Archives of Oral Biology (2005) 50, 81—87

www.intl.elsevierhealth.com/journals/arob

SHORT COMMUNICATION

Role of hypoxia and interleukin-1b in geneexpressions of matrix metalloproteinases intemporomandibular joint disc cells

Akihiko Yamaguchi*, Itaru Tojyo, Hiroaki Yoshida, Shigeyuki Fujita

Department of Oral and Maxillofacial Surgery, Wakayama Medical University, 811-1,Kimiidera, Wakayama-city 641-8509, Japan

Accepted 11 June 2004

KEYWORDSTemporomandibularjoint;Hypoxia;Interleukin-1b;Matrixmetalloproteinases;Rabbit

Abstract

The aim of this study was to test the hypothesis that hypoxia and interleukin-1(IL-1)b played a substantial role in gene expressions of matrix metalloproteinases(MMPs) in temporomandibular joint (TMJ) disc cells. The TMJ disc cells were isolatedfrom rabbit TMJ, and cultured in Dulbecco’s modified Eagle’s medium (DMEM). Theexperiment was performed for 24 h in hypoxic (2% O2) and IL-1b stimulated condi-tions. To examine the effect of hypoxia and IL-1b on gene expression of MMPs andtissue inhibitors of metalloproteinase (TIMPs), we performed reverse transcription—polymerase chain reaction (RT—PCR) and real-time RT-RCR. The results showed thatthe combination of hypoxia and IL-1b caused a significant increase of MMP-1, MMP-3,MMP-9 and MMP-13 mRNA (P < 0.05). Hypoxia caused a significant increase of MMP-2mRNA (P < 0.05). The combination of hypoxia and IL-1b caused a significant decreaseof TIMP-3 compared to hypoxia (P < 0.05). These findings suggest that hypoxia andIL-1b may contribute to the degradation or remodelling of the extracellular matrix(ECM) of the disc and may have a role in the pathogenesis of TMJ disorders.# 2004 Elsevier Ltd All rights reserved.

Introduction

Temporomandibular joint (TMJ) disorders (TMDs)are multifactorial and comsplex. Most of the

Abbreviations: DMEM, Dulbecco’s modified Eagle’s medium;RT—PCR, reverse transcription—polymerase chain reaction;IL-1b, interleukin-1b.

* Corresponding author. Tel.: +81 73 441 0643;fax: +81 73 441 0643.

E-mail address: ccz26580@hkg.odn.ne.jp (A. Yamaguchi).

0003–9969/$ — see front matter # 2004 Elsevier Ltd All rights reserdoi:10.1016/j.archoralbio.2004.06.006

patients with TMDs have disc displacement. Sofar, little is known about the pathogenesis ofTMD and disc displacement. Milam and Schmitz1

suggested three mechanisms of TMJ disease: directmechanical injury, hypoxia-reperfusion injury andneurogenic inflammation. These are involved inthe degenerative processes which include the syn-thesis and activation of proinflammatory cytokines(e.g. interleukin-1 (IL-1)b) and matrix degradingenzymes (e.g. matrix metalloproteinases (MMPs)).1,2

ved.

82 A. Yamaguchi et al.

In hypoxia-reperfusion injury intracapsular hydro-static pressure may exceed the end-capillary perfu-sion pressure (e.g. with clenching3), blood flow istransiently disrupted, resulting in tissue hypoxia.With increasing hypoxia, free radicals may be pro-duced when perfusion is re-established.2 Blake etal.4 provides evidence that transient hypoxia occursin loaded human knee joints. In low levels of oxy-gen, hypoxia inducible factor-1 (HIF-1), a O2-regu-lated transcription factor, accumulates andactivates the transcription of at least 30 genes.5

The expression levels of HIF-1 are strongly increasedin rheumatoid arthritis (RA) and osteoarthritis(OA) samples compared with healthy controls.6,7

However, there is no evidence that hypoxia occursin TMJ.

Recently the relationship between the pathogen-esis of TMD and the presence of IL-1b and MMPs isdescribed.8—12 Ijima et al.13 report that MMP-9 andMMP-3 are produced by rat TMJ disc cells, and thesemay be considered to play a pivotal role in extra-cellular matrix (ECM) degradation such as IL-1-induced TMJ arthritis. We showed that MMP-3 wasdetected in severely deformed discs of TMJ withinternal derangement.11 The pathogenesis of TMDand the presence of tissue inhibitors of metallopro-teinase (TIMPs) are also described.14,15 TIMPs inhibitactivated MMPs by binding to them noncovalently ata 1:1 ratio.16,17 Until now, no work has focused onthe role of hypoxia in production of MMPs in TMJdisc.

The aim of this study was to test the hypothesisthat hypoxia and IL-1b played a substantial role inproduction of MMPs in TMJ disc cells. We examinedthe gene expressions of MMPs and TIMPs underhypoxic and IL-1b stimulated conditions in culturedrabbit TMJ disc cells.

Table 1 Details of the PCR primers used in this study.

Gene Productsize(bp)

Primer sequences

MMP-1 322 TCAGTTCGTCCTCACTCCAG, TTGGTCCAMMP-2 313 AGCCTTCTCACCCCCACCTG, GCCCTTATMMP-3 400 GGCCATCTCTTCCTTCAG, GTCACTTTCTMMP-9 362 AAACTGGATGACGATGTCTGCGTCCCG, A

ATGGTTACACCCGCGTAMMP-13 527 TTCGGCTTAGAGGTGACAGG, ACTCTTGTIMP-1 326 GCAACTCCGACCTTGTCATC, AGCGTAGGTIMP-2 415 GTAGTGATCAGGGCCAAAG, TTCTCTGTGTIMP-3 454 TCTGCAACTCCGACATCGTG, CGGATGCA18S rRNA 394 GTTGGTGGAGCGATTTGTCT, GGCCTCA

a GenBank1 accession no. X06778.

Materials and methods

TMJ disc cell isolation

New Zealand white rabbits (weight 1.6—1.7 kg)were purchased from Japan animal company(Osaka, Japan). The dissection of the rabbit TMJdiscs was carried out under the control of ourcommittee in accordance with Japanese Govern-ment Animal Protection and Management Law(No.105), Japanese Government Notification onFeeding and Safekeeping of Animals (No. 6) andThe Guidelines for Animal Experiments inWakayama Medical University. The TMJ discs wereminced and digested in 0.25% trypsin, 0.02 mM EDTA(GIBCO BRL, Life Technologies Inc. Grand Island NY,USA) and 4% collagenase (Roche Diagnostics Man-nheim, Germany) for 3 h. The TMJ disc cells werewashed and resuspended in Dulbecco’s modifiedEagle’s medium (DMEM) (GIBCO BRL) supplementedwith 10% fetal bovine serum (EQUITECH-BIO INC.),1% penicillin/streptomycin (GIBCO BRL) and 50 mg/mL ascorbic acid. The disc cells were cultured at37 8C in a humidified 20% O2, 5% CO2, and 75% N2

atmosphere for a period of about 4 weeks (fifthpassages).

Experimental design

The cells were seeded at 1 � 104 /cm2 into 35 mmtissue culture dishes. In 90% confluent, the mediumwas replaced with serum-free medium. The cultureswere rinsed again after 24 h, and 2 mL of freshserum-free medium, with or without 1 ng/mL ofrecombinant human IL-1b (PeproTech, 29 Margra-vine Road, London W68LL, UK) was added. Theexperiment was performed for 24 h in a humidified

Annealingtemperature(8C)

Primer source

CCTGTCATCTTC 60 Le Graverand et al.36

CCCACTGCCCC 60 Feldman et al.37

TTGCATTTGG 60 Bluteau et al.38

CCTGTTCCGCT 60 Reno et al.39

CCGGTGTAGGTGT 60 Majima et al.40

TCTTGGTGAAGC 60 Agarwal et al.25

ACCCAGTCCAT 60 Reno et al.39

GGCGTAGTGTT 60 Reno et al.39

CTAAACCATCCAA 60 gb X06778a

Role of hypoxia and interleukin-1b in gene expressions 83

Figure 1 Phenotypic characteristics of rabbit tempor-omandibular joint (TMJ) disc cells. Morphology of rabbitTMJ disc cells at passage 6. Bar = 250 mm.

atmosphere of normoxic conditions (20% O2, 5%CO2, and 75% N2), or hypoxic conditions (2% O2,5% CO2, and 93% N2).

Reverse transcription-PCR

The total RNA from the TMJ disc cells was isolatedusing an RNeasy1 Mini Kit (Qiagen, MD, USA), asdescribed in the protocol provided with the kit.First-strand cDNA was synthesized from 0.5 mgof total RNA using a SuperScript1 transcriptase(Invitrogen, CA, USA). Reactions were primedwith Oligo (dT)12—18 primers and the total volumewas 20 mL. Reverse transcription—polymerasechain reaction (RT—PCR) analysis was performedin a total volume of 50 mL using Taq DNA poly-merase (Ampli Taq Gold1, Applied Biosystems,Foster City, CA, USA); 1 mL of cDNA sample wasused as template. PCR amplifications were per-formed for 22—30 cycles (denaturation: 95 8C for20 s; annealing: 60 8C for 30 s; extension: 72 8C for30 s). Table 1 lists the primer sequences andPCR conditions for each gene studied. The PCRproducts were subjected to 2% agarose gelelectrophoresis, and the etidium bromide stainedbands were visualized by a densitometer (ATTO,Japan).

Real-time RT—PCR

The total RNA from the TMJ disc cells was isolatedusing an RNeasy1 Mini Kit (Qiagen, MD, USA), asdescribed in the protocol provided with the kit.First-strand cDNA was synthesized from 1 mg oftotal RNA using a SuperScript1 transcriptase (Invi-trogen, CA, USA). Reactions were primed withOligo (dT)12—18 primers and the total volume was20 mL. RT—PCR was performed using the BIO-RADiCycler iQ system (BioRad, Hercules, CA, USA)according to the manufacturer’s instructions.Reactions were performed in a total volume of50 mL using iQ SYBR Green Supermix (BioRad);0.5 mL of cDNA sample was used as template.Cycling was started with an activation step at95 8C for 3 min, the amplification programrepeated 45 times (denaturation: 95 8C for 20 s;annealing: 60 8C for 30 s; extension: 72 8C for 30 s)with fluorescence measurement at 72 8C. All sam-ples were run in triplicate for the internal control(18S ribosomal RNA (18S rRNA)) and the targetgene (Table 1) on the same plate. The fluores-cence threshold value was calculated usingthe iCycle iQ system software version 3.0A. Toconfirm amplification specificity, the PCR pro-ducts from each primer pair were subjected to amelting curve analysis. Real-time PCR efficiencies

for each reaction were calculated using theformula: Efficiency (E) =10[�1/slope], from theslope values given in the iCycle iQ system soft-ware. The DCt values for the reference gene (18SrRNA) and the target gene were calculated bysubtracting the experiment group (normoxia +IL-1b, hypoxia and hypoxia + IL-1b) from the con-trol (normoxia). The mathematical model pre-sented by Pfaffl18 was used to determine therelative quantification of the target gene in com-parison to the reference gene. The relativeexpression ratio (R) of the target gene was calcu-lated based on E and the DCt of the experimentgroup versus the control, and expressed in com-parison to 18S rRNA.

Statistical analysis

Three independent experiments involving sepa-rate cell capture, RNA extraction, and reversetranscription were performed. All values wereexpressed as the means of three experiments �S.D. Statistical significance was evaluated byANOVA and multiple-comparison tests (Fisher).A P-value less than 0.05 were considered assignificant (Fig. 3).

Results

Morphologically, primary rabbit TMJ disc cellsappeared to be polygonal or round (Fig. 1).

The combination of hypoxia and IL-1b caused asignificant increase of levels of mRNAs of MMP-1,MMP-3, MMP-9 and MMP-13 (P < 0.05). Hypoxiaalone caused a significant increase of MMP-2 mRNAcompared to normoxia (P < 0.05). The combination

84 A. Yamaguchi et al.

Figure 2 Effect of hypoxia and Interleukin-1b on geneexpression of matrix metalloproteinases (MMPs) andtissue inhibitors of metalloproteinase (TIMPs). Reversetranscription—polymerase chain reaction (RT—PCR) wasperformed to evaluate the gene expression of MMPsand TIMPs. 18S rRNA is internal control. (N) normoxia(N + IL-1) normoxia + IL-1b (H) hypoxia (H + IL-1) hypoxia +IL-1b.

of hypoxia and IL-1b caused a significant decrease ofTIMP-3 compared to hypoxia (P < 0.05). The induc-tion of MMP-2 and TIMP-3 by hypoxia alone waslower than the induction of the other MMPs byhypoxia and IL-1b. No other effects were observed(Figs. 2 and 3).

Discussion

The cells of the TMJ disc are said to resemble fibro-cytes, fibroblasts, and fibrochondrocytes.19—22 Inour study, the cells of rabbit TMJ disc resembledchondrocytes or fibrochondrocytes (Fig. 1).

Articular cartilage is an avascular tissue and aphysiologically hypoxic tissue with an oxygengradient ranging from about 6% at the cartilagesurface to <1% in the deepest layers.23 Theoxygen gradient similar to that of the articularcartilage may occur in a TMJ disc which is alsoavascular tissue. In pathological conditions, a

further decrease in oxygen tension may occur.In this study, hypoxic condition was set 2% O2

because Wiesener et al.6,24 described HIF-1was stabilized under condition of hypoxia (<3%oxygen).

Agarwal et al.25 showed that the exposure ofrabbit TMJ fibrochondrocytes to IL-1b (1 ng/mL)for 24 h induced significant amounts of MMP-1. Lessthan 1 ng/mL IL-1 concentrations have beendetected in diseased TMJ synovial fluids, which leadus to choose the 1 ng/mL concentration for theexperiments.26

The regulation of MMP-2 is different from otherclasses of MMPs in joint cartilages.13 Ijima et al.reported that IL-1 did not affect the expression ofMMP-2 mRNA.13 Our data was consistent with thatreported by them. The expression of MMP-2 mRNAwas affected by hypoxia and not by IL-1b (Fig. 3). Itwas low comparable to the induction of the otherMMPs by hypoxia and IL-1.

In the present study, there was the lackof effect of IL-1b on mRNA expression of MMPsin normoxia. This result was different from theresults observed in other in vitro studies.13,25,27—29

The induction of MMPs might be seen if the ex-periments are performed by various time coursesand concentrations of IL-1b. However in thisstudy, we suggest that IL-1b induction of severalMMPs in TMJ disc cells may be depend largely onhypoxia.

The expression of MMPs and TIMPs is controlledby various cascades and factors. In this study, themolecular mechanisms by which combination ofhypoxia and IL-1b increase MMPs are not clear,but HIF-1 is probably related to this mechanisms.Stimulation of cultured synovial fibroblasts with IL-1b leads to stabilization of HIF-1.30 HIF-1 inducesiNOS gene expression31 and Murrell et al.32 reportthat NO plays a regulatory role in the activation ofMMP-1 and MMP-3 in articular chondrocytes andcartilage. Moreover hypoxia induces transcriptionfactor ETS-1 via the activity of HIF-1.33 ETS-1induces the gene expressions of MMPs (MMP-1,MMP-3, and MMP-9) and gelatinolytic activity ofMMP-9.34,35

Our results showed that the combination ofhypoxia and IL-1b is required for increasedgene expression of several MMPs, whereasdecreased or did not affect the expression ofTIMPs. These findings suggest that hypoxia andIL-1b may contribute to the TMJ disc ECM degra-dation or remodelling and may have a role inthe pathogenesis of TMJ disorders. It is not wellknown yet that the molecular mechanisms bywhich hypoxia increase MMPs and modulate theeffect of IL-1b, but the further investigation will

Role of hypoxia and interleukin-1b in gene expressions 85

Figure 3 Effect of hypoxia and interleukin-1b on gene expression of matrix metalloproteinases (MMPs) and tissueinhibitors of metalloproteinase (TIMPs). Real-time polymerase chain reaction (RT- PCR) was performed to evaluate thegene expression of MMPs and TIMPs. (a) MMP-1 (b) MMP-2 (c) MMP-3 (d) MMP-9 (e) MMP-13 (f) TIMP-1 (g) TIMP-2 (h) TIMP-3. Values represent the fold increase in gene expression relative to normoxia controls and are the mean � S.D. of threeindependent experiments. P < 0.05. (N) normoxia (N + IL-1) normoxia + IL 1b (H) hypoxia (H + IL-1) hypoxia + IL-1b.

allow us to understand about the pathogenesisof TMDs.

Acknowledgements

This research was supported, in part, by a grant-in-aid for Scientific Research from the Japanese Min-istry of Education, Science, Sports and Culture(No.13771240).

References

1. Milam SB, Schmitz JP. Molecular biology of temporomandib-ular joint disorders: proposed mechanisms of disease. J OralMaxillofac Surg 1995;53:1448—54.

2. Milam SB, Zardeneta G, Schmitz JP. Oxidative stress anddegenerative temporomandibular joint disease: a proposedhypothesis. J Oral Maxillofac Surg 1998;56:214—23.

3. Nitzan DW. Intraarticular pressure in the functioning humantemporomandibular joint and its alteration by uniform ele-vation of the occlusal plane. J Oral Maxillofac Surg 1994;52:671—9.

86 A. Yamaguchi et al.

4. Blake DR, Merry P, Unsworth J, Kidd BL, Outhwaite JM,Ballard R et al. Hypoxic-reperfusion injury in the inflamedhuman joint. Lancet 1989;1:289—93.

5. Semenza GL. Hypoxia-inducible factor 1: oxygen homeosta-sis and disease pathophysiology. Trends Mol Med 2001;7:345—50.

6. Hollander AP, Corke KP, Freemont AJ, Lewis CE. Expressionof hypoxia-inducible factor 1a by macrophages in the rheu-matoid synovium: implications for targeting of therapeuticgenes to the inflamed joint. Arthritis Rheum 2001;44:1540—4.

7. Giatromanolaki A, Sivridis E, Maltezos E, Athanassou N,Papazoglou D, Gatter KC et al. Upregulated hypoxia induciblefactor-1a and -2a pathway in rheumatoid arthritis andosteoarthritis. Arthritis Res Ther 2003;5:193—201.

8. Kubota E, Imamura H, Kubota T, Shibata T, Murakami K.Interleukin-1b and stromelysin (MMP3) activity of synovialfluid as possible markers of osteoarthritis in the temporo-mandibular joint. J Oral Maxillofac Surg 1997;55:20—7.

9. Kubota E, Kubota T, Matsumoto J, Shibata T, Murakami KI.Synovial fluid cytokines and proteinases as markers oftemporomandibular joint disease. J Oral Maxillofac Surg1998;56:192—8.

10. Suzuki T, Segami N, Kaneyama K, Nishimura M, Nojima T.Specific expression of interleukin-1b in temporomandibularjoints with internal derangement: correlation with clinicalfindings. Oral Surg Oral Med Oral Pathol Oral Radiol Endod1999;88:413—7.

11. Yoshida H, Yoshida T, Iizuka T, Sakakura T, Fujita S. Thelocalization of matrix metalloproteinase-3 and tenascin insynovial membrane of the temporomandibular joint withinternal derangement. Oral Dis 1999;5:50—4.

12. Tanaka A, Kumagai S, Kawashiri S, Takatsuka S, Nakagawa K,Yamamoto E et al. Expression of matrix metalloproteinase-2and -9 in synovial fluid of the temporomandibular jointaccompanied by anterior disc displacement. J Oral PatholMed 2001;30:59—64.

13. Ijima Y, Kobayashi M, Kubota E. Role of interleukin-1 ininduction of matrix metalloproteinases synthesized by rattemporomandibular joint chondrocytes and disc cells. Eur JOral Sci 2001;109:50—9.

14. Kapila S, Lee C, Richards DW. Characterization and identi-fication of proteinases and proteinase inhibitors synthesizedby temporomandibular joint disc cells. J Dent Res 1995;74:1328—36.

15. Breckon JJ, Hembry RM, Reynolds JJ, Meikle MC. Identifica-tion of matrix metalloproteinases and their inhibitor in thearticular disc of the craniomandibular joint of the rabbit.Arch Oral Biol 1996;41:315—22.

16. Hayakawa T. Tissue inhibitors of metalloproteinases andtheir cell growth-promoting activity. Cell Struct Funct1994;19:109—14.

17. Greene J, Wang M, Liu YE, Raymond LA, Rosen C, Shi YE.Molecular cloning and characterization of human tissueinhibitor of metalloproteinase 4. J Biol Chem 1996;271:30375—80.

18. Pfaffl MW. A new mathematical model for relative quanti-fication in RT—PCR. Nucleic Acids Res 2001;29:e45.

19. Berkovitz BK, Pacy J. Age changes in the cells of the intra-articular disc of the temporomandibular joints of rats andmarmosets. Arch Oral Biol 2000;45:987—95.

20. Landesberg R, Takeuchi E, Puzas JE. Cellular, biochemicaland molecular characterization of the bovine temporoman-dibular joint disc. Arch Oral Biol 1996;41:761—7.

21. Milam SB, Klebe RJ, Triplett RG, Herbert D. Characterizationof the extracellular matrix of the primate temporomandib-ular joint. J Oral Maxillofac Surg 1991;49:381—91.

22. Mills DK, Fiandaca DJ, Scapino RP. Morphologic, micro-scopic, and immunohistochemical investigations into thefunction of the primate TMJ disc. J Orofac Pain 1994;8:136—54.

23. Cernanec J, Guilak F, Weinberg JB, Pisetsky DS, Fermor B.Influence of hypoxia and reoxygenation on cytokine-inducedproduction of proinflammatory mediators in articular carti-lage. Arthritis Rheum 2002;46:968—75.

24. Wiesener MS, Turley H, Allen WE, Willam C, Eckardt KU, TalksKL et al. Induction of endothelial PAS domain protein-1 byhypoxia: characterization and comparison with hypoxia-inducible factor-1a. Blood 1998;92:2260—8.

25. Agarwal S, Long P, Gassner R, Piesco NP, Buckley MJ. Cyclictensile strain suppresses catabolic effects of interleukin-1bin fibrochondrocytes from the temporomandibular joint.Arthritis Rheum 2001;44:608—17.

26. Alstergren P, Ernberg M, Kvarnstrom M, Kopp S. Interleukin-1b in synovial fluid from the arthritic temporomandibularjoint and its relation to pain, mobility, and anterior openbite. J Oral Maxillofac Surg 1998;56:1059—65 discussion1066.

27. Jo H, Park JS, Kim EM, Jung MY, Lee SH, Seong SC et al. The invitro effects of dehydroepiandrosterone on human osteoar-thritic chondrocytes. Osteoarthritis Cartilage 2003;11:585—94.

28. Im HJ, Pacione C, Chubinskaya S, Van Wijnen AJ, Sun Y,Loeser RF. Inhibitory effects of insulin-like growth factor-1and osteogenic protein-1 on fibronectin fragment- and inter-leukin-1b-stimulated matrix metalloproteinase-13 expres-sion in human chondrocytes. J Biol Chem 2003;278:25386—94.

29. Ahmed S, Rahman A, Hasnain A, Goldberg VM, Haqqi TM.Phenyl N-tert-butyl nitrone down-regulates interleukin-1 b-stimulated matrix metalloproteinase-13 gene expression inhuman chondrocytes: suppression of c-Jun NH2-terminalkinase, p38-mitogen-activated protein kinase and activatingprotein-1. J Pharmacol Exp Ther 2003;305:981—8.

30. Thornton RD, Lane P, Borghaei RC, Pease EA, Caro J, MochanE. Interleukin-1 induces hypoxia-inducible factor 1 in humangingival and synovial fibroblasts. Biochem J 2000;350:307—12.

31. Palmer LA, Semenza GL, Stoler MH, Johns RA. Hypoxiainduces type II NOS gene expression in pulmonaryartery endothelial cells via HIF-1. Am J Physiol 1998;274:L212—9.

32. Murrell GA, Jang D, Williams RJ. Nitric oxide activatesmetalloprotease enzymes in articular cartilage. BiochemBiophys Res Commun 1995;206:15—21.

33. Oikawa M, Abe M, Kurosawa H, Hida W, Shirato K, Sato Y.Hypoxia induces transcription factor ETS-1 via the activity ofhypoxia-inducible factor-1. Biochem Biophys Res Commun2001;23:39—43.

34. Oda N, Abe M, Sato Y. ETS-1 converts endothelial cells to theangiogenic phenotype by inducing the expression of matrixmetalloproteinases and integrinb3. J Cell Physiol 1999;178:121—32.

35. Iwasaka C, Tanaka K, Abe M, Sato Y. Ets-1 regulates angio-genesis by inducing the expression of urokinase-type plas-minogen activator and matrix metalloproteinase-1 and themigration of vascular endothelial cells. J Cell Physiol1996;169:522—53.

36. Le Graverand MP, Eggerer J, Vignon E, Otterness IG, BarclayL, Hart DA. Assessment of specific mRNA levels in cartilageregions in a lapine model of osteoarthritis. J Orthop Res2002;20:535—44.

37. Feldman LJ, Mazighi M, Scheuble A, Deux JF, De Benedetti E,Badier-Commander C et al. Differential expression of matrix

Role of hypoxia and interleukin-1b in gene expressions 87

metalloproteinases after stent implantation and balloonangioplasty in the hypercholesterolemic rabbit. Circulation2001;103:3117—22.

38. Bluteau G, Conrozier T, Mathieu P, Vignon E, Herbage D,Mallein-Gerin F. Matrix metalloproteinase-1, -3, -13 andaggrecanase-1 and -2 are differentially expressed in experi-mental osteoarthritis. Biochim Biophys Acta 2001;1526:147—58.

39. Reno C, Boykiw R, Martinez ML, Hart DA. Temporal altera-tions in mRNA levels for proteinases and inhibitors and theirpotential regulators in the healing medial collateral liga-ment. Biochem Biophys Res Commun 1998;252:757—63.

40. Majima T, Marchuk LL, Shrive NG, Frank CB, Hart DA. In-vitrocyclic tensile loading of an immobilized and mobilized liga-ment autograft selectively inhibits mRNA levels for collage-nase (MMP-1). J Orthop Sci 2000;5:503—10.