role of a host-induced arginase of xanthomonas …...59 quorum sensing (qs) (bodman et al. 1998). 60...
TRANSCRIPT
1
1 Role of a host-induced arginase of Xanthomonas oryzae pv. oryzae in promoting virulence on
2 rice
3 Yuqiang Zhanga‡, Guichun Wub‡, Ian Palmerc, Bo Wanga, Guoliang Qiana, Zheng Qing Fuc* and
4 Fengquan Liua,b*
5 aDepartment of Plant Pathology, College of Plant Protection, Nanjing Agricultural University,
6 Nanjing 210095, China/Key Laboratory of Integrated Management of Crop Diseases and Pests
7 (Nanjing Agricultural University), Ministry of Education, China
8 bInstitute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Jiangsu Key Laboratory
9 for Food Quality and Safety-State Key Laboratory Cultivation Base of Ministry of Science and
10 Technology, Nanjing 210014, People´s Republic of China
11 cDepartment of Biological Sciences, University of South Carolina, Columbia, SC 29208, USA
12
13 Fengquan Liu*：[email protected] (* corresponding author; submitting author)
14 Postal address: No.1 Weigang, Nanjing Agricultural University, Nanjing City, Jiangsu Province,
15 210095; Tel: +86-25-84390873
16 Zheng Qing Fu*：[email protected] (*corresponding author)
17 Postal address: Department of Biological Sciences, University of South Carolina, Columbia, SC
18 29208, USA; Tel: +01-803-777-8753
19 † The first two authors contribute equally to this research.
20
21
Page 1 of 44
2
22 ABSTRACT
23 The plant bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight of rice,
24 which is one of the most destructive diseases prevalent in Asia and parts of Africa. Despite many
25 years of research, how Xoo causes bacterial blight of rice is still not completely understood. Here,
26 we show that the loss of the rocF gene caused significant decrease in the virulence of Xoo in the
27 susceptible rice cultivar IR24. Bioinformatics analysis demonstrated that the rocF gene encodes an
28 arginase. Quantitative real-time PCR (qRT-PCR) and Western blot assays revealed that expression
29 of the rocF gene was significantly induced by rice and arginine. The rocF gene deletion mutant
30 strain showed elevated sensitivity to hydrogen peroxide (H2O2), reduced production of
31 extracellular polysaccharide (EPS) and reduced biofilm formation, all of which are important
32 determinants for the full virulence of Xoo, compared to those of the wild-type strain. Taken
33 together, the results of this study revealed a mechanism by which a bacterial arginase is required
34 for the full virulence of Xoo on rice because of its contribution to tolerance to reactive oxygen
35 species, production of EPS, and biofilm formation.
36 Key words: Xanthomonas oryzae pv. oryzae, arginase, virulence, biofilm
37
38 INTRODUCTION
39 The plant bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight of
40 rice, which was first characterized in Japan in 1884 and has been one of the most destructive
41 diseases prevalent in Asia and parts of Africa, Australia and Latin (Sere et al. 2005, Nino-Liu et
42 al. 2006). Xoo typically infects rice leaves through wound sites or hydathodes at the leaf tip or
43 margin. After the pathogen propagates in the intercellular spaces of the epidermis, the bacteria
Page 2 of 44
3
44 colonize and spread through the plant xylem vessels where they can interact with the xylem
45 parenchyma cells, ultimately resulting in tissue necrosis and wilting (Gonzalez et al. 2012).
46 The Xoo -rice interaction is an important working model to explain how pathogens inhibit the
47 host plant immune responses (Hilaire et al. 2001). Previous studies indicate that Xoo can employ
48 multiple virulence factors to promote its pathogenicity on rice, such as extracellular polysaccharide
49 (EPS), biofilm, effectors secreted by the type III secretion system, cell motility, adhesion
50 molecules, stress tolerance and the quorum sensing (QS) system (Buttner et al. 2010, Yu et al.
51 2016). EPS can enhance the attachment to different environmental surfaces, protect themselves
52 from desiccation and promote the colonization of bacterial pathogens in host by reducing the host
53 responses (Sutherland 1988). Meanwhile, EPS is involved in the formation of biofilm (Vu et al.
54 2009). Biofilm is an important virulence factor for bacterial pathogens to protect themselves from
55 environment stresses, such as superoxide radical, hydrogen peroxides and high or low pH values
56 (Marquis 1995). The production of EPS and the formation of biofilm are critical for the tolerance
57 to hydrogen peroxide (H2O2) which is an anti-microbial agent to kill Xoo (Bae et al. 2018). In
58 addition, the production of EPS and the formation of biofilms in bacteria can be regulated by
59 quorum sensing (QS) (Bodman et al. 1998).
60 Studies showed that arginine can augment the biofilm formation and polysaccharide intercellular
61 adhesin to promote the pathogenic ability of Staphylococcus aureus (Zhu et al. 2007). In addition,
62 arginine is important for the growth and biofilm development of
63 Streptococcus gordonii which is an oral bacteria (Jakubovics et al. 2015). The arginase pathway
64 is one arm of arginine catabolism in bacterial pathogens which is encoded by the rocABC and
65 rocDEF operons and the rocG gene (Calogero et al. 1994, Gardan et al. 1995). The rocF gene that
66 encodes an arginase is responsible for the first step of the arginase pathway which hydrolyzes
Page 3 of 44
4
67 arginine to ornithine and urea (Lu 2006). The arginase has been shown to be crucial for its
68 pathogenicity of Helicobacter pylori in the human stomach through dysregulating the host immune
69 response, such as inhibiting nitric-oxide (NO) production of macrophages by directly competing
70 with host nitric-oxide synthase, protecting pathogen from damage of reactive oxygen species
71 (ROS), inhibiting human T cell proliferation and reducing the expression of the TCR-zeta chain
72 (CD3 zeta) (Gobert et al. 2001, Zabaleta et al. 2004, Shi et al. 2014, George et al. 2017). In addition,
73 arginase is essential for the survival of Leishmania donovani in humans to cause disease (Boitz et
74 al. 2017). This pathway also is employed by some pathogens to consume arginine as a carbon and
75 nitrogen source during their infection of the host, which has been shown in Mycobacterium
76 tuberculosis, Trypanosoma cruzi and Candida albicans (Xiong et al. 2016).
77 Interestingly, our preliminary study of proteomics showed that the expression of RocF in Xoo
78 was induced by host rice and was identified as an arginase. But the reason why it was induced is
79 still unknown. Pathogenic bacteria can activate the transcription of host-induced genes to disrupt
80 host immune response and adapt to highly heterogenous environment in host tissues (Bumann et
81 al. 2007). Recent work has indicated that the expression of genes acrA and dinF in Ralstonia
82 solanacearum can be induced by toxic compounds and are required for the colonization and
83 bacterial wilt virulence in tomato (Brown et al. 2007). Meanwhile, Kachroo found that there’s one
84 rice-induced protein in Magnaporthe grisea by using two-dimensional polyacrylamide gel
85 electrophoresis which plays an important role in the process of infection (Kachroo et al. 2010). In
86 addition, studies demonstrated that sRNA genes are related to the adaptation to environmental
87 stress conditions and pathogenicity of bacterial pathogens. For example, the expression of sRNA,
88 IsrJ which controls the virulence of Salmonella typhimurium by regulating the translocation
89 efficiency of virulence-associated effectors into host cells, was induced by low oxygen or
Page 4 of 44
5
90 magnesium within macrophages (Padalon-Brauch et al. 2008). Therefore, the host-induced genes,
91 protein and sRNA are required for the virulence of pathogens. Whether the rice-induced arginase
92 in Xoo also is important for promoting virulence on rice is still unrevealed.
93 In this study, we found that the arginase is encoded by the rocF gene (Accession NO.
94 WP_011407409) and is required for the full virulence of Xoo on rice. Bioinformatic analysis
95 showed that the rocF gene is highly conserved among important plant-pathogenic Xanthomonas
96 species. We also obtained the evidence that expression of the rocF gene is significantly induced
97 by rice leaf extracts and arginine by using QRT-PCR and Western Blot. Subsequent genetic and
98 phenotypic studies showed that the rocF gene plays an important role in the multiple virulence-
99 related functions of Xoo, including extracellular polysaccharide (EPS) production, biofilm
100 formation and the tolerance to hydrogen peroxide (H2O2). To the best of our knowledge, this is the
101 first report of a bacterial arginase that is a functional virulence factor in a plant pathogen and these
102 findings will be useful in elucidating the course of events in the plant-pathogen interactions.
103
104 MATERIALS AND METHODS
105 Strains, plasmids and growth conditions. The bacterial strains and plasmids used in this study
106 are listed in Table 1. Escherichia coli was grown in Luria-Bertani (LB) medium at 37 °C and the
107 Xoo wild-type strain PXO99A and derived mutant strains were cultured in nutrient broth (NB)
108 medium at 28 °C (Qian et al. 2013). The minimal medium XVM1 (20 mM NaCl, 0.5 mM
109 phosphate, 10 mM sucrose, 2 mg/L methionine) containing macerated rice, wheat or tobacco
110 leaves: 20 g of four- to five-week-old leaves of rice, wheat or tobacco were macerated in the liquid
111 nitrogen which were used as leaf extract, then were added to 400 mL XVM1 medium and
112 autoclaved to analyze the expression of the rocF gene (Tsuge et al. 2002, Gonzalez et al. 2013).
Page 5 of 44
6
113 Antibiotics of kanamycin (50 µg/mL), spectinomycin (25 µg/mL), and gentamicin (25 µg/mL)
114 were added to growth medium as appropriate for selection. Plasmids were transformed into E. coli
115 by heat shock and into the Xoo wild-type strain PXO99A by electroporation.
116 Bioinformatic analysis of the RocF protein. The domain organization of the RocF protein was
117 analyzed by using the online software at the SMART website (http://smart.embl-heidelberg.de/).
118 BLASTP was used to search for homologs of the RocF protein in Xanthomonas species that were
119 obtained from the National Center for Biotechnology Information (NCBI). DNAMAN software
120 was used to analyze the relevant DNA sequence alignments.
121 Construction of the rocF gene deletion mutant and complementary strains. The Xoo wild-
122 type strain PXO99A was used as the parental strain to obtain the in-frame deletion mutant via the
123 method of allelic homologous recombination which has been previously described (Qian et al.
124 2013). For complementation of rocF, a 1890 bp DNA fragment containing the rocF gene and its
125 predicted promoter region was cloned into pUFR047 plasmid. The resulting constructs were
126 transformed into the ΔrocF strain by electroporation to obtain the complementary strain. The PCR
127 primers used in this study are listed in Supplemental Table S1.
128 Construction of pSS122 promoter-probe plasmid and β-glucuronidase reporter assay. To
129 determine the activity of the rocF gene promoter, the promoter of the rocF gene was predicted by
130 using the online software Promoter 2.0 Prediction Server
131 (http://www.fruitfly.org/seq_tools/promoter.html) and one 376 bp promoter was amplified by PCR
132 using the primers P-rocF-F and P-rocF-R. The amplified promoter was digested with the
133 restriction endonucleases and was then integrated into the pSS122 promoter-probe vector plasmid
134 (which was constructed from pUFR047) by T4 DNA ligase. Then the recombined plasmid was
135 transformed into the wild-type strain by electroporation and grown on NA (NB agar) plates with
Page 6 of 44
7
136 gentamicin and ampicillin. In addition, the β- glucuronidase activity assay was performed as
137 described (Pandey et al. 2010). Briefly, a single colony was cultured in NB liquid medium with
138 gentamicin and ampicillin to an optical density of 1.0 at 600 nm, and 3 µL bacterial suspensions
139 were dropped onto the XVM1 medium plates containing 38 µM/mL X-Gluc (5-bromo-4-chloro-
140 3-indolyl-β-D-glucuronic acid) and different concentrations of arginine at 28 °C for 5-7 days.
141 Meanwhile, 4 to 5-week-old leaves from the susceptible rice cultivar IR24 were inoculated with
142 the wild-type strain which contains the pSS122 plasmid with or without the rocF promoter
143 produced by using the leaf-clipping method, then the leaves of the 7th and 14th days were dipped
144 into the GUS assay buffer containing 38 µM/mL X-Gluc at 37 °C for 3 days. All the leaves were
145 subsequently dipped into ethanol for approximately 5 minutes, which was repeated three times
146 until the chlorophyll disappeared in the rice leaves. Leaves which were inoculated with ddH2O and
147 the wild-type strain as a negative control. At least 20 leaves were inoculated for each treatment
148 and every treatment was repeated three times.
149 RNA extraction and quantitative real-time PCR (qRT-PCR) analysis. The transcriptional
150 level of genes in the PXO99A strains which were cultured in NB liquid medium with or without
151 H2O2 and XVM1 liquid medium with or without rice, wheat, tobacco leaf extracts or 0.1 mM amino
152 acids were analyzed as described with some modifications (Song et al. 2017). Total RNA was
153 extracted with the Trizol reagent (Takara, Dalian, China) according to the manufacture’s protocol
154 and cDNA was synthesized from total RNA using the TransScript All-in-One First-Strand cDNA
155 Synthesis SuperMix (with One-Step gDNA Removal) Kit (TransGen Biotech, Beijing, China)
156 according to the manufacturer’s instructions. QRT-PCR was performed in Applied Biosystem’s
157 QuantStudioTM 6 and 7 Flex Real-Time PCR System (Applied Biosystem’s, Foster City, CA,
158 USA). 100 ng cDNA of each sample was used in qRT-PCR. The relative expression ratio was
Page 7 of 44
8
159 calculated by using -ΔΔCt method. The 16S rRNA was used as an endogenous control and qRT-
160 PCR was repeated three times with four independent biological replicates each time.
161 Western blot analysis of the expression of the RocF protein. To test the expression level of
162 the RocF protein under different conditions, one integrated PXO99A strain was cultured as
163 previously described (Wang et al. 2018).Briefly, we fused the Flag tag (GAT TAC AAG GAT
164 GAC GAC GAT AAG) to the 5’ terminus of the rocF gene and this fragment was amplified by
165 PCR. Then the fragment was cloned into the pUFR047 plasmid and the integrated plasmid was
166 transformed into the Xoo wild-type strain PXO99A to obtain a strain in which the region containing
167 the rocF gene was replaced by the FLAG tagged fused fragment. The integrated Xoo wild-type
168 strain PXO99A were cultured in 50 mL NB liquid medium at 28 °C, while shaking at 220 rpm to
169 an optical density of 1.0 at 600 nm and were centrifuged at 6000 rpm for 5 minutes, then the
170 supernatants were discarded and the cell pellets were suspended in 50 mL XVM1 liquid medium
171 with or without rice, wheat, tobacco leaf extracts or 0.1 mM arginine at 28 °C, while shaking at
172 220 rpm for another 16 h incubation. Bacterial cells were harvested at 10000 rpm, at 4 °C for 10
173 minutes, and 1 mL RIPA (Radio Immunoprecipitation Assay) lysis buffer with 3 µL PMSF
174 (Phenylmethanesulfonyl fluoride) and 3 µL protease inhibitor cocktail were added to extract the
175 total proteins. The samples were subsequently centrifuged at 10000 rpm, at 4 °C for 5 minutes and
176 transferred the supernatants to new 2 mL tubes containing protein loading buffer before being
177 frozen at -80 °C. 6 µg total proteins of each sample were used in Western blot. Soluble proteins
178 were separated on SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes
179 by using a semidry blot machine (Bio-Rad, USA). Membranes were blocked with 1 × PBST buffer
Page 8 of 44
9
180 with 5% nonfat milk and were probed with anti-Flag mouse antibody (1:5000) before being
181 incubated with HRP-conjugated Goat anti-mouse secondary antibody (1:10000). The α subunit of
182 RNA polymerase was used as a control for sample loading. The experiment was independently
183 repeated three times.
184 Virulence assays on rice. The susceptible rice cultivar IR24 was planted in a growth chamber
185 under a cycle of 16 h of light at 28 °C and 8 h of dark at 25 °C (Wang et al. 2018).Then the four-
186 to five- week-old leaves were inoculated with PXO99A strains in sterile distilled water at an optical
187 density of 0.5 at 600 nm by the method of leaf-clipping described previously (Kauffman, 1973).
188 Lesion lengths were measured 15 days after inoculation. For the bacterial population assay, 3 cm
189 clipped leaf sections were centered on the inoculation sites that were inoculated by PXO99A strains
190 and ground in 2 mL tube with 1 mL sterile distilled water, and at least 10 leaves were collected for
191 each sample. Bacterial populations were measured by dilution plating of 100 µL bacterial
192 suspension on NB solid medium and the number of bacterial colonies was counted. At least 50
193 leaves were inoculated by each treatment and every treatment was repeated three times.
194 Biofilm formation assays. The method used to analyze biofilm formation has been described
195 previously with some modifications (Li et al. 2012). Briefly, the PXO99A strains were cultured in
196 NB liquid medium to an optical density of 1.0 at 600 nm. 40 µL bacterial suspensions were
197 transferred to sterilized polystyrene tubes with 4 mL NB liquid medium and incubated at 28 °C,
198 while shaking at 220 rpm overnight, and all the tubes were subsequently kept in the chamber at 28
199 °C for 7 days without shaking. The bacterial suspensions were moved from the tubes and washed
200 three times with sterilized water. The biofilm formed on tubes was visualized by staining with 0.1%
201 crystal violet, after 20 minutes, excess stain was removed and the tubes were washed three times
202 with sterilized water. The stained biofilm on the tubes was dissolved in acetic acid: Ethanol (1:4,
Page 9 of 44
10
203 v:v) and was measured the absorbance value was measured at an optical density of 590 nm through
204 the use of an Agilent 8453 UV-visible spectrophotometer (Agilent Technologies, Inc., Santa Clara,
205 CA, USA). The experiment was repeated three times.
206 The confocal laser scanning microscope (CLSM) technology used to assay the formation of
207 biofilm has been described previously (Tondo et al. 2016). In brief, we transformed the pUFZ75
208 plasmid, which can express the green fluorescent protein (GFP), into the PXO99A strains. The
209 GFP-labeled PXO99A strains were cultured in NB liquid medium with 10 mM kanamycin to an
210 optical density of 1.0 at 600 nm, 40 µL suspensions were transferred into 4 mL NB liquid medium
211 and then 200 µL mixed suspensions were transferred into sterilized flow-chambers covered with
212 glass slides (cat. no. 155411, Lab-Tek, NUNC, Naperville. IL, USA). All of the flow-chambers
213 were kept in a humidified polyvinylchloride (PVC)-box at 28 °C for 2-3 days without shaking.
214 Biofilm construction was visualized by CLSM (Leica Microsystems Inc., Buffalo Grove, IL, USA)
215 with an excitation wavelength of 488 nm and an emission wavelength of 500 to 545 nm with a 20
216 × objective. The images were analyzed with LAS_X_Small_2.0.0_14332 software, which was
217 provided with the confocal microscope described above. At least three biological replicates were
218 carried out for each treatment.
219 Measurement of tolerance to oxidative stresses. The PXO99A strains were cultured in NB
220 liquid medium were grown to an optical density of 1.0 at 600 nm. Then 80 µL bacterial suspensions
221 of each strain were transferred into new sterilized glass bottles with 8 mL NB liquid medium
222 containing 0, 0.1 and 0.2 mM H2O2. Meanwhile, bacterial suspensions of the PXO99A strains at
223 an optical density of 1.0 at 600 nm were diluted 5 folds (5 ×) and 25 folds (25 ×) and 3 µL diluted
224 bacterial suspensions were dropped onto the surface of NB solid plates with 0, 0.1 and 0.2 mM
225 H2O2. All glass bottles were inoculated at 28 °C while rotating at a speed of 220 rpm and the plates
Page 10 of 44
11
226 were inoculated in a 28 °C incubator for 2-3 days. Bacterial viability was analyzed by observing
227 their growth on these plates and in these bottles. At least three biological replicates were carried
228 out for each treatment.
229 Quantitative determination of Extracellular Polysaccharide production. The PXO99A
230 strains were cultured on NB agar plates at 28 °C for 2-3 days. Then, cells were incubated in NB
231 liquid medium at 220 rpm, at 28 °C to an optical density of 1.0 at 600 nm. 500 µL bacterial
232 suspensions of the relative strains were transferred to 50 mL sterilized NB liquid medium and
233 incubated at 28 °C with constant shaking at 220 rpm for 5 days. 50 mL bacterial suspension was
234 centrifuged at 10,000 rpm for 10 minutes, the supernatant was transformed into new containers
235 and 100 mL ethanol was added to precipitate the EPS for 24 h. The precipitated EPS was then
236 dried at 70 °C and the dried EPS was weighed using a digital analytical balance. Every experiment
237 was repeated at least three times.
238 Data analysis. All analysis was conducted by using SPSS 14.0 (SPSS Inc., Chicago, IL, USA).
239 Significant differences in virulence, bacterial population, EPS production, biofilm formation and
240 gene expressions among different strains were determined via the hypothesis test of percentages
241 (t-test).
242
243 RESULTS
244 The RocF protein is highly conserved among many important plant-pathogenic
245 Xanthomonas species. To better understand the rocF gene, bioinformatics analysis was performed.
246 The open reading frame of the rocF gene (locus tag: PXO_RS22625) is 924 bp and the nucleotide
247 position in the genome is from 4951804 to 4952727 (Fig. 1A). The RocF protein contains an
248 arginase domain (from residues 6 to 300) which was predicted by using SMART
Page 11 of 44
12
249 (http://smart.embl-heidelberg.de/) and the molecular weight is 3.316 kDa as predicted by using the
250 ExPASy ProtParam tool (https://web.expasy.org/protparam/). Amino acid sequence alignment
251 analysis demonstrated that the RocF protein is highly conserved among the important plant-
252 pathogenic Xanthomonas species such as, Xanthomonas oryzae pv. oryzae KACC 10331(Accession:
253 AAW73689), Xanthomonas campestris pv. campestris str. B100 (Accession: WP_012439504),
254 Xanthomonas campestris pv. campestris str. ATCC 33913 (Accession: NP_639266), Xanthomonas
255 oryzae pv. oryzicola BLS256 (Accession: AEQ98376), Xanthomonas campestris pv. campestris str. 8004
256 (Accession: AAY51054), Xanthomonas gardneri (Accession: WP_074058724) and Xanthomonas
257 oryzae pv. oryzae PXO86 (Accession: AJQ85091) (Fig. 1B).
258 The expression of the rocF gene is induced by rice leaf extracts and arginine in vitro. To
259 determine whether the expression of the rocF gene can be induced by rice leaf extracts, we
260 performed qRT-PCR experiments to determine the transcriptional level of the rocF gene in XVM1
261 liquid medium with or without rice leaf extracts as described in the Experimental Procedures. The
262 results of the qRT-PCR showed that the transcriptional level of the rocF gene is approximately 4
263 folds higher in XVM1 medium in the presence of rice leaf extracts than in XVM1 medium, the
264 transcriptional level of the rocF gene also can be significantly induced by non-host plant leaf
265 extracts, including wheat and tobacco. The same method was used to detect the transcriptional
266 level of the rocF gene in XVM1 liquid medium with 0.1 mM arginine. The results of the qRT-
267 PCR experiment showed that the transcriptional level of the rocF gene is approximately 5 folds
268 higher in the XVM1 medium in the presence of 0.1 mM arginine than in XVM1 medium in the
269 absence of arginine (Fig. 2A). We also measured the transcriptional level of the rocF gene in the
270 XVM1 medium containing seven different amino acids at a concentration of 0.1 mM. The results
271 showed that the expression of the rocF gene was significantly induced by glutamate and ornithine
272 which were metabolites from arginine, but not histidine, methionine, proline, phenylalanine and
Page 12 of 44
13
273 leucine (Supplemental Fig. S1). All these results indicate that the expression of the rocF gene can
274 be significantly induced by rice leaf extracts and arginine.
275 Since the expression of the rocF gene can be significantly induced by rice leaf extracts and
276 arginine at transcriptional level, we then investigated whether the expression of the RocF protein
277 can be induced at the same conditions by using western blot. The integrated PXO99A strain was
278 constructed in which the 5’ terminus of the rocF gene was labeled with a FLAG tag as described
279 in the Experimental Procedures. The PXO99A strain with FLAG-tagged rocF gene was cultured
280 in 50 mL XVM1 liquid medium with or without rice leaf extracts or 0.1 mM arginine, and the total
281 proteins were extracted and analyzed as described in the Experimental Procedures. Western
282 blotting analysis showed that the presence of rice leaf extracts or arginine resulted in a significant
283 increase in the expression of the RocF protein compared with that observed in cells grown in
284 XVM1 medium, and detectable bands corresponding to the predicted size of the RocF-FLAG
285 fusion protein were observed. Meanwhile, the expression of the RocF protein also can be
286 significantly induced by wheat and tobacco leaf extracts. Under the same test conditions, the
287 expression of the α subunit of RNA polymerase was analyzed as an internal control (Fig. 2B).
288 These data indicate that the expression of the rocF gene and RocF can be induced by host and non-
289 host leaf extracts and arginine maybe the potential inducer.
290 The promoter activity of the rocF gene is induced by arginine during pathogen infection.
291 To further confirm that the promoter of the rocF gene was also functional in rice leaf, the the β-
292 glucuronidase activities of the PXO99A strains with or without the pSS122 plasmid containing the
293 promoter of the rocF gene in rice leaves were determined as described in the Experimental
294 Procedures. Few indigo-blue staining was observed in major longitudinal veins of rice leaves after
295 7 days inoculation of the PXO99A strain with the pSS122 plasmid containing the promoter of the
Page 13 of 44
14
296 rocF gene, but no staining was observed in major longitudinal veins of rice leaves which were
297 infected by the PXO99A strains with or without the pSS122 reporter plasmid. Staining intensity
298 increased during the development of rice. Intense indigo-blue staining was also observed in major
299 longitudinal veins of rice leaves after 14 days inoculation of the PXO99A strain with the pSS122
300 plasmid containing the promoter of the rocF gene, but indigo-blue staining still can’t be observed
301 in major longitudinal veins of rice leaves (Fig. 3A). These results demonstrate that the activity of
302 the rocF promoter maybe increased by components of the rice leaves during the infection of the
303 PXO99A strain.
304 The results of qRT-PCR and Western blot showed that the expression of rocF was significantly
305 induced by arginine, therefore, we speculated that the arginine in rice leaves is the component to
306 increase the activity of the rocF gene. Therefore, we determined the activity of the rocF gene on
307 XVM1 medium plates with or without 0.1 mM arginine. Indigo staining was observed of the
308 PXO99A strain with the pSS122 plasmid containing the promoter of the rocF gene, while no
309 staining was observed of the PXO99A strain with or without the pSS122 plasmid (Fig. 3B). All the
310 results suggest that the activity of the promoter of the rocF gene is significantly induced by
311 arginine during pathogen infection.
312 The rocF gene is required for the full virulence of X. oryzae pv. oryzae. To investigate the
313 potential biological functions of the rocF gene in PXO99A, a rocF gene deletion mutant strain
314 (ΔrocF) and a complementary strain [ΔrocF (rocF)] were constructed. The qRT-PCR results
315 showed that the corresponding region of the rocF gene was deleted successfully (Supplemental
316 Fig. S2). The virulence assay for PXO99A strains in the susceptible rice cultivar IR24 was
317 performed by the leaf-clipping method (Guo et al., 2015). The lesion lengths were measured 15
318 days post-inoculation (Fig. 4A) and the data were presented in (Fig. 4B). The results showed that
Page 14 of 44
15
319 the wild-type strain caused a lesion length of 26 ± 0.8 cm while the ΔrocF strain just caused a
320 lesion length of just 12.5 ± 1.0 cm in all infected leaves. These data indicate the virulence of
321 PXO99A is significantly decreased after the deletion of the rocF gene. The virulence of ΔrocF
322 strain in the leaves of susceptible rice cultivar IR24 was restored in the complementary strain
323 ΔrocF(rocF), which caused a lesion length of 23 ± 1.2 cm. Meanwhile, we assayed the
324 colonization of PXO99A on rice leaves at 0, 8 and 15 day post-inoculation. The growth of the
325 ΔrocF strain was significantly reduced on rice leaves compared with the growth of the wild-type
326 strain and the reduced bacterial population was restored to the of wild-type levels by
327 complementation (Fig. 4C). To determine whether the deletion of the rocF gene resulted in a
328 decrease in the proliferation of PXO99A, we tested their growth rates in NB liquid medium. There
329 was no difference among the wild-type, ΔrocF and ΔrocF(rocF) strains in their ability to grow in
330 NB liquid medium (Supplemental Fig. S3). The results indicate that deletion of the rocF gene does
331 not influence the viability of PXO99A. Three replicates were used for each treatment and the
332 experiment was repeated three times. Overall, these results demonstrate that a functional rocF gene
333 is required for PXO99A to achieve full virulence on rice.
334 Deletion of the rocF gene reduces extracellular polysaccharide (EPS) production by X.
335 oryzae pv. oryzae. The formation of EPS is associated with attachment to different environmental
336 surfaces and EPS represents an essential factor in the virulence of pathogenic bacteria (Neo et al.,
337 2010). This finding promoted us to determine whether the deletion of the rocF gene affects the
338 production of EPS in PXO99A. The wild-type, ΔrocF and ΔrocF(rocF) strains were grown in NB
339 liquid medium for 5 days, and EPS was extracted from the cultures and was quantified as described
340 in the Experimental Procedures. The results showed that EPS production was reduced by
341 approximately 50% in ΔrocF strain compared with the wild-type strain and there was no
Page 15 of 44
16
342 significant difference in EPS production between ΔrocF(rocF) strain and wild-type strain (Fig.
343 5A). In addition, our qRT-PCR data showed that deletion of the rocF gene caused significantly
344 decreased expression of genes related to polysaccharide biosynthesis process including
345 PXO_RS15910 (GumC) , PXO_RS14800 (alpha-L-fucosidase), PXO_RS11405 (sugar ABC
346 transporter permease), PXO_RS11410 (multiple sugar transport system substrate-binding protein),
347 PXO_RS08055 (L-arabinonolactonase), PXO_RS10635 (multiple sugar transport system ATP-
348 binding protein) and PXO_RS14820 (glycoside hydrolase family 3) (Fig. 5B). These data
349 demonstrate that the rocF gene plays an important role in EPS production of PXO99A.
350 Loss of the rocF gene affects the biofilm formation of X. oryzae pv. oryzae on abiotic
351 surfaces. EPS is involved in the formation of biofilm which is a virulence factor in many plant
352 pathogenic bacteria (Danhorn et al. 2007, Vu et al. 2009). Since deletion of the rocF gene reduced
353 the production of EPS, it is likely that the rocF gene is related to the biofilm formation in PXO99A.
354 To test this hypothesis, we determined biofilm formation in the wild-type, ΔrocF and ΔrocF(rocF)
355 strains of PXO99A on the surface of polystyrene tubes. The results showed that biofilm formation
356 on the surface of polystyrene tubes by the ΔrocF strain was significantly reduced compared to that
357 formed by the wild-type strain (Fig. 6A). The level of crystal violet staining, which indicates
358 biofilm formation, in the ΔrocF strain was reduced by approximately 40% compared with that
359 produced by the wild-type strain (Fig. 6B) and crystal violet staining of biofilm produced by the
360 complemented strain was restored to level observed for the wild-type strain. These results indicate
361 that the rocF gene contributes to the biofilm formation of PXO99A on the surface of polystyrene
362 tubes. To further validate these results, we used the confocal laser scanning microscope (CLSM)
363 technology to observe the biofilm formation of PXO99A strains as described in the Experimental
364 Procedures. The results showed that the ΔrocF strain produced a less organized biofilm than the
Page 16 of 44
17
365 wild-type strain. Meanwhile, the thickness of the biofilm produced by the ΔrocF strain is
366 approximately 20 to 30 µm, which is much thinner than the approximately 50 to 60 µm thick
367 biofilm produced by the wild-type strain (Fig. 6C). These data indicate that the deletion of the
368 rocF gene negatively influenced the biofilm formation. Therefore, the data from these two assays
369 demonstrate that the rocF gene is required for biofilm formation of PXO99A.
370 The rocF gene contributes to hydrogen peroxide stress tolerance of X. oryzae pv. oryzae.
371 During infection, plant bacterial pathogens produce EPS and biofilm to protect them against the
372 damage caused by environmental stresses such as hydrogen peroxide (H2O2) (Vu et al. 2009).
373 Therefore, to investigate the role of the rocF gene in resistance to H2O2, we carried out the
374 experiments as described in the Experimental Procedures. The results showed that the growth of
375 the ΔrocF strain was weaker on 0.1 mM and 0.2 mM H2O2 plates than the growth of the wild-type
376 strain (Fig. 7A) and the similar result was found in 8 ml NB liquid medium with 0, 0.1 and 0.2
377 mM H2O2 (Fig. 7B). In addition, the growth rate of the ΔrocF strain was significantly inhibited in
378 the presence of 0.2 mM H2O2 in NB liquid medium compared with the wild-type and ΔrocF(rocF)
379 strains (Fig. 7C). All the results indicated that the ΔrocF strain was significantly more sensitive to
380 H2O2 than the wild-type strain. In addition, the complementary strain could fully rescue their
381 tolerance to H2O2. Meanwhile, the genes including PXO_RS17325 (catalase HPII), PXO_RS22555
382 (catalase), PXO_RS05475 (ahpC), PXO_RS05465 (LysR family transcriptional regulator) and
383 PXO_RS06520 (Fur family transcriptional regulator), which are involved in H2O2 detoxification
384 and adaption, were measured. Their transcriptional levels were determined in the wild-type strain
385 and the ΔrocF strain in the presence of 0.1 mM H2O2 by qRT-PCR. The results showed that the
386 expression of these genes was significantly reduced in the ΔrocF strain compared to that in the
Page 17 of 44
18
387 wild-type strain (Fig. 7D). Taken together, these data demonstrated that the rocF gene is indeed
388 involved in the hydrogen peroxide stress tolerance of PXO99A.
389
390 DISCUSSION
391 In this study, we identified a novel Xoo virulence gene, rocF, which encodes an arginase. Mutant
392 of the rocF gene showed dramatically reduced virulence on rice. The results of this study indicate
393 that decreased EPS production, reduced Biofilm formation and enhanced sensitivity to H2O2 are
394 major reasons of the deficiency in virulence of the rocF mutant.
395 EPS is an important virulence determinant in Xanthomonas spp. during the infection of
396 pathogens. EPS can create an environment for the growth and spread of pathogens in planta and
397 protect pathogens against toxic compounds from host to enhance pathogenicity, for example, H2O2
398 (Guo et al. 2015). The detR mutant showed reduced virulence of Xoo which resulted from a
399 reduction of EPS and intolerance to ROS (MP et al. 2016). The deletion of the rocF gene in Xoo
400 also resulted in the loss of extracellular polysaccharide (EPS) production, meanwhile, the
401 transcriptional level of PXO_RS15910 (gumC) was decreased in ΔrocF compared with wild-type.
402 GumC is one of the important gum genes which is responsible for transport and polymerization
403 and is required for EPS synthesis, mutant of this gene showed reduced virulence (Kim et al. 2009).
404 Therefore, we conclude that the rocF gene plays an important role in EPS biosynthesis and
405 virulence by regulating gumC transcription. Another key factor contributing to the loss of virulence
406 of the rocF mutant is reduced biofilm formation. Xoo can adhere to the plant surface and then
407 invade the intercellular space of the host plant cells to acquire nutrition and impair plant defense
408 responses. Biofilm is potentially associated with adhesion to surfaces during the infection and
409 colonization and is important for the tolerance to environment stresses of Xoo (Boher et al. 1997,
Page 18 of 44
19
410 Crossman et al. 2004, Vu et al. 2009). Our results showed that the deletion of rocF caused less
411 formation of biofilm on the surface of polystyrene tubes. Therefore, we conclude that the rocF
412 gene is crucial for the formation of biofilm to regulate the virulence of Xoo. Xoo successfully infect
413 rice depending on the ability to counteract H2O2, its catalases are essential for the detoxification
414 process of H2O2. It has been reported that the OxyR-regulated catalase CatB functions as an
415 important factor to detoxify H2O2 in order to promote the bacterial pathogenesis of Xoo on rice
416 (Yu et al. 2016). In our study, ΔrocF was hypersensitive to H2O2 and very small bacterial
417 population survived under the condition of 0.2 mM H2O2. In addition, we measured the
418 transcriptional levels of catalases in ΔrocF because catalase is required for the detoxification of
419 H2O2 in Xanthomonas spp. during their early stages of infection. The results of qRT-PCR indicated
420 that the transcriptional levels of PXO_RS17325 (catalase HPII), PXO_RS22555 (catalase) and
421 PXO_RS05475 (ahpC) were deregulated. These findings lead us to conclude that the rocF mutant
422 caused dramatically reduced virulence of Xoo on rice, maybe due to the deregulation of detoxifying
423 enzymes, such as catalases.
424 Although EPS production, biofilm formation and tolerance to hydrogen peroxide (H2O2)
425 contribute to the virulence of Xoo on rice, more work will be needed to increase our understanding
426 of the underlying molecular mechanisms of their regulation in Xoo. Study showed that the
427 metabolic enzyme fructose-1,6-bisphosphate aldolase can combine the promoter region of katG
428 and rpoA to regulate their transcription in pathogenic Francisella (Ziveri et al. 2017). In our study,
429 we the rocF gene encodes an arginase which is an arginine metabolic enzyme and the
430 transcriptional levels of genes that are related to EPS biosynthesis or detoxification of H2O2 were
431 reduced, this leads us to conclude that the metabolic enzyme arginase maybe also can combine the
432 promoter region of these genes to regulate their transcription.
Page 19 of 44
20
433 In addition, arginine has been characterized as an important nitrogen source for plants (Slocum
434 2005). More importantly, arginine is a common substrate used by nitric oxide synthase (NOS) to
435 produce nitric oxide (NO) and NO is a diffusible molecular messenger that plays a key role in the
436 rapid induction of the plant immune response (Vidhyasekaran 2014). Therefore, whether the rocF
437 mutant caused dramatically reduced virulence of Xoo on rice is associated with the metabolic of
438 arginine then inhibit the NO production of rice needs our further studies.
439 In summary, this study demonstrated that after Xoo infects rice, the arginine in rice is used by
440 Xoo to induce the expression of the rocF gene which contributes to the EPS production, biofilm
441 formation and hydrogen peroxide (H2O2) detoxification. Notably, all of these functions are major
442 factors, that contribute to the reduced virulence of the rocF gene deletion mutant strain. This is the
443 first report of a bacterial arginase that is a functional virulence factor in a plant pathogen. This study not
444 only identified a conserved protein RocF as a virulence determinant in Xoo, but also is helpful to
445 our understanding of the pathogenic mechanisms of Xoo. In future studies, it will be interesting to
446 determine how the rocF gene contributes to the expression of important genes in EPS production
447 and H2O2 detoxification and adaption.
448
449 ACKNOWLEDGEMENTS
450 This work was supported by National Natural Science Foundation of China (31571974 and
451 31371906).
452
453 LITERATURE CITED
454 Andrade, M. O., C. S. Farah and N. Wang 2014. The post-transcriptional regulator rsmA/csrA activates 455 T3SS by stabilizing the 5' UTR of hrpG, the master regulator of hrp/hrc genes, in Xanthomonas. 456 PLoS Pathog 10(2): e1003945.457 Bae, N., H. J. Park, H. Park, M. Kim and S. W. Han 2018. Deciphering the functions of the outer membrane 458 porin OprBXo involved in virulence, motility, exopolysaccharide production, biofilm formation and 459 stress tolerance in Xanthomonas oryzae pv. oryzae. Mol Plant Pathol 19(12): 2527-2542.
Page 20 of 44
21
460 Bodman, S. B., Von, D. R. Majerczak and D. L. Coplin 1998. A negative regulator mediates quorum-sensing 461 control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc Natl Acad Sci 462 U S A 95(13): 7687-7692.463 Boher, B., M. Nicole, M. Potin and J. P. Geiger 1997. Extracellular polysaccharides from Xanthomonas 464 axonopodis pv. manihotis interact with cassava cell walls during pathogenesis. Mol Plant Microbe 465 Interact 10(7): 803-811.466 Boitz, J. M., C. A. Gilroy, T. D. Olenyik, D. Paradis, J. Perdeh, K. Dearman, M. J. Davis, P. A. Yates, Y. Li and 467 M. K. Riscoe 2017. Arginase is Essential for Survival of Leishmania donovani Promastigotes but not 468 Intracellular Amastigotes. Infection & Immunity 85(1): IAI.00554-00516.469 Brown, D. G., J. K. Swanson and C. Allen 2007. Two host-induced Ralstonia solanacearum genes, acrA and 470 dinF, encode multidrug efflux pumps and contribute to bacterial wilt virulence. Appl Environ 471 Microbiol 73(9): 2777-2786.472 Bumann, D. and R. H. Valdivia 2007. Identification of host-induced pathogen genes by differential 473 fluorescence induction reporter systems. Nat Protoc 2(4): 770-777.474 Buttner, D. and U. Bonas 2010. Regulation and secretion of Xanthomonas virulence factors. Fems 475 Microbiology Reviews 34(2): 107-133.476 Calogero, S., R. Gardan, P. Glaser, J. Schweizer, G. Rapoport and M. Debarbouille 1994. RocR, a novel 477 regulatory protein controlling arginine utilization in Bacillus subtilis, belongs to the NtrC/NifA 478 family of transcriptional activators. J Bacteriol 176(5): 1234-1241.479 Crossman, L. and J. M. Dow 2004. Biofilm formation and dispersal in Xanthomonas campestris. Microbes 480 & Infection 6(6): 623-629.481 Danhorn, T. and C. Fuqua 2007. Biofilm formation by plant-associated bacteria. Annual Review of 482 Microbiology 61(1): 401.483 Gardan, R., G. Rapoport and M. Debarbouille 1995. Expression Of the Rocdef Operon Involved In Arginine 484 Catabolism In Bacillus-Subtilis. Journal Of Molecular Biology 249(5): 843-856.485 George, G., M. Kombrabail, N. Raninga and A. K. Sau 2017. Arginase of Helicobacter Gastric Pathogens 486 Uses a Unique Set of Non-catalytic Residues for Catalysis. Biophysical Journal 112(6): 1120.487 Gobert, A. P., D. J. McGee, M. Akhtar, G. L. Mendz, J. C. Newton, Y. Cheng, H. L. Mobley and K. T. Wilson 488 2001. Helicobacter pylori arginase inhibits nitric oxide production by eukaryotic cells: a strategy 489 for bacterial survival. Proc Natl Acad Sci U S A 98(24): 13844-13849.490 Gonzalez, J. F., G. Degrassi, G. Devescovi, D. De Vleesschauwer, M. Hofte, M. P. Myers and V. Venturi 2012. 491 A proteomic study of Xanthomonas oryzae pv. oryzae in rice xylem sap. J Proteomics 75(18): 5911-492 5919.493 Gonzalez, J. F., M. P. Myers and V. Venturi 2013. The inter-kingdom solo OryR regulator of Xanthomonas 494 oryzae is important for motility. Molecular Plant Pathology 14(3): 211-221.495 Guo, W., L. F. Zou, L. L. Cai and G. Y. Chen 2015. Glucose-6-phosphate dehydrogenase is required for 496 extracellular polysaccharide production, cell motility and the full virulence of Xanthomonas 497 oryzae pv. oryzicola. Microb Pathog 78: 87-94.498 Hilaire, E., S. A. Young, L. H. Willard, J. D. McGee, T. Sweat, J. M. Chittoor, J. A. Guikema and J. E. Leach 499 2001. Vascular defense responses in rice: peroxidase accumulation in xylem parenchyma cells and 500 xylem wall thickening. Mol Plant Microbe Interact 14(12): 1411-1419.501 Jakubovics, N. S., J. C. Robinson, D. S. Samarian, E. Kolderman, S. A. Yassin, D. Bettampadi, M. Bashton and 502 A. H. Rickard 2015. Critical roles of arginine in growth and biofilm development by Streptococcus 503 gordonii. Mol Microbiol 97(2): 281-300.504 Kachroo, P., ., K. H. Lee, C. Schwerdel, ., J. E. Bailey and B. B. Chattoo 2010. Analysis of host-induced 505 response in the rice blast fungus Magnaporthe grisea using two-dimensional polyacrylamide gel 506 electrophoresis. Electrophoresis 18(1): 163-169.
Page 21 of 44
22
507 Kim, S. Y., J. G. Kim, B. M. Lee and J. Y. Cho 2009. Mutational analysis of the gum gene cluster required for 508 xanthan biosynthesis in Xanthomonas oryzae pv oryzae. Biotechnology Letters 31(2): 265-270.509 Li, J. and N. Wang 2012. The gpsX gene encoding a glycosyltransferase is important for polysaccharide 510 production and required for full virulence in Xanthomonas citri subsp. citri. BMC Microbiol 12: 31.511 Lu, C. D. 2006. Pathways and regulation of bacterial arginine metabolism and perspectives for obtaining 512 arginine overproducing strains. Appl Microbiol Biotechnol 70(3): 261-272.513 Marquis, R. E. 1995. Oxygen metabolism, oxidative stress and acid-base physiology of dental plaque 514 biofilms. J Ind Microbiol 15(3): 198-207.515 MP, N., P. J, C. MH and L. SW 2016. Role of DetR in defence is critical for virulence of Xanthomonas oryzae 516 pv. oryzae. Molecular Plant Pathology 17(4): 601-613.517 Nino-Liu, D. O., P. C. Ronald and A. J. Bogdanove 2006. Xanthomonas oryzae pathovars: model pathogens 518 of a model crop. Mol Plant Pathol 7(5): 303-324.519 Padalon-Brauch, G., R. Hershberg, M. Elgrably-Weiss, K. Baruch, I. Rosenshine, H. Margalit and S. Altuvia 520 2008. Small RNAs encoded within genetic islands of Salmonella typhimurium show host-induced 521 expression and role in virulence. Nucleic Acids Research 36(6): 1913-1927.522 Pandey, A. and R. V. Sonti 2010. Role of the FeoB Protein and Siderophore in Promoting Virulence of 523 Xanthomonas oryzae pv. oryzae on Rice. Journal of Bacteriology 192(12): 3187-3203.524 Qian, G. L., C. H. Liu, G. C. Wu, F. Q. Yin, Y. C. Zhao, Y. J. Zhou, Y. B. Zhang, Z. W. Song, J. Q. Fan, B. S. Hu 525 and F. Q. Liu 2013. AsnB, regulated by diffusible signal factor and global regulator Clp, is involved 526 in aspartate metabolism, resistance to oxidative stress and virulence in Xanthomonas oryzae pv. 527 oryzicola. Molecular Plant Pathology 14(2): 145-157.528 Sere, Y., A. Onasanya, V. Verdier, K. Akator, L. S. Ouedraogo, Z. Segda, M. M. Mbare, A. Y. Sido and A. 529 Basso 2005. Rice Bacterial Leaf Blight in West Africa: Preliminary Studies on Disease in Farmers' 530 Fields and Screening Released Varieties for Resistance to the Bacteria. Asian Journal of Plant 531 Sciences 4(6): 577-579.532 Shi, Y. Y., M. Chen, Y. X. Zhang, J. Zhang and S. G. Ding 2014. Expression of three essential antioxidants of 533 Helicobacter pylori in clinical isolates. Journal Of Zhejiang University-Science B 15(5): 500-506.534 Slocum, R. D. 2005. Genes, enzymes and regulation of arginine biosynthesis in plants. Plant Physiol 535 Biochem 43(8): 729-745.536 Song, Z., Y. Zhao, G. Qian, B. O. Odhiambo and F. Liu 2017. Novel insights into the regulatory roles of gene 537 hshB in Xanthomonas oryzae pv. oryzicola. Res Microbiol 168(2): 165-173.538 Sutherland, I. W. 1988. Bacterial surface polysaccharides: structure and function. Int Rev Cytol 113: 187-539 231.540 Tondo, M. L., M. L. Delprato, I. Kraiselburd, M. V. F. Zenoff, M. E. Farias and E. G. Orellano 2016. KatG, the 541 Bifunctional Catalase of Xanthomonas citri subsp citri, Responds to Hydrogen Peroxide and 542 Contributes to Epiphytic Survival on Citrus Leaves. Plos One 11(3).543 Tsuge, S., A. Furutani, R. Fukunaka, T. Oku, K. Tsuno, H. Ochiai, Y. Inoue, H. Kaku and Y. Kubo 2002. 544 Expression of Xanthomonas oryzae pv. oryzae hrp Genes in XOM2, a Novel Synthetic Medium. 545 Journal of General Plant Pathology 68(4): 363-371.546 Vidhyasekaran, P. 2014. Nitric Oxide Signaling System in Plant Innate Immunity. 21(1): 375-384.547 Vu, B., M. Chen, R. J. Crawford and E. P. Ivanova 2009. Bacterial extracellular polysaccharides involved in 548 biofilm formation. Molecules 14(7): 2535-2554.549 Wang, B., G. Wu, Y. Zhang, G. Qian and F. Liu 2018. Dissecting the virulence-related functionality and 550 cellular transcription mechanism of a conserved hypothetical protein in Xanthomonas oryzae pv. 551 oryzae. Molecular Plant Pathology.552 Xiong, L., J. L. L. Teng, M. G. Botelho, R. C. Lo, S. K. P. Lau and P. C. Y. Woo 2016. Arginine Metabolism in 553 Bacterial Pathogenesis and Cancer Therapy. International Journal of Molecular Sciences 17(3): 554 363.
Page 22 of 44
23
555 Yu, C., N. Wang, M. Wu, F. Tian, H. Chen, F. Yang, X. Yuan, C. H. Yang and C. He 2016. OxyR-regulated 556 catalase CatB promotes the virulence in rice via detoxifying hydrogen peroxide in Xanthomonas 557 oryzae pv. oryzae. BMC Microbiol 16(1): 269.558 Zabaleta, J., D. J. McGee, A. H. Zea, C. P. Hernandez, P. C. Rodriguez, R. A. Sierra, P. Correa and A. C. Ochoa 559 2004. Helicobacter pylori arginase inhibits T cell proliferation and reduces the expression of the 560 TCR zeta-chain (CD3zeta). J Immunol 173(1): 586-593.561 Zhu, Y., E. C. Weiss, M. Otto, P. D. Fey, M. S. Smeltzer and G. A. Somerville 2007. Staphylococcus aureus 562 biofilm metabolism and the influence of arginine on polysaccharide intercellular adhesin synthesis, 563 biofilm formation, and pathogenesis. Infect Immun 75(9): 4219-4226.564 Ziveri, J., F. Tros, I. C. Guerrera, C. Chhuon, M. Audry, M. Dupuis, M. Barel, S. Korniotis, S. Fillatreau, L. 565 Gales, E. Cahoreau and A. Charbit 2017. The metabolic enzyme fructose-1,6-bisphosphate 566 aldolase acts as a transcriptional regulator in pathogenic Francisella. Nat Commun 8(1): 853.
567
568 TABLES569570
571 Table 1. Bacterial strains and plasmids used in this study.572
Strains or plasmids Characteristicsa Source
Strains
Escherichia coli
DH5aF-, φ80dlacZ∆M15, ∆(lacZYA-argF)U169, deoR, recA1,
endA1, hsdR17(rk-,mk+), phoA, supE44, λ-, thi-1, gyrA96
This study
Xanthomonas oryzae pv. oryzae
PXO99A Philippine race 6; Wild-type strain (WT) (Qian et al. 2013)
ΔrocF rocF in-frame deletion mutant of strain PXO99A This study
ΔrocF(rocF) ΔrocF harboring plasmid pUFR047-rocF (Complementary strain); GmR, AmpR
This study
PXO99A(pUFZ75) PXO99A harboring plasmid pUFZ75 (GFP-labeled strain); KmR
This study
ΔrocF(pUFZ75) ΔrocF harboring plasmid pUFZ75 (GFP-labeled strain); KmR
This study
PXO99A(pSS122) PXO99A harboring plasmid pSS122; ApR, GmR This study
PXO99A(pSS122::rocF) PXO99A harboring plasmid pSS122 with rocF promotor; ApR, GmR
This study
Plasmids
Page 23 of 44
24
pK18mobsacB allelic exchange suicide vector, sacB oriT(RP4); KmR (Qian et al. 2013)
pK18-rocF pK18mobsacB with two PXO_03177 flanking fragments; KmR
This study
pUFR047 Broad-host-range expression vector; IncW, GmR, AmpR, Mob+, Mob(p), lacZα+, Par+
(Andrade et al. 2014)
pUFR047-rocF pUFR047 carrying gene rocF with its native promoter region; GmR, AmpR
This study
pUFR047-rocF-Flag pUFR047 carrying gene rocF with its native promoter region and Flag label; GmR, AmpR
This study
pUFZ75 Ptrp-TIR-gfp cassette in pUFR034, KmR (Guo et al. 2015)
pSS122 Promoter probe vector, IncW, GmR, ApR (Gonzalez et al. 2012)
pSS122::rocF pSS122 carrying gene rocF with its native promoter region, GmR, ApR
This study
573 a KmR, GmR AmpR = kanamycin, gentamicin, ampicillin, respectively.574
575
576
577
578 FIGURE CAPTIONS
579 Figure 1. Bioinformatics analysis of the rocF gene. (A) Schematic diagram of the rocF gene in
580 the genome of X. oryzae pv. oryzae PXO99A. The open arrows indicate location, length and
581 orientation of the ORFs. The middle element shows the domain structure analysis of the RocF
582 protein which was performed by using SMART software. The lower element shows that the rocF
583 gene was amplified by PCR primers P1 and P2 and was cloned into the pUFR047 plasmid for
584 complementation of the rocF mutant. (B) The identity of arginase homologues in important plant-
585 pathogenic Xanthomonas species. a Xoo PXO99A: X. oryzae pv. oryzae PXO99A, Xoo PXO86: X.
586 oryzae pv. oryzae PXO86, Xoo KACC10331: X. oryzae pv. oryzae KACC10331, Xoc BLS256: X.
587 oryzae pv. oryzicola BLS256, Xcc B100: X. campestris pv. campestris B100, Xcc ATCC33913:
Page 24 of 44
25
588 X. campestris pv. campestris str ATCC33913, Xcc 8004: X. campestris pv. campestris str. 8004. b
589 Domains were predicted by the Smart website http://smart.emblheidelberg.de/ . C According to a
590 BLASTP search.
591 Figure 2. The expression of the rocF gene in different media. (A) The mRNA expression levels
592 of the rocF gene in different XVM1 medium were detected by using qRT-PCR. The relative
593 transcriptional levels of these genes were calculated by qRT-PCR with respect to the
594 transcriptional levels of the corresponding transcriptional levels in the wild-type and the 16S rRNA
595 as the internal standard. (B) Analysis of the protein expression level of the RocF protein in different
596 XVM1 medium by using Western blot. The upper bands corresponding to the predicted size of
597 RocF-FLAG fusion were detected by the monoclonal antibody Anti-FLAG and the lower bands
598 corresponding to the RNA polymerase α-subunit were detected by the specific antibody Anti-
599 RNAP. XVM1: negative control, XVM1#: XVM1 medium with 0.1 mM/L arginine, XVM1##:
600 XVM1 medium with 5 g/L rice leaf extracts, XVM1###: XVM1 medium with 5 g/L wheat leaf
601 extracts, XVM1####: XVM1 medium with 5 g/L tobacco leaf extracts. Values are the means ± SDs
602 from three independent experiments. Asterisks above error bars indicate significant differences
603 compared with XVM1 medium (t-test, **P< 0.01).
604 Figure 3. GUS activity determination of the promoter of the rocF gene in rice leaves and
605 under arginine condition. (A) GUS activity determination of the PXO99A strains with or without
606 the pSS122 plasmid containing the promoter of the rocF gene infected rice leaves stained by GUS
607 assay buffer containing X-Gluc (5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid). The leaves
608 were acquired after the inoculation of 7 and 14 days. The wild-type strain without the pSS122
609 vector and ddH2O infected leaves were used as negative control. The indigo-blue staining indicates
610 increased GUS activity of the promoter of the rocF gene. DPI: days post-inoculation. (B) GUS
Page 25 of 44
26
611 activity determination of the PXO99A strains with or without the pSS122 plasmid containing the
612 promoter of the rocF gene under the XVM1 medium with or without 0.1 mM arginine and X-Gluc.
613 The indigo staining indicates increased activity of the promoter of the rocF gene. XVM1: XVM1
614 medium without 0.1 mM arginine. XVM1#: XVM1 medium with 0.1 mM arginine. The
615 experiment was repeated three times.
616 Figure 4. The results of the pathogenicity test of X. oryzae pv. oryzae on host rice. (A) Disease
617 symptoms caused by the wild-type, ΔrocF and ΔrocF(rocF) strains on four- to five-week-old
618 susceptible rice cultivar IR24 leaves. Representative pictures were taken 15 days post inoculation.
619 Sterilized water inoculated rice leaves as a negative control. (B) Lesion length caused by the wild-
620 type, ΔrocF and ΔrocF(rocF) strains (OD600 = 0.5) on four- to five-week-old susceptible rice
621 cultivar IR24 leaves by using leaf clipping method. The lesion lengths were calculated 15 days
622 post inoculation. (C) Bacterial populations of the wild-type, ΔrocF and ΔrocF(rocF) strains
623 (OD600 = 0.5) on four- to five-week-old susceptible rice cultivar IR24 leaves by using leaf clipping
624 method. The inoculated rice leaves for extracting bacteria were harvested after 0, 8 and 15 days,
625 homogenized in sterilized water and serially diluted on NB solid plates to cout the number of
626 bacterial populations (CFU). The bacterial populations were presented as the lg CFU per leaf.
627 Values are the means ± SDs from three independent experiments (n = 50). The asterisks above the
628 error bars indicate significant differences compared with the wild-type strain (t-test, **P< 0.01).
629 Figure 5. Effects of rocF gene deletion on the production of extracellular polysaccharide
630 (EPS) by X. oryzae pv. oryzae. (A) Determination of EPS production by the wild-type, ΔrocF and
631 ΔrocF(rocF) strains grown in NB liquid medium after 5 days with shaking at 220 rpm at 28 ℃.
632 The bacterial cultures were collected for the determination of EPS production. (B) Determination
Page 26 of 44
27
633 of the transcriptional levels of seven sugar transport and biosynthesis genes in the wild-type and
634 ΔrocF strains grown in NB liquid medium by using qRT-PCR. The relative transcriptional levels
635 of these genes were calculated by qRT-PCR with respect to the transcriptional levels of the
636 corresponding transcriptional levels in the wild-type and the 16S rRNA as the internal standard.
637 Values are the means ± SDs from three independent experiments. The asterisks above error bars
638 indicate significant differences compared with the wild-type strain (t-test, **P< 0.01).
639 Figure 6. Effects of rocF gene deletion on the formation of biofilm by X. oryzae pv. oryzae.
640 (A) Biofilm formation by the wild-type, ΔrocF and ΔrocF(rocF) strains on polystyrene tubes
641 stained with crystal violet. (B) Biofilm production quantification of the wild-type, ΔrocF and
642 ΔrocF(rocF) strains on polystyrene tubes corresponding to part A. The value of OD590 was
643 measured after the stained tubes were incubated with ethanol-acetone. (C) Confocal laser scanning
644 microscopy was performed for observing 3-dimension structure of biofilm formation by the wild-
645 type and ΔrocF strains. Images were obtained by using a 20 × objective. Values are the means ±
646 SDs from three independent experiments. The asterisks above the error bars indicate significant
647 differences compared with the wild-type (t-test, **P< 0.01).
648 Figure 7. The observation of the resistance to hydrogen peroxide (H2O2) of X. oryzae pv.
649 oryzae. (A) The wild-type, ΔrocF and ΔrocF(rocF) strains were pre-cultured to the exponential
650 phase of the indicated value (OD600 = 1.0) in NB liquid medium which as the initial cultures (1 X),
651 then was diluted 5 folds (5 X) and 25 folds (25 X). Three microliters of the initial cultures and
652 diluted cultures for each strain were dropped onto NB solid medium plates with 0, 0.1 and 0.2 mM
653 H2O2 to observe their growth defects. (B) Eight microliters of the initial cultures in part A were
654 transformed into eight milliliter NB liquid mediums with 0, 0.1 and 0.2 mM H2O2 to observe their
655 growth defects, pictures were taken of each sample at 0, 24 and 48 h. (C) Twenty microliters of
Page 27 of 44
28
656 the initial cultures in part A were transformed into twenty milliliter NB liquid mediums with 0.2
657 mM H2O2 to observe their growth rates, the values of each samples at OD600 every two hours. (D)
658 The mRNA expression levels of genes which are associated with the detoxification and adaption
659 to H2O2 in the wild-type and ΔrocF strains which were grown in NB liquid medium with 0.1 mM
660 H2O2 were determined by using qRT-PCR. The relative transcriptional levels of these genes were
661 calculated by qRT-PCR with respect to the transcriptional levels of the corresponding
662 transcriptional levels in the wild-type and the 16S rRNA as the internal standard. Values are the
663 means ± SDs from three independent experiments. The asterisks above error bars indicate
664 significant differences compared with the wild-type strain (t-test, **P< 0.01).
665
Page 28 of 44
Figure 1. Bioinformatics analysis of the rocF gene. (A) Schematic diagram of the rocF gene in the genome of X. oryzae pv. oryzae PXO99A. The open arrows indicate location, length and orientation of the ORFs. The middle element shows the domain structure analysis of the RocF protein which was performed by using
SMART software. The lower element shows that the rocF gene was amplified by PCR primers P1 and P2 and was cloned into the pUFR047 plasmid for complementation of the rocF mutant. (B) The identity of arginase
homologues in important plant-pathogenic Xanthomonas species. a Xoo PXO99A: X. oryzae pv. oryzae PXO99A, Xoo PXO86: X. oryzae pv. oryzae PXO86, Xoo KACC10331: X. oryzae pv. oryzae KACC10331, Xoc BLS256: X. oryzae pv. oryzicola BLS256, Xcc B100: X. campestris pv. campestris B100, Xcc ATCC33913: X.
campestris pv. campestris str ATCC33913, Xcc 8004: X. campestris pv. campestris str. 8004. b Domains were predicted by the Smart website http://smart.emblheidelberg.de/ . C According to a BLASTP search.
188x265mm (96 x 96 DPI)
Page 29 of 44
Figure 2. The expression of the rocF gene in different media. (A) The mRNA expression levels of the rocF gene in different XVM1 medium were detected by using qRT-PCR. The relative transcriptional levels of these
genes were calculated by qRT-PCR with respect to the transcriptional levels of the corresponding transcriptional levels in the wild-type and the 16S rRNA as the internal standard. (B) Analysis of the protein
expression level of the RocF protein in different XVM1 medium by using Western blot. The upper bands corresponding to the predicted size of RocF-FLAG fusion were detected by the monoclonal antibody Anti-FLAG and the lower bands corresponding to the RNA polymerase α-subunit were detected by the specific antibody Anti-RNAP. XVM1: negative control, XVM1#: XVM1 medium with 0.1 mM/L arginine, XVM1##: XVM1 medium with 5 g/L rice leaf extracts, XVM1###: XVM1 medium with 5 g/L wheat leaf extracts, XVM1####: XVM1 medium with 5 g/L tobacco leaf extracts. Values are the means ± SDs from three
independent experiments. Asterisks above error bars indicate significant differences compared with XVM1 medium (t-test, **P< 0.01).
85x122mm (300 x 300 DPI)
Page 30 of 44
Page 31 of 44
Figure 3. GUS activity determination of the promoter of the rocF gene in rice leaves and under arginine condition. (A) GUS activity determination of the PXO99A strains with or without the pSS122 plasmid
containing the promoter of the rocF gene infected rice leaves stained by GUS assay buffer containing X-Gluc (5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid). The leaves were acquired after the inoculation of 7 and 14 days. The wild-type strain without the pSS122 vector and ddH2O infected leaves were used as negative
control. The indigo-blue staining indicates increased GUS activity of the promoter of the rocF gene. DPI: days post-inoculation. (B) GUS activity determination of the PXO99A strains with or without the pSS122
plasmid containing the promoter of the rocF gene under the XVM1 medium with or without 0.1 mM arginine and X-Gluc. The indigo staining indicates increased activity of the promoter of the rocF gene. XVM1: XVM1
medium without 0.1 mM arginine. XVM1#: XVM1 medium with 0.1 mM arginine. The experiment was repeated three times.
85x121mm (300 x 300 DPI)
Page 32 of 44
Page 33 of 44
Figure 4. The results of the pathogenicity test of X. oryzae pv. oryzae on host rice. (A) Disease symptoms caused by the wild-type, ΔrocF and ΔrocF(rocF) strains on four- to five-week-old susceptible rice cultivar IR24 leaves. Representative pictures were taken 15 days post inoculation. Sterilized water inoculated rice
leaves as a negative control. (B) Lesion length caused by the wild-type, ΔrocF and ΔrocF(rocF) strains (OD600 = 0.5) on four- to five-week-old susceptible rice cultivar IR24 leaves by using leaf clipping method. The lesion length were calculated 15 days post inoculation. (C) Bacterial populations of the wild-type, ΔrocF
and ΔrocF(rocF) strains (OD600 = 0.5) on four- to five-week-old susceptible rice cultivar IR24 leaves by using leaf clipping method. The inoculated rice leaves for extracting bacteria were harvested after 0, 8 and
15 days, homogenized in sterilized water and serially diluted on NB solid plates to cout the number of bacterial populations (CFU). The bacterial populations were presented as the lg CFU per leaf. Values are the
means ± SDs from three independent experiments (n = 50). The asterisks above the error bars indicate significant differences compared with the wild-type strain (t-test, **P< 0.01).
Page 34 of 44
Figure 5. Effects of rocF gene deletion on the production of extracellular polysaccharide (EPS) by X. oryzae pv. oryzae. (A) Determination of EPS production by the wild-type, ΔrocF and ΔrocF(rocF) strains grown in
NB liquid medium after 5 days with shaking at 220 rpm at 28 ℃. The bacterial cultures were collected for the determination of EPS production. (B) Determination of the transcriptional levels of seven sugar transport
and biosynthesis genes in the wild-type and ΔrocF strains grown in NB liquid medium by using qRT-PCR. The relative transcriptional levels of these genes were calculated by qRT-PCR with respect to the transcriptional levels of the corresponding transcriptional levels in the wild-type and the 16S rRNA as the internal standard. Values are the means ± SDs from three independent experiments. The asterisks above error bars indicate
significant differences compared with the wild-type strain (t-test, **P< 0.01).
Page 35 of 44
Figure 6. Effects of rocF gene deletion on the formation of biofilm by X. oryzae pv. oryzae. (A) Biofilm formation by the wild-type, ΔrocF and ΔrocF(rocF) strains on polystyrene tubes stained with crystal violet. (B) Biofilm production quantification of the wild-type, ΔrocF and ΔrocF(rocF) strains on polystyrene tubes corresponding to part A. The value of OD590 was measured after the stained tubes were incubated with
ethanol-acetone. (C) Confocal laser scanning microscopy was performed for observing 3-dimension structure of biofilm formation by the wild-type and ΔrocF strains. Images were obtained by using a 20 × objective.
Values are the means ± SDs from three independent experiments. The asterisks above the error bars indicate significant differences compared with the wild-type (t-test, **P< 0.01).
Page 36 of 44
Figure 7. The observation of the resistance to hydrogen peroxide (H2O2) of X. oryzae pv. oryzae. (A) The wild-type, ΔrocF and ΔrocF(rocF) strains were pre-cultured to the exponential phase of the indicated value
(OD600 = 1.0) in NB liquid medium which as the initial cultures (1 X), then was diluted 5 folds (5 X) and 25 folds (25 X). Three microliters of the initial cultures and diluted cultures for each strain were dropped onto NB solid medium plates with 0, 0.1 and 0.2 mM H2O2 to observe their growth defects. (B) Eight microliters of the initial cultures in part A were transformed into eight milliliter NB liquid mediums with 0, 0.1 and 0.2
mM H2O2 to observe their growth defects, pictures were taken of each sample at 0, 24 and 48 h. (C) Twenty microliters of the initial cultures in part A were transformed into twenty milliliter NB liquid mediums
with 0.2 mM H2O2 to observe their growth rates, the values of each samples at OD600 every two hours. (D) The mRNA expression levels of genes which are associated with the detoxification and adaption to H2O2 in the wild-type and ΔrocF strains which were grown in NB liquid medium with 0.1 mM H2O2 were determined
by using qRT-PCR. The relative transcriptional levels of these genes were calculated by qRT-PCR with respect to the transcriptional levels of the corresponding transcriptional levels in the wild-type and the 16S
rRNA as the internal standard. Values are the means ± SDs from three independent experiments. The asterisks above error bars indicate significant differences compared with the wild-type strain (t-test, **P<
0.01).
Page 37 of 44
1 SUPPLEMENTARY MATERIALS
2 Role of a host-induced arginase of Xanthomonas oryzae pv. oryzae in promoting
3 virulence on rice
4 Yuqiang Zhanga‡, Guichun Wub‡, Ian Palmerc, Bo Wanga, Guoliang Qiana, Zheng Qing
5 Fuc* and Fengquan Liua,b*
6 aDepartment of Plant Pathology, College of Plant Protection, Nanjing Agricultural
7 University, Nanjing 210095, China/Key Laboratory of Integrated Management of Crop
8 Diseases and Pests (Nanjing Agricultural University), Ministry of Education, China
9 bInstitute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Jiangsu Key
10 Laboratory for Food Quality and Safety-State Key Laboratory Cultivation Base of
11 Ministry of Science and Technology, Nanjing 210014, People´s Republic of China
12 cDepartment of Biological Sciences, University of South Carolina, Columbia, SC
13 29208, USA
14 Fengquan Liu* ： [email protected] (* corresponding author; submitting
15 author)
16 Postal address: No.1 Weigang, Nanjing Agricultural University, Nanjing City, Jiangsu
17 Province, 210095; Tel: +86-25-84390873
18 Zheng Qing Fu*：[email protected] (*corresponding author)
19 Postal address: Department of Biological Sciences, University of South Carolina,
20 Columbia, SC 29208, USA; Tel: +01-803-777-8753
21 † The first two authors contribute equally to this research.
22
Page 38 of 44
23
24
25 Supplemental Fig. S1. The expression of the rocF gene in different medium. The
26 mRNA expression levels of the rocF gene in different XVM1 mediums were detected
27 by using qRT-PCR. The relative transcriptional levels of these genes were calculated
28 by qRT-PCR with respect to the transcriptional levels of the corresponding
29 transcriptional levels in the wild-type and the 16S rRNA as the internal standard. 1:
30 XVM1 medium as negative control, 2: XVM1 medium with 0.1 mM methionine, 3:
31 XVM1 medium with 0.1 mM proline, 4: XVM1 medium with 0.1 mM phenylalanine,
32 5: XVM1 medium with 0.1 mM leucine, 6: XVM1 medium with 0.1 mM histidine, 7:
33 XVM1 medium with 0.1 mM ornithine, 8: XVM1 medium with 0.1 mM glutamate.
34 The relative transcriptional levels of these genes were calculated by qRT-PCR with
35 respect to the transcriptional levels of the corresponding transcriptional levels in the
36 wild-type and the 16S rRNA as the internal standard. Values are the means ± SDs from
37 three independent experiments. Asterisks above error bars indicate significant
38 differences compared with XVM1 medium (t-test, **P< 0.01).
Page 39 of 44
39
40 Supplemental Fig. S2. The construction of the rocF gene mutant strain of X. oryzae
41 pv. oryzae PXO99A. (A) The rocF gene mutant of the wild-type strain was tested by
42 PCR. (B) The rocF mutant strains were confirmed by using special primers from the
43 rocF gene through PCR. (C) The expression of the rocF gene in the wild-type, ΔrocF
44 and ΔrocF(rocF) strains was determined by qRT-PCR. The relative transcriptional
45 levels of these genes were calculated by qRT-PCR with respect to the transcriptional
46 levels of the corresponding transcriptional levels in the wild-type and the 16S rRNA as
47 the internal standard. Three replicates were used for each treatment and the experiment
48 was repeated three times. Values are the means ± SDs from three independent
49 experiments. Asterisks above error bars indicate significant differences compared with
50 the wild-type (t-test, **P< 0.01).
Page 40 of 44
51
52
53 Supplemental Fig. S3. The growth rates of X. oryzae pv. oryzae PXO99A strains.
54 The wild-type, ΔrocF and ΔrocF(rocF) strains were pre-cultured to the exponential
55 phase of the indicated value (OD600 = 1.0) in NB liquid medium then two hundred
56 microliters of the cultures were transformed into twenty milliliter NB liquid mediums
57 to observe their growth rates, the values of each samples at OD600 every two hours.
58 Three replicates were used for each treatment and the experiment was repeated three
59 times. ● Represented the wild-type strain (PXO99A), ♦ Represented the rocF mutant
60 strain (ΔrocF), ▲ Represented the complementary strain of ΔrocF (ΔrocF(rocF)).
61 Values are the means ± SDs from three independent experiments. Asterisks above error
62 bars indicate significant differences compared with the wild-type (t-test, **P< 0.01).
636465666768 SUPPLEMENTAL TABLE S1. Primers used in this study.69
Primer Sequence (5’ to 3’)a Purpose/Description SourceFor mutant construction
Page 41 of 44
rocF-1F CGGAATTCCGCCACAGCAGCCTTGACGACC
This study
rocF-1R GAACGCCAATCAGGGAAACC
To amplify a 404 bp upstream homologuearm of gene rocF This
studyrocF-2F GGTTTCCCTGATTGGCGTTCGACGCTG
ATGCGGGATTGThis study
rocF-2R GCTCTAGAGCCGCTTGATACGGCCTCGA
To amplify a 710 bp downstream homologue arm of gene rocF
This study
v-rocF-F GTTTCCCTGATTGGCGTTCC To amplify 568 bp fragment of gene rocF for
This study
v-rocF-R CGATGCGGTGCTGCTTGAT mutant confirmationFor ComplementationCΔrocF-F CGGAATTCCGGGGCAGGGCAAAAAAC
AGCGCTTCGCATGAAAGACGTTGCGGTAGCGCGG
This study
CΔrocF-R GGGGTACCCCACTCCTCATGGATAAAGCGGCGCGTTGCCGCAAATCGAACAATTCAGGTG
To amplify a 1890 bp fragment containinggene rocF and its native promoter
This study
For C-terminal Flag tag fusion in genome levelrocF-Flag-1F CGGGATCCCCTTGCCGGCACCTGCGA
CGGThis study
rocF-Flag-1R CGGGATGACTACAAAGACGACGACGACAAATGATCCAGCGCTG
To amplify a 438 bp upstream homologuearm of gene rocF -Flag This
studyrocF-Flag-2F GGATCATTTGTCGTCGTCGTCTTTGTA
GTCATCCCGCATCAGCThis study
rocF-Flag-2R GCTCTAGACCGGAGGAGAAGCGGCTGATC
To amplify a 337 bp downstream homologue arm of gene rocF -Flag
This study
For GUS assayP-rocF-F CGGGGTACCAACGCCAATCAGGGAAA
CCThis study
P-rocF-R CCCAAGCTTCAGCGTTATTCGGCATGAAA
To amplify a fragment containing376 bp gene rocF promoter
This study
For qRT-PCR (quantitative real-time PCR)16S rRNA-F TTCATGGAGTCGAGTTGCAG This
study16S rRNA-R GTCAAGTCATCATGGCCCTT
The internal control forrelative quantification
This study
qRT-rocF-F TCATTGATCGACAGATCCGA This study
qRT-rocF-R GCACGTCTCCGACGATATTT
To determine the transcriptional level of the gene rocF
This study
qRT-PXO_RS08055-F
ACCTGTGGAATGCGCAATG To determine the transcriptional level of the
This study
qRT- CAGATCGCACCAGTACAAGC gene PXO_RS08055 This
Page 42 of 44
PXO_RS08055-R studyqRT-PXO_RS10635-F
CAAGGTCTACGAAAACGGCC To determine the transcriptional level of the
This study
qRT-PXO_RS10635-R
CTGCCTGCACTGATGTCTTC gene PXO_RS10635 This study
qRT-PXO_RS11405-F
TGAAGCGTAATTCCGTTGCC To determine the transcriptional level of the
This study
qRT-PXO_RS11405-R
CAGCAGGTCGATGTAGTTGC gene PXO_RS11405 This study
qRT-PXO_RS11410-F
AACTGTTGATATTGGCCGCC To determine the transcriptional level of the
This study
qRT-PXO_RS11410-R
TGGGGTTGTGCTTTTCGAAG gene PXO_RS11410 This study
qRT-PXO_RS14800-F
TGCTGCTGTTCAAGGTGTTC To determine the transcriptional level of the
This study
qRT-PXO_RS14800-R
TTGGATTCCTGCACGAACAC gene PXO_RS14800 This study
qRT-PXO_RS14820-F
CTGTTTCCGTTCGGCTATGG To determine the transcriptional level of the
This study
qRT-PXO_RS14820-R
CTGAAAACCGACCAGACTGC gene PXO_RS14820 This study
qRT-PXO_RS15910-F
AAAGATCGCCAACACGTACG To determine the transcriptional level of the
This study
qRT-PXO_RS15910-R
AAAGAAGGTTTGTCGTCGCC gene PXO_RS15910 This study
qRT-PXO_RS17325-F
TCAAATTCCATTGGCGTCCC To determine the transcriptional level of the
This study
qRT-PXO_RS17325-R
GCACCAACTCTTCGGGAATG gene PXO_RS17325 This study
qRT-PXO_RS05465-F
GCTGATCGAGGAAAAGAGCG To determine the transcriptional level of the
This study
qRT-PXO_RS05465-R
CCAGTGTCATGTTGTCGTGG gene PXO_RS05465 This study
qRT-PXO_RS06520-F
CACAAGCTCGAATCGGTCAA To determine the transcriptional level of the
This study
qRT-PXO_RS06520-R
ATAACCCATGCACTTCCAGC gene PXO_RS06520 This study
qRT-PXO_RS05475-F
ATTGATGATGAAGGTGCCGC To determine the transcriptional level of the
This study
qRT-PXO_RS05475-R
CGACAACTATGCTGCCTTCC gene PXO_RS05475 This study
qRT-PXO_RS22555-F
ACGGCGATGAACAGTTTTCC To determine the transcriptional level of the
This study
qRT- ACTTTGCTGCCTCCGGATAT gene PXO_RS22555 This
Page 43 of 44
PXO_RS22555-R study7071
72 METHODS USED IN THIS SECTION
73 Bacterial growth assays in NB liquid medium
74 To investigate whether the deletion of the rocF gene influences the normal growth rate
75 of X. oryzae pv. oryzae PXO99A, we cultured the XOO strains in NB liquid medium to
76 an optical density of 1.0 at 600 nm and transferred 200 µL bacterial suspensions to new
77 sterilized bottles containing 20 mL NB liquid medium. The values for optical density
78 at 600 nm were recorded every 2 h for 32 h and pictures were obtained every 24 h.
79
Page 44 of 44