pkl background did not affect
expression of the five tested genes. Thus, increased expression of the test genes upon
loss of the repressor CLF requires the presence of PKL. These results support our
hypothesis that PKL activity is indeed required for gene activation.
![Page 62: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/62.jpg)
60
Figure 3. PKL directly binds to genes with reduced expression in pkl mutants. ChIP analysis of PKL binding, H3K27me3 and H3 levels at At3g48740, At5g10230, At5g47980, LEC1, FUS3, and ABI3 in five-day-old seedling roots. Nonspecific IgG antibodies served as a negative control. ChIP PCR was performed in triplicate, one representative PCR for each locus is shown in the left panels, and quantification of the results show recovery as percent of input in the right panels. Black and gray bars represent wild type and pkl pkr2, respectively. Significance of PKL binding (left panels) and reduced H3K27me3 in pkl pkr2 (right panels) was determined by two-tailed Student's t-test, *P<0.01. Error bars, SEM. IP, immunoprecipitation.
In contrast, LEC1 and FUS3 were synergistically up-regulated in pkl clf double
mutants (Figure 4B), supporting the idea that PKL and CLF are required for
![Page 63: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/63.jpg)
61
repression of both genes. Given that LEC1 and FUS3 are not direct target genes of
PKL (Figure 3) suggests that PKL indirectly represses target genes by activating a
repressor. Consistent with increased expression of LEC1 and FUS3 in pkl clf mutants,
we observed a significantly increased penetrance of the pickle root phenotype in the
double mutant (Figure 4C). To summarize, a set of PcG target genes were directly
bound by PKL, had reduced expression in pkl and pkl pkr2 mutants, and additional
loss of CLF did not affect expression. Other PcG target genes were not directly bound
by PKL, had increased expression in pkl and pkl pkr2 mutants, and additional loss of
CLF led to a further increase in expression.
Figure 4. Direct PKL target genes have similar expression levels in pkl and pkl clf double mutants, while LEC1 and FUS3 are synergistically up-regulated in pkl clf. Quantitative RT–PCR analysis of (A) At3g48740, At5g10230, At5g47980, At1g66800, At5g53190 and (B) LEC1 and FUS3 expression in roots of five-day-old wild-type, clf, pkl, and pkl clf seedlings. Significance of increased mRNA levels compared to wild-type (A) and pkl (B) was determined by two-tailed Student's t-test, *P<0.001. Error bars, SEM. (C) pickle root formation was assayed from five-day-old wild-type, clf, pkl, and pkl clf seedling roots. Numbers on top of bars represent total number of scored seedlings. Experiments were performed in triplicates. Significance of increased pickle root penetrance in pkl clf compared to pkl was determined by two-tailed Student's t-test, *P<0.01. Error bars, SEM. wt, wild-type.
![Page 64: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/64.jpg)
62
4.3.4 pkl pkr2 Mutants Have Reduced Expression of PcG Genes and Reduced H3K27me3 Levels
A subset of PcG target genes was de-repressed in pkl and pkl pkr2 mutants, and we
wondered whether this could be caused by reduced expression of genes for PcG
proteins. Therefore, we tested expression of FIE, EMF2, VRN2, CLF, SWN, MEA, and
MSI1 in roots of pkl and pkl pkr2 mutants. Indeed, we detected strongly reduced
expression of EMF2, CLF, and SWN (Figure 5A), suggesting that PKL is directly or
indirectly required for the activation of PcG protein encoding genes. To distinguish
between both possibilities, we performed ChIP analysis and tested binding of PKL to
the promoter regions of EMF2, CLF and SWN. We clearly detected binding of PKL to
EMF2 and SWN promoter regions, but no binding was detected to the promoter region
of CLF (Figure 5B) and neither to regions within the gene body (data not shown).
Thus, we conclude that PKL is directly required for the activation of EMF2 and SWN,
whereas PKL-mediated activation of CLF is possibly an indirect effect. We found
SWN and EMF2 promoter regions marked by H3K27me3, but no significant
enrichment for this mark was detected at the CLF promoter, suggesting that PKL is
targeted preferentially to PcG target genes. This conclusion was supported by the
observation that genes with reduced expression in pkl and pkl pkr2 mutants were also
significantly enriched for H3K27me3 (Figure 2C). Previous whole genome analysis
of H3K27me3 distribution did not reveal enrichment for H3K27me3 at EMF2 and
SWN loci (Zhang et al., 2007a), which might be attributed to the use of whole
seedlings by Zhang and colleagues (2007a) in contrast to the root tissues used here.
Loss of CLF function leads to reduced H3K27me3 levels (Schubert et al., 2006; Jiang
et al., 2008); therefore, we tested whether reduced expression of genes for PcG
proteins EMF2, CLF and SWN in pkl pkr2 was reflected in reduced H3K27me3 levels.
We assayed global H3K27me3 levels and indeed found less H3K27me3 in pkl pkr2
than in wild-type primary roots (Figure 5C). Previously, we observed induced
expression of embryo-specific genes such as LEC1 and FUS3 in clf swn seedlings
(Makarevich et al., 2006). Therefore, we tested whether clf swn seedlings developed
similar embryonic characteristics like pkl (Ogas et al., 1997) and pkl pkr2 mutants.
![Page 65: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/65.jpg)
63
Figure 5. Reduced H3K27me3 levels in pkl pkr2 are associated with reduced expression levels of direct PKL target genes EMF2 and SWN. (A) Quantitative RT–PCR analysis of FIE, EMF2, VRN2, CLF, SWN, MEA and MSI1 expression in roots of wild-type, pkl, pkr2, and pkl pkr2 seedlings. Significance of decreased mRNA levels compared to wild-type was determined by two-tailed Student's t-test, *P<0.001. Error bars, SEM. (B) ChIP analysis of PKL binding, H3K27me3 and H3 levels at EMF2, CLF and SWN in five-day-old seedling roots. Nonspecific IgG antibodies served as a negative control. ChIP PCR was performed in triplicate, one representative PCR for each locus is shown in the left panels, and quantification of the results show recovery as percent of input in the right panels. Black and gray bars represent wild type and pkl pkr2, respectively. Significance was determined by two-tailed Student's t-test, **P<0.001, *P<0.01. Error bars, SEM. (C) Western blot anlysis with anti-H3 and anti-H3K27me3 antibodies of wild-type, pkl, pkl pkr2 and clf seedling root tissues. wt, wild-type.
![Page 66: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/66.jpg)
64
Figure 6. pkl enhances the clf swn phenotype. (A) Localization of seed storage specific triacylglycerol accumulation in wild-type, pkl, pkr2, pkl pkr2, clf swn, and pkl clf swn seedlings at 14 days after germination using the lipid staining dye Fat Red. cit_bfScale bars, wt, pkl, pkr2, pkl pkr2, clf swn: 0.25 cm; clf swn close-up and pkl clf swn: 0.1 cm. (B) Quantitative RT–PCR analysis of EMF2, CLF and SWN expression in aerial parts of 14 day old wild-type, pkl and pkl pkr2 seedlings. Error bars, SEM.
Indeed, clf swn seedlings were clearly stained with the neutral lipid staining dye Fat
Red (Ogas et al., 1997), indicating the accumulation of seed storage specific
triacylglycerols (Figure 6A). Triacylglycerol accumulation in clf swn seedlings was
![Page 67: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/67.jpg)
65
only detected in structures developing from above-ground organs, suggesting that the
third E(Z) homolog MEA, which is expressed in wild-type and clf swn roots
((Kiyosue et al., 1999) and data not shown), can compensate the lack of CLF and
SWN functions in roots. Triacylglycerols accumulated in pkl pkr2 seedlings only in
primary roots, suggesting that PKL-mediated repression of EMF2, CLF and SWN was
restricted to primary root tissues. When testing this hypothesis we found normal
expression of EMF2, CLF and SWN in aerial parts of pkl and pkl pkr2 seedlings
(Figure 6B). However, lack of PKL function strongly enhanced the clf swn phenotype,
and pkl clf swn triple mutants only formed callus-like tissues that accumulated
triacylglycerols (Figure 6A). It is possible that PKL is required for PcG gene
activation in primary roots of wild-type plants but also in aerial parts of clf swn
mutants; reduced expression of other PcG genes would then enhance the clf swn
phenotype. To summarize, we propose that development of embryonic traits in pkl
pkr2 is a secondary consequence of reduced expression of genes for PcG proteins,
resulting in reduced levels of H3K27me3 and faulty expression of embryonic
regulators such as LEC1, FUS3 and ABI3. This hypothesis predicts a significant
overlap of genes up-regulated in pkl pkr2 and genes up-regulated in LEC1
overexpressing lines (Mu et al., 2008). In agreement with this prediction the overlap
of genes up-regulated in pkl pkr2 and in LEC1 overexpressing lines was significant
(p<1E-15). In contrast, no significant overlap was detected between down-regulated
genes of both datasets (Figure S4 and Table S1).
4.3.5 PKL and PcG Proteins Act Antagonistically on a Similar Set of Target Genes
Our transcriptional profiling experiments revealed a significant overlap of genes with
reduced expression levels in pkl and pkl pkr2 mutants and genes marked by
H3K27me3 (Figure 2C), suggesting that PKL acts as transcriptional activator for PcG
protein target genes. To test this hypothesis we analyzed adult phenotypes of pkl clf
double mutants. Expression of PcG genes CLF, SWN and EMF2 was not affected by
loss of PKL/PKR2 function in adult leaves (Figure 7A); therefore, lack of PKL
function in a clf mutant background is expected to suppress at least partially the clf
mutant phenotype.
![Page 68: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/68.jpg)
66
Figure 7. pkl suppresses leaf curling and homeotic flower transformations in clf mutants. (A) Quantitative RT–PCR analysis of EMF2, CLF and SWN expression in leaves of wild-type, pkl and pkl pkr2. Error bars, SEM. (B) Leaves of wild-type, clf, pkl, and pkl clf. Scale bars, 5 mm. (C) Flowers of wild-type, clf, pkl, and pkl clf. Scale bars, 1 mm. (D) Quantification of flowers with homeotic transformations in wild-type, clf, pkl, and pkl clf. Numbers on top of bars represent total number of scored flowers. Six individual plants were scored per genotype. Error bars, SEM. (E) Quantitative RT–PCR analysis of AG, AP3, and FLC expression in leaves of wild-type, clf, pkl, and pkl clf seedlings. Error bars, SEM. wt, wild-type. (F) ChIP analysis of PKL binding, H3K27me3 and H3 levels at AP3, AG and FLC in seedlings. Nonspecific IgG antibodies served as a negative control. Quantitative ChIP PCR was performed with four replicates and quantification of the results show recovery as percent of input. Significance was determined by two-tailed Student's t-test, **P<0.001, *P<0.01. Error bars, SEM.
![Page 69: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/69.jpg)
67
There are two prominent phenotypic changes caused by lack of CLF function, (i) clf
mutants have narrowed and upward curled leaf blades and (ii) clf flowers have partial
homeotic transformations of sepals and petals towards carpels and stamens,
respectively (Goodrich et al., 1997). Both phenotypes were clearly suppressed in the
pkl clf double mutant. The leaf blade of pkl clf plants was flat like the blade of wild-
type leaves (Figure 7B) and we did not observe flowers with homeotic
transformations in pkl clf plants. In contrast, about 30% of clf flowers developed
homeotic transformations (Figure 7C and 7D). Thus, consistent with our hypothesis
that PKL and CLF have antagonistic roles, lack of PKL function largely suppressed
the clf mutant phenotype. To test whether we could find further molecular support for
this hypothesis, we tested expression of the known CLF target genes AP3, AG and
FLC (Schubert et al., 2006; Jiang et al., 2008) in clf, pkl and clf pkl double mutants.
All three genes had increased expression levels in clf mutants; but expression levels
were greatly reduced in the clf pkl double mutant (Figure 7E). Finally, we tested
whether PKL directly binds to AP3, AG and FLC and performed ChIP analysis of
wild-type, clf and pkl seedlings. We clearly detected binding of PKL to the promoter
regions of all three genes in wild-type as well as in clf seedlings (Figure 7E). Because
PKL binding to AP3, AG and FLC occurred in wild-type as well as in clf seedlings
while PKL-dependent activation of these genes was only observed in clf mutants, it is
possible that PKL can activate transcription only in the absence of H3K27me3. In line
with this hypothesis we detected significantly reduced levels of H3K27m3 at the three
tested loci in clf seedlings. Thus, developmental and molecular phenotypes of clf pkl
double mutants and direct binding of PKL to PcG target genes support the conclusion
that PKL is required for the activation of PcG target genes.
![Page 70: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/70.jpg)
68
4.4 Discussion
4.4.1 PKL Acts as Transcriptional Activator
The chromatin remodeling factor PKL has been implicated in maintenance of cell
identity in plant seedlings by suppressing seed-associated developmental programs
(Ogas et al., 1997; Rider et al., 2003; Henderson et al., 2004; Li et al., 2005), and we
found that PKL acts redundantly with PKR2. PKL and PKR2 are homologs of
metazoan CHD3/CHD4 proteins (Ogas et al., 1999) that are part of multisubunit
complexes with histone deacetylase activity such as the NuRD complex (Bouazoune
and Brehm, 2006; Hall and Georgel, 2007). Therefore, it was suggested that PKL acts
as transcriptional repressor and suppresses embryonic regulators like LEC1 and FUS3
(Ogas et al., 1999; Zhang et al., 2008; Rider et al., 2003; Henderson et al., 2004; Li et
al., 2005). However, previous studies did not detect any effect of PKL activity on
acetylation levels, casting doubt on the idea that PKL might be part of a plant NuRD-
like complex (Zhang et al., 2008). Instead, Zhang and colleagues (2008) proposed that
PKL is involved in H3K27me3-mediated transcriptional repression, because they
found in pkl mutants reduced H3K27me3 levels and increased expression for LEC1,
FUS3 and several other loci. Nevertheless, the connection between PKL and PcG
protein-mediated H3K27me3 remained unclear.
We used ChIP to test binding of PKL to genes that have altered expression in pkl
mutants and therefore are potential direct PKL target genes. We failed to detect direct
binding of PKL to any of the up-regulated genes. In contrast, we detected direct
binding of PKL to several of the down-regulated genes. Therefore, we conclude that
PKL does not act as transcriptional repressor but as transcriptional activator.
Interestingly, Drosophila dCHD3 acts as a monomer and is not part of a NuRD-like
complex (Murawska et al., 2008). Furthermore, Drosophila CHD3/CHD4 proteins
dMi-2 and dCHD3 colocalize with active RNA polymerase II on polytene
chromosomes (Srinivasan et al., 2005; Murawska et al., 2008). Thus, it is possible that
at least some members of the CHD3/CHD4 protein family could have a role in
transcriptional activation in animals as well.
![Page 71: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/71.jpg)
69
4.4.2 PKL Has a trxG-like Function
PKL can act as transcriptional activator, and genes that are down-regulated in pkl
mutants are of particular interest. We observed a significant overlap of this set of
down-regulated genes with genes reported to carry H3K27me3. All identified direct
PKL target genes carry H3K27me3. Thus, one major group of genes activated by
PKL consists of PcG protein target genes. Because PKL acts as transcriptional
activator of PcG protein target genes, PKL can be considered as a plant trxG protein.
A trxG function of a CHD protein is not without precedence, as the Drosophila CHD
protein Kismet-L counteracts PcG protein-mediated repression by promoting
transcription elongation through recruiting ASH1 and TRX histone methyltransferases
(Srinivasan et al., 2008). For PKL, this idea is supported by the partial suppression of
the clf mutant phenotype by pkl. In summary, direct activation of PcG genes by PKL
explains the down-regulation of many genes with H3K27me3 in pkl mutants.
4.4.3 PKL Is Required for Expression of PcG Proteins that Are Subject of Autoregulation
In addition to down-regulation of H3K27me3-covered genes in pkl, we observed up-
regulation of many H3K27me3-covered genes as well. This is consistent with earlier
observations by others (Zhang et al., 2008). Because we failed to detect direct binding
of PKL to any of the up-regulated genes, we conclude that increased expression of
these genes in pkl is an indirect effect. We show that this indirect effect is caused by
reduced expression of PcG protein encoding genes in pkl pkr2 roots. We find that in
roots EMF2 and SWN loci contain H3K27me3, the hallmark of PcG protein-mediated
regulation. Thus, EMF2 and SWN, which code for PcG proteins, are themselves PcG
protein targets. Autoregulation of genes for PcG proteins has been observed before in
Drosophila (Ali and Bender, 2004). In Arabidopsis, the MEDEA (MEA) gene, a
homolog of E(Z), is repressed by PcG proteins in post-embyronic tissues (Jullien et al.,
2006; Katz et al., 2004). Similar to many other PcG protein target genes, EMF2 and
SWN require PKL for efficient expression, because in pkl pkr2 roots expression of
both genes is strongly reduced. Expression of CLF in pkl pkr2 roots is reduced as well,
but this could be an indirect effect because we detected neither H3K27me3 at the CLF
locus nor PKL binding to CLF. Together, reduced expression of EMF2, SWN and
CLF explains the reduced H3K27me3 levels in pkl pkr2 roots and the de-repression of
![Page 72: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/72.jpg)
70
a number of PcG target genes. As lack of PKL did not prevent increased expression of
LEC1, FUS3, ABI3 as well as many other PcG target genes, we propose that PKL is
required for the activation of only a subset of PcG target genes.
PKL and PKR2 are expressed mostly in the seedling root ((Li et al., 2005) and Figure
1C), and loss of cell identity in pkl pkr2 is restricted to primary root tissues. Thus,
PKL and PKR2 function mainly in the seedling root; other proteins might activate
PcG protein target genes in aerial organs, possibly other PKL homologs.
4.4.4 PKL Represses Embryonic Traits Via Maintaining PcG Protein Activity
PcG proteins in plants and animals are master regulators of genomic programs
(Köhler and Villar, 2008). However, whereas in mammals PcG proteins are required
to maintain pluripotency and to prevent cell differentiation, in plants PcG proteins are
required to promote cell differentiation by suppressing embryonic development. The
PcG proteins CLF and SWN act redundantly and lack of both, CLF and SWN causes
cells to de-differentiate and to form callus-like tissues that give rise to somatic
embryos (Chanvivattana et al., 2004). EMF2 is likely part of PRC2-like complexes
together with CLF and SWN (Chanvivattana et al., 2004); EMF2 interacts with both,
CLF and SWN in yeast and a weak emf2 mutant allele resembles clf (Chanvivattana et
al., 2004). Mutant studies support the idea that PcG protein function is impaired in pkl
and pkl pkr2 roots: First, the pkl pkr2 and clf swn double mutants have similar
phenotypes. Both activate the embryonic master regulator LEC1 (this study and
(Makarevich et al., 2006)) and both express embryonic traits in seedlings. Second, the
clf swn mutant phenotype is strongly enhanced in the pkl clf swn triple mutant,
causing complete transformation of germinating seedlings into callus-like tissues. For
several reasons we believe that reduced expression of PcG genes is rather the cause
than the consequence of the pkl root phenotype: (i) PcG genes EMF2 and SWN are
direct target genes of PKL, (ii) about 35% of pkl pkr2 mutants undergo transformation
to pkl roots, whereas expression levels of PcG genes CLF and SWN are reduced to
20% of wild-type expression levels, indicating reduced expression levels of PcG
genes in roots that do not adopt a pkl phenotype, (iii) in line with the last argument,
expression of PcG genes was indeed reduced in pkl pkr2 roots that did not undergo
discernable transformations (data not shown).
![Page 73: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/73.jpg)
71
LEC1 is sufficient to induce somatic embryogenesis (Lotan et al., 1998; Mu et al.,
2008) and development of embryogenic characteristics in pkl pkr2 roots is likely a
consequence of LEC1 de-repression due to reduced PcG protein activity. LEC1
activates FUS3 (Kagaya et al., 2005; To et al., 2006), suggesting that increased FUS3
expression in pkl pkr2 is a consequence of increased LEC1 expression. FUS3
expression increases in pkl pkr2 despite no detectable decrease in H3K27me3 levels at
FUS3; this is consistent with previous observations that H3K27me3 is not sufficient
for gene silencing (Schubert et al., 2006). Finally, we conclude that PKL restricts
embryogenic potential by regulating expression of genes for PcG proteins that are
needed to repress activators of embryonic cell fate such as LEC1.
Taken together, our study revealed that the plant CHD3 proteins PKL/PKR2 directly
activate PcG protein target genes; thus, PKL/PKR2 have trxG-like functions and
counteract PcG protein repressive activities during development. In the future, it will
be important to find out how CHD3 proteins and PcG proteins target the same genes
and why at certain loci repression dominates and at other loci activation dominates.
![Page 74: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/74.jpg)
72
4.5 Materials and Methods
4.5.1 Plant Material and Growth Conditions
All Arabidopsis thaliana mutants used in this study are in the Columbia accession.
The pkl mutant used in this study was the pkl-1 allele described by Ogas et al. (1997).
Mutant alleles clf-29 and swn-3 were described previously (Bouveret et al., 2006;
Chanvivattana et al., 2004). pkr1-1, pkr2-1 and pkr2-2 correspond to
WiscDsLox407C12, SALK 109423 and SALK 115303 respectively (Alonso et al.,
2003). Single, double and triple homozygous mutant plants were characterized by
PCR (for primers see Table S2). Seeds were surface sterilized (5% sodium
hypochlorite, 0.1% Tween-20) and plated on MS medium (MS salts, 1% sucrose, pH
5.6, 0.8% bactoagar). After stratification for one day at 4°C, plants were grown in a
growth cabinett under a long day photoperiod (16 h light and 8 h dark) at 23°C. For
monitoring pickle root development, plates were incubated in vertical position and the
phenotype was scored after 7 days. Experiments were performed in triplicates (three
plates per experiment) and each experiment was performed at least three times. 10 day
old seedlings were transferred to soil and plants were grown in a growth room at 60%
humidity and daily cycles of 16 h light at 23°C and 8 h darkness at 18°C.
4.5.2 Transcript Level Analysis
Root tips of five-day-old seedlings were harvested and total RNA was extracted using
the RNeasy kit (Qiagen). For quantitative RT-PCR, RNA was treated with DNaseI
and reverse transcribed using the First strand cDNA synthesis kit (Fermentas). For
transcript analysis of aerial tissues, RNA was extracted using Trizol reagent
(Invitrogen) and cDNA was synthesized as described above. Gene-specific primers
and SYBR green JumpStart TaqReadyMix (Sigma-Aldrich) were used on a 7500 Fast
Real-Time PCR system (Applied Biosystems). PP2A was used as reference gene. For
sequences of primers see Table S2. Quantitative RT-PCR was performed using three
replicates and results were analyzed as described (Simon, 2003).
![Page 75: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/75.jpg)
73
4.5.3 Anti–PKL Antibodies and Protein Immunoblot Analysis
Anti-PKL antibodies were generated against the C-terminus of the PKL protein
(amino acids 1111–1384) by immunizing rabbits with the purified protein. For
analysis of PKL protein in wild-type and pkl-1 mutant plants, rosette leaves were
ground in liquid nitrogen and incubated in 2×urea sample buffer (65 mM Tris, pH 6.8,
5% β-mercaptoethanol, 2% SDS, 10% glycerin, 0.25% bromphenol blue, 8 M urea)
for 5 min at 70°C. After centrifugation, the protein samples were loaded on a SDS-
polyacrylamide gel and analyzed on immunoblots using antibodies against PKL.
Equal loading and transfer of proteins was verified by staining the membrane in
Ponceau Red solution (0.1% Ponceau S, 5% acetic acid). For analysis of H3 and
H3K27me3, nuclear proteins from five-day-old seedling roots were extracted as
described previously (Xia et al., 1997). Protein blots were first probed with anti-
H3K27me3 (Millipore, cat. 07-449) followed by anti-H3 antibodies (Millipore, cat.
07-690).
4.5.4 Chromatin Immunoprecipitation
Root tips of five-day-old seedlings or aerial parts of ten-day-old seedlings were
harvested and proteins were crosslinked in 10 mM dimethyladipimate for 20 min.
After washing with distilled water proteins were crosslinked to DNA with 1%
formaldehyde for 15 min. ChIP was performed as previously described (Makarevich
et al., 2006) using antibodies against histone H3 (Millipore, cat. 07-690), H3K27me3
(Millipore, cat. 07-449) and rabbit IgG (Santa Cruz Biotechnology, cat. sc-2027). All
tested regions were within 400 bp upstream of the start ATG. For sequences of
primers see Table S2. PCR products were analyzed by agarose gel electrophoresis and
quantified using ImageJ (http://rsbweb.nih.gov/ij/). Three PCR reactions were used
for quantification and results presented as percent of input. Alternatively, gene-
specific primers and SYBR green JumpStart TaqReadyMix (Sigma-Aldrich) were
used on a 7500 Fast Real-Time PCR system (Applied Biosystems). Quantitative ChIP
PCR was performed with four replicates and results were analyzed as described and
presented as percent of input (Simon, 2003). All ChIP experiments were performed at
least twice.
![Page 76: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/76.jpg)
74
4.5.5 Localization of Triacylglycerols
Whole seedlings were incubated for 1 h in filtered Fat red solution (0.5% Fat Red
Bluish in 60% isopropanol), washed three times with water and inspected.
4.5.6 Microarray Analysis
Samples, array design, and hybridizations
Root tips of five-day-old seedlings were harvested, and total RNA was extracted
using the RNeasy kit (Qiagen). Three independent biological replicates were analyzed,
each replicate containing about 300 seedlings. Labeling and hybridization to the
arrays has been described previously (Hennig et al., 2003). Affymetrix Arabidopsis
ATH1 GeneChips® were used throughout the experiment (Affymetrix, Santa Clara,
CA). The exact list of probes present on the arrays can be obtained from the
manufacturer's website (http://www.affymetrix.com). Analysis was based upon
annotations compiled by TAIR (www.arabidopsis.org, version 2007-5-2). Data were
deposited into the ArrayExpress database (Accession number E-MEXP-2140).
Bioinformatic analysis
Signal values were derived from Affymetrix*.cel files using GCRMA (Wu et al.,
2003).
All data processing was performed using the statistic package R (version 2.6.2) that is
freely available at http://www.r-project.org/ (Ihaka and Gentleman, 1996). Quality
control was done using the affyQCReport package in R. In addition, we calculated
coefficients of variation (cv) between replicates as a quantitative measure of data
quality and consistency between replicates as described previously (Köhler et al.,
2003). Median cv values for triplicate array sets were between 1.4 and 2.8%
demonstrating the high quality of the data. Differentially expressed genes were
identified using the limma package in R (Smyth, 2004). Multiple-testing correction
was done using the q-value method (Storey and Tibshirani, 2003). Probesets were
called significantly differentially expressed when q<0.05. To enrich for biologically
relevant changes, only probesets with a minimal fold change of 2 were selected. Data
for H3K27me3 target loci were from (Zhang et al., 2007a). The significance of
enrichments was estimated based on the hypergeometric test. This test is identical to
![Page 77: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/77.jpg)
75
the one-tailed version of Fisher's exact test, and it is considered to be the most
appropriate approach to test overlaps of gene lists (Khatri et al., 2005; Goeman and
Bühlmann, 2007). First, the hypergeometric test models a sampling without
replacement, where probabilities change during the sampling (in contrast, for instance,
to the binomial or chi-square tests). Second, the hypergeometric test is accurate even
for small sample size (n<1000). Analysis of tissue-specificity of differentially
expressed genes was performed in Genevestigator (Zimmermann et al., 2004).
4.6 Acknowledgements
We are grateful to Dr. W. Gruissem for sharing laboratory facilities.
4.7 Footnotes
The authors have declared that no competing interests exist.
This research was supported by Swiss National Science Foundation
(http://www.snf.ch/D/Seiten/default.aspx) grant PP00A-106684/1 to CK, grant
3100AO-116060 to LH, and by the ETH Research Grant
(http://www.vpf.ethz.ch/services/TH/index_EN) TH-12 06-1 to CK. The funders had
no role in study design, data collection and analysis, decision to publish, or
preparation of the manuscript.
![Page 78: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/78.jpg)
76
4.8 Supporting Information
Figure S1. Principal component analysis. A two-dimensional plot of the first and second principle components of the data showing the relative relationship between the 15 samples based on 611 genes with altered expression in pkl or pkl pkr2. Expression values were averages of triplicate measurements, and PCA was performed using TMEV (http://www.tm4.org/mev.html).
![Page 79: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/79.jpg)
77
Figure S2. Seed-specific genes are up-regulated in pkl pkr2 roots. (A) Microarray analysis of seedling, inflorescence, rosette and root tissues reveals seed-specific expression of genes with increased expression in roots of pkl pkr2 seedlings. Numbers of microarrays used for this analysis are indicated on right side of panel. (B) Seed-specific genes are synergistically up-regulated in pkl pkr2 mutants. SLR, signal log ratio. Error bars, SEM.
![Page 80: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/80.jpg)
78
Figure S3. Anti-PKL antibodies specifically recognize the PKL protein. Western blot analysis with anti-PKL antibodies of wild-type and pkl leave tissues. Panel on the left shows Ponceau stained membrane. wt, wild-type.
Figure S4. Venn diagrams of up-regulated and down-regulated genes in pkl pkr2 seedling roots and seedlings overexpressing LEC1 (LEC1 OE (Mu et al., 2008)). Numbers in parenthesis represent total numbers of up-regulated and down-regulated genes in the respective genotypes. p-values are based on the hypergeometric test.
![Page 81: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/81.jpg)
79
Table S1. List of genes deregulated in pkl and pkl pkr2 roots.
Probesets upregulated in pkl pkr2
Probesets AGI 245044_at AT2G26500 245051_at AT2G23320 245052_at AT2G26440 245076_at AT2G23170 245127_at AT2G47600 245193_at AT1G67810 245195_at AT1G67740 245196_at AT1G67750 245197_at AT1G67800 245198_at AT1G67700 245218_s_at AT1G59218;AT1G58848 245304_at AT4G15630 245314_at AT4G16745 245499_at AT4G16480 245560_at AT4G15480 245567_at AT4G14630 245642_at AT1G25275 245650_at AT1G24735 245731_at AT1G73500 245736_at AT1G73330 245765_at AT1G33600 245768_at AT1G33590 246057_at AT5G08400 246154_at AT5G19940 246194_at AT4G37000 246225_at AT4G36910 246268_at AT1G31800 246273_at AT4G36700 246308_at AT3G51820 246417_at AT5G16990 246432_at AT5G17490 246463_at AT5G16970 246510_at AT5G15410 246566_at AT5G14940 246595_at AT5G14780 246814_at AT5G27200 246888_at AT5G26270 246889_at AT5G25470 246906_at AT5G25475 247013_at AT5G67480 247073_at AT5G66570 247097_at AT5G66460 247131_at AT5G66190
![Page 82: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/82.jpg)
80
247167_at AT5G65850 247239_at AT5G64640 247268_at AT5G64080 247320_at AT5G64040 247326_at AT5G64110 247340_at AT5G63700 247362_at AT5G63140 247421_at AT5G62800 247424_at AT5G62850 247463_at AT5G62210 247473_at AT5G62260 247686_at AT5G59700 247690_at AT5G59800 247729_at AT5G59530 247851_at AT5G58070 247899_at AT5G57345 247902_at AT5G57350 247904_at AT5G57390 247988_at AT5G56910 248016_at AT5G56380 248125_at AT5G54740 248128_at AT5G54770 248151_at AT5G54270 248301_at AT5G53150 248336_at AT5G52420 248348_at AT5G52190 248407_at AT5G51500 248435_at AT5G51210 248625_at AT5G48880 248660_at AT5G48650 248722_at AT5G47810 248828_at AT5G47110 248886_at AT5G46110 249013_at AT5G44700 249082_at AT5G44120 249127_at AT5G43500 249174_at AT5G42900 249201_at AT5G42370 249247_at AT5G42310 249255_at AT5G41610;AT5G41612 249295_at AT5G41280 249353_at AT5G40420 249384_at AT5G39890 249524_at AT5G38520 249547_at AT5G38160 249548_at AT5G38170 249775_at AT5G24160 249876_at AT5G23060 249894_at AT5G22580
![Page 83: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/83.jpg)
81
249942_at AT5G22300 250031_at AT5G18240 250049_at AT5G17780 250073_at AT5G17170 250160_at AT5G15210 250187_at AT5G14370 250207_at AT5G13930 250243_at AT5G13630 250262_at AT5G13410 250293_s_at AT5G13370;AT5G13360 250476_at AT5G10140 250501_at AT5G09640 250611_at AT5G07200 250620_at AT5G07190 250812_at AT5G04900 250815_s_at AT5G05040;AT5G05060 250967_at AT5G02790 251010_at AT5G02550 251038_at AT5G02240 251065_at AT5G01870 251082_at AT5G01530 251100_at AT5G01670 251202_at AT3G63040 251248_at AT3G62150 251325_s_at AT3G61470;AT5G28450 251360_at AT3G61210 251420_at AT3G60490 251480_at AT3G59710 251491_at AT3G59480 251576_at AT3G58200 251664_at AT3G56940 251762_at AT3G55800 251795_at AT3G55390 251814_at AT3G54890 251838_at AT3G54940 251885_at AT3G54050 251886_at AT3G54260 251946_at AT3G53540 251964_at AT3G53370 252115_at AT3G51600 252116_at AT3G51510 252130_at AT3G50820 252175_at AT3G50700 252291_s_at AT3G49120;AT3G49110 252300_at AT3G49160 252359_at AT3G48440 252383_at AT3G47780 252441_at AT3G46780 252648_at AT3G44630
![Page 84: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/84.jpg)
82
252652_at AT3G44720 252659_at AT3G44430 252678_s_at AT3G44300;AT3G44310 252698_at AT3G43670 252711_at AT3G43720 252786_at AT3G42670 252823_at AT4G40045 252863_at AT4G39800 252924_at AT4G39070 252929_at AT4G38970 252995_at AT4G38370 253042_at AT4G37550 253046_at AT4G37370 253049_at AT4G37300 253085_s_at AT4G36280 253125_at AT4G36040 253278_at AT4G34220 253299_at AT4G33800 253301_at AT4G33720 253394_at AT4G32770 253420_at AT4G32260 253499_at AT4G31900 253627_at AT4G30650 253738_at AT4G28750 253749_at AT4G29080 253754_at AT4G29020 253767_at AT4G28520 253776_at AT4G28390 253790_at AT4G28660 253811_at AT4G28190 253849_at AT4G28080 253854_at AT4G27900 253857_at AT4G27990 253871_at AT4G27440 253879_s_at AT4G27560;AT4G27570 253894_at AT4G27150 253895_at AT4G27160 253902_at AT4G27170 253904_at AT4G27140 253907_at AT4G27250 253922_at AT4G26850 253930_at AT4G26740 254095_at AT4G25140 254274_at AT4G22770 254293_at AT4G23060 254496_at AT4G20070 254562_at AT4G19230 254687_at AT4G13770 254704_at AT4G18020
![Page 85: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/85.jpg)
83
254764_at AT4G13250 254790_at AT4G12800 254889_at AT4G11650 254970_at AT4G10340 255248_at AT4G05180 255433_at AT4G03210 255435_at AT4G03280 255457_at AT4G02770 255471_at AT4G03050 255566_s_at AT4G01780;AT3G48670 255572_at AT4G01050 255715_s_at AT4G00320;AT5G41830 255720_at AT1G32060 255751_at AT1G31950 255773_at AT1G18590 255779_at AT1G18650 255886_at AT1G20340 255997_s_at AT1G29910;AT1G29920;AT1G29930 256053_at AT1G07260 256122_at AT1G18180 256189_at AT1G30140 256309_at AT1G30380 256514_at AT1G66130 256542_at AT1G42550 256736_at AT3G29410 256780_at AT3G13640 256918_s_at AT3G18960;AT4G01580 256975_at AT3G21000 256979_at AT3G21055 257021_at AT3G19710 257026_at AT3G19200 257041_at no_match 257054_at AT3G15353 257168_at AT3G24430 257232_at AT3G16500 257371_at AT2G47810 257412_at no_match 257447_at AT2G04230 257624_at AT3G26220 257625_at AT3G26230 257666_at AT3G20270 257698_at AT3G12730 257715_at AT3G12750 257722_at AT3G18490 257756_at AT3G18680 257768_at AT3G23060 257807_at AT3G26650 257832_at AT3G26740 257932_at AT3G17040
![Page 86: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/86.jpg)
84
257947_at AT3G21720 258087_at AT3G26060 258094_at AT3G14690 258151_at AT3G18080 258167_at AT3G21560 258179_at AT3G21690 258240_at AT3G27660 258246_s_at AT5G39060;AT3G29120;AT1G62766;AT1G08105 258257_at AT3G26770 258258_at AT3G26790 258287_at AT3G15990 258310_at AT3G26744 258327_at AT3G22640 258338_at AT3G16150 258495_at AT3G02690 258702_at AT3G09730 258746_at AT3G05950 258857_at AT3G02110 258920_at AT3G10520 258923_at AT3G10450 258931_at AT3G10010 258953_at AT3G01430 258957_at AT3G01420 258993_at AT3G08940 259008_at AT3G09390 259142_at AT3G10200 259167_at AT3G01570 259297_at AT3G05360 259316_at AT3G01175 259489_at AT1G15790 259491_at AT1G15820 259517_at AT1G20630 259544_at AT1G20620 259592_at AT1G27950 259599_at AT1G28110 259625_at AT1G42970 259723_at AT1G60960 259752_at AT1G71040 259765_at AT1G64370 259813_at AT1G49860 259838_at AT1G52220 259840_at AT1G52230 259880_at AT1G76730 259909_at AT1G60870 259975_at AT1G76470 259980_at AT1G76520 259981_at AT1G76450 260060_at AT1G73680 260086_at AT1G63240
![Page 87: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/87.jpg)
85
260106_at AT1G35420 260155_at AT1G52870 260181_at AT1G70710 260236_at AT1G74470 260238_at AT1G74520 260262_at AT1G68470 260472_at AT1G10990 260542_at AT2G43560 260551_at AT2G43510 260592_at AT1G55850 260716_at AT1G48130 260745_at AT1G78370 260770_at AT1G49200 260783_at AT1G06160 260916_at AT1G02475 260968_at AT1G12250 260982_at AT1G53520 261025_at AT1G01225 261149_s_at AT1G19570;AT1G19550 261197_at AT1G12900 261218_at AT1G20020 261305_at AT1G48470 261503_at AT1G71691 261514_at AT1G71870 261618_at AT1G33110 261746_at AT1G08380 261754_at AT1G76130 262098_at AT1G56170 262118_at AT1G02850 262181_at AT1G78060 262226_at AT1G53885 262229_at AT1G68620 262301_at AT1G70880 262304_at AT1G70890 262431_at AT1G47540 262460_s_at AT1G06030;AT1G50390 262536_at AT1G17100 262542_at AT1G34180 262557_at AT1G31330 262577_at AT1G15290 262601_at AT1G15310 262605_at AT1G15170 262632_at AT1G06680 262644_at AT1G62710 262801_at AT1G21010 262888_at AT1G14790 263046_at AT2G05380 263096_at AT2G16060 263114_at AT1G03130
![Page 88: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/88.jpg)
86
263138_at AT1G65090 263184_at AT1G05560 263231_at AT1G05680 263320_at AT2G47180 263433_at AT2G22240 263438_at AT2G28660 263465_at AT2G31940 263475_at AT2G31945 263736_at AT1G60000 263777_at AT2G46450 263979_at AT2G42840 264079_at AT2G28490 264124_at AT1G79360 264148_at AT1G02220 264187_at AT1G54860 264213_at AT1G65390 264301_at AT1G78780 264400_at AT1G61800 264470_at AT1G67110 264482_at AT1G77210 264513_at AT1G09420 264524_at AT1G10070 264545_at AT1G55670 264574_at AT1G05300 264606_at AT1G04660 264612_at AT1G04560 264721_at AT1G23000 264741_at AT1G62290 264752_at AT1G23010 264774_at AT1G22890 264837_at AT1G03600 264839_at AT1G03630 264845_at AT1G03680 264959_at AT1G77090 265033_at AT1G61520 265095_at AT1G03880 265117_at AT1G62500 265287_at AT2G20260 265290_at AT2G22590 265333_at AT2G18350 265354_at AT2G16700 265672_at AT2G31980 265741_at AT2G01320 265876_at AT2G42290 265921_at AT2G18490 266141_at AT2G02120 266391_at AT2G41290 266415_at AT2G38530 266539_at AT2G35160
![Page 89: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/89.jpg)
87
266673_at AT2G29630 266756_at AT2G46950 266790_at AT2G28950 266860_at AT2G26870 266917_at AT2G45830 266925_at AT2G45740 266938_at AT2G18950 267075_at AT2G41070 267164_at no_match 267247_at AT2G30170 267288_at AT2G23680 267300_at AT2G30140 267317_at AT2G34700 267376_at AT2G26330 267526_at AT2G30570
Probesets upregulated in pkl pkr2 and marked by H3K27me3
Probesets AGI 245076_at AT2G23170 245314_at AT4G16745 245567_at AT4G14630 245736_at AT1G73330 245765_at AT1G33600 245768_at AT1G33590 246432_at AT5G17490 246510_at AT5G15410 246566_at AT5G14940 247167_at AT5G65850 247326_at AT5G64110 247421_at AT5G62800 247424_at AT5G62850 247904_at AT5G57390 247988_at AT5G56910 248016_at AT5G56380 248125_at AT5G54740 248407_at AT5G51500 249082_at AT5G44120 249174_at AT5G42900 249384_at AT5G39890 249547_at AT5G38160 249775_at AT5G24160 249894_at AT5G22580 249942_at AT5G22300 250207_at AT5G13930 250476_at AT5G10140 250611_at AT5G07200 250620_at AT5G07190 251420_at AT3G60490
![Page 90: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/90.jpg)
88
251480_at AT3G59710 251576_at AT3G58200 251838_at AT3G54940 253085_s_at AT4G36280 253299_at AT4G33800 253301_at AT4G33720 253499_at AT4G31900 253754_at AT4G29020 253767_at AT4G28520 253894_at AT4G27150 253895_at AT4G27160 253902_at AT4G27170 253904_at AT4G27140 253907_at AT4G27250 254095_at AT4G25140 254687_at AT4G13770 254889_at AT4G11650 255471_at AT4G03050 256514_at AT1G66130 256736_at AT3G29410 257021_at AT3G19710 257026_at AT3G19200 257371_at AT2G47810 257698_at AT3G12730 257768_at AT3G23060 257947_at AT3G21720 258179_at AT3G21690 258240_at AT3G27660 258257_at AT3G26770 258258_at AT3G26790 258327_at AT3G22640 258746_at AT3G05950 258957_at AT3G01420 259813_at AT1G49860 260262_at AT1G68470 260551_at AT2G43510 260716_at AT1G48130 261503_at AT1G71691 261618_at AT1G33110 262229_at AT1G68620 262301_at AT1G70880 262304_at AT1G70890 262431_at AT1G47540 262601_at AT1G15310 262644_at AT1G62710 263046_at AT2G05380 263979_at AT2G42840 264079_at AT2G28490 264124_at AT1G79360
![Page 91: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/91.jpg)
89
264187_at AT1G54860 264470_at AT1G67110 264606_at AT1G04660 265095_at AT1G03880 265117_at AT1G62500 265290_at AT2G22590 265921_at AT2G18490 266141_at AT2G02120 266391_at AT2G41290 266415_at AT2G38530 266790_at AT2G28950 266860_at AT2G26870 266917_at AT2G45830 267317_at AT2G34700
Probesets upregulated in pkl pkr2 and in LEC1 OE
Probesets AGI 245127_at AT2G47600 246194_at AT4G37000 246273_at AT4G36700 246595_at AT5G14780 246814_at AT5G27200 246889_at AT5G25470 247097_at AT5G66460 247268_at AT5G64080 247340_at AT5G63700 247421_at AT5G62800 248125_at AT5G54740 248435_at AT5G51210 249013_at AT5G44700 249082_at AT5G44120 249255_at AT5G41610;AT5G41612249353_at AT5G40420 249894_at AT5G22580 250476_at AT5G10140 250501_at AT5G09640 250611_at AT5G07200 250620_at AT5G07190 250812_at AT5G04900 251202_at AT3G63040 251838_at AT3G54940 252786_at AT3G42670 253049_at AT4G37300 253085_s_at AT4G36280 253394_at AT4G32770 253767_at AT4G28520 253894_at AT4G27150 253895_at AT4G27160
![Page 92: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/92.jpg)
90
253902_at AT4G27170 253904_at AT4G27140 253930_at AT4G26740 254095_at AT4G25140 255471_at AT4G03050 258240_at AT3G27660 258258_at AT3G26790 258327_at AT3G22640 259142_at AT3G10200 259167_at AT3G01570 259752_at AT1G71040 260262_at AT1G68470 260716_at AT1G48130 260745_at AT1G78370 261305_at AT1G48470 261503_at AT1G71691 262431_at AT1G47540 262644_at AT1G62710 263138_at AT1G65090 264079_at AT2G28490 264187_at AT1G54860 264513_at AT1G09420 264606_at AT1G04660 264612_at AT1G04560 264741_at AT1G62290 264752_at AT1G23010 265095_at AT1G03880 265117_at AT1G62500 266391_at AT2G41290 267075_at AT2G41070 267317_at AT2G34700
Table S2. Primers used in this study.
PKL qPCR primers GCTTGTTACATCCATACCAG TGAATTGTCTTGCCTAGTCC
PKR1 qPCR primers GATAGCAAAGCTAGCCAGCAATG TTGGTTGAAGACAGGTGGATC
PKR2 qPCR primers AAGCACGTGATGTTATATGGGAAC TGCTCATATCAACACGCAAAATG
LEC1 qPCR primers AAATCCATCTCTGAATTGAACTT CACGATACCATTGTTCTTGT
FUS3 qPCR primers GCCAAACAACAATAGCAGAA TTTCTTGCTTGTATAACGTAATTG
ABI3 qPCR primers ATGTATCTCCTCGAGAACAC CCCTCGTATCAAATATTTGCC
At3g48740 qPCR primers
CTTATGAACTTTGGAGGATTCTGTG TTACCGTCCTGATTATGCTTAGAG
![Page 93: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/93.jpg)
91
At5g10230 qPCR primers
GAAATCGCTTGTACTAGATCTG TACCAAGAGCTTTCGAATGTC
At5g47980 qPCR primers
CGATTGGAAACTTACAAGGG CTCTTCTTTCTCCTTCCTAAACTC
At1g66800 qPCR primers
GCCGTGTTGATAAGGATAATGAG ATAGGAGTGAACTCAATTCCCA
At5g53190 qPCR primers
TCTCGTCGTTATGAAGAAAGTG CATATTAGGTGACGCAAGAAAGAG
FIE qPCR primers CGTTTCTTCGATGTCTTCGT ACGACTCTTCCTTATCTTCATCAG
EMF2 qPCR primers CAGAAGACTGAAGTAACTGAAGAC AAATTGAGGAGATCGTGGGT
VRN2 qPCR primers GCAGAAATAACACCAGGAGAC CCACGGTTTCCATCATTCAG
CLF qPCR primers ATTATTCGCATGACCCTTGAG CATGTCTTGCCTTGATTTCAC
SWN qPCR primers CAGGGAATGATAATGATGAGGT GACCAGCAGACTTTGTAGAG
MEA qPCR primers GGTGAGGCACTAGAATTGAGCAGT CCATAGTCCTGCCCAACCG
MSI1 qPCR primers CATTTGATAGCCACAAAGAGGAG TCATCGATCCTGCTAAGGTC
AP3 qPCR primers CCAGACAAACAGACAAGTGACGTATT GCTGATATACTCATGAAGCTTGTTGG
AG qPCR primers ACGGAATTATTTCCAAGTCGC GCCTATATTACACTAACTGGAGAG
FLC qPCR primers TGTGGATAGCAAGCTTGTGG TAGTCACGGAGAGGGCAGTC
PP2A qPCR primers TAACGTGGCCAAAATGATGC GTTCTCCACAACCGCTTGGT
CLF ChIP primers GTTTCTAATTTACACGCTTCCC AATCTGAAATGTTGGAGGAG
EMF2 ChIP primers GGTGGATCTCTAATTTGAACTC GAAGGTGAAGATTAGGATGG
SWN ChIP primers CTCAAACGTAACTGCTATAACC CATTACATACAAAGAACGCC
LEC1 ChIP primers TAACTCACTTTCGTAACGCA GAGGTCTATATCTCTTTCCCA
FUS3 ChIP primers TGGTTGAGTGTTAGTTTAGTGG TGGGTTTCAGTGATAGAGATAGAG
ABI3 ChIP primers GAACAAACTGGAACACATGG GATCTGAAGTATACGAGATGTG
At3g48740 ChIP primers
GATTTGGTAATGGTTTAGCGTG TCAGTGTTGAAGAGACTCATGG
At5g10230 ChIP primers
CCAGCTATCTTGATTTCTTTCC TGTTGTCTAGATGATGAGGT
At5g47980 ChIP primers
CTATCATCCAATTACGTGCT AAACTCATTGAACGACACCA
AG ChIP primers AAGAACTACCCACCAATAACTC
![Page 94: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/94.jpg)
92
AGAGCAATCTAAAGGTTCAC AP3 ChIP primers TTTAGTAACTCAAGTGGACCC
CCCTCTCGCCATATTCTTCTC FLC ChIP primers CTATAGAGTTGCTATGGG
CCAAGTAATAGGTCCACAG
![Page 95: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/95.jpg)
93
4.9 References
Ali JY, Bender W. (2004). Cross-regulation among the Polycomb group genes in
Drosophila melanogaster. Mol Cell Biol 24, 7737–7747.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, et al. (2003). Genome-wide
insertional mutagenesis of Arabidopsis thaliana. Science 301, 653–657.
Bleé E, Joyard J. (1996). Envelope membranes from spinach chloroplasts are a site of
metabolism of fatty acid hydroperoxides. Plant Physiology 110, 445–454.
Bouazoune K, Brehm A. (2006). ATP-dependent chromatin remodeling complexes in
Drosophila. Chromosome Res 14, 433–449.
Bouveret R, Schonrock N, Gruissem W, Hennig L. (2006). Regulation of flowering
time by Arabidopsis MSI1. Development 133, 1693–1702.
Chanvivattana Y, Bishopp A, Schubert D, Stock C, Moon YH, et al. (2004).
Interaction of Polycomb-group proteins controlling flowering in Arabidopsis.
Development 131, 5263–5276.
Eshed Y, Baum SF, Bowman JL. (1999). Distinct mechanisms promote polarity
establishment in carpels of Arabidopsis. Cell 99, 199–209.
Goeman JJ, Bühlmann P. (2007). Analyzing gene expression data in terms of gene
sets: methodological issues. Bioinformatics 23, 980–987.
Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz EM, et al. (1997). A
polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature 386,
44–51.
Hall JA, Georgel PT. (2007). CHD proteins: a diverse family with strong ties.
Biochem Cell Biol 85, 463–476.
![Page 96: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/96.jpg)
94
Henderson JT, Li HC, Rider SD, Mordhorst AP, Romero-Severson J, et al. (2004).
PICKLE acts throughout the plant to repress expression of embryonic traits and may
play a role in gibberellin-dependent responses. Plant Physiol 134, 995–1005.
Henikoff S. (2008). Nucleosome destabilization in the epigenetic regulation of gene
expression. Nat Rev Genet 9, 15–26.
Hennig L, Menges M, Murray JAH, Gruissem W. (2003). Arabidopsis transcript
profiling on Affymetrix genechip arrays. Plant Mol Biol 53, 457–465.
Ihaka R, Gentleman R. R: a language for data analysis and graphics. (1996). J Comp
Graph Stat 5, 299–314.
Jiang D, Wang Y, Wang Y, He Y. (2008). Repression of FLOWERING LOCUS C
and FLOWERING LOCUS T by the Arabidopsis Polycomb repressive complex 2
components. PLoS ONE 3(10), e3404. doi: 10.1371/journal.pone.0003404.
Jullien PE, Katz A, Oliva M, Ohad N, Berger F. (2006). Polycomb group complexes
self-regulate imprinting of the Polycomb group gene MEDEA in Arabidopsis. Curr
Biol 16, 486–492.
Kagaya Y, Toyoshima R, Okuda R, Usui H, Yamamoto A, et al. (2005). LEAFY
COTYLEDON1 controls seed storage protein genes through its regulation of
FUSCA3 and ABSCISIC ACID INSENSITIVE3. Plant Cell Physiol 46, 399–406.
Katz A, Oliva M, Mosquna A, Hakim O, Ohad N. (2004). FIE and CURLY LEAF
Polycomb proteins interact in the regulation of homeobox gene expression during
sporophyte development. Plant J 37, 707–719.
Khatri P, Done B, Rao A, Done A, Draghici S. (2005). A semantic analysis of the
annotations of the human genome. Bioinformatics 21, 3416–3421.
![Page 97: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/97.jpg)
95
Kiyosue T, Ohad N, Yadegari R, Hannon M, Dinneny J, et al. (1999). Control of
fertilization-independent endosperm development by the MEDEA Polycomb gene in
Arabidopsis. Proc Natl Acad Sci U S A 96, 4186–4191.
Köhler C, Hennig L, Spillane C, Pien S, Gruissem W, et al. (2003). The Polycomb-
group protein MEDEA regulates seed development by controlling expression of the
MADS-box gene PHERES1. Genes Dev 17, 1540–1553.
Köhler C, Villar CB. (2008). Programming of gene expression by Polycomb group
proteins. Trends Cell Biol 18, 236–243.
Li HC, Chuang K, Henderson JT, Rider SD, Jr, Bai Y, et al. (2005). PICKLE acts
during germination to repress expression of embryonic traits. Plant J 44, 1010–1022.
Lotan T, Ohto M, Yee KM, West MA, Lo R, et al. Arabidopsis LEAFY
COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell
1998;93:1195–1205.
De Lucia F, Crevillen P, Jones AM, Greb T, Dean C. (2008). Inaugural Article: A
PHD-Polycomb Repressive Complex 2 triggers the epigenetic silencing of FLC
during vernalization. Proc Natl Acad Sci U S A 105, 16831–168316.
Makarevich G, Leroy O, Akinci U, Schubert D, Clarenz O, et al. (2006). Different
Polycomb group complexes regulate common target genes in Arabidopsis. EMBO
Rep 7, 947–952.
Mu J, Tan H, Zheng Q, Fu F, Liang Y, et al. (2008). LEAFY COTYLEDON1 is a key
regulator of fatty acid biosynthesis in Arabidopsis. Plant Physiol 148, 1042–1054.
Murawska M, Kunert N, van Vugt J, Langst G, Kremmer E, et al. (2008). dCHD3, a
novel ATP-dependent chromatin remodeler associated with sites of active
transcription. Mol Cell Biol 28, 2745–2757.
![Page 98: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/98.jpg)
96
Ogas J, Cheng JC, Sung ZR, Somerville C. (1997). Cellular differentiation regulated
by gibberellin in the Arabidopsis thaliana pickle mutant. Science 277, 91–94.
Ogas J, Kaufmann S, Henderson J, Somerville C. (1999). PICKLE is a CHD3
chromatin-remodeling factor that regulates the transition from embryonic to
vegetative development in Arabidopsis. Proc Natl Acad Sci U S A 96, 13839–13844.
Rider S, Henderson JT, Jerome RE, Edenberg HJ, Romero-Severson J, et al. (2003).
Coordinate repression of regulators of embryonic identity by PICKLE during
germination in Arabidopsis. Plant J 35, 33–43.
Ruthenburg AJ, Li H, Patel DJ, Allis CD. (2007). Multivalent engagement of
chromatin modifications by linked binding modules. Nat Rev Mol Cell Biol 8, 983–
994.
Schmid M, Davison TS, Henz SR, Pape UJ, Demar M, et al. (2005). A gene
expression map of Arabidopsis thaliana development. Nat Genet 37, 501–506.
Schubert D, Primavesi L, Bishopp A, Roberts G, Doonan J, et al. (2006). Silencing by
plant Polycomb-group genes requires dispersed trimethylation of histone H3 at lysine
27. EMBO J 25, 4638–4649.
Shimono Y, Murakami H, Kawai K, Wade PA, Shimokata K, et al. (2003). Mi-2 beta
associates with BRG1 and RET finger protein at the distinct regions with
transcriptional activating and repressing abilities. J Biol Chem 278, 51638–51645.
Simon P. (2003). Q-Gene: processing quantitative real-time RT-PCR data.
Bioinformatics 19, 1439–1440.
Smyth G. (2004). Linear models and empirical bayes methods for assessing
differential expression in microarray experiments. Stat Appl Genet Mol Biol 3, 1–26.
Srinivasan S, Armstrong JA, Deuring R, Dahlsveen IK, McNeill H, et al. (2005). The
Drosophila trithorax group protein Kismet facilitates an early step in transcriptional
elongation by RNA Polymerase II. Development 132, 1623–1635.
![Page 99: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/99.jpg)
97
Srinivasan S, Dorighi KM, Tamkun JW. (2008). Drosophila Kismet regulates histone
H3 lysine 27 methylation and early elongation by RNA polymerase II. PLoS Genet
4(10), e1000217. doi: 10.1371/journal.pgen.1000217.
Storey J, Tibshirani R. Statistical significance for genomewide studies. (2003). Proc
Natl Acad Sci U S A 100, 9440–9445.
To A, Valon C, Savino G, Guilleminot J, Devic M, et al. (2006). A Network of Local
and Redundant Gene Regulation Governs Arabidopsis Seed Maturation. Plant Cell 18,
1642–1651.
Turck F, Roudier F, Farrona S, Martin-Magniette ML, Guillaume E, et al. (2007).
Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation
of histone H3 lysine 27. PLoS Genet 3(6), e86. doi: 10.1371/journal.pgen.0030086.
Wood CC, Robertson M, Tanner G, Peacock WJ, Dennis ES, et al. (2006). The
Arabidopsis thaliana vernalization response requires a polycomb-like protein complex
that also includes VERNALIZATION INSENSITIVE 3. Proc Natl Acad Sci U S A
103, 14631–14636.
Wu Z, Irizarry RA, Gentleman R, Murillo FM, Spencer F. (2003). A model based
background adjustment for oligonucleotide expression arrays. Technical Report John
Hopkins University, Department of Biostatistics Working Papers, Baltimore, MD.
Xia Y, Nikolau BJ, Schnable PS. (1997). Developmental and hormonal regulation of
the Arabidopsis CER2 gene that codes for a nuclear-localized protein required for the
normal accumulation of cuticular waxes. Plant Physiol 115, 925–937.
Xu L, Shen WH. (2008). Polycomb silencing of KNOX genes confines shoot stem
cell niches in Arabidopsis. Curr Biol 18, 1966–1971.
![Page 100: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/100.jpg)
98
Zhang H, Rider SD, Jr, Henderson JT, Fountain M, Chuang K, et al. (2008). The
CHD3 remodeler PICKLE promotes trimethylation of histone H3 lysine 27. J Biol
Chem 283, 22637–22648.
Zhang X, Clarenz O, Cokus S, Bernatavichute YV, Pellegrini M, et al. (2007a).
Whole-Genome Analysis of Histone H3 Lysine 27 Trimethylation in Arabidopsis.
PLoS Biol 5(5), e129. doi: 10.1371/journal.pbio.0050129.
Zhang X, Germann S, Blus BJ, Khorasanizadeh S, Gaudin V, et al. (2007b). The
Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation. Nat
Struct Mol Biol 14, 869–871.
Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W. (2004). Genevestigator.
Arabidopsis microarray database and analysis toolbox. Plant Physiol 136, 2621–2632.
![Page 101: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/101.jpg)
99
Chapter 5. The chromatin remodeler PICKLE and
Polycomb group proteins act together to time seed
germination
Corina Belle R. Villar and Claudia Köhler
5.1 Abstract
When the embryo has completed the seed maturation stage, it enters a quiescent state
called seed dormancy. Seed dormancy is characterized by the unability of the seed to
germinate even though the conditions are favorable for germination. The end of seed
dormancy and transition to germination is controlled by the relative levels of the
phytohormones gibberrellic acid (GA) and abscisic acid (ABA). When the seed
germinates, ABA levels drop and GA levels rise. This drop in ABA correlates with a
drop in the expression of the ABA-induced genes ABSCISIC ACID INSENSITIVE 3
(ABI3) and ABI5. These genes code for transcription factors that themselves activate
late embryogenesis genes responsible for dessication tolerance of the dormant seed.
Therefore, the decrease in their expression is necessary to ensure that the seed
germinates. In this study we investigated the regulation of ABI3 expression during
seed germination. Here, we report that ABI3 repression determines the timing of seed
germination, and that seed germination is accompanied by an increase in Polycomb
group (PcG) gene expression as well as an increase in enrichment of histone H3 with
trimethylated lysine 27 (H3K27me3) at the ABI3 locus. Therefore, we propose that
ABI3 repression during seed germination is due to PcG activity at the ABI3 locus. We
also report that PKL likely facilitates PcG-mediated ABI3 repression during
germination.
![Page 102: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/102.jpg)
100
5.2 Introduction
Seed dormancy is the failure of an intact viable seed to complete germination under
favorable conditions (Bewley, 1997). At the end of seed dormancy, under favorable
environmental conditions (water, oxygen, appropriate temperature, light) the embryo
leaves the quiescent state – it undergoes water uptake by imbibition, rapidly resumes
metabolic activity and undergoes cell elongation of the embryo axis (radicle) – until
the covering layers of endosperm and seed coat are ruptured and the radicle emerges.
Radicle emergence is considered as a visible sign that germination has been
completed, and is generally used to score germination (Bewley, 1997).
Mutant studies have provided important insights into the control of germination by
phytohormones abscisic acid (ABA) and gibberellic acid (GA). GA and ABA exert
antagonistic effects on germination; GA promotes germination while ABA prevents it
(Bewley, 1997). In the mature, dry seed ABA levels are high and GA levels are low
(Finkelstein et al., 2008). Under normal germination conditions, GA synthesis starts
when the seed starts water uptake during imbibition (Debeaujon and Koornneef, 2000;
Lee et al., 2002), while ABA levels drop rapidly (Ali-Rachedi et al., 2004).
Many factors affect germination rate, e.g., stratification, seed age and the presence of
sugars. The GA biosynthesis enzyme giberellic acid 3-oxidase (GA3OX1) is induced
by stratification at 4°C in dark-imbibed seeds (Yamauchi et al., 2004), while the GA
degradation enzyme giberellic acid 2-oxidase (GA2OX2) is repressed at low
temperatures. In addition, the presence of sugars sucrose, glucose and fructose at low
concentrations represses ABA-induced inhibition of germination (Finkelstein and
Lynch, 2000b).
ABA reaches peak level inside the seed midway through embryogenesis (Karssen et
al., 1983). ABA is synthesized both in the embryo and in the maternally derived seed
coat. Even though the study by Karssen et al. (1983) showed that the majority of ABA
that accumulates in the middle of embryogenesis is synthesized by maternal tissue, it
is the ABA synthesized by the embryo that confers desiccation tolerance and seed
![Page 103: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/103.jpg)
101
dormancy (Finkelstein et al., 2002). The enzyme nine-cis-epoxycarotenoid
dioxygenase (NCED) is the key regulatory enzyme in ABA biosynthesis (Nambara
and Marion-Poll, 2005). ABA-deficient mutants of maize produce viviparous seeds,
i.e., the seeds germinate even before they detach from the parent plant (Robertson,
1955; Tan et al., 2003). In Arabidopsis, NCED genes are expressed in different tissues.
NCED6 and NCED9 are expressed exclusively in the endosperm and embryo during
embryo development and both are required for ABA-induced seed dormancy (Lefevre
et al., 2006).
Another viviparous maize mutant, vp1, was discovered to be the result of a mutation
in a B3 domain transcription factor required for late embryo development (McCarty et
al., 1991). Arabidopsis thaliana has an ortholog of the maize VP1, called ABSCISIC
ACID INSENSITIVE 3 (ABI3), because loss-of-function mutants of this gene were
discovered in screens for seeds that germinate in the presence of high exogenous
ABA (Koorneef et al., 1984; Finkelstein et al., 1994). Severe abi3 mutants produce
non-dormant green seeds and result in embryo lethality when seeds are allowed to
desiccate (Nambara et al., 1992; Ooms et al., 1993). ABI3, together with other
transcription factors LEAFY COTYLEDON 1 (LEC1), LEC2 and FUSCA 3 (FUS3),
control seed maturation programs (To et al., 2006). Loss-of-function mutants of all
four genes – LEC1, LEC2, FUS3 and ABI3 – all show reduced expression of seed-
specific proteins (To et al., 2006). But only abi3 (and cotyledons of lec1) show
reduced sensitivity to ABA (Parcy et al., 1997; Meinke et al., 1994), suggesting that
among these factors, mainly ABI3 is involved in ABA-induced delay in germination.
ABA also promotes the accumulation of a basic leucine zipper transcription factor
ABI5 (Finkelstein and Lynch, 2000a). ABI5 activates LATE AND ABUNDANT (LEA)
genes that are required to confer osmotolerance to the embryo (Lopez-Molina and
Chua, 2000). Recent yeast two-hybrid studies have shown that ABI3 and ABI5
physically interact with each other (Nakamura et al., 2001), which suggests that these
transcription factors interact in the ABA signaling pathway. It has also been shown
that ABI5 acts downstream of ABI3, as 35S:ABI5 can complement the abi3-1 mutant
phenotype while 35S:ABI3 cannot complement the abi5-4 phenotype (Lopez-Molina
et al., 2002).
![Page 104: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/104.jpg)
102
During germination, ABI3 and ABI5 mRNA and protein levels rapidly drop from peak
levels when the seeds are dry. Seeds overexpressing ABI5 germinated and developed
under normal conditions, but under stress conditions the seeds experienced
development arrest and resulted in delayed germination (Lopez-Molina et al., 2001).
Therefore, it is essential to lower ABI5 expression in order to ensure germination.
How exactly ABI3 and ABI5 become repressed as the seed germinates, however, is
still unclear. The ABI3 locus contains a hallmark of Polycomb group (PcG)-mediated
gene regulation, trimethylation of lysine 27 at histone H3 (H3K27me3; Zhang et al.,
2007), suggesting that PcG proteins might be involved in mediating germination.
Therefore, in this study I investigated the functional requirement of PcG proteins in
ABI3 and ABI5 repression and germination.
![Page 105: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/105.jpg)
103
5.3 Results
5.3.1 Expression of CLF is inversely correlated with expression of ABI3 and ABI5 during germination
The germination rate of wild-type seeds was assessed over time from 0 until 5 days
after imbibition (dai) under non-stratifying conditions. Radicle emergence was used
as the criterion to score germination. Under these conditions, wild-type seeds started
to germinate at 2 dai (Figure 1A). I analyzed expression of the ABA-responsive
genes ABI3 and ABI5 as well as PcG genes CLF and SWN during germination
(Figures 1B, 1C).
Both genes were highly expressed before imbibition (0 dai), and rapidly decreased
during imbibition, coinciding with the onset of germination. ABI5 showed a dramatic
decrease in expression at 1 dai, decreasing ~25-fold even before germination occurred,
whereas ABI3 mRNA levels only decreased 6-fold at 2 dai, the time when
germination has occurred.
Expression levels of CLF were inversely correlated with ABI3 and ABI5 expression;
whereas CLF was undetectable before germination, expression increased over time,
reaching peaks at 3 and 5 dai (Figure 1D). SWN mRNA was detectable before and
after germination, but expression levels were at the lowest point at the onset of
germination (2 dai) (Figure 1E). The inverse correlation between mRNA levels of
CLF and ABI3 and ABI5 genes suggested that ABI3 and ABI5 expression is under
regulatory control of PcG proteins during germination.
![Page 106: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/106.jpg)
104
Figure 1. Expression of ABI3 and ABI5 and PcG genes CLF and SWN during germination of wild-type seeds. A. Germination rate of wild-type seeds over time, from 0 to 5 days after imbibition (dai). Percentages represent an assay of 300 wild-type seeds. B. Relative ABI3 mRNA levels of wild-type seeds during germination. C. Relative ABI5 mRNA levels of wild-type seeds during germination. D. Relative CLF mRNA levels of wild-type seeds during germination. E. Relative SWN mRNA levels of wild-type seeds during germination. Error bars, standard deviation of three replicates.
5.3.2 Levels of H3K27me3 at the ABI3 locus increase during germination
If ABI3 and ABI5 are under regulatory control of PcG proteins, we expected to
observe increased levels of H3K27me3 at the ABI3 and ABI5 loci. Chromatin
immunoprecipitation (ChIP) was performed with wild-type seeds before and after
imbibition (0, 2 dai) using antibodies against H3K27me3 (Figure 2). Indeed,
H3K27me3 levels at the ABI3 locus were increased about 5-fold at 2 dai compared to
![Page 107: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/107.jpg)
105
0 dai, whereas no H3K27me3 enrichment could be detected at the ABI5 locus before
or after germination. These results suggest that ABI3 is a direct target of PcG-
mediated repression during germination, whereas ABI5 expression is not directly
regulated by PcG proteins.
Figure 2. H3K27me3 enrichment at ABI3 and ABI5 loci during germination. Error bars, SEM. 5.3.3 PcG proteins regulate seed germination
The next question I addressed was whether PcG proteins are responsible for
repression of ABI3 during germination. Therefore, I performed a germination time
course comparing wild type and swn, clf and swn clf mutants. To avoid biases due to
![Page 108: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/108.jpg)
106
different seed age or parental plant growth conditions, all seeds used in subsequent
experiments were derived from plants that were grown side by side in the same
growth chamber and harvested when they were completely dry. If PcG proteins are
indeed responsible for the repression of ABI3 during germination, we expected that
PcG mutants would exhibit differences in germination rate compared to wild type,
and that ABI3 expression levels in PcG mutants would remain consistently high.
As shown in Figure 3A, loss of SWN pronouncedly delayed germination, whereas loss
of CLF only slightly delayed germination. We also tested the germination rate of
seeds derived from plants that were homozygous for the swn mutation and segregating
for clf (swn clf/+), as double homozygous mutants fail to develop to maturity
(Chanvivattana et al., 2004). Strikingly, loss of CLF within the swn mutant
background synergistically impaired germination. Whereas about 90% of seeds of clf
and swn single mutants germinated at 5 dai, only about 50% of swn clf/+ double
mutants germinated. Given that only 25% of all seeds are homozygous for clf and swn,
this indicated that loss of PcG function dramatically impaired germination. Decreased
germination rates upon loss of PcG function were reflected by increased levels of
ABI3 expression. Although ABI3 expression decreased after imbibition in swn and clf
single mutants, ABI3 expression levels remained higher in swn compared to wild type,
consistent with a decreased germination capacity of swn mutant seedlings. Most
pronouncedly, in swn clf/+ double mutants ABI3 expression remained high until 5 dai,
consistent with a dramatically impaired germination rate of swn clf/+ double mutants
(Figures 3B, 3C). At 5 dai, swn clf double mutant seedlings are already
distinguishable from its siblings, therefore, at 5 dai only swn clf mutants were used as
material for gene expression analysis. These results demonstrate that loss of PcG
impairs germination, correlating with a failed repression of ABI3 expression.
![Page 109: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/109.jpg)
107
Figure 3. Expression of ABI3 and ABI5 in wild type and Polycomb mutants during germination. A. Germination rate of wild type, swn, clf and swn clf/+ seeds. Percentages represent assays of 300 seeds per genotype. B. ABI3 expression levels during germination. Error bars, standard deviation of three replicates.
5.3.4 Loss of PICKLE enhances the PcG mutant phenotype
Loss of PcG function dramatically impaired germination, but it did not completely
prevent it, as about 15% of phenotypically clearly distinguishable swn clf double
mutant seedlings had germinated at 5 dai. Therefore, I asked the question whether
there are other factors that together with PcG proteins mediate the germination
response. Previous studies have shown that the putative chromatin remodeling factor
PICKLE (PKL) shares a subset of target genes with PcG proteins and regulates their
expression (Zhang et al., 2007; Aichinger, Villar et al., 2009). ABI3 is upregulated in
![Page 110: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/110.jpg)
108
the pkl mutant (Perruc et al., 2007; Aichinger, Villar et al., 2009), although we failed
to detect direct binding of PKL to the ABI3 locus (Aichinger, Villar et al., 2009).
Importantly, loss of PKL impairs the germination ability of seeds and causes ABA
hypersensitivity, consistent with increased ABI3 expression levels (Perruc et al., 2007).
To test the functional role of PKL and PcG proteins during seed germination, I
investigated the germination response of pkl swn clf/+ triple mutants (Figure 4a).
Seeds used in this experiment were derived from plants that were grown side by side
in the same growth chamber and harvested when they were completely dry.
Consistent with previously published data (Perruc et al., 2007), loss of PKL impaired
germination and only about 50% of pkl mutant seeds had germinated at 5 dai (Figure
4A). Impaired germination was associated with increased ABI3 expression levels
(Figure 4B). Loss of PKR2 did not enhance the pkl germination phenotype (Figure
4A), indicating that PKR2 does not act redundantly with PKL in regulating
germination.
Triple pkl swn clf mutant seedlings develop into callus-like structures forming somatic
embryos (Aichinger, Villar et al., 2009). Therefore, seeds used in this experiment
were homozygous for pkl swn but segregated for clf. However, none of the
germinated seedlings revealed a callus-like phenotype, suggesting that triple mutant
seeds do not germinate. After scoring germination at 5 dai, I put 51 ungerminated
seeds from the pkl swn clf/+ segregating population on medium with GA and stratified
the plates for 3 days before putting the plates in the light chamber. After 2 weeks the
pkl swn clf triple mutants could be clearly distinguished. The 51 seeds all germinated,
with 40 of them (~80%) showing the callus-like structures characteristic of the pkl
swn clf mutant phenotype, while the rest were either pkl swn or pkl swn clf/+. Taking
this into account, this clearly demonstrates a synergistic effect of pkl on swn clf
mutants on germination.
![Page 111: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/111.jpg)
109
Figure 4. Expression of ABI3 wild-type, PcG and pkl mutant seeds during germination. A. Germination rate of wild-type (wt), pkl, swn, clf, pkl swn, swn clf/+, pkl pkr2 and pkl swn clf/+ seeds over time, from 0 to 5 days after imbibition (dai). Percentages indicate assays of 300 seeds per genotype. B. Corresponding relative ABI3 mRNA levels. Error bars, standard deviation of three replicates.
I addressed the question whether the synergistic effect of pkl on swn clf mutants is
reflected by increased ABI3 expression levels. Because pkl swn clf triple mutant do
not germinate under the experimental conditions used in the germination assay, I
tested ABI3 expression in the ungerminated seeds. However, ABI3 expression levels
in swn clf/+ and pkl swn clf/+ were comparable (Figure 4b). It is possible that several
of the ungerminated seeds were still heterozygous for the clf mutation, as also pkl swn
seeds had a delay in germination (Figure 4a). I tested how many of the ungerminated
seeds in the germination experiment were indeed triple pkl swn clf mutants by putting
![Page 112: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/112.jpg)
110
them on medium with 100 µM GA and stratified the seeds for 3 days before
incubating them in the growth chamber. Around 80% of the seeds developed into
callus-like structures, while the rest germinated into seedlings. This means that around
20% of the plant material from used for gene expression anaylsis were either pkl swn
or pkl swn clf/+. However, also the swn clf mutant is segregating for the clf mutation
and only 25% of tested seedlings are expected to be homozygous for both mutations.
Therefore, the relative number of triple or double homozygous mutants is comparable.
Therefore, I conclude that the synergistic effect of pkl on clf swn mutants is mediated
by an additional effect of PKL on regulators of germination.
5.3.5 PKL is required for H3K27me3 at the ABI3 locus during germination
Since ABI3 expression levels were increased in pkl single mutant seeds compared to
wild type, I asked the question whether PKL binds directly to ABI3 during
germination, and whether PKL affects PcG activity at the ABI3 locus. To answer
these questions, ChIP was performed using wild-type and pkl pkr2 seeds before (0 dai)
and after imbibition (2 dai), with antibodies against PKL as well as H3K27me3
(Figure 5). pkl pkr2 seeds were used instead of the pkl single mutant to avoid
problems caused by cross reactivity of the anti-PKL antibody with the homologous
PKR2 protein. Consistent with our previous data (Aichinger, Villar et al., 2009), I
failed to detect binding of PKL to the ABI3 locus, which, however, could be an
experimental problem caused by a failure of the antibody to detect the PKL protein
when it is part of a protein complex. Therefore, whether PKL directly binds to the
ABI3 locus during germination remains unresolved.
However, the presence of PKL clearly affected the H3K27me3 enrichment at the
ABI3 locus (Figure 5A). In the wild type, H3K27me3 at the ABI3 locus strongly
increased during germination. In contrast, in the pkl pkr2 mutant, H3K27me3
enrichment remained at a similar low level after germination like before germination,
suggesting that PKL is required for PcG proteins to access the ABI3 locus. As well, in
both wild type and pkl pkr2, CLF expression increased substantially during
germination (Figure 5B). And SWN expression levels in wild type and pkl pkr2 are
very similar (Figure 5C), thereby ruling out the possibility that the differences in
![Page 113: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/113.jpg)
111
H3K27me3 enrichment levels in wild type and pkl pkr2 is due to less PcG expression
in pkl pkr2.
Figure 5. PKL is required for PcG activity at the ABI3 locus during germination. A. PKL and H3K27me3 enrichment at the ABI3 locus in wild-type and pkl pkr2 seeds before (0 dai) and after germination (2 dai). Error bars, SEM. B. Relative CLF expression before and after germination. Error bars, standard deviation of three replicates. C. Relative SWN expression before and after germination. Error bars, standard deviation of three replicates.
![Page 114: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/114.jpg)
112
5.4 Discussion
In this study I investigated the role of PcG proteins and the chromatin remodeler PKL
during seed germination. I found that germination is under control of PcG proteins
CLF and SWN and that this response is likely mediated by regulation of ABI3
expression. ABI3 is not marked by H3K27me3 before germination, but the presence
of this mark dramatically increased at 2 dai, correlating with strongly decreased ABI3
expression levels at this time point. Also strongly supporting the essential role of PcG
proteins for ABI3 repression was provided by mutant analysis. Whereas loss of CLF
had no marked effect on ABI3 expression and germination, loss of SWN delayed
germination, correlated with increased ABI3 expression levels. Most importantly, loss
of PcG function in swn clf double mutants caused loss of ABI3 repression and strongly
impaired germination, establishing firm evidence that PcG proteins are essential
regulators of plant germination.
I furthermore could provide evidence that the chromatin remodeler PKL is likely to
facilitate targeting PcG proteins to the ABI3 locus. Loss of PKL caused increased
ABI3 expression and delayed germination. This response was connected with
decreased H3K27me3 levels at the ABI3 locus, suggesting that PKL facilitates the
access of PcG proteins to the ABI3 locus during germination. I failed to detect direct
binding of PKL to the ABI3 locus; however, this could be caused by an experimental
failure caused by an inaccessibility of the epitopes used to generate the PKL
antibodies. I detected reduced expression of CLF in pkl mutants; therefore, reduced
H3K27me3 levels at the ABI3 locus in pkl could be an indirect effect. However, loss
of CLF did not increase ABI3 expression and did not delay germination, making this
scenario rather unlikely. Although formal proof for a direct action of PKL at the ABI3
locus is missing, the data provided in this work would strongly suggest a direct action
of PKL at the ABI3 locus.
PKL is a predicted chromatin remodeling factor and although there are no
biochemical data on the functional role of PKL available, it is possible that PKL is
required to move nucleosomes. PcG proteins bind to nucleosome-depleted regions
![Page 115: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/115.jpg)
113
(Mito et al, 2007), therefore, one possibility is that PKL is required to shift
nucleosomes to allow binding of PcG proteins. PKL is homologous to Drosophila and
human CHD3 protein Mi-2, which has been shown to remodel nucleosomes in an
ATP-dependent manner in vitro (Brehm et al., 2000; Wang and Zhang, 2001).
However, loss of PKL function less dramatically affects ABI3 expression and
germination than loss of PcG function, suggesting that PKL facilitates PcG function,
but is not essential to mediate PcG function. The analysis of the pkl pkr2 double
mutant revealed that PKR2 is unlikely to act redundantly with PKL during
germination, suggesting that there are alternative pathways supporting the access of
PcG protein to chromatin. It is also possible that in the absence of chromatin
remodelers PcG proteins gain access to their target sites with reduced efficiency.
Our previous data argued against a direct role of PKL in regulating ABI3 expression
(Aichinger, Villar et al., 2009). This interpretation was based on the finding that in pkl
pkr2 seedling roots expression of PcG genes was strongly reduced. We also failed to
detect direct binding of PKL to the ABI3 locus in roots, whereas we detected binding
of PKL to genes that had decreased expression levels in pkl (Aichinger, Villar et al.,
2009). It is possible that PKL has tissue-specific action and dependent on the tissue
and time-point during development it can access specific target genes. Therefore, I
hypothesize that PKL directly binds to the ABI3 locus during germination and allows
access of PcG proteins, whereas in seedling roots binding of PcG proteins to the ABI3
locus occurs independently of PKL.
The synergistic effect of pkl on swn clf mutants suggests that PKL has additional roles
during germination aside from mediating ABI3 repression. Our previous study
revealed a requirement of PKL for gene activation, suggesting that PKL is required
during germination to activate genes in the gibberellin response pathway. Indeed,
transcript levels of AtGA3ox1 and AtGA20ox1, which code for enzymes involved in
GA biosynthesis are reduced in pkl (Henderson et al., 2004), supporting this idea.
Whether expression of these genes is as well reduced in pkl seeds during germination
remains to be shown.
![Page 116: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/116.jpg)
114
Together, this study suggests that germination is controlled by two opposing activities:
repression of ABI3 mediated by PcG proteins and facilitated by PKL and activation of
germination due to an unknown role of PKL in the germination response.
![Page 117: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/117.jpg)
115
5.5 Materials and Methods
5.5.1 Chemical and plant materials
All chemicals were bought from Sigma-Aldrich unless otherwise stated.
Different Arabidopsis thaliana accessions were used in the study, as needed in
different experiments. These were obtained from the Nottingham Arabidopsis Stock
Centre. Mutants used in the study are listed in Table 1. Double and triple mutants
were obtained by crossing the mutant lines and genotyping the appropriate
combinations in the F2 or F3 generation.
Table 1. List of Arabidopsis thaliana mutants used in the study.
Mutant Allele Accession Type of mutation Citation
pkl pkl-1 Col-0 EMS-induced mutation Ogas et al., 1998
pkr2 pkr2-1 Col-0 T-DNA insertion,
SALK_109423
Aichinger, Villar et al.,
2009
swn swn-3 Col-0 T-DNA insertion,
SALK_050195
Chanvivattana et al., 2004
clf clf-29 Col-0 T-DNA insertion,
SALK_021003
Bouveret et al., 2006
Seeds used for germination experiments were harvested from plants that were grown
side by side in the same growth chamber.
5.5.2 Arabidopsis seed surface sterilization
Seeds were surface sterilized in sodium hypochlorite solution (5% sodium
hypochlorite, 0.1% Triton X-100) for 10 minutes and washed at least three times with
sterile water inside a clean bench.
![Page 118: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/118.jpg)
116
5.5.3 Plant growth conditions
Surface sterilized seeds were sown on MS plates (Murashige and Skoog basal salts
(Duchefa), 1% sucrose, pH 5.6, 0.8% bactoagar). After one day stratification in the
dark at 4°C, plants were grown in a growth room under long-day conditions (16 hours
light, 8 hours dark) at 22 °C. For germination experiments, however, surface-
sterilized seeds are sown on MS media without sucrose and were not stratified.
For plants that were needed for crosses, transformation and seeds, after 10 days,
seedlings were transferred to soil and grown in a growth chamber at long-day
conditions (16 hours light, 8 hours dark) at 22°C and 60% humidity.
5.5.4 Germination time course
Seeds from plants grown side by side in the growth chamber were used for
germination experiments. Seeds were surface sterilized and sown on MS plates
without sucrose. For each genotype, 100 seeds were sown in each of 3 MS plates.
Germination rate was measured at each specified time point (0, 1, 2, 3, 5 days after
imbibition), determined by looking at the seeds under a stereomicroscope.
Germination was scored according to radical emergence. Gene expression analysis
was also done on seeds at the aforementioned time points.
5.5.5 Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) was performed using antibodies against H3
(Millipore, cat. 07-690), H3K27me3 (Millipore, cat. 07-449), rabbit IgG (Santa Cruz
Biotechnology, cat. sc-2027) and PKL (kindly provided by J. Reyes). ChIP
experiments were done at least twice.
For ChIP on seeds before and after imbibition, the protocol described by Acevedo et
al. (2007) was used. Briefly, 0.1 g of plant tissue was harvested and flash frozen in
liquid nitrogen and ground to a fine powder. Nuclei was isolated by homogenizing
each sample in ice-cold 20 mL Honda Buffer (2.5% (w/v) Ficoll 400, 5% dextran T40,
0.44 M sucrose, 25 mM Tris-HCl pH 7.4, 10 mM MgCl2, 10 mM β-mercaptoethanol,
EDTA-free protease inhibitors). The samples were then filtered through 2 layers of
![Page 119: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/119.jpg)
117
50-µm nylon mesh and then through 2 layers of miracloth (Calbiochem), to which
was added Triton X-100 to a final concentration of 0.5%. After incubation on ice for
15 minutes, the samples were centrifuged for 5 minutes at 1,500×g and 4°C. The
pellet was resuspended 1 mL Honda buffer containing 0.1% Triton X-100 and then
centrifuged once again for 5 minutes at 1,500×g and 4°C. The nuclear pellet was then
carefully resuspended in 1 mL of 1X PBS (phosphate buffer saline) with EDTA-free
protease inhibitors and 10 mM DMA. Formaldehyde was added to a final
concentration of 1%, mixed gently and incubated on ice for 8 minutes for crosslinking.
Crosslinking was stopped with glycine to a final concentration of 0.125 M, and
incubated on ice for another 5 minutes. The samples were then centrifuged at 1,500 g
for 5 minutes and washed twice with 1X PBS with protease inhibitors. The washed
pellet was then resuspended in 300 µL Nuclei Lysis Buffer (50 mM Tris-HCl pH 8,
10 mM EDTA, 1% SDS, EDTA-free protease inhibitors), incubated on ice for 10
minutes and flash frozen in liquid nitrogen. It was then thawed at room temperature to
aid in nuclei lysis and then sonicated for 10 minutes with 30 seconds on, 1 minute off
cycles on a Bioruptor 200 sonicator. The sonicated chromatin was then centrifuged at
16,000×g for 10 minutes and the supernatant was transferred to a new tube, to which
30 µL of pre-blocked Staph A cells (Calbiochem) was added for pre-clearing for 15
minutes at 4°C on a rotating platform. The pre-cleared chromatin was centrifuged at
16,000×g for 10 minutes and evenly distributed into as many 0.5 mL siliconized tubes
as required for the experiment (one for each antibody). Each sample was filled to 0.5
mL with ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7
mM Tris-HCl pH 8, 167 mM NaCl) and then 0.1 µg of each antibody was added and
allowed to form complexes overnight at 4°C in a rotating platform. Immune
complexes were collected by adding 5 µL pre-blocked Staph A cells per sample and
incubating in a rotating platform for 15 minutes. The samples were then centrifuged at
16,000×g for 10 minutes at 4°C, and the supernatant was removed. The pellet was
then washed twice in 0.5 mL 1X dialysis buffer (2 mM EDTA, 50 mM Tris-HCl pH 8,
0.2% N-lauroylsarcosine) and thrice in ChIP wash buffer (100 mM Tris-HCl pH 9,
500 mM LiCl, 1% NP40, 1% deoxycholic acid). As much of the supernatant was
removed by aspirating with a 2-µL pipette tip. Immune complexes were then eluted
twice with 50 µL elution buffer, by vortexing at “vortex 3” setting on a Vortex Genie
(Scientific Industries) for 20 minutes each time. The eluates were combined and then
reverse crosslinked, along with input DNA, with final concentration of 0.45 M NaCl
![Page 120: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/120.jpg)
118
at 100°C for 15 minutes. It was then treated with 10 µg DNAse-free RNAse for 15
minutes at 37°C and then with 2 µg proteinase K for 15 minutes at 67 °C, and then
purified using the QIAquick PCR purification kit (Qiagen) according to the
manufacturer’s instructions. ChIP DNA was eluted with a total of 100 µL elution
buffer (supplied in the kit) and stored at -20°C until use for ChIP DNA analysis.
5.5.6 Standard molecular biology procedures
DNA extraction
Standard genomic DNA was extracted using the method described by Edwards et al.
(1991). Plant material was harvested in a 1.5-mL tube containing glass beads and
flash-frozen in liquid nitrogen. The frozen tissue was ground using an
amalgamator/mixer (Ivoclar Vivadent). To each ground plant sample, 500 µL of
Edwards buffer (200 mM Tris pH 7.5, 250 mM NaCl, 25 mM EDTA, 0.5% (w/v)
SDS) was added. The sample was vortexed and centrifuged for 5 minutes at 13,200
rpm in a benchtop centrifuge, from which 400 µL of the supernatant liquid was taken
and placed in a new 1.5-mL tube with equal volume of isopropanol. The sample was
mixed by inverting and centrifuged for 10 min at 13,200 rpm. The supernatant was
then decanted and the pellet was washed with 1 mL 70% ethanol. The tube was again
centrifuged for 5 min at 13,200 rpm, the supernant was decanted. The DNA pellet air-
dried and then resuspended in 100 µL sterile water.
RNA extraction and cDNA synthesis
RNA from dry seeds and germinating seeds were extracted using RNeasy Plant kit
(Qiagen) according to the manufacturer’s instructions. RNA was reverse transcribed
to cDNA using the RevertAid First strand cDNA synthesis kit (Fermentas) according
to the manufacturer’s instructions.
PCR
Standard PCR was done with the following components: 1X PCR buffer (10 mM
Tris-HCl pH 7.5, 1.5 mM MgCl2, 50 mM KCl), 0.2 mM of each dNTP, 0.25 µM each
primer, 0.5 U Taq polymerase. Recombinant Taq polymerase was made following the
![Page 121: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/121.jpg)
119
procedure described by Desai and Pfaffle (1995). PCR cycling conditions were varied
depending on primer sequence, primer efficiency and amplicon length.
PCR primer design
PCR primers for genotyping T-DNA insertion mutants were designed using the T-
DNA primer design tool at http://signal.salk.edu/tdnaprimers.2.html. Primers for
genotyping are listed in Table 2. PCR primers for gene expression analysis (Table 3)
and ChIP analysis (Table 4) were designed using PerlPrimer.
Table 2. PCR primers used for genotyping of mutant alleles. Forward (Fwd) and reverse (Rev) primers were used for genomic DNA-specific PCR. Reverse and T-DNA border primer (T-DNA) primers were used for T-DNA-specific PCR. All sequences are written from 5’ to 3’. Mutant allele
Mutant identifier Primers
pkl-1 Fwd: CGATGCACTTGAGACAACT Rev: GATGACACTAAGAGAAGCTGAAATTCAGGC Amplicon cut by Hpy188I
pkr2-1 SALK_109423 Fwd: CGTAAAAGCTTCATTTGCGTC Rev: TTTTGCTTAGAATATCATTCTCTGG T‐DNA: CAACACTCAACCCTATCTCGG
clf-29 SALK_021003 Fwd: TGGGTTCGTTTAGGAACCATT Rev: CCAGCATAACAGTTGACATAGCA T‐DNA: CAACACTCAACCCTATCTCGG
swn-3 SALK_050195 Fwd: CGTTTCCGAGGATGTCATTGTG Rev: TGGAACTTTTGAGTGGCTAGAGGTG T‐DNA: GCGTGGACCGCTTGCTGCAACT
Table 3. PCR primers used for gene expression analysis Gene Primers ABI3 qPCR primers ATGTATCTCCTCGAGAACAC
CCCTCGTATCAAATATTTGCC ABI5 qPCR primers CAGAACAATGCTCAGAACGG
CGGGTTTGGATTAGGTTTAGG CLF qPCR primers ATTATTCGCATGACCCTTGAG
CATGTCTTGCCTTGATTTCAC SWN qPCR primers CAGGGAATGATAATGATGAGGT
GACCAGCAGACTTTGTAGAG PP2A qPCR primers TAACGTGGCCAAAATGATGC
GTTCTCCACAACCGCTTGGT
![Page 122: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/122.jpg)
120
Table 4. PCR primers used for ChIP analysis Gene Type of analysis Primers ABI3 Quantitative TTAGCTGTTCATCAGTTCTTCC
CGAGTCTAGATCTGAAGTATACGA ABI5 Quantitative CCTGGACCTGTCTAAGTTAGC
TATGTTCTCACCGTGAGAGTG Quantitative PCR Analysis
Gene-specific primers were used with the Fast-SYBR-mix (Applied Biosystems) on a
7500 Fast Real-time PCR system (Applied Biosystems). Analyses were performed
using at least three experimental replicates. Primer efficiency and dissociation plot of
each primer pair was determined, and from this, mean expression values and standard
errors were determined.
For gene expression analysis, relative expression was calculated by the ratio of the
mean expression value of the gene of interest to that of the reference gene, where
PP2a was used as the reference gene. Error bars were calculated by error propagation
calculation.
For ChIP DNA analysis, the results were presented as percent of input (Simon, 2003).
Error bars were calculated by error propagation calculation.
![Page 123: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/123.jpg)
121
5.6 References
Acevedo LG, Iniguez AL, Holster HL, Zhang X, Green R and Farnham PJ. (2007).
Genome-scale ChIP-chip analysis using 10,000 human cells. Biotechniques 43(6),
791-7.
Aichinger E, Villar CB, Farrona S, Reyes JC, Hennig L and Köhler C. (2009). CHD3
proteins and Polycomb group proteins antagonistically determine cell identity in
Arabidopsis. PLoS Genet 5(8), e1000605.
Ali-Rachedi S, Bouinot D, Wagner MH, Bonnet M, Sotta B, Grappin P, Jullien M.
(2004). Changes in endogenous abscisic acid levels during dormancy release and
maintenance of mature seeds: studies with the Cape Verde Islands ecotype, the
dormant model of Arabidopsis thaliana. Planta 219(3), 479-88.
Bewley JD. (1997). Seed germination and dormancy. Plant Cell 9(7),1055-1066
Brehm A, Tufteland KR, Aasland R and Becker PB. (2004). The many colours of
chromodomains. Bioessays 26, 133-140.
Chanvivattana Y, Bishopp A, Schubert D, Stock C, Moon Y-H, Sung ZR and
Goodrich J. (2004). Interaction of Polycomb-group proteins controlling flowering in
Arabidopsis. Development 131, 5263-5276.
Debeaujon I and Koornneef M. (2000). Gibberellin requirement for Arabidopsis seed
germination is determined both by testa characteristics and embryonic abscisic acid.
Plant Physiol 122(2), 415-24.
Desai UJ and Pfaffle PK. (1995). Single-step purification of a thermostable DNA
polymerase expressed in Escherichia coli. Biotechniques 19, 780-782.
Edwards K, Johnstone C and Thompson C. (1991). A simple and rapid method for the
preparation of plant genomic DNA for PCR analysis. Nucleis Acids Res 19, 1349.
![Page 124: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/124.jpg)
122
Finkelstein RR. (1994): Mutations in two new Arabidopsis ABA response loci are
similar to abi3 mutations. Plant J 5, 765-771.
Finkelstein R and Lynch T. (2000a). The Arabidopsis abscisic acid response gene
ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12, 599-609.
Finklestein R and Lynch T. (2000b). Abscisic acid inhibition of radicle emergence but
not seedling growth is suppressed by sugars. Plant Physiol 122, 1179-1186.
Finkelstein RR, Gampala SS and Rock CD. (2002). Abscisic acid signaling in seeds
and seedlings. Plant Cell 14 Suppl, S15-45.
Finkelstein R, Reeves W, Ariizumi T, Steber C. (2008). Molecular aspects of seed
dormancy. Annu Rev Plant Biol 59, 387-415.
Henderson JT, Li hC, Rider SD, Mordhorst AP, Romero-Severson J, Cheng JC,
Robey J, Sung ZR, deVries SC, and Ogas J. (2004). PICKLE acts throughout the
plant to repress expression of embryonic traits and may play a role in gibberellin-
dependent responses. Plant Physiol 134, 995-1005.
Karssen C, Brinkhorst-van der Swan D, Breckland A, and Koornneef M. (1983).
Induction of dormancy by endogenous abscisic acid: Studies of abscisic acid deficient
genotypes of Arabidopsis thaliana (L.) Heynh. Planta 157, 158-165.
Koorneef M, Reuling G and Karssen C. (1984). The isolation and characterization of
abscisic acid-insensitive mutants of Arabidopsis thaliana. Physiol Plant 61, 377-383.
Lee S, Cheng H, King KE, Wang W, He Y, Hussain A, Lo J, Harberd NP, Peng J.
(2002). Gibberellin regulates Arabidopsis seed germination via RGL2, a GAI/RGA-
like gene whose expression is up-regulated following imbibition. Genes Dev 16(5),
646-58.
![Page 125: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/125.jpg)
123
Lefebvre V, North H, Frey A, Sotta B, Seo M, Okamoto M, Nambara E, Marion-Poll
A. (2006). Functional analysis of Arabidopsis NCED6 and NCED9 genes indicates
that ABA synthesized in the endosperm is involved in the induction of seed dormancy.
Plant J 45(3), 309-19.
Lopez-Molina L and Chua N-H. (2000). A null mutation in a bZIP factor confers
ABA-insensitivity in Arabidopsis thaliana. Plant Cell Physiol 41, 541-547.
Lopez-Molina L., Mongrand S and Chua, N-H. (2001). A post-germination
development arrest checkpoint is mediated by abscisic acid and requires the ABI5
transcription factor in Arabidopsis. Proc Nat Acad Sci USA 98, 4782-4787.
Lopez-Molina L, Mongrand S, McLachlin DT, Chait BT and Chua, N-H. (2002).
ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during
germination. Plant J 32, 317-328.
McCarty, DR, Hattori T, Carson CB, Vasil V, Lazar M and Vasil I. (1991). The
Viviparous-1 developmental gene of maize encodes a novel transcription
activator.Cell 66, 895-905.
Meinke DW, Franzmann LH, Nickle TC and Yeung EC. (1994). Leafy cotyledon
mutants of Arabidopsis. Plant Cell 6, 1049-1064.
Mito Y, Henikoff JG and Henikoff S. (2007). Histone replacement marks the
boundaries of cis-regulatory domains. Science 315, 1408–1411.
Nakamura S, Lynch TJ and Finkelstein RR. (2001). Physical interactions between
ABA response loci of Arabidopsis. Plant J 26(6), 627-635.
Nambara E and McCourt P. (1992). A mutant of Arabidopsis which is defective in
seed development and storage protein accumulation is a new abi3 allele. Plant J 2,
388-392.
![Page 126: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/126.jpg)
124
Nambara E and Marion-Poll A. (2005). Abscisic acid biosynthesis and catabolism.
Annu Rev Plant Biol 56, 165-185.
Ooms JJJ, Leon-Kloosterzeil KM, Bartels D, Koornneef M and Karssen CM. (1993).
Acquisition of desiccation tolerance and longevity in seeds of Arabidopsis thaliana.
Plant Physiol 102, 1185-1191.
Parcy F, Valon C, Kohara A, Misera S and Giradudat J. (1997). The ABSCISIC
ACID-INSENSITIVE3, FUSCA3 and LEAFY COTYLEDON1 loci act in concert to
control multiple aspects of Arabidopsis seed development. Plant Cell 9, 1265-1277.
Perruc E, Kinoshita N and Lopez-Molina L. (2007). The role of chromatin-
remodeling factor PKL in balancing osmotic stress responses during Arabidopsis seed
germination. Plant J 52(5), 927-36.
Robertson D. (1955). The genetics of vivipary in maize. Genetics 40, 745-760.
Tan BC, Joseph LM, Deng, WT, Liu L, Li QB, Cline K and McCarty DR. (2003).
Molecular characterization of the Arabidopsis 9-cis epoxycarotenoid dioxygenase
gene family. Plant J 35, 44–56.
To A, Valon C, Savino G, Guilleminot J, Devic M, Giraudat J and Parcy F. (2006). A
network of local and redundant gene regulation governs Arabidopsis seed maturation.
Plant Cell 18, 1642-1651.
Wang HB and Zhang Y. (2001). Mi2, an auto-antigen for dermatomyositis, is an
ATP-dependent nucleosome remodeling factor. Nucleic Acids Res 29, 2517-2521.
Zhang X, Clarenz O, Cokus S, Bernatavichute YV, Pellegrinii M, Goodrich J, and
Jacobsen SE. (2007). Whole-genome analysis of histone H3 lysine 27 trimethylation
in Arabidopsis. PLoS Biol 5, e129.
![Page 127: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/127.jpg)
125
Chapter 6. Conclusions
Higher plants undergo different developmental changes during their life cycle.
Transition from one stage to the next requires tight regulation of genes that are needed
to be expressed at one stage and repressed at another. PcG proteins play crucial roles
in these processes by regulating the stable repression of a subset of genes during
specific developmental stages of plant development. As a consequence of PcG action
specific genomic programmes are active at defined stages of plant development. The
aim of this thesis was to contribute to our understanding of the role and action of PcG
proteins during different stages of plant development.
PcG proteins mediate imprinting of PHE1 during seed development
The FIS PcG complex acts in the female gametophyte and during seed development.
Two of its direct target genes, MEA and PHE1, are regulated by genomic imprinting.
Genomic imprinting is the monoallelic expression of specific genes depending on
their parent of origin. In the case of PHE1, it is maternally imprinted and therefore,
paternally expressed. In Chapter 3, I showed that although PHE1 is a PcG target, its
imprinting is not a direct consequence of PcG action. Rather, PHE1 imprinting is due
to a combination of PcG binding and the presence of a methylated region containing
tandem repeats downstream of the PHE1 locus. This region is likely to be
differentially methylated in the endosperm, with the maternal allele being less
methylated compared to the paternal allele due to the activity of the DNA glycosylase
DEMETER (DME) in the central cell (Hsieh et al., 2009; Gehring et al., 2009). How
this differentially methylated region interacts with the FIS complex that binds to the
promoter region is still unknown. But the current model (Makarevich et al., 2008)
suggests that this unmethylated region in the maternal allele may block transcription
by forming a repressive loop. This loop could be formed by facilitated binding of the
FIS PcG complex to this region in the central cell. Data from our laboratory
(Weinhofer et al., 2010) revealed that FIS PcG binding and DNA methylation largely
exclude each other, so if this region becomes demethylated due to DME activity, it
might become accessible for the FIS PcG complex.
![Page 128: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/128.jpg)
126
A looping model would be similar to the insulin-like growth factor II (Igf2)
imprinting model in mouse (Li et al., 2008) and the Dp(1;f)LJ9 mini-X chromosome
imprinting in Drosophila (MacDonald et al., 2010; Hou and Gorces, 2010). In the
mammalian Igf2 model proposed by Li et al. (2008), the CCCTC-binding factor
(CTCF) binds to the unmethylated maternal allele of the imprinting control region
(ICR) of the H19/Igf2 imprinting domain. CTCF then interacts with the PcG protein
Suz12 and this interaction recruits the PRC2 complex, leading to the addition of
H3K27me3 marks at the maternal allele, and consequently, transcriptional repression
of the maternal allele. While imprinting in plants affect single genes, and imprinting
in mammals affect single genes or clusters of genes, in Drosophila, it affects not only
single genes but whole chromosomes. The study by MacDonald et al. (2010) focused
on imprinting of the garnet gene of the Dp(1;f)LJ9 mini-X chromosome, where
maternal inheritance of the chromosome leads to full expression of the garnet gene,
while paternal inheritance leads to variegated garnet expression. This study revealed
that Drosophila CTCF (dCTCF) maintains the maternal imprint. One of the
mechanisms suggested by Hou and Gorces (2010) by which dCTCF mediates
maintenance of maternal imprinting is the formation of a chromosome loop between
two dCTCF sites, one adjacent to the heterochromatin and another upstream of the
garnet gene. This loop prevents spreading of heterochromatin and thus allows
transcription of the garnet gene from the maternal allele. Similarities in imprinting
mechanisms of PHE1 in plants, Igf2 in mammals and garnet in flies suggest that
genomic imprinting is evolutionarily conserved.
PcG proteins and PKL antagonistically determine cell identity
In plants, PcG proteins are required to promote cell differentiation by suppressing
embryonic development. A similar function has been proposed by the CHD3 protein
PKL, which is required for PHE1 repression during vegetative development. The
genetic connection between pkl and PcG proteins in suppressing embryonic traits was
the main objective of Chapter 4. In Chapter 4, I showed that PKL is a direct activator
of some PcG target genes. PKL activity counteracts PcG-mediated repression and
therefore, PKL has trxG-like function.
![Page 129: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/129.jpg)
127
I also showed that PKL directly targets PcG genes, in particular EMF2 and SWN,
implicating that PKL suppresses embryonic traits through regulation of PcG gene
expression. PcG-mediated repression of embryonic traits, therefore, also requires PKL.
The underlying molecular mechanism of PKL action is still unclear. However, PKL
encodes a putative CHD3 chromatin remodeling factor, suggesting that PKL moves
nucleosomes along the DNA, allowing access of proteins such as transcription factors,
polymerases and/or PcG proteins to defined DNA sequence motifs. If so, we
hypothesized that PKL has context-specific function; whereas at some loci PKL acts
as a trxG protein and facilitates binding of transcriptional activators, at other loci it
acts as a facilitator of PcG binding. Data shown in Chapter 4 provide support for this
hypothesis.
PcG proteins and PKL determine timing of seed germination
Transition from a seed’s quiescent state to germination is determined by relative
levels of the phytohormones GA and ABA. Higher ABA to GA level maintains
dormancy. ABA induces expression of ABI genes. It is known that ABI3 is a PcG
target (Zhang et al., 2007), but whether PcG action on ABI3 controls germination was
unclear. I showed in Chapter 5 that PcG proteins CLF and SWN regulate timing of
germination by controlling ABI3 expression, and that this PcG-mediated regulation of
ABI3 expression is facilitated by PKL. I hypothesize that binding of PKL allows PcG
proteins to access the ABI3 locus during germination. PKL’s action as a chromatin
remodeler in PcG-mediated control of germination is currently being investigated. If
confirmed, this mechanism of PcG- and PKL-mediated control of germination timing
is further proof that PcG and PKL act on similar target genes.
In conclusion, in my thesis I revealed PcG-mediated mechanisms of gene regulation
during different stages of plant development: the gametophytic stage, the transition
from the quiescent embryo to seedling stage and during vegetative development. The
results from my thesis not only emphasize the essential role of PcG proteins for plant
development, but also underline the importance of other chromatin-modifying
processes, such as DNA methylation and the activity of chromatin remodeling factors.
How different epigenetic modifications interact to regulate gene expression and
![Page 130: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/130.jpg)
128
specify cell identity is the subject of the rapidly expanding field of developmental
biology with many exciting discoveries still to be made.
![Page 131: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/131.jpg)
129
Chapter 7. References
Armstrong JA, Papoulas O, Daubresse G, Sperling AS, Lis JT, Scott MP, Tamkun JW.
(2002). The Drosophila BRM complex facilitates global transcription by RNA
polymerase II. EMBO J 21(19), 5245-5254.
van Attikum H, Fritsch O, Hohn B, Gasser SM. (2004). Recruitment of the INO80
complex by H2A phosphorylation links ATP-dependent chromatin remodeling with
DNA double-strand break repair. Cell 119(6), 777-788.
Aufsatz W, Mette MF, van der Winden J, Matzke M, Matzke AJ. (2002). HDA6, a
putative histone deacetylase needed to enhance DNA methylation induced by double-
stranded RNA. EMBO J 21(24), 6832-6841.
Baker SC, Robinson-Beers K, Villanueva JM, Gaiser JC, Gasser CS. (1997).
Interactions among genes regulating ovule development in Arabidopsis thaliana.
Genetics 145, 1109-1124.
Bao Y, Shen X. (2007). Chromatin remodeling in DNA double-strand break repair.
Curr Opin Genet Dev 17(2), 126-131.
Baroux C, Gagliardini V, Page DR, Grossniklaus U. (2006). Dynamic regulatory
interactions of Polycomb group genes: MEDEA autoregulation is required for
imprinted gene expression in Arabidopsis. Genes Dev 20, 1081-1086.
Bartee L, Bender J. (2001). Two Arabidopsis methylation-deficiency mutations confer
only partial effects on a methylated endogenous gene family. Nucleic Acids Res
29(10), 2127-2134.
Bash R, Lohr D. (2001). Yeast chromatin structure and regulation of GAL gene
expression. Prog Nucleic Acid Res Mol Biol 65, 197-259.
![Page 132: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/132.jpg)
130
Bezhani S, Winter C, Hershman S, Wagner JD, Kennedy JF, Kwon CS, Pfluger J, Su
Y, Wagner D. (2007). Unique, shared, and redundant roles for the Arabidopsis
SWI/SNF chromatin remodeling ATPases BRAHMA and SPLAYED. Plant Cell
19(2), 403-416.
Bird AP, Wolffe AP. (1999). Methylation-induced repression--belts, braces, and
chromatin. Cell 99(5), 451-454.
Bostick M, Kim JK, Estève PO, Clark A, Pradhan S, Jacobsen SE (2007). UHRF1
plays a role in maintaining DNA methylation in mammalian cells. Science
317(5845),1760-1764.
Bratzel, F, Lopez-Torrejon, G, Koch, M, Del Pozo, JC, Calonje, M. (2010). Keeping
cell identity in Arabidopsis requires PRC1 RING-finger homologs that catalyze H2A
monoubiquitination. Current Biology 20, 1853-1859.
Brzeski J, Jerzmanowski A. (2003). Deficient in DNA methylation 1 (DDM1) defines
a novel family of chromatin-remodeling factors. J Biol Chem 278(2), 823-828.
Campos EI and Reinbert D. (2009). Histones: annotating chromatin. Annu Rev Genet
43, 559 – 599.
Cao X, Jacobsen SE. (2002). Locus-specific control of asymmetric and CpNpgG
methylation by the DRM and CMT3 methyltransferase genes. Proc Natl Acad Sci U S
A 99 Suppl 4, 16491-16498.
Chai B, Huang J, Cairns BR, Laurent BC. (2005). Distinct roles for the RSC and
Swi/Snf ATP-dependent chromatin remodelers in DNA double-strand break repair.
Genes Dev 19(14), 1656-61.
Chodavarapu RK, Feng S, Bernatavichute YV, Chen PY, Stroud H, Yu Y, Hetzel JA,
Kuo F, Kim J, Cokus SJ, Casero D, Bernal M, Huijser P, Clark AT, Krämer U,
![Page 133: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/133.jpg)
131
Merchant SS, Zhang X, Jacobsen SE, Pellegrini M. (2010). Relationship between
nucleosome positioning and DNA methylation. Nature 466(7304), 388-392.
Choi Y, Gehring M, Johnson L, Hannon M, Harada JJ, Goldberg RB, Jacobsen SE,
Fischer RL (2002). DEMETER, a DNA glycosylase domain protein, is required for
endosperm gene imprinting and seed viability in Arabidopsis. Cell 110, 33–42
Chua YL, Watson LA, Gray JC. (2003). The transcriptional enhancer of the pea
plastocyanin gene associates with the nuclear matrix and regulates gene expression
through histone acetylation. Plant Cell 15(6), 1468-1479.
Clapier CR, Cairns BR. (2009). The biology of chromatin remodeling complexes.
Annu Rev Biochem 78, 273-304.
Cokus SJ, Feng S, Zhang X, Chen Z, Merriman B, Haudenschild CD, Pradhan S,
Nelson SF, Pellegrini M, Jacobsen SE. (2008). Shotgun bisulphite sequencing of the
Arabidopsis genome reveals DNA methylation patterning. Nature 452(7184), 215-219.
Côté J, Quinn J, Workman JL, Peterson CL. (1994). Stimulation of GAL4 derivative
binding to nucleosomal DNA by the yeast SWI/SNF complex. Science 265(5168), 53-
60.
Delmas V, Stokes DG, Perry RP. (1993). A mammalian DNA-binding protein that
contains a chromodomain and an SNF2/SWI2-like helicase domain. Proc Natl Acad
Sci U S A 90(6), 2414-2418.
Ebbert R, Birkmann A, Schüller HJ. (1999). The product of the SNF2/SWI2
paralogue INO80 of Saccharomyces cerevisiae required for efficient expression of
various yeast structural genes is part of a high-molecular-weight protein complex. Mol
Microbiol 32(4), 741-751.
Ehrlich M. (2003). Expression of various genes is controlled by DNA methylation
during mammalian development. J Cell Biochem 88(5), 899-910.
![Page 134: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/134.jpg)
132
Elfring LK, Deuring R, McCallum CM, Peterson CL, Tamkun JW. (1994).
Identification and characterization of Drosophila relatives of the yeast transcriptional
activator SNF2/SWI2. Mol Cell Biol 14(4), 2225-2234.
Erkina TY, Zou Y, Freeling S, Vorobyev VI, Erkine AM. (2010). Functional interplay
between chromatin remodeling complexes RSC, SWI/SNF and ISWI in regulation of
yeast heat shock genes. Nucleic Acids Res 38(5),1441-1449.
Eshed Y, Baum SF, Bowman JL. (1999). Distinct mechanisms promote polarity
establishment in carpels of Arabidopsis. Cell 99, 199–209.
Fan Y, Nikitina T, Zhao J, Fleury TJ, Bhattacharyya R, Bouhassira EE, Stein A,
Woodcock CL, Skoultchi AI. (2005). Histone H1 depletion in mammals alters global
chromatin structure but causes specific changes in gene regulation. Cell 123(7), 1199-
1212.
Farrona S, Hurtado L, Bowman JL, Reyes JC. (2004). The Arabidopsis thaliana
SNF2 homolog AtBRM controls shoot development and flowering. Development
131(20), 4965-4975.
Farrona S, Hurtado L, Reyes JC. (2007). A nucleosome interaction module is required
for normal function of Arabidopsis thaliana BRAHMA. J Mol Biol 73(2), 240-250.
Francis NJ, Kingston RE, Woodcock CL. (2004). Chromatin compaction by a
polycomb group protein complex. Science 306(5701), 1574-1577.
Fritsch O, Benvenuto G, Bowler C, Molinier J, Hohn B. (2004). The INO80 protein
controls homologous recombination in Arabidopsis thaliana. Mol Cell 16(3), 479-485.
Gehring M, Bubb KL, Henikoff S. (2009). Extensive demethylation of repetitive
elements during seed development underlies gene imprinting. Science 324(5933),
1447-1451.
![Page 135: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/135.jpg)
133
Gehring M, Huh JH, Hsieh TF, Penterman J, Choi Y, Harada JJ, Goldberg RB,
Fischer RL. (2006). DEMETER DNA glycosylase establishes MEDEA Polycomb
gene self-imprinting by allele-specific demethylation. Cell 124, 495-506.
Goldmark JP, Fazzio TG, Estep PW, Church GM, Tsukiyama T. (2000). The Isw2
chromatin remodeling complex represses early meiotic genes upon recruitment by
Ume6p. Cell 103(3), 423-433.
Gong Z, Morales-Ruiz T, Ariza RR, Roldán-Arjona T, David L, Zhu JK. (2002).
ROS1, a repressor of transcriptional gene silencing in Arabidopsis, encodes a DNA
glycosylase/lyase. Cell 111(6), 803-814.
Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz EM, et al. (1997). A
polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature 386,
44–51.
Grossniklaus U, Vielle-Calzada JP, Hoeppner MA, Gagliano WB. (1998). Maternal
control of embryogenesis by MEDEA a Polycomb group gene in Arabidopsis. Science
280, 446-450.
Gurley LR, Walters RA, Tobey RA. (1975). Sequential phsophorylation of histone
subfractions in the Chinese hamster cell cycle. J Biol Chem 250(10), 3936-3944.
Hashimoto H, Takami Y, Sonoda E, Iwasaki T, Iwano H, Tachibana M, Takeda S,
Nakayama T, Kimura H, Shinkai Y. (2010). Histone H1 null vertebrate cells exhibit
altered nucleosome architecture. Nucleic Acids Res 38(11), 3533-3545.
Hellauer K, Sirard E, Turcotte B. (2001). Decreased expression of specific genes in
yeast cells lacking histone H1. J Biol Chem 276(17), 13587-13592.
Hendzel MJ, Wei Y, Mancini MA, Van Hooser A, Ranalli T, Brinkley BR, Bazett-
Jones DP, Allis CD. (1997). Mitosis-specific phosphorylation of histone H3 initiates
primarily within pericentromeric heterochromatin during G2 and spreads in an
![Page 136: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/136.jpg)
134
ordered fashion coincident with mitotic chromosome condensation. Chromosoma
106(6), 348-360.
Hennig L, Derkacheva M. (2009). Diversity of Polycomb group complexes in plants:
same rules, different players? Trends Genet 25(9), 414-423.
Hou C and Corces VG. (2010). Insulators and imprinting from flies to mammals.
BMC Biol 8, 104.
Houben A, Demidov D, Caperta AD, Karimi R, Agueci F, Vlasenko L. (2007).
Phosphorylation of histone H3 in plants--a dynamic affair. Biochim Biophys Acta
1769(5-6), 308-315.
Houben, A., Wako, T., Furushima-Shimogawara, R., Presting, G., Kunzel, G.,
Schubert, I., Fukui, K. (1999) The cell cycle dependent phosphorylation of histone H3
is correlated with the condensation of plant mitotic chromosomes. Plant J 18, 675-679.
Hsieh T-F and Fischer R. (2005). Biology of chromatin dynamics. Annu Rev Plant
Biol 56, 327-351.
Hsieh TF, Ibarra CA, Silva P, Zemach A, Eshed-Williams L, Fischer RL, Zilberman
D. (2009). Genome-wide demethylation of Arabidopsis endosperm. Science
324(5933), 1451-1454.
Hsu JM, Huang J, Meluh PB, Laurent BC. (2003). The yeast RSC chromatin-
remodeling complex is required for kinetochore function in chromosome segregation.
Mol Cell Biol 23(9), 3202-3215.
Huanca-Mamani W, Garcia-Aguilar M, León-Martínez G, Grossniklaus U, Vielle-
Calzada JP. (2005). CHR11, a chromatin-remodeling factor essential for nuclear
proliferation during female gametogenesis in Arabidopsis thaliana. Proc Natl Acad
Sci U S A 102(47), 17231-17236.
![Page 137: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/137.jpg)
135
Huang J, Hsu JM, Laurent BC. (2004). The RSC nucleosome-remodeling complex is
required for Cohesin's association with chromosome arms. Mol Cell 13(5), 739-50.
Erratum in: Mol Cell 15(2), 315.
Hurtado L, Farrona S, Reyes JC. (2006). The putative SWI/SNF complex subunit
BRAHMA activates flower homeotic genes in Arabidopsis thaliana. Plant Mol Biol
62(1-2), 291-304.
Ito T, Bulger M, Pazin MJ, Kobayashi R, Kadonaga JT. (1997). ACF, an ISWI-
containing and ATP-utilizing chromatin assembly and remodeling factor. Cell 90(1),
145-155.
Izzo A, Kamieniarz K, and Schneider R. (2008). The histone H1 family: specific
members, specific functions? Biol Chem 389(4), 333-343.
Jeddeloh JA, Stokes TL, Richards EJ. (1999). Maintenance of genomic methylation
requires a SWI2/SNF2-like protein. Nat Genet 22(1), 94-97.
Jedrusik MA, Schulze E. (2001). A single histone H1 isoform (H1.1) is essential for
chromatin silencing and germline development in Caenorhabditis elegans.
Development 128(7), 1069-1080.
Jónsson ZO, Jha S, Wohlschlegel JA, Dutta A. (2004). Rvb1p/Rvb2p recruit Arp5p
and assemble a functional Ino80 chromatin remodeling complex. Mol Cell 16(3), 465-
477.
Jullien PE, Katz A, Oliva M, Ohad N, Berger F. (2006a). Polycomb group complexes
self-regulate imprinting of the Polycomb group gene MEDEA in Arabidopsis. Curr
Biol 16, 486-492.
Kakutani T, Jeddeloh JA, Flowers SK, Munakata K, Richards EJ. (2001).
Developmental abnormalities and epimutations associated with DNA
hypomethylation mutations. Proc Natl Acad Sci U S A 93(22), 12406-12411. Erratum
in: Proc Natl Acad Sci U S A 98(13), 7647.
![Page 138: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/138.jpg)
136
Köhler C, Hennig L, Spillane C, Pien S, Gruissem W, Grossniklaus U. (2003). The
Polycomb-group protein MEDEA regulates seed development by controlling
expression of the MADS-box gene PHERES1. Genes Dev. 17, 1540-1553.
Lee W, Tillo D, Bray N, Morse RH, Davis, RW, Hughes TR, Nislow C. (2007). A
high-resolution atlas of nucleosome occupancy in yeast. Nature Genetics 39, 1235 –
1244.
Lewis, PH. (1947). D. melanogaster new mutants: Report of Pamela H. Lewis.
Drosophila Inform Ser 21, 69.
Li J, Gorospe M, Hutter D, Barnes J, Keyse SM, Liu Y. (2001). Transcriptional
induction of MKP-1 in response to stress is associated with histone H3
phosphorylation-acetylation. Mol Cell Biol 21(23), 8213-8224.
Li T, Hu JF, Qiu X, Ling J, Chen H, Wang S, Hou A, Vu TH, Hoffman AR. (2008).
CTCF regulates allelic expression of Igf2 by orchestrating a promoter-polycomb
repressive complex 2 intrachromosomal loop. Mol Cell Biol 28(20), 6473-6482.
Lindroth AM, Cao X, Jackson JP, Zilberman D, McCallum CM, Henikoff S, Jacobsen
SE. (2001). Requirement of CHROMOMETHYLASE3 for maintenance of CpXpG
methylation. Science 292(5524), 2077-2080.
Lindstrom KC, Vary JC Jr, Parthun MR, Delrow J, Tsukiyama T. (2006). Isw1
functions in parallel with the NuA4 and Swr1 complexes in stress-induced gene
repression. Mol Cell Biol 26(16), 6117-6129.
Lu X, Wontakal SN, Emelyanov AV, Morcillo P, Konev AY, Fyodorov DV,
Skoultchi AI (2009). Linker histone H1 is essential for Drosophila development, the
establishment of pericentric heterochromatin, and a normal polytene chromosome
structure. Genes Dev 23, 452–465.
![Page 139: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/139.jpg)
137
Lusser A, Urwin DL, Kadonaga JT. (2005). Distinct activities of CHD1 and ACF in
ATP-dependent chromatin assembly. Nat Struct Mol Biol 12(2), 160-166.
MacDonald WA, Menon D, Bartlett NJ, Sperry GE, Rasheva V, Meller V, Lloyd VK.
(2010). The Drosophila homolog of the mammalian imprint regulator, CTCF,
maintains the maternal genomic imprint in Drosophila melanogaster. BMC Biol 8,
105.
Makarevich G, Villar CB, Erilova A, Köhler C. (2008). Mechanism of PHERES1
imprinting in Arabidopsis. J Cell Sci 121, 906-912.
Martienssen RA, Colot V. (2001). DNA methylation and epigenetic inheritance in
plants and filamentous fungi. Science 293(5532), 1070-1074.
Matzke M, Kanno T, Daxinger L, Huettel B, Matzke AJ. (2009). RNA-mediated
chromatin-based silencing in plants. Curr Opin Cell Biol 21(3), 367-376.
Mavrich TN, Ioshikhes IP, Venters BJ, Jiang C, Tomsho LP, Qi J, Schuster SC,
Albert I, Pugh BF. (2008a) A barrier nucleosome model for statistical positioning of
nucleosomes throughout the yeast genome. Genome Res 18(7), 1073-1083.
Mavrich TN, Jiang C, Ioshikhes IP, Li X, Venters BJ et al., (2008b). Nucleosome
organization in the Drosophila genome. Nature 453, 358-362.
Morey L, Helin K. (2010). Polycomb group protein-mediated repression of
transcription. Trends Biochem Sci 35(6), 323-32.
Morillon A, Karabetsou N, O’Sullivan J, Kent N, Proudfoot N, and Mellor J. (2003).
Isw1 chromatin remodeling ATPase coordinates transcription elongation and
termination by RNA polymerase II. Cell 115(4), 425–435.
Murfett J, Wang XJ, Hagen G, Guilfoyle TJ. (2001). Identification of Arabidopsis
histone deacetylase HDA6 mutants that affect transgene expression. Plant Cell 13(5),
1047-1061.
![Page 140: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/140.jpg)
138
Noh YS, Amasino RM. (2003). PIE1, an ISWI family gene, is required for FLC
activation and floral repression in Arabidopsis. Plant Cell 15(7), 1671–1682.
Nowak SJ, Corces VG. (2000). Phosphorylation of histone H3 correlates with
transcriptionally active loci. Genes Dev 14(23), 3003-3013.
Ogas J, Cheng JC, Sung ZR, Somerville C. (1997). Cellular differentiation regulated
by gibberellin in the Arabidopsis thaliana pickle mutant. Science 277, 91–94.
Okada Y, Yamagata K, Hong K, Wakayama T, Zhang Y. (2010). A role for the
elongator complex in zygotic paternal genome demethylation. Nature 463(7280), 554-
558.
Oki M, Aihara H and Ito T. (2007). Role of histone phosphorylation in chromatin
dynamics and its implications in diseases. In Chromatin and Disease, 319-336.
Ortega-Galisteo AP, Morales-Ruiz T, Ariza RR, Roldán-Arjona T. (2008).
Arabidopsis DEMETER-LIKE proteins DML2 and DML3 are required for
appropriate distribution of DNA methylation marks. Plant Mol Biol (6), 671-681.
Papamichos-Chronakis M, Peterson CL. (2008). The Ino80 chromatin-remodeling
enzyme regulates replisome function and stability. Nat Struct Mol Biol 15(4), 338-345.
Ramakrishnan V, Finch JT, Graziano V, Lee PL, and Sweet RM. (1993). Crystal
structure of globular domain of histone H5 and its implications for nucleosome
binding. Nature 362(6417), 219-223.
Ramón A, Muro-Pastor MI, Scazzocchio C, Gonzalez R. (2000). Deletion of the
unique gene encoding a typical histone H1 has no apparent phenotype in Aspergillus
nidulans. Mol Microbiol 35(1), 223-233.
Ren, B., F. Robert, J. J. Wyrick, O. Aparicio, E. G., Jennings, I. Simon, J. Zeitlinger, J.
Schreiber, N. Hannett, E. Kanin, T. L. Volkert, C. J. Wilson, S. P. Bell, and R. A.
![Page 141: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/141.jpg)
139
Young. (2000). Genome-wide location and function of DNA-binding proteins.
Science 290, 2306-2309.
Rider S, Henderson JT, Jerome RE, Edenberg HJ, Romero-Severson J, et al. (2003).
Coordinate repression of regulators of embryonic identity by PICKLE during
germination in Arabidopsis. Plant J 35, 33–43.
Ronemus MJ, Galbiati M, Ticknor C, Chen J, Dellaporta SL. (1996). Demethylation-
induced developmental pleiotropy in Arabidopsis. Science 273(5275), 654-657.
Roth SY, Denu JM, Allis CD. (2001). Histone acetyltransferases. Annu Rev Biochem
70, 81-120.
Sanchez-Pulido, L, Devos, D, Sung, ZR, Calonje, M. (2008). RAWUL: A new
ubiquitin-like domain in PRC1 Ring finger proteins that unveils putative plant and
worm PRC1 orthologs. BMC Genomics 9, 308.
Sasaki, H. and Matsui, Y. (2008). Epigenetic events in mammalian germ-cell
development: reprogramming and beyond. Nat Rev Genet 9, 129-140
Scheuermann JC, de Ayala Alonso AG, Oktaba K, Ly-Hartig N, McGinty RK,
Fraterman S, Wilm M, Muir TW, Müller J. (2010). Histone H2A deubiquitinase
activity of the Polycomb repressive complex PR-DUB. Nature 465(7295), 243-247.
Schubert D, Primavesi L, Bishopp A, Roberts G, Doonan J, Jenuwein T, Goodrich J.
(2006). Silencing by plant Polycomb-group genes requires dispersed trimethylation of
histone H3 at lysine 27. EMBO J 25, 4638-4649.
Schones DE, Cui K, Cuddapah S, Roh TY, Barski A, Wang Z, Wei G, Zhao K. (2008).
Dynamic regulation of nucleosome positioning in the human genome. Cell 132(5),
887-898.
Schwartz YB, Pirrotta V. (2007). Polycomb silencing mechanisms and the
management of genomic programmes. Nat Rev Genet 8(1), 9-22.
![Page 142: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/142.jpg)
140
Segal E, Fondufe-Mittendorf Y, Chen L, Thåström A, Field Y, Moore IK, Wang JP,
Widom J. (2006). A genomic code for nucleosome positioning. Nature
442(7104),772-778.
Shaked H, Avivi-Ragolsky N, Levy AA. (2006). Involvement of the Arabidopsis
SWI2/SNF2 chromatin remodeling gene family in DNA damage response and
recombination. Genetics. 173(2), 985-994.
Shen X, Xiao H, Ranallo R, Wu WH, Wu C. (2003). Modulation of ATP-dependent
chromatin-remodeling complexes by inositol polyphosphates. Science 299(5603),
112-114.
Shen X, Yu L, Weir JW, Gorovsky MA. (1995). Linker histones are not essential and
affect chromatin condensation in vivo. Cell 82(1), 47-56.
Sieburth LE, Meyerowitz EM. (1997). Molecular dissection of the AGAMOUS
control region shows that cis elements for spatial regulation are located intragenically.
Plant Cell 9(3), 355-365.
Simic R, Lindstrom DL, Tran HG, Roinick KL, Costa PJ, Johnson AD, Hartzog GA,
Arndt KM. (2003). Chromatin remodeling protein Chd1 interacts with transcription
elongation factors and localizes to transcribed genes. EMBO J 22(8), 1846-1856.
Sing A, Pannell D, Karaiskakis A, Sturgeon K, Djabali M, Ellis J, Lipshitz HD,
Cordes SP. (2009). A vertebrate Polycomb response element governs segmentation of
the posterior hindbrain. Cell 138(5), 885-897.
Soppe WJ, Jasencakova Z, Houben A, Kakutani T, Meister A, Huang MS, Jacobsen
SE, Schubert I, Fransz PF. (2002). DNA methylation controls histone H3 lysine 9
methylation and heterochromatin assembly in Arabidopsis. EMBO J 21(23), 6549-
6559.
![Page 143: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/143.jpg)
141
Tai HH, Geisterfer M, Bell JC, Moniwa M, Davie JR, Boucher L, McBurney MW.
(2003). CHD1 associates with NCoR and histone deacetylase as well as with RNA
splicing proteins. Biochem Biophys Res Commun 308(1), 170-176.
Talbert P and Henikoff S. (2010). Histone variants – ancient wrap artists of the
epigenome. Mol Cell Bio 11, 264-275.
Tang X, Hou A, Babu M, Nguyen V, Hurtado L, Lu Q, Reyes JC, Wang A, Keller
WA, Harada JJ, Tsang EW, Cui Y. (2008). The Arabidopsis BRAHMA chromatin-
remodeling ATPase is involved in repression of seed maturation genes in leaves.
Plant Physiol 147(3), 1143-1157.
Varga-Weisz PD, Wilm M, Bonte E, Dumas K, Mann M, Becker PB. (1997).
Chromatin-remodelling factor CHRAC contains the ATPases ISWI and
topoisomerase II. Nature 388(6642), 598-602.
Vincent JA, Kwong TJ, Tsukiyama T. (2008). ATP-dependent chromatin remodeling
shapes the DNA replication landscape. Nat Struct Mol Biol 15(5), 477-484.
Vongs A, Kakutani T, Martienssen RA, Richards EJ. (1993). Arabidopsis thaliana
DNA methylation mutants. Science 260(5116), 1926-1928.
Wagner D, Meyerowitz EM. (2002). SPLAYED, a novel SWI/SNF ATPase homolog,
controls reproductive development in Arabidopsis. Curr Biol 12(2), 85-94.
Wassenegger M, Heimes S, Riedel L, Sänger HL. (1994). RNA-directed de novo
methylation of genomic sequences in plants. Cell 76(3), 567-76.
Xella B, Goding C, Agricola E, Di Mauro E, Caserta M. (2006). The ISWI and CHD1
chromatin remodelling activities influence ADH2 expression and chromatin
organization. Mol Microbiol 59(5), 1531-41.
Xiao W, Gehring M, Choi Y, Margossian L, Pu H, Harada JJ, Goldberg RB, Pennell
RI, Fischer RL. (2003). Imprinting of the MEA Polycomb gene is controlled by
![Page 144: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/144.jpg)
142
antagonism between MET1 methyltransferase and DME glycosylase. Dev Cel. 5, 891-
901.
Xu, L, Shen, W-H. (2008). Polycomb silencing of KNOX genes confines shoot
meristem cell niches in Arabidopsis. Current Biology 18, 1966 – 1971.
Zhou, Y., Santoro, R., and Grummt, I. (2002). The chromatin remodeling complex
NoRC targets HDAC1 to the ribosomal gene promoter and represses RNA
polymerase I transcription. EMBO J 21(17), 4632–4640.
Zhu J, Kapoor A, Sridhar VV, Agius F, Zhu JK. (2007). The DNA glycosylase/lyase
ROS1 functions in pruning DNA methylation patterns in Arabidopsis. Curr Biol 17(1),
54-59.
Zhu JK. (2009). Active DNA demethylation mediated by DNA glycosylases. Annu
Rev Genet 43, 143-166.
![Page 145: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/145.jpg)
143
Curriculum Vitae
Corina Belle R. Villar
Personal Information
Address Sumatrastrasse 39, 8006 Zürich, Switzerland
Email [email protected]; [email protected]
Date of birth June 1, 1980
Nationality Filipino
Education
2006 – present Doctoral student, ETH Zurich, Zurich, Switzerland
2004 – 2006 Master of Science in Horticulture, Universität Hannover,
Hannover, Germany
1997 – 2001 Bachelor of Science in Molecular Biology and Biotechnology,
University of the Philippines Diliman, Quezon City,
Philippines
Research Experience
2006 – present Doctoral student in the group of Prof. Dr. Claudia Köhler,
Department of Biology, ETH Zurich, Switzerland
2004 – 2006 Masters student in the group of Prof. Dr. Günther Scherer,
Faculty of Natural Sciences, Universität Hannover, Hannover,
Germany
2002 – 2004 Research technician in the group of Dr. Leobert dela Peña, Fish
Health Section, Southeast Asian Fisheries Development Center
– Aquaculture Department, Tigbauan, Iloilo, Philippines
2000 – 2001 Bachelor’s student in the group of Prof. Dr. Cynthia Hedreyda,
BIOTECH Diliman, University of the Philippines Diliman,
Quezon City, Philippines
![Page 146: Rights / License: Research Collection In Copyright - Non ...2858/eth... · Chapter 4. CHD3 Proteins and Polycomb Group Proteins Antagonistically Determine Cell Identity in Arabidopsis.....51](https://reader035.vdocuments.net/reader035/viewer/2022062917/5ed8e62e6714ca7f4768c722/html5/thumbnails/146.jpg)
144
Publications
Villar CB, Köhler C. (2010). Plant chromatin immunoprecipitation. Methods Mol Biol
655, 401-411.
Villar CB, Erilova A, Makarevich G, Trösch R, Köhler C. (2009). Control of
PHERES1 imprinting in Arabidopsis by direct tandem repeats. Mol Plant 2(4), 654-
660.
Aichinger E, Villar CB, Farrona S, Reyes JC, Hennig L, Köhler C. (2009). CHD3
proteins and polycomb group proteins antagonistically determine cell identity in
Arabidopsis. PLoS Genet 5(8), e1000605.
Köhler C, Villar CB. (2008). Programming of gene expression by Polycomb group
proteins. Trends Cell Biol 18(5), 236-243.
Makarevich G, Villar CB, Erilova A, Köhler C. (2008). Mechanism of PHERES1
imprinting in Arabidopsis. J Cell Sci 121, 906-912.
de la Peña LD, Lavilla-Pitogo CR, Villar CB, Paner MG, Sombito CD, Capulos GC.
(2007). Prevalence of white spot syndrome virus (WSSV) in wild shrimp Penaeus
monodon in the Philippines. Dis Aquat Organ 77(3), 175-179.