rna-based plant protection - scabusa.orgrna-based plant protection karl-heinz kogel phytopathologie,...
TRANSCRIPT
![Page 1: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/1.jpg)
Host-Induced Gene Silencing to Engineer Resistance to FHB
RNA-Based Plant Protection
Karl-Heinz Kogel
Phytopathologie, Gießen
![Page 2: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/2.jpg)
RNA-Based Plant Protection
Is there an agronomicpotential for application ?
![Page 3: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/3.jpg)
The Plant Pathogen Fusarium graminearum
Jansen et al. 2005 PNAS 102Necrotrophic growth
Toxin syndrome
Head blight disease
Macroconidia
![Page 4: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/4.jpg)
Zearalenon LD50
7 mg kg-1 (body weight, mouse oral)
Copper treatments LD50
500 - 2000 mg kg-1 (mouse oral)660 mg kg-1 (birds)0.052 mg l-1 (fish)
Modern pesticide LD50
>5000 mg kg-1 (mouse oral)
Toxicity
Fusarium Head Blight
Fusarium species threaten
harvest and food safety
![Page 5: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/5.jpg)
DNA mRNA Protein
Different mechanisms of RNA interference (gene silencing)
Small inhibitory RNAs
transcriptional gene silencing(TGS)
post-transcriptional gene silencing(PTGS)
RNA-based crop protection exploits
RNA interference
![Page 6: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/6.jpg)
Post-transcriptional gene silencingAndrew Z. Fire and Craig C. Mello (Noble Prize 2006)
Key enzymes:
DICERRNase III –type endonuclase
4 DICER-like proteins in Arabidopsis
ArgonauteRNase III –type endonuclase10 Argonauts in Arabidopsis
Image from Jagtap et al. 2011
![Page 7: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/7.jpg)
N
Host-Induced Gene Silencing
transgenic plant
*Lethal target genesiRNA: DICER-released small interfering RNA; ds: double stranded RNA; N: nucleus
HIGSconstruct
= Target gene-specific DNAunder control ofinverted promoters givesrise to inhibitory RNA
N
Target mRNA*
siRNA*
dsRNA*
pathogen/pest
?
oversimplified model
Transfer ofinhibitory RNA
![Page 8: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/8.jpg)
Proof-of-Concept
dsRNA-GFP plants inoculated with §GFP-tagged Fusarium graminearum
dsGFP-RNAplants
§GFP = Green Fluorescence Protein
excitation395 nm
visible light
![Page 9: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/9.jpg)
Host-Induced Gene Silencing
Selection of the right target gene is a critical success factor
of HIGS applications
![Page 10: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/10.jpg)
The target is a critical success factor for HIGS applications
Cytochrome P450 sterol 14α-demethylase (CYP51)
De Souza et al. 2009
cyp51A (294 bp) cyp51B (232 bp)
cyp51C (250 bp) cyp51ABC (791 bp)
Azole fungicides = sterol demethylation Inhibitors (DMI)
Ergosterol biosynthesis
Gene fragments were amplified from genomic DNA with specific primers and cloned into pGEM-T easy vector
Fusarium graminearum has three CYP51 genes
![Page 11: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/11.jpg)
*Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT RNAi TOPO Transcription Kit (Invitrogen)
pGEM-T Easy cyp51 part B, A, C
AatII NcoI SpeI SacI
Clone sequences of CYP51A (294nt)
CGGTCCATTGACAATCCCCGTCTTTGGTAGCGATGTCGTATACGATTGTCCCAACTCGAAGCTCATGGAACAAAAGAAGTTTGTCAAGTTTGGCCTTACGCAAAA
AGCACTCGAGTCACACGTCCAGTTAATCGAGCGAGAGGTTCTTGACTACGTCGAAACTGATCCATCCTTTTCTGGCAGAACTAGCACCATCGATGTCCCCAAGGC
AATGGCTGAGATAACAATCTTTACTGCCTCACGTTCTTTGCAGGGTGAGGAAGTTCGGAGAAAACTCACTGCCGAGTTTGCTGC
Clone sequences of CYP51B (220nt)
CAGCAAGTTTGACGAGTCCCTGGCCGCTCTCTACCACGACCTCGATATGGGCTTCACCCCCATCAACTTCATGCTTCACTGGGCCCCTCTCCCCTGGAACCGTA
AGCGCGACCACGCCCAGCGCACTGTTGCCAAGATCTACATGGACACTATCAAGGAGCGCCGCGCCAAGGGCAACAACGAATCCGAGCATGACATGATGAAGCA
CCTTATGAACTCT
Clone sequences of CYP51C (238nt)
ATTGGAAGCACCGTACAATATGGCATCGACCCGTACGCTTTTTTCTTCGACTGCAGAGATAAATACGGCGACTGCTTTACCTTTATTCTCCTTGGCAAATCAACGA
CTGTCTTTCTTGGTCCCAAGGGCAATGACTTTATCCTCAACGGCAAACACGCCGATCTCAACGCCGAGGACGTTTATGGGAAACTTACCACGCCCGTGTTTGGTG
AGGAGGTTGTTTATGACTGCTCCAATG
The inhibitory dsRNA CYP3RNA
CYP51B CYP51A CYP51C
*CYP3RNAdsRNA: CYP3RNA buffer
![Page 12: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/12.jpg)
In planta experiment
bar p35s
p35sLB RB
cyp51B, A, C
HindIII XmaI
NosT
NosTSfi1 Sfi1
Ubi-1
Vector for plant transformation
Arabidopsis
Barley
hpt p35s
p35s
LB RB
cyp51B, A, C
HindIII XmaI
NosT
NosT
Sfi1 Sfi1
Ubi-1
![Page 13: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/13.jpg)
GenomicDNA
dsRNA dsRNA
Dicer
siRNA 21-25nt
HIGSconstruct
Host induced gene silencing
Nucleus
Cytoplasma
SilencingCYP51*
* Cytochrome P450 Sterol 14α-Demethylase
Ergosterol biosynthesis
3
plant cell
Argonaute?
fungal cellCYP3RNA processing
![Page 14: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/14.jpg)
CYP3RNA expression inhibits infectionArabidopsis
Koch et al. 2013, PNAS 110
![Page 15: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/15.jpg)
wt = cv. Golden Promise
Wildtype
transgenic lines expressing CYP3RNA
transgenic line expressing empty vector
CYP3RNA expression inhibits infectionBarley
![Page 16: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/16.jpg)
Strong inhibition of Fusarium Head Blight
Control CYP3RNA
Barley
![Page 17: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/17.jpg)
Strong silencing of fungal CYP51 expression in planta
CY51Aexpression
F usarium infectedLeaves Roots
CY51Bexpression
CY51Cexpression
Normalized with fungal ß-tubulin
Barley
![Page 18: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/18.jpg)
upperleaf part
Off-target analysis
*Simulations were run using Si-Fi software (v3.1) for predicting off-targets prediction(http://labtools.ipk-gatersleben.de).†Number of 21-mer siRNA sequences with perfect match to the query sequence.‡Number of 21-mer siRNA sequences with perfect match to the query sequence that fulfill additional criteria for efficient RNAi (See Si-Fi software).
![Page 19: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/19.jpg)
What type of inhibitory RNA is transferred ?
Fungus Plant
ILV, intraluminal vesicles, MVB, multivesicular bodies
![Page 20: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/20.jpg)
Outlook – HIGS amenable to plant breeding ?
From: Baulcombe 2013Comments on Weiberg et al. 2013
However: Botrytis cinerea targets plant defense genes by small RNAs
Botrytis Botrytis
No example has been found so far showing that a crop producessmall RNAs to target its pathogen/pest
It is too early to speculate whether breeding approacheson these plant targets could be a realistic strategy.
![Page 21: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/21.jpg)
Acknowledgments
CEREAL ROOT
Dr. Aline Koch
M.Sc. Eltayb AbdellatefDr. Jafar Imani
transgenic barley RNAi mutants
Dagmar Biedenkopf
Technical assistance
![Page 22: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/22.jpg)
Excellent effects of HIGSagainst the grain aphid Sitobion avenae*
*Collaboration with A. Vilcinskas and T. Will, Inst. f. Entomology, JLU Gießen
Eltayb Abdellatef
![Page 23: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/23.jpg)
Silencing of Salivary Sheath Protein SHP in S. avenae
Aphids feed on sap suck from
sieve tube of vascular plants.
During this process aphids
secrete gel saliva that forms a
sheath to enclose the stylet.
The stylet sheath is built up by
different proteins, though SHP
seem essential because it forms
the structural backbone of the
sheath.
Tjallingii W F J. Exp. Bot. 2006;57:739-745
![Page 24: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/24.jpg)
L26
(shp-dsRNA)
Reduced expression of shp in aphidsfed on transgenic barley
![Page 25: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/25.jpg)
Reproduction rate, growth development, and survival rate was negatively affected
![Page 26: RNA-Based Plant Protection - scabusa.orgRNA-Based Plant Protection Karl-Heinz Kogel Phytopathologie, Gießen. ... *Synthesis of dsRNA for in vitro studies was performed using BLOCK-iT](https://reader033.vdocuments.net/reader033/viewer/2022051805/5ff5fdc5d17f47334e52cdfd/html5/thumbnails/26.jpg)
Aphid generation
Silencing of shp is transmitted transgenerationally
1. 2. 3. 4. 5. 6. 7.