role of rbm3 gene in cancer

8/6/2019 Role of Rbm3 Gene in Cancer

1/41

1

CHAPTER 1

INTRODUCTION


2/41

2

1. INTRODUCTION

Cancer is one of the most common causes of disease and death in the western world. In general,

incidence rates increase with age for most forms of cancer. As human populations continue to live

longer, due to an increase of the general health status, cancer may affect an increasing number of

individuals. The cause of most common cancer types is still largely unknown, although there is an

increasing body of knowledge providing a link between environmental factors (dietary, tobacco

smoke, UV radiation etc) as well as genetic factors (germ line mutations in "cancer genes" such as

p53, APC, BRCA1, XP etc) and the risk for development of cancer.

No definition of cancer is entirely satisfactory from a cell biological point of view, despite the fact

that cancer is essentially a cellular disease and defined as a transformed cell population with net cell

growth and anti-social behavior. Malignant transformation represents the transition to a malignant phenotype based on irreversible genetic alterations. Although this has not been formally proven,

malignant transformation is believed to take place in one cell, from which a subsequently developed

tumor originates (the "clonality of cancer" dogma). Carcinogenesis is the process by which cancer is

generated and is generally accepted to include multiple events that ultimately lead to growth of a

malignant tumor. This multi-step process includes several rate-limiting steps, such as addition of

mutations and possibly also epigenetic events, leading to formation of cancer following stages of

precancerous proliferation. The stepwise changes involve accumulation of errors (mutations) in vital

regulatory pathways that determine cell division, asocial behavior and cell death. Each of these

changes may provide a selective Darwinian growth advantage compared to surrounding cells,

resulting in a net growth of the tumor cell population. A malignant tumor does not only necessarily

consist of the transformed tumor cells themselves but also surrounding normal cells which act as a

supportive stroma. This recruited cancer stroma consists of connective tissue, blood vessels and

various other normal cells, e.g., inflammatory cells, which act in concert to supply the transformed

tumor cells with signals necessary for continued tumor growth.

The most common forms of cancer arise in somatic cells and are predominantly of epithelial origin,

e.g., prostate, breast, colon, urothelial and skin, followed by cancers originating from the

hematopoetic lineage, e.g., leukemia and lymphoma, neuroectoderm, e.g., malignant gliomas, and

soft tissue tumors, e.g., sarcomas.


3/41

3

Breast cancer is the second most common form of cancer worldwide and by far the most frequent

cancer of women. Data from the GLOBOCAN 2002 database presented by Parkinrevealed 1.15

million new cases in 2002 and 0.41 million deaths during the same period (Parkin D M. et al. 2005).

If detected at an early stage, the prognosis is relatively good for a patient living in a developed

country, with a general five-year survival rate of 73%, compared to 57% in a developing country.The incidence is slowly increasing and about one in every nine women in the developed world is

believed to get breast cancer in her lifetime. Although lifestyle changes related to female steroid

hormones, including exposure to exogenous hormones, affect the risk of developing breast cancer,

these factors only make up for a small fraction of the etiology, and the benefit of preventive

manipulation is believed to be low. The decreased mortality is mainly due to earlier detection by

mammography screening and the use of modern adjuvant systemic treatment

The gene encoding RNA binding motif protein 3 (RBM3) was initially isolated from fetal brain

tissue (Derry J M et al. 1995). RBM3 is upregulated early in response to cold-shock (Danno S et

al.1997) and may protect against certain cell death pathways (Kita H et al. 2002). The RBM3 gene is

together with two other RNA binding proteins, RBMX and RBM10, all located on the X-

chromosome. A recent study revealed a significant association between expression of the X-

chromosome related RBM-genes and the proapoptoticBax gene in breast cancer tissue (Martinez-

Arribas F et al. 2006). Another protein identified with RBM domains is RBM5/LUCA15, which is

reported to play a role during cell proliferation and apoptosis and has been found down regulated in

both lung and breast cancer (Mourtada-Maarabouni M. et al. 2006).

Using cDNA selection with a YAC from the Xp11.2 region, scientists have identified a novel gene

(RBM3) thatencodes a polypeptide with high sequence similarityto a group of proteins that bind to

RNA. On a YACcontig map, RBM3 is located between OATL1 andGATA1/TFE3 in sub-band

Xp11.23, and gives rise toalternatively spliced transcripts in a variety of humantissues. The longest

open reading frame encodes a157 amino acid protein with a predicted molecularweight of 17 kDa.Its putative RNA-binding domainmost closely resembles that of two previously characterizedhuman

RNA-binding proteins, YRRM, the genefor which has been implicated in azoospermia, andhnRNP

G, a glycoprotein, also identified as an autoantigen.The homology of RBM3 in bothsequenceand size

to an RNA binding protein from maize, AAIP,suggests that it functions in a fundamental

pathwayconserved from plants to mammals(Derry JM. Kerns JA. et al)


4/41

4

CHAPTER 2

Review of literature


5/41

5

2.1. Location of RBM-3 gene

The Official Symbol of RBM3 is provided by HGNC (HUGO Gene Nomenclature Committee)& its

official Full NameRNA binding motif (RNP1, RRM) protein-3 is been provided by HGNCPrimary.

Its Gene type is protein coding.RBM-3 is also known as RNPL; IS1-RNPL. Molecular Weightof

gene is 17170 Da. It is found on Chromosome X at location of Xp11.2.This gene is a member of the

glycine-rich RNA-binding protein family and encodes a protein with one RNA recognition motif

(RRM) domain. Expression of this gene is induced by cold shock and low oxygen tension. A

pseudogene exists on chromosome 1. Multiple alternatively spliced transcript variants that are

predicted to encode different isoforms have been characterized although some of these variants fit

nonsense-mediated decay (NMD) criteria.


6/41

6

Chromosome X - NC_000023.10

Homo sapiens chromosome X, GRCh37.p2 primary reference assembly

gi|224589822|ref|NC_000023.10|


7/41

7

48,432,240 : 48,437,398 (5,159 bases shown, positive strand)

Protein Sequence 157AA NP_006734.1

MSSEEGKLFVGGLNFNTDEQ ALEDHFSSFG PISEVVVVKD

RETQRSRGFGFITFTNPEHA SVAMRAMNGE

SLDGRQIRVD HAGKSARGTRGGGFGAHGRG RSYSRGGGDQ

GYGSGRYYDS RPGGYGYGYG RSRDYNGRNQGGYDRYSGGN

YRDNYDN


8/41

8

DNA Sequence Open Reading Frame: 140 to

613 NM_006743.3

GGGAACGTTC CGGGACGTTC TCGCTACGTA CTCTTTATCA

ATCGTCTTCCGGCGCAGCCC CGTCCCTGTT TTTTGTGCTC

CTCCGAGCTCGCTGTTCGTC CGGGTTTTTT ACGTTTTAATTTCCAGGACT TGAACTGCCA TGTCCTCTGA AGAAGGAAAG

CTCTTCGTGGGAGGGCTCAA CTTTAACACC GACGAGCAGG

CACTGGAAGA CCACTTCAGC AGTTTCGGAC CTATCTCTGA

GGTGGTCGTTGTCAAGGACC GGGAGACTCAGCGGTCCAGG

GGTTTTGGTT TCATCACCTT CACCAACCCAGAGCATGCTT

CAGTTGCCAT GAGAGCCATG AACGGAGAGT CTCTGGATGG

TCGTCAGATC CGTGTGGATC ATGCAGGCAAGTCTGCTCGG

GGAACCAGAGGAGGTGGCTT TGGGGCCCAT GGGCGTGGTC

GCAGCTACTC TAGAGGTGGT GGGGACCAGGGCTATGGGAG

TGGCAGGTAT TATGACAGTCGACCTGGAGGGTATGGATAT

GGATATGGACGTTCCAGAGA CTATAATGGC AGAAACCAGG

GTGGTTATGA CCGCTACTCAGGAGGAAATT ACAGAGACAA

TTATGACAAC TGAAATGAGA CATGCACATA ATATAGATAC

ACAAGGAATA ATTTCTGATC CAGGATCGTC CTTCCAAATG

GCTGTATTTA TAAAGGTTTT TGGAGCTGCA CCGAAGCATC

TTATTTTATAGTATATCAAC CTTTTGTTTT TAAATTGACC

TGCCAAGGTAGCTGAAGACC TTTTAGACAG TTCCATCTTT

TTTTTTAAAT TTTTTCTGCC TATTTAAAGA CAAATTATGG

GACGTTTGTAGAACCTGAGT ATTTTTCTTT TTACCAGTTT

TTTAGTTTGAGCTCTTAGGT TTATTGGAGC TAGCAATAAT

TGGTTCTGGC AAGTTTGGCC AGACTGACTT CAAAAAATTA

ATGTGTATCC AGGGACATTT TAAAAACCTG TACACAGTGT

TTATTGTGGT TAGGAAGCAA TTTCCCAATG TACCTATAAG

AAATGTGCAT CAAGCCAGCC TGACCAACAT GGTGAAACCC

CATCTGTACT AAACATAAAA AAATTAGCCTGGCATGGTGG

TGTACGCCTG TAATCCCAGT GACTTGGGAGGCTGAGGCAG

GAGAATCGCT TGAACCCGGG AGGCGGAGGT TGCAGTGAGC

TAAGATCGCG CCACTGTACT CCAGCCTGGG CAACAGCGAG

ACTCCATCTC AAAAAAAAAGGAAATGTGTA TCAAGAACAT

GATTATCCAG CGGTATTTTC TAATTCAGAT CATCAAACTG

ATTATATAGA AGAGTTGGCT TTAAAATGTT TGCAAATGTC

TTTTTTTTTT TAATACTGGA AGAAAAAATA TTCTGTTGTG

TCTCATACAG TGCTTAGGATGTCTTTCACAGAGCTTATTA

AAAAGATGAA ACCTGAGAAC AAACTGCTTT ATTCTTACTC

AGCCCATTTTGCAAATTAAA AGTGGGGGCAGAGGTGGGCG

GATCACCTGA GGTCAGGAGT TCGAGACCAG CCTGGCCAAC


9/41

9

AGGGCAAAAC CCCATCTCTA CTAAAAAT

2.2. Gene profiling based on following case studies

y Promoter-sharing by different genes in human genome CPNE1and

RBM12 gene pair as an example.


10/41

10

Regulation of gene expression plays important role in cellular functions. Coregulation of different

genes may indicate functional connection or even physical interaction between gene products. Thus

analysis on genomic structures that may affect gene expression regulation could shed light on the

functions of genes.

In a whole genome analysis of alternative splicing events, we found that two distinct genes,copine I

(CPNE1) and RNA binding motifprotein 12 (RBM12), share the most 5' exons and therefore the

promoter region in human. Further analysis identified many gene pairs in human genome that share

the same promoters and 5' exons but have totally different coding sequences. Analysis of genomic

and expressed sequences, either cDNAs or expressed sequence tags (ESTs) forCPNE1 andRBM12,

confirmed the conservation of this phenomenon during evolutionary courses. The coexpression of

the two genes initiated from the same promoter is confirmed by ReverseTranscription-Polymerase

Chain Reaction (RT-PCR) in different tissues in both human and mouse.High degrees of sequence

conservation among multiple species in the 5'UTR region common toCPNE1 andRBM12 were also

identified.

Promoter and 5'UTR sharing between CPNE1 and RBM12 is observed in human, mouse and

zebrafish. Conservation of this genomic structure in evolutionary courses indicatespotential

functional interaction between the two genes. More than 20 other gene pairs in humangenome were

found to have the similar genomic structure in a genome-wide analysis, and it mayrepresent a unique

pattern of genomic arrangement that may affect expression regulation of thecorresponding

genes.(Wanling Yang,et al.2008)

y Analysis of the retinal gene expression profile after hypoxic

preconditioning identifies candidate genes for neuroprotection.

Retinal degeneration is a main cause of blindness in humans. Neuroprotectivetherapies may be used

to rescue retinal cells and preserve vision. Hypoxic preconditioningstabilizes the transcription factor

HIF-1 in the retina and strongly protects photoreceptors in ananimal model of light-induced retinal

degeneration. To address the molecular mechanisms of theprotection, we analyzed the transcriptome

of the hypoxic retina using microarrays and real-timePCR.


11/41

11

Hypoxic exposure induced a marked alteration in the retinal transcriptome withsignificantly different

expression levels of 431 genes immediately after hypoxic exposure. Thenormal expression profile

was restored within 16 hours of reoxygenation. Among the differentiallyregulated genes, several

candidates for neuroprotection were identified like metallothionein-1 and-2, the HIF-1 target gene

adrenomedullin and the gene encoding the antioxidative andcytoprotective enzyme paraoxonase 1which was previously not known to be a hypoxia responsivegene in the retina. The strongly

upregulatedcyclin dependent kinase inhibitor p21 was excludedfrom being essential for

neuroprotection.

Our data suggest that neuroprotection after hypoxic preconditioning is the result ofthe differential

expression of a multitude of genes which may act in concert to protect visual cellsagainst a toxic

insult(Markus Thierschet al.2008).

y Molecular processes during fat cell development revealed by gene

expression profiling and functional annotation.

Large-scale transcription profiling of cell models and model organisms can identifynovel molecular

components involved in fat cell development. Detailed characterization of thesequences of identified

gene products has not been done and global mechanisms have not beeninvestigated. We evaluated

the extent to which molecular processes can be revealed by expressionprofiling and functional

annotation of genes that are differentially expressed during fat celldevelopment.

Mouse microarrays with more than 27,000 elements were developed, and transcriptionalprofiles of

3T3-L1 cells (pre-adipocyte cells) were monitored during differentiation. In total, 780differentially

expressed expressed sequence tags (ESTs) were subjected to in-depth bioinformaticsanalyses. The

analysis of 3'-untranslated region sequences from 395 ESTs showed that 71% of thedifferentially

expressed genes could be regulated by microRNAs. A molecular atlas of fat celldevelopment was

then constructed by de novofunctional annotation on a sequence segment/domain-wise basis of 659

protein sequences, and subsequent mapping onto known pathways,possible cellular roles, and

subcellular localizations. Key enzymes in 27 out of 36 investigatedmetabolic pathways were

regulated at the transcriptional level, typically at the rate-limiting steps inthese pathways. Also,

coexpressed genes rarely shared consensus transcription-factor bindingsites, and were typically not


12/41

12

clustered in adjacent chromosomal regions, but were instead widelydispersed throughout the

genome.

Large-scale transcription profiling in conjunction with sophisticated bioinformaticsanalyses can

provide not only a list of novel players in a particular setting but also a global view onbiological

processes and molecular networks (Hubert Hacklet al. 2005).

y Discovery and validation of colonic tumor-associated proteins via

metabolic labeling and stable isotopic dilution.

The unique biology of a neoplasm is reflected by its distinct molecular profile compared with normal

tissue. To understand tumor development better, we have undertaken a quantitative proteomic search

for abnormally expressed proteins in colonic tumors from ApcMin/ (Min) mice. By raising pairs of

Min and wild-type mice on diets derived from natural-abundance or 15Nlabeled algae, we used

metabolic labeling to compare protein levels in colonic tumor versus normal tissue. Because

metabolic labeling allows internal control throughout sample preparation and analysis, technical

error is minimized as compared with in vitro labeling. Several proteins displayed altered expression,

and a subset was validated via stable isotopic dilution using synthetic peptide standards. We also

compared gene and protein expression among tumor and nontumor tissue, revealing limited

correlation. This divergence was especially pronounced for species showing biological change,

highlighting the complementary perspectives provided by transcriptomics and proteomics. Our work

demonstrates the power of metabolic labeling combined with stable isotopic dilution as an integrated

strategy for the identification and validation of differentially expressed proteins using rodent models

of human disease (Edward L. Huttlin).

2.3. Functions


13/41

13

y Nuclear expression of the RNA-binding protein RBM3 is associated with an improved

clinical outcome in breast cancer

Single-strand RNA-binding proteins (RBPs) are involved in many aspects of RNA metabolism and

in the regulation of gene transcription. The RBP RBM3 was recently suggested to be a proto-

oncogene in colorectal cancer; however, such a role has not been corroborated by previous studies in

the colon or other tumor types, and the prognostic implications of tumor-specific RBM3 expression

remain unclear. Mono-specific antibodies against RBM3 were generated. Antibody specificity was

confirmed using siRNA gene silencing, western blotting and immunohistochemistry on a panel of

breast cancer cell lines. Using tissue microarrays and IHC, RBM3 protein expression was examined

in 48 normal tissues and in 20 common cancers. Additional analysis in two independent breast

cancer cohorts (n=1016) with long-term follow-up was also carried out. RBM3 was upregulated in

cancer compared to normal tissues. The nuclear expression of RBM3 in breast cancer was associated

with low grade (P


14/41

14

mediated down-regulation of the cold shock protein (CSP) encoding mRNAs dramatically attenuates

cell survival in the absence of any heat application. Furthermore, we also demonstrate that knocking

down the CSPs can enhance the therapeutic response of prostate cancer cells to chemotherapy. Our

findings suggest that down-regulating CSPs in cancer cells may "mimic" the stress response the cells

experience when exposed to heat treatment rendering them more susceptible to therapy. Thus, thepharmacological modulation of RBM3 and CIRBP may represent novel therapeutic approaches for

prostate cancer (Zeng Y, et al. 2009).

y Translation regulatory factor RBM3 is a proto-oncogene that prevents mitotic

catastrophe

RNA-binding proteins play a key role in post-transcriptional regulation of mRNA stability and

translation. We have identified that RBM3, a translation regulatory protein, is significantly

upregulated in human tumors, including a stage-dependent increase in colorectal tumors. Forced

RBM3 overexpression in NIH3T3 mouse fibroblasts and SW480 human colon epithelial cells

increases cell proliferation and development of compact multicellular spheroids in soft agar

suggesting the ability to induce anchorage-independent growth. In contrast, downregulating RBM3

in HCT116 colon cancer cells with specific siRNA decreases cell growth in culture, which was

partially overcome when treated with prostaglandin E(2), a product of cyclooxygenase (COX)-2

enzyme activity. Knockdown also resulted in the growth arrest of tumor xenografts. We have also

identified that RBM3 knockdown increases caspase-mediated apoptosis coupled with nuclear cyclin

B1, and phosphorylated Cdc25c, Chk1 and Chk2 kinases, implying that under conditions of RBM3

downregulation, cells undergo mitotic catastrophe. RBM3 enhances COX-2, IL-8 and VEGF mRNA

stability and translation. Conversely, RBM3 knockdown results in loss in the translation of these

transcripts. These data demonstrate that the RNA stabilizing and translation regulatory protein

RBM3 is a novel proto-oncogene that induces transformation when overexpressed and is essential

for cells to progress through mitosis (Sureban SM, et al. 2008).


15/41

15

Fig - RBM3 and HuR are overexpressed in tumors. (a) RBM3 and HuR gene expression in tumor

and surrounding uninvolved tissues. Significant induction of RBM3 mRNA expression was observedin stages 24, whereas HuR was induced only in stage 1. * denote statistically significant differences

(*P


16/41

16


17/41

17

Fig - RBM3 overexpression induces oncogenic transformation. (a) Proliferation of three independent

NIH3T3-RBM3 clones were significantly higher than that observed with three independent NIH3T3-

vector clones. (b) NIH3T3-RBM3 cells develop large colonies in soft agar, which are bigger than

those formed by HT-29 cells. HuR overexpressing cells, on the other hand did not form any colonies

in the soft agar. (c) Quantitative estimation of number of colonies formed in soft agar (*P


18/41

18

Fig - RBM3 is essential for tumor growth. (a) RBM3 specific siRNA (si-RBM3), but not a

scrambled siRNA (si-Scr) decreases RBM3 and COX-2 mRNA expression. * denote statistically

significant differences (**P


19/41

19

Antitumor activity of si-RBM3 in mice carrying HCT116 cell tumor xenografts. HCT116 cells were

injected into the flanks of Ncr nude mice (five mice per group) and tumors were allowed to develop

for 15 days. siRNA was injected directly into the tumors starting on day 15 and every third day for a

total of five injections. Tumor sizes with standard error are shown from data collected at the time of

every injection. si-Scr treated tumors were larger than the control carrier injected tumors, whereas si-RBM3 treated tumors were smaller. A representative excised tumor at day 28 is shown to the right. *

denote statistically significant differences (*P


20/41

20

Fig - RBM3 downregulation results in mitotic catastrophe. (a) siRNAdownregulation of RBM3

increased cells in the G2/M phase. HCT116 cells were transfected at the indicated dose of either

scrambled (si-Scr) or RBM3-specific (si-RBM3) siRNA for 72 h. Cell-cycle profiles were analysed

by flow cytometry following PI staining for DNA content. The percentage of cells in the G2/M

phase following si-RBM3 transfection was increased compared to control and si-Scr cells. Addition

of PGE2 partially suppressed the RBM3 siRNA-mediated effects. (b) Knockdown of RBM3 leads to

apoptosis. HCT116 cells following siRNA transfection were stained by the TUNEL method. Arrows

show the TUNEL-positive cells, which were higher in si-RBM3 transfected cells, but less in cells

also treated with 1 M PGE2. (c) Loss of RBM3 induces checkpoint proteins. Lysates from HCT116

cells treated with si-Scr (50 nM) or si-RBM3 (10 and 50 nM), and tumor xenografts from the various

treatments were subjected to western blot analyses using specific antibodies for phospho-Ser345

Chk-1, phospho-Thr68 Chk-2, Cdc25C, phospho-Ser15 p53 and cyclin B1. Actin was used as an

internal control for loading the gels. (d) Lack of RBM3 increases cyclin B1 translocation to nucleus.

Tumor xenografts were subjected to immunohistochemical staining for cyclin B1. The arrows in the

si-RBM3 treated tumors indicate cyclin B1-positive cells in the nucleus. Representative photographs

are a magnification of 400. (e) RBM3 depletion leads to mitotic catastrophe. Tumors treated with


21/41

21

si-RBM3 were stained for TUNEL (green) and phosphorylated histone H3 (red). The cells positive

for both are shown in the merged image with yellow stain. DAPI is used to stain the nucleus. COX,

cyclooxygenase; PGE2, prostaglandin E2; RTPCR, reverse transcriptionpolymerase chain

reaction; siRNA, short interfering RNA; VEGF, vascular endothelial growth factor.


22/41

22

Fig - RBM3 and HuR interact and enhance stability. (a) Yeast two-hybrid interaction of RBM3 with

HuR. RBM3 and HuR expressed as bait and test proteins interact in the yeast by the colonies formed

on quadruple dropout media. Breakdown of the X--gal results in a blue colony. Tumor suppressor

protein p53 and SV40 T antigen (RecT) were used as positive control for interaction, but negative

for interaction with either RBM3 or HuR. (b) GST pull-down assay. 35S-methionine labeled in vitro

translated HuR (35S-HuR) was incubated with either GST-RBM3 or GST-HuR. The GST-proteins


23/41

23

were immobilized on to glutathione sepharose beads. The immobilized proteins were separated by

SDSPAGE and subjected to phosphorimager analyses. Pure GST served as negative control. (c).

Colocalization of HuR and RBM3. HeLa cells were transiently transfected with plasmids expressing

myc-epitope tagged HuR and FLAG-epitope tagged RBM3. Immunocytochemistry was performed

for the myc and FLAG epitopes. Images for the HuR and RBM3 were merged demonstratingcolocalization. Nucleus was stained by DAPI. (d) Nuclear-cytoplasmic shuttling of HuR and RBM3.

Plasmids encoding FLAG-epitope tagged HuR or RBM3 were transiently transfected into human

HeLa cells and subsequently fused with mouse NIH3T3 cells. The proteins were immunostained for

the FLAG tag, and the nuclei by Hoescht stain to differentiate human and mouse nuclei. Mouse

nuclei, seen as punctuate staining are denoted by an arrow. (e) RBM3 and HuR induce COX-2, IL-8

and VEGF mRNA expression. Ectopic expression of Flag epitope-tagged RBM3 and HuR resulted

in significant increase in endogenous COX-2, IL-8 and VEGF mRNA in HCT116 cells. There was a

trend for even higher levels when proteins were coexpressed (**P


24/41

24

Fig - RBM3 overexpression increases COX-2 mRNA stability and translation. (a) RBM3 is an ARE-

binding protein. The first 60 nucleotides of COX-2 3UTR containing many ARE sequences was

transcribed in vitro in the presence of 32P-UTP. Purified recombinant GST-RBM3 was allowed to

interact with the radiolabeled RNA and subsequently separated by native PAGE. Presence of the

RBM3 bound RNA is shown by a mobility shift as indicated to the right. (b) Increased binding of

COX-2, IL-8 and VEGF mRNA to RBM3 following overexpression. Whole cell extracts (T) from

vector transfected or RBM3 overexpressing cells were prepared after cross-linking, and subjecting to

immunoprecipitation with anti-RBM3 antibody. RNA present in the immunoprecipitate (P) and

supernatant (S) were isolated after reversing the cross-link and subjected to RTPCR for COX-2, IL-


25/41

25

8 and VEGF mRNA. Data demonstrates increased COX-2, IL-8 and VEGF mRNA in the pellet of

RBM3 overexpressing cells. (c) RBM3 and HuR increase COX-2, IL-8 and VEGF mRNA stability.

HCT116 cells were transfected with Flag epitope-tagged RBM3 and/or HuR and the stability of

endogenous transcripts was determined following addition of actinomycin D. Both RBM3 and HuR

increased COX-2 (left panel), IL-8 (middle panel) and VEGF (right panel) mRNA stability on theirown, which was further increased when the two were coexpressed. (d) Schematic representation of

control luciferase mRNA (Luc) and luciferase mRNA containing the full-length COX-2 3UTR

(Luc-COX) that is encoded in the plasmid under the control of the CMV promoter. (e) RBM3 and

HuR increase the translation of Luc mRNA containing COX-2 3UTR. HCT116 cells transiently

overexpressing RBM3, HuR or both were co-transfected with plasmids encoding either the Luc-

COX and luciferase activity was measured. Luciferase activity of Luc-COX is shown in black bars

and is relative to control cells. * denote statistically significant differences (**P


26/41

26

siRNA-mediated RBM3 knockdown reduced cell viability and finally led to cell death, which

did not involve caspase-3-mediated apoptosis, cell cycle arrest, or COX-2 regulation. In

contrast, RBM3 over-expression rescued cells from death under serum starvation. This was

associated with increased translation rates, as measured by C serine and H phenylalanine

incorporation. Together, RBM3 is a critical factor providing cellular survival advantages in anadverse microenvironment presumably by restoring translation efficacy(Wellmann S, et al.2010)

2.4. DISEASE CAUSED BY RBM-3 GENE

Breast Cancer

Breast cancer is by far the most frequent cancer in women. Surgery is the primary curative treatmentfor breast cancer patients, often in combination with adjuvant therapy. However, adjuvant therapy is

associated with substantial costs and sometimes severe side effects, and physicians have identified

reduction of overtreatment as the major clinical need in breast cancer treatment today. Thus, the

stratification of patients into different prognostic categories is of great importance as it may aid

physicians in selecting the most appropriate treatment for a given patient. RBM3 was identified on

the Human Protein Atlas (proteinatlas.org) where it shows a weak expression pattern in normal

breast tissue, but a stratified pattern in tumor samples (see Figure A). In a recent publication,3

RBM3 protein expression was evaluated in 241 tumor samples from a cohort of 500 premenopausal

women with stage II invasivebreast cancer (see Figure B). RBM3 expressionwas associated with

small, low-grade, estrogenreceptor (ER)-positive tumors, and it is anindependent predictor of

recurrence freesurvival (RFS) in ER-positive patients. It couldbe concluded that RBM3 is a good

prognosismarker in breast cancer.


27/41

27

Epithelial Ovarian Cancer

Epithelial ovarian cancer (EOC) is one of the most common forms of cancer worldwide, and a

leading cause of death from gynecological malignancy. Treatment with curative intent involves

surgery and postoperative platinum-based chemotherapy in combination with paclitaxel. However,

relapse is common, and side effects of platinum-based chemotherapy are severe. RBM3 protein

expression was evaluated in tumor samples from a cohort of 154 patients surgically treated for

primary invasive EOC.4 It was shown that RBM3 expression is weak in normal ovary tissue, butshows a stratified pattern in tumor samples (see Figure E). It could be concluded that RBM3 is a

prognostic marker that may aid physicians in determining which type of adjuvant treatment is

appropriate. This might mean a less intensive treatment for high-RBM3 patients with early-stage

cancer, and more intensive treatment for low-RBM3 patients (see Figure F).


28/41

28

Colon Cancer

Colorectal cancer is one of the most common types of cancer, and it accounts for about 10% of

cancer deaths in Europe and the USA. Surgery is the only curative treatment today, but metastatic

disease is common and this hampers successful treatment. Currently, patients with advanced disease

are routinely given chemotherapy as adjuvant treatment. RBM3 protein expression was evaluated in

274 tumor samples from a cohort of 331 retrospectively identified cases from patients who

underwent curative resection for sigmoid colon cancer (see Figure G) (manuscript in preparation).

Immunohistochemical analysis of RBM3expression showed a differential expression in colon tumor

samples (see Figure H). It could be concluded that RBM3 is a prognostic marker that may aid in

determining if patients should receive adjuvant treatment, and also the treatmentintensity level.


29/41

29


30/41

30

2.5. CONSERVE SEQUENCE

Transcript: RBM3-009

This transcript is a product of RBM3 gene .There are 12 transcripts in this gene.

.Transcript summary

It contains 8 exons & its transcript length is 1,375 bps. It is a Known type processed transcript. It has

been predicted from manually annotated transcripts (determined on a case-by-case basis) from

the Havana project.

Transcript summary

StatisticsIt contains 6 exons & its transcript length is 1,130 bps& translation length is 157 residues. It

is a Known type processed transcript. This transcript is a member of the Human CCDS (consensus

coding sequence) set: CCDS14301. It has been predicted from manually annotated transcripts

(determined on a case-by-case basis) from the Havana project.


31/41

31

Gene Tree (image)

Its a GeneTree of RBM3 gene. It contains 288 genes. Number of duplication nodes is 56& number

of ambiguous nodes15


32/41

32

Variation Table

Summary of variations in ENSG00000102317 (RBM3) by consequence type

Number of variants Type Description

2 Synonymous coding In coding sequence, not

resulting in an amino acid

change

(silent mutation)

3 Upstream Within 5 kb upstream of the 5

prime end of a transcript3 5 prime UTR In 5 prime untranslated region

11 Non-synonymous coding In coding sequence and results

in an amino acid change in

the encoded peptide sequence

14 Downstream Within 5 kb downstream of the

3 prime end of a transcript

15 Essential splice site In the first 2 or the last 2

basepairs of an intron

25 Splice site 1-3 bps into an exon or 3-8 bps

into an intron

36 3 prime UTR In 3 prime untranslated region

98 Within non-coding gene Located within a gene that does

not code for a protein

107 Intronic In intron

214 All All variants


33/41

33

2.6. HOMOLOGY OF RBM-3 GENE

Expression of RBM-3

On Northern blot analysis with a probe corresponding to nucleotides 200-794 (Sel 36) a major RNA

species of ~1.8 kb was observed in a wide variety of human adult and fetal tissues (fig.4). In

addition, a secondary transcript of ~3.0kb was also seen in all tissues along with weakly hybridizinglarger bands. Hybridization of this probe to a mouse tissue Northern blot identified a single band of

~1.6 kb indicating cross-species conservation of this RNP locus.

Fig4. expression of RBM3 in humans fetal tissues. The probe used was Sel36, a ~600bp cDNA.

The blot was stripped and re-probed with a beta-actin cDNA (bottom section). Positions of RNA size

standards in kb are indicated on the left.

Mapping & genomic of RBM3

As previously reported, STS content mapping of YACs from the Xp11.2 region has placed RBM3

b/w the OATL1 gene cluster & group of tightly linked genes defined by the GATA1 locus. Given

the complexity of cDNA isolated from the human fetal brain cDNA library however, we investigate

whether they were all derived from a single locus. Southern blot of YAC8 DNA & total human

genomic DNA, digested with HindIII&EcoRI&probd with Sel36, identified a single hybridizationband in YAC8 & an additional smaller band in total genomic DNA. Since the smaller band was not

seen in DNA from an X-only hybrid cell line, we located elsewhere in the genome. The structure of

the RBM3 gene contained within YAC8 was determined by PCR amplification & sequencing of

products from YAC8. The results indicate that RBM3 is split into at least nine exons that are

distributed over >4.5kb. when genomic seq. of individual exons amplified from YAC8 were


34/41

34

compared with the seq. of RBM3 cDNAs, it became apparent that the RNP gene with YAC8

encodes the isolated cDNA& that the variable forms are generated by alternative splicing.

Fig3. Alignment of the RNA binding domain of RBM3 with those of the proteins YRRM, RNP G

& AAIP. The positions of the conserved RNP1 & RNP2 motifs are indicated below, & those of the

seq. blocks A, 1, 2, & 4 above, the seq. alignment. Amino acids that are conserved b/w RBM3 & at

least two of the three other proteins are highlighted. The protein structure is taken from Burd and

Dreyfuss (Burd C.G et al. 1994).

2.7. Mechanism of RBM-3 gene regarding breast cancer

Single-strand RNA-binding proteins (RBPs) are involved in many aspects of RNA metabolism and

in the regulation of gene transcription (Sutherland LCet al. 2005&Burd CGet al. 1994). Reversible

binding of RBPs to RNA is accomplished through specific sequences within the proteins, such as the

RNA-recognition motif (RRM), RNA-binding motif (RBM), ribonucleoprotein motif (RNP),

the arginine-rich motif (ARM), the cold-shock domain (CSD) and many others(Burd CG et al.

1994). RBM proteins have been recognized as a specific subgroup of RRM/RBM/RNP containing

RBPs. Each of the 10 proteins designated as RBM proteins contain between 1 and 4 copies of the

RRM consensus sequence(Sutherland LC et al. 2005). The functional importance of the RRM

domain is suggested by its evolutionary conservation across species and by its presence in virtually

every organelle of the cell in which RNA is present (Sutherland LC et al. 2005).

Initially identified in a human fetal brain tissue cDNA library(Derry JM,et al. 1995), theRBM3 gene

maps to Xp11.23, and is one of three X-chromosome-related RBM genes


35/41

35

(RBMX,RBM3andRBM10). TheRBM3 gene encodes alternatively spliced transcripts, with the

longest reading frame encoding for a 157 amino-acid protein containing one RRM domain and a

glycine-rich region(Derry JM, et al. 1995). The RBM3 protein binds to both DNA and RNA(Wright

CFet al. 2001).

Although RBM proteins have been proposed to be a novel family of apoptosis regulators, the exact

function of RBM3 has yet to be fully elucidated.RBM3 transcripts have been found in various human

tissues (Derry JM, et al. 1995) and in vitro, RBM3 is one of the earliest proteins synthesized in

response to mild hypothermia(Danno Set al. 1997). A correlation between the X chromosome-

relatedRBMgenes (RBMX,RBM3 andRBM10) and the proapoptoticBax gene has been shown in

breast cancer(Martinez-Arribas Fet al. 2006).Downregulation ofRBM3 is associated with melanoma

progression(Baldi A et al. 2003); however, a recent report describedRBM3 as a proto-oncogene that

protects against mitotic catastrophe in colorectal cancer cell lines.Taken together, the role

ofRBM3 in the context of tumor initiation and progression in various cancer forms remains

unknown and, to date, no studies have addressed the role of tumor-specific RBM3 protein expression

in relation to disease outcome.

Using an antibody-based proteomics strategy, a comprehensive atlas of human protein expression

patterns has been generated through the Human Protein Atlas program

(http://www.proteinatlas.org)(Uhlen Met al. 2005 &Ponten Fet al. 2008). To date, more than 3000

antibodies (corresponding to more than 2600 different human proteins) have been screened in tissue

microarrays, representing 48 types of normal tissues, 216 human tumor samples representing the 20

most common forms of human cancer and 47 cell lines(Kampf Cet al. 2004 &Andersson ACet al.

2006), In addition to generating a map of protein expression patterns, this atlas can also be used as a

platform for the discovery of new diagnostic, prognostic and predictive cancer biomarkers. One such

candidate is RBM3, which, on the basis of its differential expression among the breast cancer

samples in the protein atlas was further evaluated in tissue microarrays constructed from two

independent breast cancer cohortsone consecutive cohort (n=512) and one cohort containingtumors from a randomized tamoxifen trial conducted in premenopausal women (n=500). The latter

cohort enabled assessment of the prognostic impact of RBM3 expression and also its potential value

as a predictor of response to tamoxifen treatment.


36/41

36

Cell Culture and Gene Silencing

The human breast cancer cell lines, MCF-7, MDA-MB-231, T47D, and the human immortalized

breast epithelial cell line MCF-10A were maintained under standard conditions. Transfection with

siRNA againstRBM3 (Applied Biosystems, Carlsbad, CA, USA) or control siRNA (Applied

Biosystems), was performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with a finalconcentration of 50nMsiRNA. Cells were harvested for protein or RNA recovery 48 and 72h

post transfection initiation. IHC was performed on cells after fixation in paraformaldehyde (4%),

dehydration and paraffin embedding.

RNA-binding proteins play a key role in post-transcriptional regulation of mRNA stability and

translation. We have identified that RBM3, a translation regulatory protein, is significantly

upregulated in human tumors, including a stage-dependent increase in colorectal tumors. Forced

RBM3 overexpression in NIH3T3 mouse fibroblasts and SW480 human colon epithelial cells

increases cell proliferation and development of compact multicellular spheroids in soft agar

suggesting the ability to induce anchorage-independent growth. In contrast, downregulating RBM3

in HCT116 colon cancer cells with specific siRNA decreases cell growth in culture, which was

partially overcome when treated with prostaglandin E2, a product of cyclooxygenase (COX)-2

enzyme activity. Knockdown also resulted in the growth arrest of tumor xenografts. We have also

identified that RBM3 knockdown increases caspase-mediated apoptosis coupled with nuclear cyclin

B1, and phosphorylated Cdc25c, Chk1 and Chk2 kinases, implying that under conditions of RBM3

downregulation, cells undergo mitotic catastrophe. RBM3 enhances COX-2, IL-8 and VEGF mRNA

stability and translation. Conversely, RBM3 knockdown results in loss in the translation of these

transcripts. These data demonstrate that the RNA stabilizing and translation regulatory protein

RBM3 is a novel proto-oncogene that induces transformation when overexpressed and is essential

for cells to progress through mitosis.


37/41

37

Chapter 3

Discussion & Conclusion


38/41

38

3.0. Discussion & Conclusion

The gene and its protein, both called RBM3, are vital for normal cell division. RBM3, a ubiquitously

expressed serine- and glycine-rich protein, is a protooncogene that binds to COX-2 ARE and

regulates COX-2 mRNA stability and translation (Dannoet al., 1997). RBM3 level is upregulated in

human tumors, and expressing the protein in non-transformed cells induces the cells to grow in an

anchorage-independent manner.Moreover, there is an increase in apoptosis and activation of

checkpoint-related proteins that enhance cell cycle progression at the level of mitosis suggesting

mitotic catastrophe. Furthermore, downregulatingIn tumors, however, low oxygen levels causes the

amount if this protein to go up dramatically. This causes cancer cells to divide uncontrollably,

leading to increased tumor formation. Powerful new technology was used to genetically silence

the protein and reduce the level of RBM3 in cancer cells. The approach stopped the tumor from

growing and led to the cell death. This new technique has now been tested successful in severaltypes of cancer models such as breast, pancreas, colon, lung, ovarian and prostate. Most cancer are

thought to come from mutation in genes, but this discovery shows for the first time that too much of

the RBM3 protein can cause normal cells to turn into cancer cells. The RBM3 protein was found in

every stage of many cancers and the amount of protein increased as the cancer grew. The protein

helped the cancer grow faster, avoid cell death (apoptosis) and was also part of the process that

formed new blood vessels to feed the tumor, a process known as angiogenesis. Angiogenesis is

essential for tumor growth and its new data suggests that targeting RBM3 may be a useful tool

against cancer. Its one thing to

demonstrate success in lab though the

proof of the pudding is what happens in

real life. The next step is, therefore

designing suitable agents to inhibit the

activity of RBM3 and clinical trails may

begin within 5 years.


39/41

39

References


40/41

40

y Andersson AC, Stromberg S, Backvall H, et al. Analysis of protein expression in cellmicroarrays: a tool for antibody-based proteomics. J HistochemCytochem 2006;54:14131423.

y Baldi A, Battista T, De Luca A, et al. Identification of genes down-regulated during

melanoma progression: a cDNA array study.ExpDermatol2003;12:213218.

y Burd CG, Dreyfuss G. Conserved structures and diversity of functions of RNA-binding

proteins. Science 1994;265:615621.

y Chappell SA, Owens GC, Mauro VP. A 5 Leader of Rbm3, a Cold Stress-induced mRNA,

Mediates Internal Initiation of Translation with Increased Efficiency under Conditions of

Mild Hypothermia. The JournalofBiological Chemistry. 2001;276(40):36917-36922.

y Danno S, Nishiyama H, Higashitsuji H, et al. Increased transcript level of RBM3, a member

of the glycine-rich RNA-binding protein family, in human cells in response to cold stress.

Biochemical andBiophysical Research Communications. 1997;236(3):804-807.

y Derry JM, Kerns JA, Francke U. RBM3, a novel human gene in Xp11.23 with a putativeRNA-binding domain.Hum Mol Genet1995;4:23072311.

y Derry JM, Kerns JA, Francke U. RBM3, a novel human gene in Xp11.23 with a putative

RNA-binding domain.Human MolecularGenetics. 1995;4(12):2307-2311.

y Derry JM. Kerns JA. Francke U. Howard Hughes Medical Insitute, Stanford University

Medical Center, CA 94305, USA

y Dresios J, Aschrafi A, Owens GC, et al. Cold stress-induced protein Rbm3 binds 60S

ribosomal subunits, alters microRNA levels, and enhances global protein synthesis.

Proceedings of the National Academy of Sciences of the United States of America.

2005;102(6):1865-1870.

y Dupont-Versteegden EE, Nagarajan R, Beggs ML, et al. Identification of cold-shock protein

RBM3 as a possible regulator of skeletal muscle size through expression profiling. American

journal of physiolog y Regulatory integrative and comparative physiology.

2008;295(4):R1263-R1273.

y Ehln , Brennan DJ, Nodin B, et al. Expression of the RNA-binding protein RBM3 is

associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer.JournalofTranslational Medicine. 2010;8:78.

y Hubert Hackl et al. Genome Biology 2005, 6:R108. doi:10.1186/gb-2005-6-13-r108.

y Jgi A, Brennan DJ, Rydn L, et al. Nuclear expression of the RNA-binding protein RBM3

is associated with an improved clinical outcome in breast cancer. Modernpathology an


41/41

official journal of the United States and Canadian Academy of Pathology Inc.

2009;22(12):1564-1574.

y Kampf C, Andersson AC, Wester K, et al. Antibody-based tissue profiling as a tool forclinical proteomics. Clinical Proteomics 2004;1:285299.

y Lleonart ME. A new generation of proto-oncogenes: cold-inducible RNA binding proteins.

BiochimicaetBiophysicaActa. 2010;1805(1):43-52.

y Martinez-Arribas F, Agudo D, Pollan M, et al. Positive correlation between the expression of

X-chromosome RBM genes (RBMX, RBM3, RBM10) and the proapoptoticBax gene in

human breast cancer.J Cell Biochem 2006;97:12751282.

y Markus Thiersch et al., BMC Genomics 2008, 9:73 doi:10.1186/1471-2164-9-73.

y Ponten F, Jirstrom K, Uhlen M. The Human Protein Atlasa tool for pathology. J Pathol

2008;216:387393.

y Stadler LJ. The gene. Society. 2010;134(874):1-37.

y Sureban SM, Ramalingam S, Natarajan G, et al. Translation regulatory factor RBM3 is a

proto-oncogene that prevents mitotic catastrophe. Oncogene. 2008;27(33):4544-4556.

y Sutherland LC, Rintala-Maki ND, White RD, et al. RNA binding motif (RBM) proteins: anovel family of apoptosis modulators? J Cell Biochem 2005;94:524.

y Uhlen M, Bjorling E, Agaton C, et al. A human protein atlas for normal and cancer tissuesbased on antibody proteomics.Mol Cell Proteomics 2005;4:19201932.

y Wanling Yang, et al. BMC Genomics 2008, 9:456 doi:10.1186/1471-2164-9-456.

y Wang H, Liu Y, Briesemann M, Yan J. Computational analysis of gene regulation in animal

sleep deprivation.Physiological Genomics. 2010;42(3):427-436.

y Wellmann S, Truss M, Bruder E, et al. The RNA-binding protein RBM3 is required for cell

proliferation and protects against serum deprivation-induced cell death. Pediatric Research.

2010;67(1):35-41.

y Wellmann S, Bhrer C, Moderegger E, et al. Oxygen-regulated expression of the RNA-

binding proteins RBM3 and CIRP by a HIF-1-independent mechanism. Journal ofCell

Science. 2004;117(Pt 9):1785-1794.

y Wright CF, Oswald BW, Dellis S. Vaccinia virus late transcription is activated invitro bycellular heterogeneous nuclear ribonucleoproteins.J BiolChem 2001;276:4068040686.

y Zeng Y, Kulkarni P, Inoue T, Getzenberg RH. Down-regulating cold shock protein genes

impairs cancer cell survival and enhances chemosensitivity. Journal of Cellular

Biochemistry. 2009;107(1):179-188.

role of rbm3 gene in cancer

Documents