rna structure date: 1/9/06 day a objectives identify the role of rna compare rna with dna
TRANSCRIPT
RNA Structure
Date: 1/9/06Day AObjectivesIdentify the role of RNACompare RNA with DNA
DNA Decoding
RNA is made up of four components– 1. Phosphate– 2. Sugar (Ribose, not Deoxyribose)– 3. Nitrogen Bases (A, U, C, G-
instead of having Thymine RNA contains Uracil
– 4. Hydrogen bonds between the two nucleotides
RNA Structure
RNA is called Ribonucleic AcidRNA is the principle molecule that carries out the instructions coded in DNA RNA is considered a macromoleculeRNA has three different types:– 1. mRNA (messenger RNA- mailman)– 2. rRNA (ribosomal RNA- the factory)– 3. tRNA (transfer RNA- deliveryman)
Comparing DNA with RNA
DNADeoxyribonucleic AcidDeoxyribose SugarUses thymine (A=T, C=G)Only found in nucleusOne typeMaster copy
RNARibonucleic AcidRibose SugarUses Uracil (A=U, C=G)Can move from nucleus to cytoplasmThree types (mRNA, rRNA, tRNA)Blueprint
Forms Of RNAmRNA rRNA tRNA
Name Messenger RNA
Ribosomal RNA
Transfer RNA
Role Transcribes the DNA into RNA by
changing the T into U everything else is the
same
Are the proteins where the assembly of the amino acids
takes place
The delivery man who brings the
proper amino acids for the sequences of
RNA
Found In Cell Nucleus/ cytoplasm
Cytoplasm Cytoplasm
Nickname mailman factory Delivery man
Transcription
Transcription: Is the process by which RNA is made– In transcription part of the nucleotide
sequence of DNA molecule is copied into RNA• DNA acts as template for RNA, • A template is a pattern, or guide, from
which a copy can be made
– MAJOR COMPONENT• RNA Polymerase
RNA Polymerase
Is an enzyme the binds directly to a molecule of DNARNA Polymerase produces a strand of RNA– One nucleotide at a time– RNA turns all T U– Example: AACT – UUGA– It gives it its complementary pair
without the T’s
RNA Polymerase
Example #2
DNA strand , give the complementary strand
AATCGGCATTACGAACTACCGA
TTAGCCGTAATGCTTGATGGCT
From the Original Strand give the RNA
UUAGCCGUAAUGCUUGAUGGCU
So RNA is the some pattern as the complementary strand with T replacing U
RNA as a Message
First, single sequence in DNA may be copied again and againSecond, by making RNA, the cell is able to keep its DNA in reserve controlling access to it and carefully regulating its use an dreplication
QUIZ
Original Strand:CGCCTGACTAGGACATACGGGComplementary Strand:?RNA strand: ?AnswerComplementary Strand: GCGGACTGATCCTGTATGCCCRNA Strand: GCGGACUGAUCCUGUAUGCCC