rules proposals for the international rules for seed ...€¦ · centrosema pubescens benth....

International Seed Testing Association

Secretariat, Zürichstrasse 50, CH-8303 Bassersdorf, Switzerland Phone: +41 44 838 60 00 Fax: +41 44 838 60 01 Email: [email protected] - http://www.seedtest.org

Document OGM13-05

OGM13-05 Proposed Changes to the ISTA Rules Edition 2014 2013-04-12 12:40 Approved by ECOM and RUL on 3 April 2013 /106

Rules Proposals for the International Rules for Seed Testing 2014 Edition

This document was prepared by the Technical Committees and the Rules Committee

of the Association and has been endorsed by the ISTA Executive Committee. The

proposals are submitted to the ISTA Ordinary Meeting 2013 for voting by the

nominated ISTA Designated Members on behalf of their respective Governments.

It is submitted to all ISTA Designated Authorities, ISTA Members and ISTA

Observer Organizations for information two months prior to the ISTA Ordinary

Meeting 2013.

It contains proposed amendments and changes for the ISTA International Rules for

Seed Testing and will be discussed and voted on at the Ordinary Meeting 2013 to be

held on Tuesday, June 18, 2013 in Antalya, Turkey under Agenda point 11.

Consideration and Adoption of the Proposed Rules Changes.


Introduction to the ISTA Rules Proposals to become effective 1 January 2014 The current version of the ISTA International Rules for Seed Testing is the 2013

edition. Single copies of replacement pages and front covers for the 2013 edition

have been sent free to all ISTA Member Laboratories. Extra copies are available for

purchase from the ISTA Publications section. As the Rules are an evolving

document, it is worth remembering that pages can be headed with different

‘effective from’ dates. The Preface for each edition includes details of changes and

when replacement pages were issued. Previous Prefaces as a ‘history of changes’ are

available on the ISTA website.

The ISTA Rules are the result of the work of the various ISTA Technical

Committees with input from many different sources. Thanks go to all the Technical

Committee members and the ISTA Secretariat for their help with this year’s

proposals.

The following Rules Proposals will be discussed at the ISTA Ordinary Meeting in

Antalya, Turkey in June 2013 and may be amended during the meeting. If the

proposals are accepted by the membership, Amendments will be issued, and they

will become the 2014 edition of the ISTA Rules.

Please let me know about any problems with these proposals.

Many thanks.

Steve Jones

Chair of Rules Committee

Contact details:

Dr Steve Jones

Canadian Food Inspection Agency

Seed Science and Technology Section

301–421 Downey Road

Saskatoon, SK, S7N 4L8

Canada

Phone: +1 306 975 6505

Fax: +1 306 975 6450

E-mail: [email protected]

Key to text changes :

Deleted text

New text

New text in large blocks, not underlined for ease of reading

Any changes made after proposals published to the membership

mailto:[email protected]


Contents

PART A. INTRODUCTION OF EDITORIAL CHANGES 5

A.1. Editorial corrections 5

PART B. NEW SPECIES AND CHANGES TO SPECIES NAMES 6

B.1. Addition of new species to Table 2A. 6

B.2. Changes to the ISTA Stabilized list affecting names used in

the ISTA Rules 6

1. Changes to species names 6

2. Changes to assignments of genera to families 9

PART C. RULES CHANGES AND NEW METHODS REQUIRING A VOTE 11

Chapter 1: Certificates 11

C.1.1. Changes to reporting for the tetrazolium test results for coated seed, seed

tapes and mats. 11

C.1.2. Inclusion of reporting requirements for tetrazolium testing of seed mixtures

Chapter 18. 11

C.1.3. Inclusion of reporting requirements for new Chapter 19. 11

Chapter 2: Sampling 12

C.2.1. Storage of samples after testing 12

C.2.2. Changes to the minimum submitted sample sizes of coated seeds 13

C.2.3. Consequential changes affecting Chapter 11: Testing of Coated Seeds 14

C.2.4. Consequential changes affecting Chapter 16: Rules for size and grading of

seeds 15

Chapter 3: The Purity Analysis 16

C.3.1. Adding the use of an anemometer for the uniform blowing method 16

Chapter 5: The Germination Test 21

C.5.1. Harmonisation on seedling evaluation in respect to the evaluation of the

cotyledons (50% rule) 21

C.5.2. Growing media for germination test. 23

C.5.3. List of seedling abnormalities 24

C.5.4. Change required due to moving genus Arachis from PSD 11 to PSD 21 25

C.5.5. Duration of germination test for certain grass species 26

C.5.6. Modification to 5.6.4 to add clarity 27

Chapter 6: Biochemical Test for Viability. The Topographical

Tetrazolium Test. 28

C.6.1. Amended explanation for testing Helianthus and Bracharia species . 28

Annex to Chapter 7: Seed Health Testing Methods 29

C.7.1. Changes to existing seed health methods to provide a uniform approach 29

C.7.2. Modification to existing seed health method 34

7-028: Detection of infectious tobamoviruses on Lycopersicon esculentum (tomato)

by the local lesion assay (indexing) on Nicotiana tabacum plants 34



7-019b: Detection of Xanthomonas campestris pv. campestris on Brassica spp.

disinfested/disinfected seed 37


7-021: Detection of Xanthomonas axonopodis pv. phaseoli and Xanthomonas

axonopodis pv. phaseoli var. fuscans on Phaseolus vulgaris (Bean) seed 49

C.7.5. New seed health method 56

7-029: Detection of Pseudomonas syringae pv. pisi on Pisum sativum (Pea) seed 56

C.7.6. New seed health method 65

7-007: Detection of Alternaria linicola, Botrytis cinerea and Colletotrichum lini

on Linum usitatissimum (Flax) seed 65

Chapter 8: Species and Variety Testing 74

C.8.1. Editorial and Committee review of the whole of Chapter 8. 74

C.8.2. New improved A-PAGE method for the verification of Triticum 85

C.8.3. New SDS-PAGE method for the verification of Triticum and xTriticosecale

varieties 90

Chapter 11: Testing Coated Seeds 93

C.11.1 Testing methods and reporting for the tetrazolium test for coated seeds 93

Chapter 18: Seed Mixtures 95

C.18.1. Testing methods and reporting for the tetrazolium test for seed mixtures 95

Chapter 19: Testing for Seeds of Genetically Modified Organisms

96

C.19.1. New Chapter for the ISTA Rules 96


PART A. INTRODUCTION OF EDITORIAL CHANGES

A.1. Editorial corrections

General editorial corrections

- Since the 2014 ISTA Rules will be completely reissued, the current “effective

from” dates will all be re-set to 1 January 2014.

- All marks which indicate changes from the previous edition will be removed,

except for the latest changes made for the 2014 edition.

- The English version of the 2014 ISTA Rules will be in A4 format.

- Wherever ‘shall’ is used it will be replaced with ‘must’, if that is the intent, or

where it makes grammatical sense.

- References to old family names (e.g. Compositae, Gramineae) will be deleted.

- The Seed Health Methods, currently referred to as “Annexe to Chapter 7”, will

now be part of Chapter 7.

- In all Seed Health Methods, the phrase ‘sponsored by’ will be amended to

‘prepared by’ together with details of the organization which organized the

comparative test. Prepared by is also used to list the authors so in this case

prepared by will be replaced by Authors. The citation for ISHI-Veg will be

updated to International Seed Health Initiative-Vegetables, ISF (ISHI-Veg).

- In all Seed Health Methods, standardise the way the equation for TSW is

presented as:

TSW = (weight of seeds / numbers of seeds) x 1000

CURRENT VERSION PROPOSED VERSION

1.5.2.2. Purity

3.7 Reporting results

§5… (e.g. Elytrigium repens).

1.5.2.2. Purity


§5… (e.g. Elytrigia repens).


Table 6A Part 1. Agricultural and horticultural seeds

Lactuca spp., column 7:

⅓ radicle, measured from radicle tip; ½

of distal end of cotyledons,if superficial;

⅓ at distal end, if pervading

⅓ radicle, measured from radicle tip; ½

of distal end of cotyledons,if superficial;

⅓ at distal end, if pervasive

ACCEPTED BY APPLAUSE RESULT


PART B. NEW SPECIES AND CHANGES TO SPECIES NAMES

B.1. Addition of new species to Table 2A.

None this year.

B.2. Changes to the ISTA Stabilized list affecting names used in

the ISTA Rules

The ISTA Stabilized List is updated every 6 years as a result of discussion within

the ISTA Nomenclature Committee. The following items have been taken from the

document “Proposed Changes to the ISTA List of Stabilized Plant Names” prepared

on 1 November 2012. The items of that document have been considered and

approved by the ISTA Nomenclature Committee, and the document will be

submitted to the ISTA Executive Committee for voting at the ISTA Ordinary

Meeting 2013. Only those items from this document that affect the 2014 ISTA Rules

are detailed here.

The changes below show the changes to species names as they will appear in Table

2A. References to older changes to species names will be removed.

Other tables and references to species names will be amended accordingly.

Once accepted by vote at the Annual General Meeting, the Stabilised List can come

into effect on 1 January 2014, to be consistent with the 2014 ISTA Rules, which also

come into effect on 1 January 2014.

The following proposal was developed and approved by a vote of the Nomenclature

Committee.

1. Changes to species names

a. Agricultural and vegetable


Andropogon gerardii Vitman Andropogon gerardi Vitman

Bromus marginatus Nees ex Steud. Bromus marginatus Steud.

Cajanus cajan (L.) Millsp. Cajanus cajan (L.) Huth

Centrosema pubescens Benth. (Centrosema pubescens Benth. see

Centrosema molle Mart. ex Benth.)

Centrosema molle Mart. ex Benth.

(previously Centrosema pubescens

Benth.)

Dichondra repens J. R. Forst & G. Forst. (Dichondra repens J. R. Forst. & G.

Forst. see Dichondra micrantha Urb.)

Dichondra micrantha Urb. (previously

Dichondra repens J. R. Forst. & G.

Forst.)

Lolium ×boucheanum Kunth (Lolium ×boucheanum Kunth see

Lolium ×hybridum Hausskn.)

Lolium ×hybridum Hausskn. (previously

Lolium ×boucheanum Kunth)

Lotononis bainesii Baker (Lotononis bainesii Baker see Listia

bainesii (Baker) B.-E. van Wyk &

Boatwr.)

Listia bainesii (Baker) B.-E. van Wyk &

Boatwr. (previously Lotononis bainesii

Baker)

Lycopersicon esculentum Mill. (Lycopersicon esculentum Mill. see

Solanum lycopersicum L.)

Solanum lycopersicum L. (previously

Lycopersicon esculentum Mill.)



Lycopersicon hybrids (Lycopersicon hybrids see Solanum

(sect. Lycopersicon) hybrids)

Solanum (sect. Lycopersicon) hybrids

(previously Lycopersicon hybrids)

Lycopersicon spp. (Lycopersicon spp. see Solanum (sect.

Lycopersicon) spp.)

Solanum (sect. Lycopersicon) spp.

(previously Lycopersicon spp.)

Pascopyrum smithii (Rydb.) Á. Löve Pascopyrum smithii (Rydb.) Barkworth

& D. R. Dewey

Paspalum wettsteinii Hack. (Paspalum wettsteinii Hack. see

Paspalum virgatum L.)

Paspalum virgatum L. (previously

Paspalum wettsteinii Hack.)

Petroselinum crispum (Mill.) Nyman ex

A. W. Hill

Petroselinum crispum (Mill.) Fuss

b. Tree and shrub


Cupressus macrocarpa Hartw. ex

Gordon

Cupressus macrocarpa Hartw.

Eucalyptus citriodora Hook. (Eucalyptus citriodora Hook. see

Corymbia citriodora (Hook.) K. D. Hill

& L. A. S. Johnson)

Corymbia citriodora (Hook.) K. D. Hill

& L. A. S. Johnson (previously

Eucalyptus citriodora Hook.)

Eucalyptus ficifolia F. Muell. (Eucalyptus ficifolia F. Muell. see

Corymbia ficifolia (F. Muell.) K. D. Hill

& L. A. S. Johnson)

Corymbia ficifolia (F. Muell.) K. D. Hill


Eucalyptus ficifolia F. Muell.)

Eucalyptus maculata Hook. (Eucalyptus maculata Hook. see

Corymbia maculata (Hook.) K. D. Hill

& L. A. S. Johnson)

Corymbia maculata (Hook.) K. D. Hill


Eucalyptus maculata Hook.)

Mahonia aquifolium (Pursh) Nutt. (Mahonia aquifolium (Pursh) Nutt. see

Berberis aquifolium Pursh)

Berberis aquifolium Pursh (previously

Mahonia aquifolium (Pursh) Nutt.)

Pinus heldreichii H. Christ Pinus heldreichii Christ

Pinus patula Schiede ex Schltdl. &

Cham.

Pinus patula Schltdl. & Cham.

Pinus ponderosa C. Lawson Pinus ponderosa P. Lawson & C.

Lawson

c. Flower, spice, herb and medicinal


Armeria maritima Willd. Armeria maritima (Mill.) Willd.

Asparagus densiflorus (Kunth) Jessop (Asparagus densiflorus (Kunth) Jessop

see Asparagus aethiopicus L.)



Asparagus aethiopicus L. (previously

Asparagus densiflorus (Kunth) Jessop)

Asparagus setaceus (Kunth) Jessop (Asparagus setaceus (Kunth) Jessop see

Asparagus plumosus L.)

Asparagus plumosus L. (previously

Asparagus setaceus (Kunth) Jessop)

Centaurea americana Nutt. (Centaurea americana Nutt. see

Plectocephalus americana (Nutt.) D.

Don)

Plectocephalus americana (Nutt.) D.

Don (previously Centaurea americana

Nutt.)

Centaurea dealbata Willd. (Centaurea dealbata Willd. see

Psephellus dealbatus (Willd.) K. Koch)

Psephellus dealbatus (Willd.) K. Koch

(previously Centaurea dealbata Willd.)

Cnicus benedictus L. (Cnicus benedictus L. see Centaurea

benedicta (L.) L.)

Centaurea benedicta (L.) L. (previously

Cnicus benedictus L.)

Coleus blumei Benth. (Coleus blumei Benth. see Plectranthus

scutellarioides (L.) R. Br.)

Plectranthus scutellarioides (L.) R. Br.

(previously Coleus blumei Benth.)

Cymbalaria muralis P. Gaertn. et al. Cymbalaria muralis G. Gaertn. et al.

Geranium hybrids* Geranium hybrids

Gerbera jamesonii Bolus ex Hook. f. Gerbera jamesonii Adlam

Helichrysum bracteatum (Vent.)

Andrews

(Helichrysum bracteatum (Vent.)

Andrews see Xerochrysum bracteatum

(Vent.) Tzvelev)

Xerochrysum bracteatum (Vent.)

Tzvelev (previously Helichrysum

bracteatum (Vent.) Andrews)

Helipterum humboldtianum (Gaudich.)

DC.

(Helipterum humboldtianum (Gaudich.)

DC. see Rhodanthe humboldtiana

(Gaudich.) Paul G. Wilson)

Rhodanthe humboldtiana (Gaudich.)

Paul G. Wilson (previously Helipterum

humboldtianum (Gaudich.) DC.)

Helipterum manglesii (Lindl.) F. Muell.

ex Benth.

(Helipterum manglesii (Lindl.) F. Muell.

ex Benth. see Rhodanthe manglesii

Lindl.)

Rhodanthe manglesii Lindl. (previously

Helipterum manglesii (Lindl.) F. Muell.

ex Benth.)

Helipterum roseum (Hook.) Benth. (Helipterum roseum (Hook.) Benth. see

Rhodanthe chlorocephala (Turcz.) Paul

G. Wilson)

Rhodanthe chlorocephala (Turcz.) Paul

G. Wilson (includes Helipterum roseum

(Hook.) Benth.)

Kochia scoparia (L.) Schrad. (Kochia scoparia (L.) Schrad. see Bassia

scoparia (L.) A. J. Scott)

Bassia scoparia (L.) A. J. Scott

(previously Kochia scoparia (L.)

Schrad.)



Leontopodium alpinum Cass. (Leontopodium alpinum Cass. see

Leontopodium nivale (Ten.) Hand.-

Mazz.)

Leontopodium nivale (Ten.) Hand.-

Mazz. (previously Leontopodium

alpinum Cass.)

Lobelia fulgens Willd. Lobelia fulgens Humb. & Bonpl. ex

Willd.

Lupinus hybrids* Lupinus hybrids

Matricaria recutita L. (Matricaria recutita L. see Matricaria

chamomilla L.)

Matricaria chamomilla L. (previously

Matricaria recutita L.)

Myosotis hybrids* Myosotis hybrids

Petunia ×hybrida hort. ex E. Vilm. (Petunia ×hybrida hort. ex E. Vilm. see

Petunia ×atkinsiana (Sweet) D. Don ex

W. H. Baxter)

Petunia ×atkinsiana (Sweet) D. Don ex

W. H. Baxter (previously Petunia

×hybrida hort. ex E. Vilm.)

Scabiosa caucasica M. Bieb. (Scabiosa caucasica M. Bieb. see

Lomelosia caucasica (M. Bieb.) Greuter

& Burdet)

Lomelosia caucasica (M. Bieb.) Greuter

& Burdet (previously Scabiosa

caucasica M. Bieb.)

Senecio cineraria DC. (Senecio cineraria DC. see Jacobaea

maritima (L.) Pelser & Meijden)

Jacobaea maritima (L.) Pelser &

Meijden (previously Senecio cineraria

DC.)

Senecio cruentus (Masson ex L’Hér.)

DC.)

(Senecio cruentus (Masson ex L’Hér.)

DC. see Pericallis cruenta (Masson ex

L’Hér.) Bolle)

Pericallis cruenta (Masson ex L’Hér.)

Bolle (previously Senecio cruentus

(Masson ex L’Hér.) DC.)

Sinningia speciosa (G. Lodd.) Hiern Sinningia speciosa (Lodd. et al.) Hiern

Solanum diflorum Vell. (Solanum diflorum Vell. see Solanum

pseudocapsicum L.)

. Solanum pseudocapsicum L. (previously

Solanum diflorum Vell.)

Tripleurospermum perforatum (Mérat)

M. Laínz

(Tripleurospermum perforatum (Mérat)

M. Laínz see Tripleurospermum

inodorum (L.) Sch. Bip.)

Tripleurospermum inodorum (L.) Sch.

Bip. (previously Tripleurospermum

perforatum (Mérat) M. Laínz)

2. Changes to assignments of genera to families


a. Agricultural and vegetable

Claytonia Portulacaceae Montiaceae

b. Tree and shrub

Cryptomeria Taxodiaceae Cupressaceae



Liquidambar Hamamelidaceae Altingiaceae

Nothofagus Fagaceae Nothofagaceae

Sequoia Taxodiaceae Cupressaceae

Sequoiadendron Taxodiaceae Cupressaceae

Taxodium Taxodiaceae Cupressaceae

c. Flower, spice, herb and medicinal

Asclepias Asclepiadaceae Apocynaceae

Cleome Capparaceae Cleomaceae

Nemophila Hydrophyllaceae Boraginaceae

Phacelia Hydrophyllaceae Boraginaceae

Pholistoma Hydrophyllaceae Boraginaceae


2.8 Tables for lot size and sample

sizes

Table 2A

… the 2007 ISTA Congress …

… to 2007 Congress changes; …

2.8 Tables for lot size and sample

sizes

Table 2A

… the 2013 ISTA Congress …

… to 2013 Congress changes; …

VOTE TO ACCEPT ITEM YES VOTES NO VOTES RESULT

B.2


PART C. RULES CHANGES AND NEW METHODS REQUIRING A VOTE

Chapter 1: Certificates

C.1.1. Changes to reporting for the tetrazolium test results for

coated seed, seed tapes and mats.

New text for reporting Tetrazolium test resuts for coated seed, seed mats and seed

tapes, see proposal under Chapter 11.

Note not for voting now but for reference only.

See after Chapter 11 for voting.

C.1.2. Inclusion of reporting requirements for tetrazolium testing

of seed mixtures Chapter 18.

Changes to Chapter 1 are required due the acceptance of the text for Tetrazolium

testing of seed mixtures in Chapter 18. See voting record following proposal C.18.1.



C.1.3. Inclusion of reporting requirements for new Chapter 19.

Changes to Chapter 1 are required due the acceptance of the new Chapter 19 in the

ISTA Rules. See voting record following proposal C.19.1.




Chapter 2: Sampling

C.2.1. Storage of samples after testing

The storage time of submitted samples is proposed to be moved from 2.5.4.6 to

2.5.3. As a consequence the storage time should be applied also to the submitted

samples on which ISTA Blue Certificates have been issued. Also due to practical

reasons it is proposed that the storage time of one year should be counted from the

receipt of samples and not from the issuance of ISTA Certificates.

It is also proposed that in the cases where storage time of one year is expected to

affect test results though samples are preserved in appropriate conditions the

requirement of storage time of one year is not a requirement for moisture proof

containers and samples of recalcitrant or intermediate species.

The following proposal was developed by the Bulking and Sampling Committee and

has been discussed with the Moisture and Storage Committees. This proposal has

been approved by a vote of the Bulking and Sampling Committee.


2.5.3. Storage of samples after testing

… Protection against insects and rodents

may be necessary.

2.5.3. Storage of samples after testing

… Protection against insects and rodents

may be necessary.

To provide for re-testing by the original

or by another seed testing laboratory,

samples on which ISTA Certificates

have been issued must be stored at least

for one year from the receipt of the

sample. Submitted samples in moisture

proof containers, and samples of

recalcitrant or intermediate species, must

be stored under appropriate conditions

for as long as it can be expected that the

results of a re-test are not affected by the

storage.

When a re-test in a different testing

laboratory is required, a portion shall be

drawn from the stored sample in

accordance with 2.5.2.2, and submitted

to the designated laboratory. The

remainder shall be retained in store.

…

When a re-test in a different testing

laboratory is required, a portion must be

drawn from the stored sample in

accordance with 2.5.2.2, and submitted

to the designated laboratory. The

remainder must be retained in store.

…

2.5.4.6 Storage of submitted samples

after testing

To provide for re-testing by the original

or by another seed testing laboratory,

submitted samples on which ISTA

Certificates have been issued shall be

stored for one year from the date of issue

of the certificate. Only in the case of

very expensive seeds …

2.5.4.6 Storage of submitted samples

after testing

Submitted samples on which ISTA

Certificates have been issued must be

stored. Only in the case of very

expensive seeds …


C.2.1


C.2.2. Changes to the minimum submitted sample sizes of coated

seeds

Bulking and Sampling Committee (BSC) proposes that the minimum submitted

sample sizes of coated seeds are decreased.

In the current Rules the requirements for submitted sample sizes are inconsistent

between non-coated seeds and coated seeds. For non-coated seeds the submitted

sample size can be equal to the working sample size for purity (i.e. to be 2500 seeds)

if determination of other seeds by number is not requested. This is not possible for

coated seeds. In the current Rules the submitted sample size for coated seeds is

always 7500 seeds for purity and germination tests though e.g. the minimum

working sample size for purity test is 2500 seeds.

For coated seeds, the submitted samples shall contain at least the number of pellets

or seeds indicated in column 2 of Table 2B Part 1 and 2.

A survey was sent to six laboratories. Five laboratories were of the opinion that

sample sizes can be decreased and one laboratory hesitated due to possible

heterogeneity in seed lots. However, according to the opinion of the BSC possible

heterogeneity problem should be smaller in coated seeds than in non-coated seeds

and on the otherhand the submitted sample size does not solve heterogeneity

problems.

The following proposal was therefore developed by the Bulking and Sampling

Committee and approved by a vote.


2.5.4.4 Submitted sample

Minimum size of submitted samples are

as follows:

a) For moisture determination, 100 g for

species that have to be ground (see

Table 9A) and 50 g for all other species.

When moisture meters are to be used for

testing, a larger sample size may be

necessary. Contact the ISTA seed testing

laboratory for specific instructions.

2.5.4.4 Submitted sample

The minimum size of submitted samples

are as follows:

a) For moisture determination, 100 g for

species that must be ground (see Table

9A) and 50 g for all other species. When

moisture meters are to be used for

testing, a larger sample size may be

necessary. Contact the ISTA seed testing

laboratory for specific instructions.

b)… b)…

c) For all other tests, at least the weight

prescribed in column 3 of Table 2A. As

long as a determination of other seeds by

number is not requested, the submitted

sample shall weigh at least the amount

indicated for the working sample for

purity analysis in column 4 of Table 2A.

In the case of coated seeds, the

submitted samples shall contain not less

than the number of pellets or seeds

indicated in column 2 of Table 2B, Part

1 and Part 2.

c) For all other tests, at least the weight

prescribed in column 3 of Table 2A. As

long as a determination of other seeds by

number is not requested, the submitted

sample must weigh at least the amount

indicated for the working sample for

purity analysis in column 4 of Table 2A.

In the case of coated seeds, the

submitted samples must contain not less

than the number of pellets or seeds

indicated in column 2 of Table 2B, Part

1 and Part 2. As long as a determination

of other seed by number or size grading

is not requested, the submitted sample

need only contain as a minimum, the

number of seeds indicated for the

working sample for purity analysis in

column 3 of Table 2B Parts 1 and 2.

If the submitted sample is smaller than

prescribed, …

If the submitted sample is smaller than

prescribed, …


Table 2B Part 1. Sample sizes (number of seeds) for pelleted seeds, encrusted seed

and seed granules

Determinations Minimum

submitted

sample

Minimum

working

sample

Purity analysis (including verification of species) 2500 2500

Weight determination 2500 Pure pellet

fraction

Germination 2500 400

Determination of other seeds 10000 7500

Determination of other seeds (encrusted seeds and

seeds granules)

25000 25000

Size grading 5000 1000

Table 2B Part 2. Sample sizes (number of seeds) for seed tapes and mats

Determinations Minimum submitted

sample

Minimum working

sample

Verification of species 300 100


Purity analysis (if required) 2500 2500

Determination of other

seeds

10000 7500

C.2.3. Consequential changes affecting Chapter 11: Testing of

Coated Seeds

In the Chapter 11: Testing of Coated Seeds there are Tables 11A and 11B that are

copies of the Tables 2B Part 1 and Part 2. In the case that the proposal concerning

Tables 2B Part 1 and Part 2 is accepted then also Tables 11A and 11B should be

changed.

Table 11A. Sample sizes of pelleted seeds in number of pellets.

Note: this table is a copy of Table 2B Part 1

Determinations Minimum

submitted sample

Minimum working

sample

Purity analysis (including verification of

species)

2500 2500

Weight determination 2500 Pure pellet

fraction


Determination of other seeds 10000 7500

Determination of other seeds (encrusted

seeds and seeds granules)

25000 25000

Size grading 5000 1000


Table 11A. Sample sizes of seed tapes

Note: this table is a copy of Table 2B Part 2

Determinations Minimum submitted

sample

Minimum working

sample

Verification of species 300 100


Purity analysis (if required) 2500 2500

Determination of other

seeds

10000 7500


C.2.3

C.2.4. Consequential changes affecting Chapter 16: Rules for size

and grading of seeds

Current Rules for size grading of seeds for Beta seeds and pelleted seeds indicate the

same working sample weights (two samples of 50 grams) regardless of seed species

or coating material. In Chapter 16 there is no reference to Chapter 2, Table 2B Part 1

where the submitted sample and working sample sizes for coated seeds are

described.

The following proposal was developed by the Bulking and Sampling Committee and

approved by a vote.


16.1 For Beta seeds and pelleted seeds

The control of size grading is carried out

on a sample, weighing at least 250g,

which must be sent must be sent to the

testing laboratory in an airtight

container. Two working samples of

about 50 g (not less than 45g and not

more than 55g) each are used. Each

sample is subjected to a screening

analysis.

….

16.1 For Beta seeds and pelleted seeds

The control of size grading is carried out

on a sample, weighing at least 250g or

for pelleted seeds, a sample consisting of

the number of seeds indicated in the

Table 2B Part 1. The sample must be

sent to the testing laboratory in an

airtight container. Two working samples

of about 50 g (not less than 45g and not

more than 55g) each are used. For

pelleted seeds, two working samples of

about 1000 seed each are used. Each

sample is subjected to a screening

analysis.

…

If this tolerance is exceeded, a further

sample of 50g (and if necessary a fourth

sample) must be analysed.

….

If this tolerance is exceeded, a further

sample of 50g or 1000 pelleted seeds

(and if necessary a fourth sample) must

be analysed.

…


C.2.4


Chapter 3: The Purity Analysis

C.3.1. Adding the use of an anemometer for the uniform blowing

method

To use an anemometer to monitor the equivalent air velocity (EAV) value of the

optimum blowing point obtained using the ISTA calibration samples.

There is no existing procedure for using the EAV value to monitor the calibration

points for General blowers in the ISTA Rules.

Expected benefits

Currently, ISTA requires a regular calibration of the blowers using the ISTA

uniform calibration sample (UCS). However, the frequent use of a UCS can cause it

to rapidly deteriorate. Using simply the air gate opening between calibrations is

reliable in some blowers but not in others. Using a desired air velocity point

regardless of gate opening, motor conditions, etc. is a more reliable way to

reproduce the correct point as it is determined with a calibration sample.

The EAV of the optimum blowing point is the air velocity value of the air gate

opening at the optimum blowing point for a specific calibration sample.

The casual factor in seed separations in any blowing procedure is the velocity of air

that flows through the working sample. Therefore, using the EAV directly to

monitor the procedure allows the analyst to detect any undesirable variation. In

addition, using the EAV makes the application of the blowing procedure simple and

verifiable at any time.

Using an anemometer will minimize the use of the UCS, and thus protect the

integrity of the calibration samples. This approach is critical to maintain the integrity

of the UCS in all future blowing procedures. This technology in combination with

the use of uniform calibration samples should increase the uniformity within and

across laboratories.

Measuring the EAV takes only a few minutes, thus it will be easy for laboratories to

keep records of the equivalent air velocity value of the optimum blowing point for

quality control purposes.

The following proposal was developed by the Blowing Procedure Working Group of

the Purity Committee and approved by vote.


3.4 Apparatus

Aids …

Hand lenses …

Sieves …

3.4 Apparatus

3.4.1 Magnifiers, reflected light and

sieves

Aids …

Hand lenses …

Sieves …



3.4.2 Seed blowers

Seed blowers can be used to separate

light-weight material such as chaff and

empty florets in grasses from the heavier

seeds.

Blowers that will give the most accurate

separations normally handle only small

samples (up to 5g). A good blower

should provide a uniform flow of air, be

capable of standardization and retain all

the particles which it separates.

Seed blowers can be used to separate

light-weight material such as chaff and

empty florets from the heavier seeds for

all species as a tool for purity analysis.

Blowers that will give the most accurate

separations normally handle only small

samples (up to 5g). A good blower

should provide a uniform flow of air, be

capable of standardization and retain all

the particles which it separates.

For certain species and varieties of

Poaceae, seed blowers must be used by

the uniform blowing method (3.5.2.5) to

separate light-weight material such as

chaff and empty florets from the heavier

seeds.

In order to maintain a uniform flow of

air the blower should have one or more

air compression chambers and a fan

driven by a uniform speed motor. The

diameter of the blowing tube should be

in proportion to the size of the working

sample and the tube should be long

enough to allow satisfactory separation

of the sample. The valve or gate that

regulates the air flow should be capable

of precise adjustment, should be

calibrated and marked to permit easy

reading, and its construction and

location should prevent areas of strong

and weak currents in the blowing tube.

In order to maintain a uniform flow of

air, the blower should have one or more

air compression chambers and a fan

driven by a uniform-speed motor. The

diameter of the blowing tube should be

in proportion to the size of the working

sample, and the tube should be long

enough to allow satisfactory separation

of the sample. The valve or air gate that

regulates the air flow should be capable

of precise adjustment, should be

calibrated and marked to permit easy

reading, and its construction and

location should prevent areas of strong

and weak currents in the blowing tube.

A manometer is desirable for

standardizing the blower.

A blower to be used for the uniform

blowing method must be capable of:

a) blowing at different pressures

(determined by the use of the

calibration samples) to suit different

species;

b) maintaining a uniform flow of air

along the tube at any required

pressure;

c) rapid adjustment to any pressure

likely to be required. The setting to

provide each pressure should be

checked periodically by blowing a

calibration sample issued under the

authority of ISTA;

d) accurate time setting.

A seed blower to be used for the uniform

blowing method must be capable of:

a) blowing at different air velocities

(determined by the use of the

calibration samples) to suit different

species;

b) maintaining a uniform flow of air at

the velocity required by the crop

species under test;

c) rapid adjustment to any velocity

likely to be required. The setting to

provide each velocity should be

checked annually by blowing a


authority of ISTA;

d) accurate time setting.



3.4.2.1 Calibration of the seed blower

The air gate openings and the Equivalent

Air Velocity (EAV) value (see 3.4.2.2)

of the optimum blowing point for a

General type seed blower are determined

by using the uniform calibration

samples. Calibration samples are issued

under the authority of ISTA and are

available for Dactylis glomerata and

Poa pratensis. Prior to calibration, the

calibration samples must be exposed to

room conditions overnight.

For those not having a General type seed

blower, please contact the ISTA

Secretariat.

The air gate opening for the varieties of

Poa pratensis listed in Table 3A, with an

average thousand-seed weight less than

0.35 g, and for Poa trivialis is obtained

by multiplying the value of the air gate

setting for Poa pratensis by 0.82

(applies only for General type seed

blowers).

3.4.2.2 Determination of the equivalent

air velocity

After a General type seed blower has

been calibrated according to 3.4.2.1, the

EAV of the air gate opening must be

measured using an anemometer. The

following procedure must be used:

1. Set the blower at the optimum

blowing point, i.e. the air gate

opening, obtained with the

ISTA uniform calibration

sample for the relevant species,

e.g. Dactylis glomerata or Poa

pratensis. Do not change that

air gate opening.

2. Remove the sample cup from

the cup holder, insert the

anemometer with digital

display facing up, and align the

fan of the anemometer over the

blower opening where the air

flows from the chamber into the

sample cup holder.

3. Turn on the anemometer and

select metres per second (m/s),

hold the anemometer in a

steady position and then turn on

the blower.



4. Read the air velocity value after

the digital display of the

anemometer reaches a steady

reading (typically about 30

seconds after the blower was

turned on). Example: If the

anemometer indicates 2.3 m/s

most frequently and fluctuates

between 2.2 and 2.4 m/s, the

EAV value of that specific air-

gate opening would be recorded

as 2.3 ± 0.1 m/s.

Once the optimum air velocity has been

measured, the seed blower can be

recalibrated using the anemometer, by

adjusting the blower setting until the

optimum air velocity for the blower and

species or variety is reached. The EAV

for one blower is not transferable to

another blower.

The optimum blowing point must be

verified using the ISTA uniform

calibration sample after major servicing

of the blower, such as changing parts of

the motor or the glass column. In

general, it is strongly recommended that

the blowing point be verified annually

using the ISTA uniform calibration

sample.

Laboratories that can not, or do not, use

the EAV to determine the blowing point

must calibrate the blower with the ISTA

uniform calibration sample.

Note: Frequent use of the ISTA uniform

calibration sample can cause a shift in

blowing point due to deterioration and

monitoring the blowing point simply by

air gate opening may be reliable in some

blowers and not in others.

3.4.2.3 Anemometer type

Any suitable anemometers can be used

as long as the anemometer fits in the

sample cup holder compartment of the

blower and has a scale calibrated in

metres per second for reading the air

velocity value.

3.4.2.4 Calibration of the anemometer

The anemometer should be calibrated at

the set intervals set by the laboratory. In

addition, the batteries should be replaced

once a year.



3.5.2.5 Uniform blowing method

This method is obligatory for Poa

pratensis, Poa trivialis and Dactylis

glomerata.

3.5.2.5 Poa pratensis, Poa trivialis and

Dactylis glomerata

For Poa pratensis, Poa trivialis and

Dactylis glomerata, the uniform blowing

method (see 3.4) is obligatory.

The working sample size is 1 g for Poa

pratensis and Poa trivialis, and 3 g for

Dactylis glomerata.

The blowing pressure is determined for

Poa pratensis and Dactylis glomerata by

means of a calibration sample issued

under the authority of ISTA. The

blowing pressure for the varieties of Poa

pratensis listed in Table 3A with an

average weight of 1000 seeds <0.35g is

obtained by multiplying the blower


(applies only for General Seed Blowers).

The blowing pressure for Poa trivialis is

obtained by multiplying the blower


(applies only for General Seed Blowers).

Prior to calibration, both the calibration

and working samples must be exposed to

room conditions.

The working sample size is 1 g for Poa

pratensis and Poa trivialis, and 3 g for

Dactylis glomerata.

The optimum blower settings for Poa

pratensis and Dactylis glomerata are

determined by means of a uniform


authority of ISTA (see 3.4.2.1). The

optimum blower setting for the varieties

of Poa pratensis listed in Table 3A, with

an average thousand-seed weight less

than 0.35 g, and for Poa trivialis is

obtained by multiplying the value of the

optimum blower setting setting for Poa

pratensis by 0.82 (applies only for

General type seed blowers).

For those not having a General type seed

blower, please contact the ISTA

Secretariat.

3.5.2.5.1 Blowing

Set the blower at the blowing point

obtained with the uniform calibration

sample. Place the working sample into

the cup and blow for exactly three

minutes.

For blowing samples, set the seed

blower to the optimum blower setting,

obtained with the ISTA uniform

calibration sample or the anemometer

(see 3.4.2.1).

Place the working sample into the cup

and blow for exactly 3 min.

Prior to blowing, the working sample

must be exposed to room conditions to

equilibrate with ambient conditions..


C.3.1


Chapter 5: The Germination Test

C.5.1. Harmonisation on seedling evaluation in respect to the

evaluation of the cotyledons (50% rule)

Harmonisation between ISTA Rules and ISTA Handbook on Seedling

Evaluation in respect to the evaluation of the cotyledons (50% rule)

An appendix was added in 2009 into the ISTA Handbook on Seedling Evaluation,

but changes have not been implemented in ISTA Rules. It is there proposed to

harmonise rules regarding seedling evaluation to what has been described in the

Handbook, in particular when there is a damage at the point of attachment of the

cotyledons to the seedling axis.

The following proposal is from the Germination Committee and approved by a vote.


5.2.6 The 50% rule

The 50% rule is used in the evaluation of

cotyledons and primary leaves.

Cotyledon tissue:

– Seedlings are considered normal as

long as half or more of the total

cotyledon tissue is functional

– Seedlings are abnormal when more

than half of the cotyledon tissue is

missing, necrotic, decayed or

discoloured.

5.2.6 The 50% rule

The 50% rule is used in the evaluation of

cotyledons and primary leaves.

Cotyledon tissue:

– Seedlings are considered normal as

long as half or more of the total

cotyledon tissue is functional

– Seedlings are abnormal when more

than half of the cotyledon tissue is

missing, necrotic, decayed or

discoloured.

Primary leaves:

…

The 50% rule does not apply if the tissue

around the terminal bud or the terminal

bud itself is necrotic or decayed; such

seedlings are abnormal irrespective of

the condition of the cotyledons or

primary leaves.

Primary leaves:

…

The 50% rule does not apply if the two

points of attachment of the cotyledons to

the seedling axis or the terminal bud

itself is necrotic or decayed; such

seedlings are abnormal irrespective of

the condition of the cotyledons or

primary leaves. It does not apply also if

one point of attachment of one cotyledon

is necrotic or decayed and if the other

cotyledon is not intact; such seedlings

are also considered as abnormal.

Further details of how the 50% rule is

applied can be found in the ISTA

Handbook on Seedling Evaluation.

…

Further details of how the 50% rule is

applied can be found in the ISTA

Handbook on Seedling Evaluation.

…

5.2.8.1. Seedling abnormalities

…

3 Abnormalities of the cotyledons and

primary leaves

…


…

3 Abnormalities of the cotyledons and

primary leaves

…


Note: damage or decay of the cotyledons

at the points of attachment to the

seedling axis or near the terminal bud

renders a seedling abnormal, irrespective

of the 50% rule.

Note: damage or decay of the cotyledons

at the two points of attachment of the

cotyledons to the seedling axis or near

the terminal bud renders a seedling

abnormal, irrespective of the 50% rule.

The 50% rule also does not apply if one

point of attachment of one cotyledon is

necrotic or decayed and the other

cotyledon is not intact; such seedlings

are also considered as abnormal.


C.5.1


C.5.2. Growing media for germination test.

Growing media for germination test.

It is suggested to delete the sentence referring to the use of “moistened porous paper

or absorbent cotton” in order to avoid confusion regarding the need to determine the

water content and the water retention capacity of these substrates.



5.6.2.1 Growing media

5.6.2.1.1. Methods using paper

Top of paper (TP): the seeds are

germinated on top of one or more layers

of paper which are placed:

–…

– directly on trays in germination

incubators. The relative humidity in the

incubators must then be maintained at a

level that prevents tests drying out.

Moistened porous paper or absorbent

cotton can be used as a base for

substrates.

5.6.2.1 Growing media

5.6.2.1.1. Methods using paper

Top of paper (TP): the seeds are

germinated on top of one or more layers

of paper which are placed:

–…

– directly on trays in germination

incubators. The relative humidity in the

incubators must then be maintained at a

level that prevents tests drying out.


C.5.2


C.5.3. List of seedling abnormalities

List of seedling abnormalities

Introduction of “trapped coleoptile” in the list of seedling abnormalities. This defect

is mentioned several times in the ISTA Handbook for Seedling Evaluation but is not

yet included in the list of seedling abnormalities.




…

4 Abnormalities of the coleoptiles and

the primary leaf

41 The coleoptile

…


…

4 Abnormalities of the coleoptiles and

the primary leaf

41 The coleoptile

…

41/12 is trapped under the lemma or the

testa.


C.5.3


C.5.4. Change required due to moving genus Arachis from PSD 11

to PSD 21

Change in Germination Chapter following the proposal from the Purity

Committee to move the genus Arachis from PSD 11 to PSD 21.

The consequence of moving Arachis from PSD 11 to PSD 21 is that seeds in pods or

seeds out of pods are defined as pure seed units. As pods may interfere with

germination, it is suggested to make it clear that the pods must be removed before

planting the seeds in a germination test.



5.6 Procedure

5.6.1 Working sample

…

Multigerm seed units are not broken up

for the germination test but are tested as

though they were single seeds.

5.6 Procedure


…

Multigerm seed units, except for

Arachis, are not broken up for the

germination test but are tested as though

they were single seeds.

For Arachis, although a pod is a pure

seed unit, seed must be removed from

the pod before use in a germination test.


C.5.4


C.5.5. Duration of germination test for certain grass species

Duration of germination test for certain grass species

A validation study on the duration of the germination test for Lolium perenne,

Festuca rubra and Poa pratensis was carried out. Eight ISTA-accredited

laboratories in seven countries on three continents participated. Four samples per

species were germinated using different temperature regimes, and seedlings were

evaluated at different times.

The results show that repeatability and reproducibility were similar for the last two

counts in all species, and were at acceptable levels. The different temperature

regimes and shortening the duration of the germination test resulted in statistically

significant differences of less than 3%.

The variation caused by shortening the duration of the germination test is of the

same magnitude as the variation caused by different temperature regimes.

It is suggested that the duration of the germination test of the indicated Lolium

species is reduced to 10 days, that of the Festuca species to 14 days and that of the

Poa species to 21 days. The results can be extrapolated to other species of the same

genus that have similar germination patterns, as they have already the same test

conditions and test duration according to the Germination Committee

members/experts. The following proposal is from the Germination Committee,

approved by a vote, and supported by a validation study.

Table 5A Part 1 Agricultural and vegetable seeds PROPOSED VERSION

Species Substrate Temperature (°C) First

count (d)

Final

count (d)

Recommendations for

breaking dormancy

1 2 3 4 5 6

Festuca

filiformis

TP 20<=>30; 15<=>25 5 21 14 KNO3; prechill

Festuca

heterophylla

TP 20<=>30; 15<=>25 5 21 14 KNO3; prechill

Festuca ovina TP 20<=>30; 15<=>25 5 21 14 KNO3; prechill

Festuca rubra TP 20<=>30; 15<=>25 5 21 14 KNO3; prechill

Lolium x

hybridum

TP 20<=>30; 15<=>25;

20

5 14 10 KNO3; prechill

Lolium

multiflorum

TP 20<=>30; 15<=>25;

20


Lolium perenne TP 20<=>30; 15<=>25;

20


Poa nemoralis TP 20<=>30; 15<=>25;

10 <=>30


Poa palustris TP 20<=>30; 15<=>25;

10 <=>30


Poa pratensis TP 20<=>30; 15<=>25;

10 <=>30



C.5.5


C.5.6. Modification to 5.6.4 to add clarity

In addition to the above changes and to allow laboratories to continue with current

practise for test durations for the species mentioned above section 5.6.4 has been

modified. The changes are to make it clear how many days test extension for a

germination test is now allowed for those species even after the prescribed periods

are shortened.

The following proposal is from the Rules Chair and Vice-Chair and is supported by

the Germination Committee and approved by a vote.


5.6.4 Duration of the test

…

If it seems advisable, when for example

some seeds have just started to

germinate, the prescribed test period

may be extended by 7 days or up to half

the prescribed period for the longer tests.

5.6.4 Duration of the test

…

If it seems advisable, when for example

some seeds have just started to

germinate, the prescribed test period

may be extended by:

a) 7 days;

b) up to half the prescribed period;

c) up to 21 days for Lolium spp.;

d) up to 32 days for Festuca spp.

(except F. arundinacea and

pratensis);

e) up to 42 days for Poa spp.

(except P. bulbosa);

f) up to 54 days for Poa bulbosa.

If, on the other hand, the maximum

germination of the sample has been

obtained before the end of the prescribed

test period, a test may be terminated. At

the request of the applicant the

germination test may be terminated

when the sample reaches a

predetermined germination percentage.

…

If, on the other hand, the maximum

germination of the sample has been

obtained before the end of the prescribed

test period, a test may be terminated. At

the request of the applicant the

germination test may be terminated

when the sample reaches a

predetermined germination percentage.

…


C.5.6


Chapter 6: Biochemical Test for Viability. The Topographical

Tetrazolium Test.

C.6.1. Amended explanation for testing Helianthus and Bracharia

species .

Helianthus

During a discussion with Valerie Blouin it was realised that the explanation: “ ⅓ of

distal end of cotyledons if pervading” is not included in the Table 6, or in the

working sheet, but it is in the old TEZ handbook. There was also a validation study

of Helianthus under the leadership of Augusto Martinelli, where this was a proposal

for the rules in 2001. The Tetrazolium Committee does not know why this was not

included in the current rules and consequently is now being added.

Brachiaria

Investigation by Augusto Martinelli discovered that the text for Bracharia testing

methods was not carried forward from previous Rules editions to the current edition

therefore a correction is proposed as shown.

Note: Although these could be considered editorial corrections a vote is being asked

for to provide transparency.

This proposal is submitted by the Tetrazolium Committee and approved by vote.

Helianthus

spp.

W/18 Remove pericarp

and seed coats from

the seed.

1 3 Cut longitudinally through

the cotyledons and the

radicle-hypocotyl axis.

Observe both sides of the

seed.

⅓ radicle measured from

radicle tip, ⅓ of distal end

of cotyledons if pervasive,

½ of distal end of the

cotyledons if superficial

Brachiaria

spp.

BP/16;

W/6

Remove glumes,

cut transversely

near embryo

1 18 Observe external embryo

surface.

⅓ radicle

BP/16;

W/6

Cut longitudinally

through embryo

and 3/4 of

endosperm.

1 2 Observe cut surface. ⅓ radicle


C.6.1


Annex to Chapter 7: Seed Health Testing Methods

C.7.1. Changes to existing seed health methods to provide a

uniform approach

These changes are a result of the regular review of existing SHC methods. If

accepted the dates for approved date and review due dates will need to be updated in

the tables listing the SHC methods in the Rules and Annexe.

Although these changes could be considered as editorial it is better that they are

formaly voted on as there are several that could be seen as technical changes to the

method.

This proposal is submitted by the Seed Health Committee and approved by vote.

Editorial corrections: (following method reviews)

Methods 7-001b and 7-002b:

page 3 in Materials: Malt agar plates with streptomycin sulphate

page 6

o in table Preparation of Malt agar + streptomycin

o in table: streptomycin sulphate 50 mg

o 4. …50°C and add streptomycin sulphate dissolved in water.

Method 7-003:

page 3 in Methods: 2. Plating…dish (bottom) and soak…

Method 7-009:

Change pathogen name to Gibberella circinata Nirenberg & O’Donnell

Method 7-006:

page 2 in Background: five years. Lesions on severely infected seeds may

be either brown with whitish centres surrounded by a pale brown to dark

brown area or reddish lesions of variable size (Fig.1). Direct inspection is

not considered as a dependable method, as not all infected seeds bear

symptoms and on dark-skinned varieties symptoms are more difficult to

see.

In Fig 1 legend: Lesions on severely infected seeds may be either brown

with whitish centres surrounded by a pale brown to dark brown area or

reddish lesions of variable size (Fig.1). Direct inspection is not considered

as a dependable method, as not all infected seeds bear symptoms and on

dark-skinned varieties symptoms are more difficult to see.

Methods 7-010, 11 and 12: (the same modifications for each method)

page 3 in Methods

o Media …(filter paper) Whatman No. 1 or equivalent

o 2. Blotter

On water-soaked blotters in Petri dishes. Place 25 seeds in each dish.

Replace with: 2.1 Place three layers of 9.0 cm filter paper in each plate

and soak with sterile distilled/de-ionised water. Drain away excess

water. 2.2 Aseptically place 25 seeds, evenly spaced, on the surface of

the filter paper in each dish.

o 3. Incubation … If the filter paper dries out during incubation, add

an appropriate amount of sterile distilled/de-ionised water onto the

paper, usually after 3 days of incubation. Avoid touching the seeds

as adding water can cause cross contaminations.

Methods 7-014: to align with 7-022

In 7-14 (top of the pages) and preface ii: Septoria Stagonospora nodorum

…


Page 3 in materials: … Agar containing 100ppm with streptomycin

sulphate

Page 3 in Methods: 2. Agar method Plating: Aseptically place a maximum

of 10 seeds evenly spaced, onto the agar surface of each Malt agar or Potato

Dextrose agar plate containing 100ppm streptomycin sulphate.

Page 4 in preparation of media:

o 2. Malt agar: 1 mg may be used between 50 and 100ppm,

depending on the level of saprophytic bacterial contamination

commonly encountered.

5. 50°C and add streptomycin sulphate dissolved in water

o 2. Potato dextrose agar: 1 mg may be used between 50 and

100ppm, depending on the level of saprophytic bacterial

contamination commonly encountered

5. 50°C and add streptomycin sulphate dissolved in water

Method 7-027: sample size: In any case, the minimum sample size should be 400

seeds.

Addition of positive controls in all methods

(Note methods 7-005, 7, 17, 18 are not modified yet as SHC reviews are in

progress or new method modification are proposed)

Method 7-001a:

In Materials, reference material: the use of reference cultures or other

appropriate material is recommended

In method

o 2.1

o 2.2 Positive control (reference material): Aseptically place seeds

evenly spaced (CCP) onto the surface of the filter paper in enough

plates to obtain the reference culture, or plate a reference culture

on media.

o 6. …Fig 1, bottom left). Compare with positive control. Record…

Method 7-001b:



In method

o 1.1

o 1.2 Positive control (reference material): ): Aseptically place seeds

evenly spaced (CCP), onto the agar surface of enough malt agar


on one Malt agar plate.

o 4. …Fig 1, bottom left). Compare with positive control. Record…

Method 7-002a:



In method

o 2.1


evenly spaced (CCP), onto the surface of the filter paper in enough

plates to obtain the reference culture or plate a reference culture on

media

o 6. …of conidia. Compare with positive control. Record…


Method 7-002b:



In method

o 1.1


evenly spaced (CCP), onto the agar surface of enough malt agar


on one Malt agar plate.

o 4. …Fig 1). Compare with positive control. Record…

Method 7-003:


appropriate material is recommended whenever possible

In method

o 2.1

o 2.2 Positive control (reference material): Aseptically place seeds in

enough plates to obtain the reference culture or plate a reference

culture on media

o 4. …as infected. Compare with positive control. Examination…

Method 7-004:



In method

o 1.1



culture on media

o 4. …as infected. Compare with positive control.

Method 7-008:



In method

o 2.1


pretreated in the same way as 1., in enough plates to obtain the

reference culture or plate a reference culture on media

o 4. …Salt (1978). Compare with positive control.

Method 7-009:



In method

o 3.1


pretreated in the same way as 1., in enough containers to obtain

the reference culture or plate a reference culture on media

o 5. … (1980). Compare with positive control.

Method 7-010:



In method

o 2.1



culture on media

o 4. …rounded ends. Compare with positive control.


Method 7-011:



In method

o 2.1



culture on media

o 4. …-400. Compare with positive control.

Method 7-012:



In method

o 2.1



culture on media

o 4. …after 7 days. Compare with positive control.

Method 7-013a:

In method 3. (fig 2). Compare with positive control (reference material).

Method 7-013b:

In method 14. 7-013a. Compare with positive control (reference material).

Page 4 method states “….one part glycerol to three parts ethanol…..”

Correct to “….one part glycerol to two parts ethanol…..”

Method 7-014:



In method

o 2.1



culture on media

o 4. …with age. Compare with positive control.

Method 7-015:


appropriate material (included in the test kit) is recommended

Method 7-016:

In method

o 2.1



culture on media


Method 7-022:



In method

o 2.1


pretreated as in 1., evenly spaced (CCP), onto the agar surface of

enough malt agar plates to obtain the reference culture, or plate a

reference culture on one Malt agar or PDA plate.

o 5. …2005). Compare with positive control.

Method 7-025:

In Materials, reference material: reference cultures or other appropriate

material

In method

o 3.2 …2004). Compare with positive control.

Method 7-027:

In method 8. (Figs 1–3). Compare with positive control (reference

material).

Editorial corrections: host common names added

Method 7-001a, b and 7-002a , b : …carota (carrot)

Method 7-015: …spp (fescue)

Method 7-016: …max (soybean, soya bean)

Method 7-020 : …carota (carrot)

Method 7-021 and 7-023 : …vulgaris (bean)

Method 7-024 : …sativum (pea)

Method 7-027 : …vulgare (barley)


C.7.1


C.7.2. Modification to existing seed health method

7-028: Detection of infectious tobamoviruses on Solanum

lycopersicum (tomato) by the local lesion assay (indexing) on

Nicotiana tabacum plants

Modification to 7-028 after comments and review by the authors and the SHC.

This proposal is submitted by the Seed Health Committee and approved by vote.


Improved phrasing.

…The local lesion assay or indexing

method is derived from a

multilaboratory comparative test

organised by the International Seed

Health Initiative for Vegetables, ISF

(ISHI-Veg). It is based on the detection

of infectious virus by mechanical

inoculation of resistant Nicotiana assay

plants with tomato seed extract (Holmes

1929; Hadas 1999; Hadas et al., 2004).

The use of resistant plants to

tobamoviruses (Holmes 1938;

Hammond-Kosack and Jones 1996;

Erickson et al., 1999a; Whitham et al.,

1994; Boovaraghan et al., 2007) such as

Nicotiana tabacum ‘Xanthi NN’ (Stange

et al., 2004; Diaz-Griffero et al., 2006)

triggers the development of local lesions

(Holmes 1938; Takahashi 1956; Dawson

1999) on the inoculated leaf surface as a

hypersensitive reaction product

(Ehrenfeld et al., 2008; Takahashi 1956;

Erickson et al., 1999b; Whitham et al.,

1994; Taliansky et al., 1994).…

The local lesion assay method is derived

from a multilaboratory comparative test

organised by the International Seed

Health Initiative for Vegetables, ISF

(ISHI-Veg). It is based on the detection

of infectious virus by mechanical

inoculation of resistant Nicotiana assay

plants with tomato seed extract (Holmes

1929; Hadas 1999; Hadas et al., 2004).

In tobacco plants carrying the N gene

such as Nicotiana tabacum ‘Xanthi NN’

(Stange et al., 2004; Diaz-Griffero et al.,

2006) resistance to tobamoviruses

(Holmes 1938; Hammond-Kosack and

Jones 1996; Erickson et al., 1999a;

Whitham et al., 1994; Boovaraghan et

al., 2007) is based on a hypersensitive

reaction to virus infection (Ehrenfeld et

al., 2008; Takahashi 1956; Erickson et

al., 1999b; Whitham et al., 1994;

Taliansky et al., 1994). which results in

a local necrotic lesion (Holmes 1938;

Takahashi 1956; Dawson 1999)

preventing subsequent systemic spread

of the virus….

……However, to increase test

sensitivity, the ISHI comparative

……However, to increase test

sensitivity, the ISHI-Veg comparative

Indexing replaced with local lesion assay. Greenhouse or growth room use clarified..

Materials:…

Tobacco plants: resistant to all races of

the pathogen for indexing (e.g.

Nicotiana tabacum ‘Xanthi NN’)

Greenhouse/Controlled Environment

Room or cabinet (module)

Materials:…

Tobacco plants: resistant to all races of

the pathogen for local lesion assay (e.g.

Nicotiana tabacum ‘Xanthi NN’)

Controlled Greenhouse / Growth

Chamber

70 % ethanol is not suitable for removing/disinfecting tobamoviruses.

Sample preparation

… This can be achieved by swabbing or

spraying equipment and gloved hands

with 70% ethanol or equivalent.

Sample preparation

…This can be achieved by swabbing or

spraying equipment and gloved hands

with an alkaline soap or equivalent and

then rinsing with water to remove

residues.



Different buffer can be used but does not have to be defined by the antiserum

supplier.

Indexing replaced with assay.

1. Extraction of virus from the seed

1.1 Using a grinder, grind seeds of each

sub-sample in the PBS seed extraction

buffer (4 mL per 100 seeds) or as

defined by the antisera provider if

indexing is performed after ELISA pre-

screening.

1.2 Process seed extracts within 4 h after

grinding or store them at 4 °C when

indexing is performed after ELISA pre-

screening (CCP).

1. Extraction of virus from the seed

1.1 Using a grinder, grind seeds of each

subsample in the PBS seed extraction

buffer at a rate of (4 mL per 100 seeds)

or in an alternative ELISA buffer if the

assay is performed after ELISA pre-

screening (CCP).

1.2 Process seed extracts within 4 h after

grinding or store them at 4 °C when the

assay is performed after ELISA pre-

screening (CCP).

2. 2. Positive control (seeds or reference

material)(CCP)

…

ii. grind flour of pea seeds mixed with

ground TMV/ToMV/PMMoV-infected

Nicotiana

leaves in seed extraction buffer (5 mL

per 5 g) or as defined by the ELISA

antiserum

provider (CCP) or

2. 2. Positive control (seeds or reference

material)(CCP)

…

ii. grind flour of pea seeds mixed with

ground TMV/ToMV/PMMoV-infected

Nicotiana leaves in seed extraction

buffer (5 mL per 5 g) or in an alternative

ELISA buffer if the assay is performed

after ELISA pre-screening (CCP) or

…

iii. use liquid extract of

TMV/ToMV/PMMoV-infected leaves of

solanaceous hosts

(CCP).

…

iii. use liquid extract of

TMV/ToMV/PMMoV-infected leaves of

solanaceous hosts sufficiently diluted in

PBS seed extraction buffer or in an

alternative ELISA buffer if the assay is

performed after ELISA pre-screening

(CCP)

There should be some slight pressure applied during inoculation to facilitate virus

penetration in the leaf. Indexing replaced with local lesion assay.

4. Indexing (mechanical inoculation of

plants)

…

4.2.1 Place a drop of inoculum (100 μL)

onto the leaf. Smear the drop with

fingers, wearing plastic gloves or plastic

finger tips, on the leaf surface without

applying pressure (CCP).

4. Local lesion assay (mechanical

inoculation of plants)

….

4.2.1 Place a drop of inoculum (100 μL)

onto the leaf. Smear the drop with

fingers, wearing plastic gloves or plastic

finger tips, on the leaf surface with

constant but slight pressure (CCP).

Appropriate quantity of carborundum powder is the critical point of this step. Slight

pressure is required.

Bioassay replaced with assay.

Critical control points [identified by

CCP in the methods]

Critical control points [identified by

CCP in the methods]

– If the local lesion assay is performed

after ELISA pre-screening, it has to be

shown that local lesions can be obtained

with the alternative buffer equivalent to

PBS (Steps 1.1, 2.1.ii, 2.1.iii)



– If the local lesion assay is

performed…

If a laboratory routinely uses ELISA as a

pre-screen, the correlation between

ELISA responses and the number of

lesions in the bioassay should be well

established for the routinely used

reference material. This will further

establish whether the storage of samples

has influenced the assay results.

…

– If the local lesion assay is performed…

If a laboratory routinely uses ELISA as a

pre-screen, the correlation between

ELISA responses and the number of

lesions in the assay should be well

established for the routinely used

reference material. This will further

establish whether the storage of samples

has influenced the assay results.

…

– Leaves should be dusted with the

appropriate quantity of carborundum

powder and with gentle movements to

avoid leaf damage (Step 4.1.2)

…

– Leaves should be dusted with the

appropriate quantity of carborundum

powder (Step 4.1.2)

…

Smearing of the extract on the leaf

surface should be performed with gentle

finger movements with constant pressure

but avoiding leaf damage. Inoculation of

leaves should be performed by wearing

gloves and/or plastic finger tips which

should be changed between sub-

samples. Hands should be cleaned

thoroughly between samples with an

alkaline soap or equivalent and then

rinsed with water to remove soap

residues (Step 4.2.1).

Smearing of the extract on the leaf

surface should be performed with gentle

finger movements with constant but

slight pressure but avoiding leaf damage.

Inoculation of leaves should be

performed by wearing gloves and/or

plastic finger tips which should be

changed between subsamples. Hands

should be cleaned thoroughly between

samples with an alkaline soap or

equivalent and then rinsed with water to

remove soap residues (Step 4.2.1).


C.7.2.



7-019b: Detection of Xanthomonas campestris pv. campestris on

Brassica spp. disinfested/disinfected seed

Note: If this method is accepted as 7-019b the existing method 7-019 needs to be

renumbered to 7-019a.

This proposal is submitted by the Seed Health Committee, approved by vote and is

supported by a validation study.

Crop: Brassica spp. (broccoli, cabbage, calabrese, canola, cauliflower, oilseed rape)

Pathogen: Xanthomonas campestris pv. campestris (black rot) Authors: Asma M.

1, Koenraadt H.M.S

2and Politikou A.

3

1BejoZaden B.V., P.O. Box 50, 1749 ZH Warmenhuizen,

The Netherlands. Email: [email protected]

2Naktuinbouw, P.O. Box 40, 2370 AA Roelofarendsveen,

The Netherlands. E-mail: [email protected]

3ISF, 7 Chemin du Reposoir, 1260 Nyon, Switzerland.

Email: [email protected] Revision History: Version 1.0. 1 January 2014.

Prepared by: International Seed Health Initiative-Vegetables, ISF (ISHI-Veg)

Background

The ISTA Rule 7-019 has been developed and validated for the detection of Xanthomonas campestris pv. campestris (Xcc) on Brassica spp. untreated seed. Hot water treatment (HWT) and related proprietary treatments against Xcc are a common practice to treat Brassica spp. seed lots found to be pathogen positive. To monitor the efficacy of such treatments the seed lots are retested for viable cells of Xcc. The ISTA Rule 7-019 involves only seed soaking for pathogen extraction. This relatively mild extraction of the pathogen from whole seeds does not allow for the detection of internally located X.campestris pv. campestris cells which might have survived the treatment. To facilitate detection, seed must be ground to extract the internally located cells that have a better chance of surviving the treatment than bacteria located on the seeds surface. A modification of the ISTA Rule 7-019 involving wet grinding of the disinfested/disinfected seed has been developed and validated in a comparative test between eight laboratories organised by the International Seed Health Initiative-Vegetables (ISHI-Veg). Wet grinding strongly enhances the extraction and detection of viable Xanthomonas campestris pv. campestris located internally in disinfested/disinfected seed. Other changes to theISTA Rule 7-019 consist of the use of buffered saline (PBS) rather than saline as well as a larger ratio of buffer to the seed. This avoids a reduction of the X. campestris pv. campestris recovery due to a suboptimal pH, especially with certain proprietary treatments (Koenraadt et al., 2007). Other changes include concentration of the seed extract by centrifugation, a longer incubation time of the plated extracts to increase the sensitivity of the assay, modifications of the semi-selective media mCS20ABN and FS, and modification of the pathogenicity test.

Validation Studies

Asma M., Koenraadt H. and Politikou A. (2012)


Copies are available by e-mail from [email protected], or by mail from the ISTA Secretariat.

Reproducibility: dispersion = 1

Repeatability: dispersion = 1

Detection limits: 1.5 cfu/mL (theroretical, P=0.95)

Safety Precautions

Ensure you are familiar with hazard data and take appropriate safety precautions, especially during preparation of media, autoclaving, and weighing out of ingredients. It is assumed that this procedure is being carried out in a microbiological laboratory by persons familiar with the principles of Good Laboratory Practice, Good Microbiological Practice, and aseptic technique. Dispose all waste materials in an appropriate way (e.g. autoclave, disinfect) and in accordance with local health, environmental and safety regulations.

Treated Seed

This test method is suitable for seed that has been treated using physical (hot water) or chemical (chlorine) or proprietary processes with the aim of disinfestation/disinfection, provided that any residue, if present, does not influence the reliability of the assay. This test method has not been validated for seed treated with protective chemicals or biological substances.

Sample and subsample size

The sample (total number of seeds tested) and subsample size to be tested depends on the desired tolerance standard (maximum acceptable percentage of seeds infested) and detection limit (theoretical minimum number of pathogen propagules per seed which can be detected).In any case, the recommended maximum subsample size is 10,000 seeds and the recommended minimum sample size is 30,000 seeds. A full discussion of these aspects can be found in Geng et al. (1987), Roberts et al. (1993) and Roberts (1999).

Materials

Reference material - Known strain of Xanthomonas campestris pv. campestris or standardised reference material.

Plates of FS medium - 9.0 cm Petri dishes (3 plates of each medium per subsample + controls).

Plates of mCS20ABN medium

- 9.0 cm Petri dishes (3 plates of each medium per subsample + controls).

Plates of YDC medium

- For subculture (at least 1 per subsample).

Conical flasks - With sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) for soaking of seeds (25 mL per 1,000 seeds).

Orbital shaker

Grinder - e.g. Ultra Turrax with S25N-25G dispersion tool or equivalent.

Filter bags - e.g. Bag filter model P 400 mL (Interscience, France) or universal extraction bag model with synthetic intermediate layer (Bioreba, Switzerland) or filter extraction bags (Neogen Europe, Scotland) for filtering coarse particles from extracts.



Centrifuge - e.g. capable of providing centrifugal force of 5,000 g.

Dilution bottles - Containing 4.5 mL of sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) (1 per subsample). Other volumes may be acceptable, see General Methods.

Automatic pipettes - Check accuracy and precision regularly.

Sterile pipette tips

Sterile bent glass rods

70% ethanol - For disinfection of surfaces, equipment.

Balance - Capable of weighing to the nearest 0.001 g.

pH meter - Capable of being read to the nearest 0.01 pH unit.

Incubator - Capable of operating at 28°C-30°C).

Brassica spp. seedlings

- Susceptible to all races of the pathogen for pathogenicity test (e.g. B. oleracea cv. Wirosa).

Sample Preparation

This can be done in advance of the assay.

It is vital to exclude any possibility of cross-contamination between seed samples, it is therefore essential to disinfect all surfaces, containers, hands, etc. both before and after handling each sample. This can be achieved by swabbing/spraying equipment and gloved hands with 70% ethanol.

Count the number of seeds in a known weight. Estimate the Thousand Seed Weight (TSW) as:


Based on the estimated TSW, weigh out subsamples of the required size into new, clean polythene bags or containers.

Method

[Critical control points are indicated by CCP]

Extraction

Suspend seeds of each subsample in sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) in a conical flask or equivalent container. The volume should be adjusted according to the number of seeds used (25 mL per 1,000 seeds) (CCP).

Shake for 2.5 h at room temperature (20-25°C) on an orbital shaker set at 100-125 rpm.

Grind the seeds with a grinder until all seeds are completely ground. This point should be reached in at most 2 min of grinding. If not, select alternative grinding equipment. Depending on the type of grinder used, disinfect properly between subsamples and samples to avoid any cross contamination (CCP).

1. Dilution and plating

1.1. Filter coarse particles from the seed extract, using a bag filter model P 400 mL (InterScience, France), universal extraction bag model with synthetic intermediate layer (Bioreba, Switzerland) or filter extraction bags (Neogen Europe, Scotland) (Fig. 1).

1.2. Transfer 3.5 mL of the filtered seed extract to a tube and keep the samples on ice. This 3.5 mL sample must be used to prepare a


tenfold dilution (use 0.5 mL) and a tenfold concentration (use 2 mL). The remaining sample (1 mL) must be used to plate the undiluted seed extract.

1.3. Prepare a tenfold dilution (10-1

dilution) from the filtered seed extract. Pipette 0.5 mL of the extract into 4.5 mL of sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) and vortex to mix (10

-1

dilution) (see General Methods).

1.4. Prepare a tenfold concentrated extract (101 concentration) by

centrifugation of 2 mL sample for 5 min at 5,000 g. Carefully remove the supernatant and re-suspend the pellet in 200 μL of sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v).

1.5. Pipette 100 μL of the tenfold dilution (10-1

dilution) and then the undiluted seed extract onto one plate of each of the selective media (FS and mCS20ABN) and spread over the surface with a sterile bent glass rod (see General Methods).

1.6. Pipette 100 μL of the tenfold concentrated seed extract (101

concentration) onto one plate of each of the selective media (FS and mCS20ABN) and spread over the surface with a sterile bent glass rod (see General Methods).

1.7. Incubate plates at 28-30°C upside down and examine after 4-6 days (CCP).

2. Positive control (culture or reference material)

2.1. Prepare a suspension of a known strain of X. campestris pv. campestris in sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) or reconstitute standardised reference material according to the supplier’s instructions.

2.2. Dilute the suspension sufficiently to obtain dilutions containing approx. 10

2 to 10

4 cfu/mL. This may require up to seven ten-fold

dilutions from a turbid suspension.

2.3. Pipette 100 μL of appropriate countable dilutions onto plates of each of the selective media (FS, mCS20ABN) and spread over the surface with a sterile bent glass rod.

2.4. Incubate plates with the sample plates.

3. Sterility check

3.1. Prepare a dilution series from a sample of the extraction medium (i.e. PBS plus Tween 20), containing no seeds, and plate on each of the media as for samples.

4. Examination of the plates

4.1. Examine sterility check and positive control plates (CCP).

4.2. Examine the sample plates for the presence of typical X. campestris pv. campestris colonies by comparison with the positive control plates.

4.3. On FS after 4-6 d, X. campestris pv. campestris colonies are small, pale green, mucoid and surrounded by a zone of starch hydrolysis. This zone appears as a halo that may be easier to see with a black background (Fig. 2A).

4.4. After 4-6 d on mCS20ABN, X. campestris pv. campestris colonies are yellow, mucoid and surrounded by a zone of starch hydrolysis (Fig. 2B).

4.5. Record the number of suspect and other colonies (CCP) (see General Methods).

5. Confirmation/identification of suspect colonies

5.1. Subculture suspect colonies to sectored plates of YDC. To avoid the potential for cross-contamination of isolates, use a new sectored plate for each subsample. The precise numbers of subcultured colonies will depend on the number and variability of suspect colonies on the plate: if present at least six suspect colonies should be subcultured per subsample (CCP).

5.2. Subculture the positive control isolate to a sectored plate for comparison.


5.3. Incubate sectored plates for 3-4 d at 28-30°C.

5.4. Compare appearance of growth with positive control. On YDC X. campestris pv. campestris colonies are yellow and mucoid (Fig. 3). (CCP).

5.5. Confirm the identity of isolates by pathogenicity on Brassica seedlings of known susceptibility or by polymerase chain reaction (PCR) (CCP).

5.6. Record results for each colony subcultured.

6. Pathogenicity assay

6.1. Grow seedlings of a Brassica cultivar known to be susceptible to all races of X. campestris pv. campestris (e.g. Wirosa; see Vicente et al., 2001) at 20-30°C ( 2°C) in small pots or modules until at least 2-3 true leaf stage.

6.2. Scrape a small amount of bacterial growth directly from a 24-48 h YDC culture (e.g. sectored plate) with a sterile cocktail stick or insect pin.

6.3. Inoculate the secondary veins of the first two true leafs by stabbing with the cocktail stick or insect pin.

6.4. Inoculate 2-4 plants per isolate.

6.5. Inoculate seedlings with the positive control isolate and stab with a sterile cocktail stick or insect pin as a negative control (CCP).

6.6. Grow on plants at 20-30°C.

6.7. Examine plants for the appearance of typical progressive V-shaped, yellow/necrotic lesions with blackened veins after 10-14 days (See Fig. 4). Symptoms may be visible earlier depending on temperature and the aggressiveness of the isolate. Compare with positive control (CCP). It is important to discriminate between the progressive lesions caused by the vascular pathogen X. campestris pv. campestris and the limited dark necrotic lesions at the inoculation site caused by leaf spot Xanthomonas (classified as X. c. pv. raphani or X.c. pv. armoraciae (see Kamounvet al., 1992; Alvarez et al., 1994; Tamura et al., 1994; Vicente et al., 2001; Roberts et al., 2004).

7. PCR test (CCP)

7.1. Follow the PCR Option1 or the PCR Option 2 described in the ISTA Rule 7-019 to confirm the suspect isolates.

Fig. 1. Extracts of ground cabbage seeds in a lateral filter bag. The lateral filter is used to remove coarse particles from the crude seed extract (see arrow).


Fig. 2. Plates of FS (A) and mCS20ABN (B) after 5 days of incubation at 28°C

showing typical colonies of Xanthomonas campestris pv.campestris surrounded by zones of starch hydrolysis.

Fig.3. Typical yellow mucoid growth of isolates of Xanthomonas campestris pv. campestris on a sectored plate of YDC after 3 days at 28°C. Only suspect cultures are indicated by arrows.

Fig. 4. Cabbage leaves 7 days post inoculation with Xanthomonas campestris pv. campestris. Typical symptoms are black veins, wilting and chlorosis. The lower left leaf was used as a negative control.

A

B


General Methods (common to many test procedures)

Preparation of ten-fold dilution series

Each dilution should be prepared by pipetting 0.5 mL (± 5%) from a well-mixed seed extract or previous dilution into a universal bottle (screw-capped) or similar container containing 4.5 mL (± 2%) of sterile diluent and then vortexing to mix prior to the next dilution step. A new sterile pipette tip should be used for each dilution step. Pipettes should be checked regularly for accuracy and precision and re-calibrated as necessary. It is acceptable to prepare ten-fold dilutions using other volumes provided that the laboratory can demonstrate that the required accuracy and precision can be achieved.

Plating of dilutions.

This should be done as soon as possible after dilutions have been prepared and certainly within 30 min. Working from the highest (most dilute) dilution to the undiluted extract, 0.1 mL is pipetted onto the center of a surface-dry, labelled agar plate. The liquid should then be spread evenly over the entire surface of the medium with a bent glass rod. If care is taken to work from the highest to the lowest dilution (or undiluted extract) a single pipette tip and a single bent glass rod can be used for each sample. Ensure that all liquid has been absorbed by the agar before inverting and incubating plates. If necessary allow plates to dry under a sterile air-flow in a microbiological safety cabinet or laminar flow hood.

Recording of dilution plates

Record the results for all dilution plates. The most accurate estimate of bacterial numbers should be obtained from spread plates with total number between 30 and 300 colonies. However this may be further complicated depending on the relative numbers of suspect pathogen and other colonies. In order to minimise effort, start recording with the highest dilution (most dilute) and count the number of suspect and the number of other colonies. If the total number of colonies on a plate greatly exceeds 300 there is little value in trying to make a precise count if a more reliable count has already been obtained from a more dilute plate, in which case it is sufficient to record the number of colonies as ‘m’ (many) if they are still separate or ‘c’ (confluent) if they have run together.

Sectored Plates

Using a laboratory marker pen, draw lines on the base of a standard 9 cm plate (Petri dish) to divide it into six equal sectors. Subculture single colonies from dilution plates and make a single zigzagged streak within a single sector on the plate. Take care to leave sufficient space between each isolate to ensure the growth does not coalesce. Thus six suspect colonies can be subcultured to each sectored plate. Separate plates should be used for each sample/subsample. If the purity of subcultured isolates is doubtful, they should be further streaked out on whole plates.

Reporting Results

The result of a seed health test should indicate the scientific name of the pathogen and the test method used. When reported on an ISTA Certificate, results are entered under Other Determinations.

In the case of a negative result (pathogen not detected in any subsamples), the results should be reported in terms of the tolerance standard and detection limit. The tolerance standard depends on the total number of seeds tested, n, and is approximately 3/n (P=0.95) (see Roberts et al., 1993); the detection limit per subsample is equal to the detection limit per mL multiplied by the volume of extract.


In the case of a positive result, the report should indicate the mean number of colony forming units (cfu) of the pathogen per seed and either the number of positive subsamples out of the total number tested and the sample size or the maximum likelihood estimate of the proportion of infested seeds

Quality Assurance

General

A record should be kept of the date and results of pipette calibration checks.

It is essential that operators have received appropriate training and use automatic pipettes correctly.

Critical Control Points

[Identified by CCP in the methods]

Dry grinding of seed followed by the addition of an extraction buffer has found to be inadequate (Step 1.1).

In case an Ultra Turrax grinder is used to grind the seed, the grinder should be run in hot water and/or 70% ethanol and subsequently in sterile water to prevent any cross-contamination between subsamples. To achieve complete sterilization between samples the S25N-25G dispersion tool of the grinder has to be autoclaved or disassembled and the parts immersed in 70 % ethanol (Step 1.3).

The time between grinding and plating of the corresponding suspensions must be kept under 1 hour (Step 1.3).

Due to the exposure to harsh condition during the seed treatment the initial multiplication time of X. campestris pv. campestris cells is longer than for X. campestris pv. campestris cells from untreated seeds or cells of the positive control. To obtain a similar colony size therefore a longer incubation is required when testing treated seed (Step 2.7).

There should be no growth on dilution plates prepared as a sterility check (Step 5.1).

Dilution plates prepared from positive control isolate(s) or reference material, should give single colonies with typical morphology (Step 5.1).

Numbers of bacteria on dilution plates should be consistent with the dilution (i.e. should decrease approx. ten-fold in the 10

-1 dilution) (Step 5.5.

Due to the potential for non-pathogenic isolates to be present in seed lots together with pathogenic isolates, it is essential to subculture (Step 6.1), if present, at least the minimum number of suspect colonies specified (six per subsample) and to test all Xanthomonas-like subcultured isolates for pathogenicity or in PCR test (Step 6.5).

The positive control isolate(s) or reference material should give colonies with typical morphology on YDC (Step 6.4).

Positive control isolates should be included in every pathogenicity test (Step 7.5).The positive control isolates should give typical symptoms in the pathogenicity test (Step 7.7).

The CCP of the PCR Option 1 and PCR Option 2 are described in ISTA Rule 7-019 (Step 8).

The source of starch used in the selective media is critical for observation of starch hydrolysis. Verify that each new batch of starch gives clear zones of hydrolysis with reference cultures of X. campestris pv. campestris (FS and mCS20ABN media).

The activity per gram (g) of some antibiotics may vary between batches. It may be necessary to adjust the weight or volume added to ensure that the


final number of units per litre of medium is consistent (FS and mCS20ABN media).

Prepare antibiotics stock solutions and other supplements in water, 50 or 70% ethanol. Antibiotics solutions and other supplements prepared in

distilled water must be filter sterilized with a 0.2 m bacterial filter. Alternatively it is possible to add the amount of powder to autoclaved distilled water. Solutions prepared in ethanol need no sterilization (FS and mCS20ABN media).

The activity of neomycin against some strains of X. campestris pv. campestris is known to be affected by pH. It is essential that the pH of the medium is less than 6.6 (mCS20ABN medium, Step 3).

References

Alvarez, A.M., Benedict, A.A., Mizumoto, C.Y., Hunter, J.E. and Gabriel, D.W. (1994). Serological, pathological, and genetic diversity among strains of Xanthomonas campestris pv. campestris infecting crucifers. Phytopathology 84, 1449-1457.

Asma, M.,Koenraadt, H.M.S. and Politikou, A. (2012).Proposal for a new detection method of Xanthomonas campestris pv. campestris on disinfested/ disinfected Brassica spp. seed lots. ISTA Method Validation reports 20XX.

Geng, S., Campbell, R.N., Carter, M. and Hills, M. (1987) Quality control programs for seedborne pathogens. Plant Disease 67, 236-242.

Kamoun, S., Kamdar, H.V., Tola, E. and Kado, C.I. (1992) Incompatible interactions between crucifers and Xanthomonas campestris involve a vascular hypersensitive response: role of the hrpXlocus. Molecular Plant-Microbe Interactions 5, 22-33.

Koenraadt, H., Borst, R. and van Vliet, A. (2007). Detection of Xanthomonas campestris pv. campestris in cabbage seeds after hot water treatment. Phytopathology 97, S59.

Roberts, S.J. (1999) Thresholds, standards, tests, transmission and risks. In: Proceedings of 3

rd ISTA Seed Health Symposium, Ames, Iowa, USA, 16-19

August 1999. pp 20-24. ISTA, Zürich, Switzerland.

Roberts, S.J., Brough, J., Everett, B. and Redstone, S. (2004). Extraction methods for Xanthomonas campestris pv. campestris from Brassica seed. Seed Science and Technology 32, 439-453.

Roberts, S.J., Phelps, K., Taylor, J.D. and Ridout, M.S. (1993). Design and interpretation of seed health assays. In: Sheppard, J.W., (Ed.) Proceedings of the first ISTA Plant Disease Committee Symposium on Seed Health Testing, Ottawa, Canada. Agriculture Canada, Ottawa, Canada. pp 115–125.

Tamura, K., Takikawa, Y., Tsuyumu, S. and Goto, M. (1994). Bacterial spot of crucifers caused by Xanthomonas campestris pv. raphani. Annals of the Phytopathological Society of Japan 60, 281-287.

Vicente, J.G., Conway, J., Roberts, S.J. and Taylor, J.D. (2001). Identification and origin of Xanthomonas campestris pv. campestris races and related pathovars. Phytopathology 91, 492-499.

Preparation of PBS (0.05 M phosphate) with Tween 20 (0.02% v.v) (pH 7.2-7.4)

Compound g/L

Sodium chloride (NaCl) 8.0


Na2HPO4 5.75

KH2PO4 1.0

Tween 20 0.2 mL

Distilled/de-ionised water 1000 mL

Preparation

Weigh out all the ingredients into a suitable container.

Add 1000 mL of distilled/de-ionised water.

Dissolve and dispense into final containers.

Autoclave at 121°C, 15 psi for 15 min.

Add 0.2 mL of sterile Tween 20 per 1 L after autoclaving

Storage

Provided containers are tightly closed, may be stored for several months before use.

Preparation of mCS20ABN agar medium

Compound g/L

Soya Peptone 2.0

BactoTryptone 2.0

KH2PO4 2.8

(NH4)2HPO4 0.8

MgSO4.7H2O 0.4

L-Glutamine 6.0

L-Histidine 1.0

D-Glucose (Dextrose) 1.0

Soluble starch Merck 1252 (CCP) 25.0

Bacto Agar 18.0


Nystatina (10 mg/mL 50% EtOH) 35 mg (3.5 mL)

Neomycin sulphateb (20 mg/mL distilled water) 40 mg (2.0 mL)

Bacitracinc (50 mg/mL 50% EtOH) 100 mg (2.0 mL)

a, b, c Added after autoclaving

Preparation

1. Weigh out all the ingredients except the antibiotics into a suitable container.

2. Add 1000 mL of distilled/de-ionised water.

3. Dissolve and check pH which should be 6.5, adjust if necessary (important CCP).

4. Autoclave at 121°C, 15 psi for 15 min.

5. Prepare antibiotic solutions and filter sterilise as appropriate.

6. Allow the medium to cool to approx. 50°C and add antibiotic solutions.


7. Mix thoroughly but gently by inversion/swirling to avoid air bubbles and pour plates (18 mL per 9.0 cm plate).

8. Leave plates to dry in a laminar flow bench or similar before use.

Antibiotics (amounts for guidance only, CCP)

a Dissolve 100 mg nystatine in 10 mL 50% ethanol. Add 3.5 mL/L.

b Dissolve 200 mg neomycin sulphate (770 U/mg)in 10 mL sterile distilled

water. Add 2.0 mL/L.

c Dissolve 500 mg bacitracin,(60 U/mg) in 10 mL 50% ethanol. Add 2.0 mL/L.

Storage

Store the prepared plates inverted in polythene bags at 4°C ( 2°C) and use within four weeks of preparation to ensure activity of antibiotics.

Depending on the source of starch, pre-storage in the refrigerator for several days before use may result in more easily visible zones of starch hydrolysis.

Preparation of FS agar medium

Compound g/L

K2HPO4 0.8

KH2PO4 0.8

KNO3 0.5

MgSO4.7H2O 0.1

Yeast extract 0.1

Methyl Green (1% aq.) 1.5 mL

Soluble starch Merck 1252 (CCP) 25.0

Bacto Agar 15.0

Distilled/de-ionisedwater 1000 mL

Nystatina (10 mg/mL in 50% ethanol) 35 mg (3.5 mL)

D-methionineb (1 mg/mL 50% EtOH) 3 mg (3.0 mL)

Pyridoxine-HClc(1 mg/mL 50% EtOH) 1 mg (1 mL)

Cephalexind(20 mg/mL 50% EtOH) 50 mg (2.5 mL)

Trimethoprime (10 mg/mL 70% EtOH) 30 mg (3 mL)

a, b, c, d, e Added after autoclaving

Preparation

1. Weigh out all the ingredients except antibiotics, pyridoxine-HCl and D-methionine into a suitable container.

2. Add 1000 mL (or 500 mL) of distilled/de-ionised water.

3. Dissolve and check pH which should be 6.5, adjust if necessary (important CCP).


5. Prepare the antibiotic, pyridoxine-HCl and D-methionine solutions and filter sterilise as appropriate.

6. Allow medium to cool to approx. 50°C before adding the antibiotics, pyridoxine-HCl and D-methionine solutions.


7. Mix the molten medium gently to avoid air bubbles and pour plates (18 mL per 9.0 cm plate).

8. Leave plates to dry in a laminar flow bench or similar before use.

Antibiotics (amounts for guidance only, CCP)

a Dissolve 100 mg nystatine in 10 mL 50% ethanol. Add 3.5 mL/L (1.75

mL/500 mL).

b Dissolve 10 mg D-methionine in 10 mL 50% ethanol. Add 3.0 mL/L (1.5

mL/500 mL).

c Dissolve 10 mg pyridoxine-HCl in 10 mL 50% ethanol. Add 1 mL/L (0.5

mL/500 mL).

d Dissolve 200 mg cephalexin in 10 mL 50% ethanol. Add 2.5 mL/L (1.25

mL/500 mL).

e Dissolve 100 mg trimethoprim in 10 mL 70% ethanol. Add 3 mL/L (1.5

mL/500 mL).

Storage

Store the prepared plates inverted in polythene bags at 4°C ( 2°C) and use within four weeks of preparation to ensure activity of antibiotics.

Depending on the source of starch, pre-storage in the refrigerator for several days before use may result in more easily visible zones of starch hydrolysis.

Preparation of Yeast Dextrose Chalk (YDC) agar medium

Compound g/L

Bacto Agar 15.0

Yeast Extract 10.0

CaCO3 (light powder) 20.0

D-Glucose (Dextrose) 20.0


Preparation

1. Weigh out all the ingredients into a suitable oversize container (i.e. 250 mL of medium in a 500 mL bottle/flask) to allow swirling of the medium just before pouring.


3. Steam to dissolve.


5. Allow the medium to cool to approx. 50°C.

6. Swirl to ensure even distribution of CaCO3 and avoid air bubbles, and pour plates (20 mL per 9.0 cm plate).

7. Leave the plates to dry in a laminar flow bench or similar before use.

Storage

Store the prepared plates inverted in polythene bags at 4°C ( 2°C).

Prepared plates can be stored for several months provided they do not dry out.


C.7.3



7-021: Detection of Xanthomonas axonopodis pv. phaseoli and

Xanthomonas axonopodis pv. phaseoli var. fuscans on Phaseolus

vulgaris (Bean) seed

Method now includes Xanthomonas axonopodis pv. phaseoli var. fuscans with the

use of dfferent primer sets.



Only additions to 7-021 method are indicated Authors: Grimault V.

1, Olivier V.

2, Rolland M.

3, Darrasse A.

4 and Jacques M.A.

4

1GEVES-SNES, rue Georges Morel, B.P.90024, 49071 Beaucouzé

Cedex, France. E-mail: [email protected] 2ANSES-Plant healthlaboratory,7 rue Jean Dixméras, 49044 Angers

CEDEX 01, France E-mail: [email protected]

3BioGEVES,rue Georges Morel, B.P.90024, 49071 Beaucouzé Cedex,

France. E-mail: [email protected] 4INRA, UMR1345 IRHS, SFR 149 Quasav, Bâtiment C, 42, rue Georges Morel, BP 60057, F-49071 Beaucouzécedex, France. E-mail: [email protected]

Prepared by: ISTA and International Seed Health Initiative for Vegetables, ISF (ISHI-

Veg)

Revision History: Version 2.0, 1 January 2014.

Background This method is derived from the validation studies carried out by ISTA in 2003 and 2011,... text from previous version of method In 2010 in the USA and France conflicting data were obtained with the new ISTA method. Research in France (GEVES and INRA) and in the Netherlands (Naktuinbouw) showed that some isolates that were responsible for positive results were causing symptoms in the pathogenicity assay but were not identified as Xap based on molecular methods (genetic bacterial fingerprinting in the Netherlands and pathogen specific PCR’s in France). Therefore it was concluded that the pathogenicity assay used in the ISTA method, a crucial step in the Xap test, is not reliable enough. A new pathogenicity assay was developed at INRA to allow a reliable characterization of the aggressiveness of X. axonopodis pv. phaseoli wild type strains and mutants (Darsonval et al., 2009). A comparison study of the new pathogenicity test and primers specific for X. axonopodis pv. phaseoli fuscans and non fuscans isolates (Audy et al.,1994; Boureau et al., 2012) was carried out as a collaboration between ISTA, ANSES, INRA and ISHI-Veg. This study showed that the new pathogenicity test and Audy et al, (1994) primers were good confirmation tools and that Diaggene (Boureau et al., 2012) primers gave good results but their use did not improve sensitivity of the method. Two options are proposed for confirmation of suspect isolates: Option 1: Pathogenicity assay, for laboratories not equipped or experienced with PCR. In this case, CCP must be followed and target and non target controls added (X. vesicatoria, Xap, water). This option is also valuable and less time consuming when few suspect isolates have been detected but requires a growth chamber or greenhouse equipped for high relative humidity (RH). Option 2: PCR test with Audy et al, (1994) primers. This option can be used for laboratories experienced and equipped for PCR, when a short delay is needed for obtaining results and/or a high number of suspect isolates have been detected.

Validation Studies

Grimault V., Olivier V., Rolland M., Darrasse A.

. and Jacques M.A. (2012).




Safety Precautions

text from previous version of method

Ethidium bromide Ethidium bromide is carcinogenic. Use ethidium bromide according to safety instructions. It is recommended to manipulate solution instead of powder. Some considerations are mentioned below.

– Consult the Material Safety Data Sheet on ethidium bromide before using the chemical.

– Always wear personal protective equipment when handling ethidium bromide. This includes wearing a lab coat, nitrile gloves and closed toe shoes.

– Leave lab coats, gloves, and other personal protective equipment in the lab once work is complete to prevent the spread of ethidium bromide or other chemicals outside the lab.

– All work with ethidium bromide is to be done in an "ethidium bromide" designated area in order to keep ethidium bromide contamination to a minimum.

■ UV light UV light must not be used without appropriate precautions. Ensure that UV protective eyewear is utilized when visualizing ethidium bromide.

Treated Seed

Sample and subsample size


Materials

text from previous version of method Reference material: A known strain of fuscans or non fuscans types of X. axonopodis pv. phaseoli (positive control) and of X. vesicatoria (negative control) or standardized reference material Growth chamber capable of operating at 28°C or greenhouse, with high humidity (95% RH), with quarantine status Milli Q and chemicals for PCR preparation Sterile microtubes (1.5 mL; 0.2 mL) Microliter pipettes (e.g. Gilson, Finn) with sterile filtered tips (1 µl – 1000 µl) Conventional thermocycler Electrophoresis equipment (1.5-2% agarose gels) DNA visualizing system (BET or analog reagent, UV imaging apparatus) PCR primers (Audy et al., 1994) - p7X4c: 5’ ggcaacacccgatccctaaacagg 3’ - p7X4e: 5’ cgccggaagcacgatcctcga ag 3’

Sample Preparation


Method


[Critical control points are indicated by CCP]

6.5...Confirm the identity of isolates by pathogenicity test on bean seedlings of known susceptibility (option 1) or by PCR (option 2)

6.6 text from previous version of method

7. Pathogenicity (CCP) (Darsonval et al., 2009): Option 1

7.1 Grow seedlings of a bean cultivar known to be highly susceptible to Xap (e.g. Flavert or Michelet) at 20-30°C in small pots until the first trifoliate leaf stage (approximately 16 days after sowing).

7.2 Make a 107

cfu/mL (CCP) suspension in distilled/deionized water of a

culture obtained after growth (24 or 48 h), 28°C on YDC (i.e. sectored plate).

7.3 Inoculation: dip first trifoliate leaf for 30 s in a container containing inoculum (beaker) (Fig 4).


7.4 The number of plants which should be inoculated is 3 plants per suspect isolate.

7.5 Inoculate plants with one positive X. apisolate, and 2 negative controls: X. vesicatoria and distilled/deionized water

7.6 Incubate at 28°C 16 h light, 95% RH; 25°C 8 h dark, 95% RH (CCP)

7.7 Record symptoms from 5 to 11 days (depending on when symptoms begin) after inoculation. Compare with positive and negatives controls. Typical Xap symptoms are water-soaked spots. Necrosis of lesions can develop and in case of very aggressive isolates lead to death of tissues (Fig 5 a, b, c, d). No lesions occur on negative controls (Fig 6)

8.Polymerase Chain Reaction (PCR) Audy et al. (1994): Option 2 8.1 Make a slightly turbid cell suspension at 10

7 cfu/mL(OD600nm

approximately 0.05) in 1.0 mL sterile distilled/deionized water from the suspect colonies cultured on YDC medium, and the positive and negative controls (CCP). Boil the suspension for 5 min at 95°C for DNA extraction. Store at -20°C until identification (CCP).

8.2 Use the following X. axonopodis pv. phaseoli specific pair of primers from Audy et al. (1994) that will give a product of 800bp:

p7X4c: 5’ ggcaacacccgatccctaaacagg 3’ p7X4e: 5’ cgccggaagcac gat cctcgaag 3’

8.3 Prepare the reaction mixture (page 7-021-X, adapted by INRA) (CCP). Carry out the PCR reactions in 0.2 mL thin walled PCR tubes in a final volume of 20 µl (16 µl reaction mixture + 4 µl boiled bacterial suspension).

8.4 PCR profile: An initial 3 min incubation at 94oC followed by 35 cycles of

1 min at 94oC, 2 min at 72

oC. A final 10 min incubation at 72

oC and infinity at

12oC (CCP).During each amplification run, in addition to the positive and

negative controls extracted in 8.1, a PCR negative control (DNA extract replaced by molecular biology grade water) is added.

8.5 Fractionate 10 µl of the PCR products and water (negative PCR control) by gel electrophoresis in a 1.5% agarose gel in 1X Tris-Acetate EDTA (TAE Buffer) (CCP). Include a 100bp ladder. Stain with ethidium bromide in a bath and rinse in water.

8.6 Analyse the amplification products for a X. axonopodis pv. phaseoli specific product of 800bp (CCP)= positive identification of X. axonopodis pv. phaseoli, no band = negative identification (Fig 7).

In case of a positive identification of X. axonopodis pv. phaseoli, as a low risk of false positive result is present (Audy et al. (1994) primers detect X. axonopodis pv. dieffenbachiae which are not supposed to be present on bean seeds), a pathogenicity test can be performed as complementary information.



Quality Assurance

General



[Identified by CCP in the method]


Due to the potential for non-pathogenic isolates to be present in seedlots together with pathogenic isolates, it is essential to subculture if present, at least the minimum number of suspect colonies specified (six per subsample) (Step 6.1), and to test all Xanthomonas-like subcultured isolates in pathogenicity or PCR test (Step 6.5).

For pathogenicity assay, a concentration of 107

cfu/mL must be used as lower concentrations can lead to false negative results and higher concentrations to false positive results. The humidity during incubation must be very high (minimum 95%) to obtain water-soaked lesions. If the humidity is too low, necrotic lesions can develop without any visible water-soaked spot making more difficult the interpretation of the result. Positive and negative control isolates and negative PCR control should be included


in every PCR test (Step 8.1).

DNA extracted by boiling cannot be stored for a very long time. If stored at -20°C, positive and negative controls stored in the same conditions as suspect isolates’ DNA must be used. The preparation of PCR mixture (Step 8.1, 8.4), and the preparation of agarose gel for electrophoresis (Step 8.5) should be adapted to available material and equipment of individual laboratories testing for of X. axonopodis pv. phaseoli under the condition that results will be validated on PCR controls.

Fig. 4. Inoculation by dipping first trifoliate leaf for 30 seconds in a beaker containing

inoculum.

Fig 5a Fig 5b

Fig 5c Fig 5d


Fig. 5. Phaseolus vulgaris leaves 5-11 days after inoculation with typical Xap water-soaked spots (a), necrosis (b, c) and dead tissues (d).

Fig. 6. Phaseolus vulgaris leaves 5-11 days after inoculation with a negative control.

Fig. 7: Agarose gel showing Xap specific band at 800bp (Audy et al, (1994) primers)

Example of Reaction Mixture Preparation for PCR –Audy primers

Compound Initial

concentration Final

concentration Volume (µl)

in 20 µl

Sterile water 10.02

Promega Go Taq Buffer * 5x 1x 4

dNTP 2.5 mM each 0.2 mM 1.6

p7X4c 20 µM 0.15 µM 0.15

p7X4e 20 µM 0.15 µM 0.15

Go TaqPolymerase 5 U/µl 0.02 U/µl 0.08

DNA 4

* Concentrated PCR reaction buffer (with MgCl2), from GoTaq DNA polymerase [Promega] (Laboratories using a buffer without MgCl2 will have to add this salt to a final concentration of 1.5 mM).


Example for visualization of PCR products

Preparation of Tris-Acetate EDTA (TAE) Buffer 1X

Compound mL/L

Tris-Acetate EDTA (TAE 50X) 20

Distilled/de-ionised water QSP 1000 mL

Preparation of 1.5% agarose gel for electrophoresis

Compound 1 agarose gel

(25x15 cm) 1 litre

Tris-Acetate EDTA (TAE) 1x 300 mL 1000 mL

Agarose 4.5 g 15.0 g

Preparation

1. Make sure that the gel tray is clean and dry before use. Use the gel caster. Place the gel comb(s) in position in the gel tray.

2. Weigh out the desired amount of agarose and place in an Erlenmeyer flask with a measured amount of electrophoresis buffer, e.g. for a 300 mL gel add 4.5 g of agarose and 300 mL of 1x TAE buffer to a 500 mL flask. The larger flask ensures the agarose will not boil over.

3. Dissolve the agarose in a microwave oven. All the grains of agarose should be dissolved and the solution clear.

4. Allow the medium to cool down to approx. 60oC and pour the gel caster.

5. After the gel is completely set carefully remove the gel comb(s).

6. Remove the gels and place them in the electrophoresis unit.

7. The same electrophoresis buffer used in the gel must also be used for the running buffer.

Note: The amount of 1.5% agarose gel for electrophoresis to be prepared depends on the available electrophoresis apparatus of a laboratory.

References

Audy P., Laroche A., Saindon G., Huang H.C. and Gilbertson R.L. (1994). Detection of the bean common blight bacteria, Xanthomonas campestris pv. phaseoli and X.c. phaseoli var. fuscans, using the Polymerase Chain Reaction. Molecular Plant Pathology 84, 1185-1192.

Birch P.R.J., Hyman L.J., Taylor R., Opio A.F., Bragard C., and Toth I.K. (1997). RAPD PCR-based differentiation of Xanthomonas campestris pv. phaseoli from Xanthomonas campestris pv. phaseoli var. fuscans. European Journal of Plant Pathology 103, 809–814.

Boureau T., Chhel F., Hunault G., Kerkoud M., Lardeux F., Manceau C., Poussier S. and Saubion F. (2012). Procédé de dépistage de Xanthomonas axonopodis pv. Phaseoli. Patent. Publication 2970480, 20 July 2012.

Darsonval A., Darrasse A., Durand K., Bureau C., Cesbron S. and Jacques M.A. 2009. Adhesion and fitness in the bean phyllosphere and transmission to seeds of Xanthomonas fuscans subsp. fuscans. Molecular Plant-Microbes Interactions 22, 747-757.

Lopez, R., Asensio C., and Gilbertson R.L. (2006). Phenotypic and genetic diversity in strains of common blight bacteria (Xanthomonas campestris pv. phaseoli and X. campestris pv. phaseoli var. fuscans) in a secondary center of diversity of the common bean host suggests multiple introduction events. Phytopathology 96,1204–1213.

Mkandawire, A.B.C., Mabagala R.B., Guzman P., Gepts P., and Gilbertson R.L. (2004). Genetic diversity and pathogenic variation of common blight bacteria (Xanthomonas campestris pv. phaseoli and X. campestris pv. phaseoli var. fuscans) suggests pathogen coevolution with the common bean. Phytopathology 94, 593–603.

Schaad, N.W., Postnikova E., Lacy G.H., Sechler A., Agarkova I., Stromberg P.E., Stromberg V.K., and Vidaver A.K. (2006). Emended classification of xanthomonad pathogens on citrus. Systematic and Applied Microbiology 29, 690–695.


Simoes T.H.N., Gonçalves E.R., Rosato Y.B. and Mehta A. (2007).Differentiation of Xanthomonas species by PCR-RFLP of rpfB and atpDgenes.FeMS Microbiology Letters 271, 33-39.

Toth I.K., Hyman L.J., Talylor R. and Birch P.R.J. 1998. PCR-based detection of Xanthomonas campestris pv. phaseoli var. fuscans in plant material and it differentiation from X. c. pv. phaseoli. Journal of Applied Microbiology 85, 327–336.

Vauterin, L., Hoste B., Kersters K., and Swings J. 1995. Reclassification of Xanthomonas. International Journal of Systematic Bacteriology 45, 472–489.

Vauterin L., Rademaker J. and Swings J. 2000. Synopsis on the taxonomy of the genus Xanthomonas. Phytopathology 90, 677-682.


C.7.4


C.7.5. New seed health method

7-029: Detection of Pseudomonas syringae pv. pisi on Pisum

sativum (Pea) seed

New seed health method.



Crop: Pisum sativum (pea) Pathogen: Pseudomonas syringae pv. pisi (bacterial blight) Authors: V.Grimault

1, R. Germain

2 and A. Politikou

3

1GEVES-SNES, rue Georges Morel, B.P.90024, 49071 Beaucouze

Cedex, France Email: [email protected], 2Vilmorin Sa, Rue du manoir, 49250 La Menitre, France

Email:[email protected] 3ISF, 7 Chemin du Reposoir, 1260 Nyon, Switzerland. Email:

[email protected]

Prepared by: International Seed Health Initiative for Vegetables, ISF (ISHI-Veg) Revision History: Version 1.0. 1 January 2014.

Background Pseudomonas syringae pv. pisi (P. syringae pv. pisi), causal organism of bacterial blight on pea seeds (Grondeau et al., 1993), is a seed-borne (Hollaway et al., 2007) and seed-transmitted (Grondeau et al., 1993; 1996; Roberts et al., 1992, 1996) bacterial pathogen. Several studies on the characterization of P. syringae pv. pisi (Grondeau et al., 1996; Elvira-Recuenco and Taylor 2001) and distinction between the pv. syringae and pv. pisi (Malandrin and Samson 1998) have been conducted for identification purposes and for the development of tests for the P. syringae pv. pisi detection on pea seed (Lyons and Taylor 1990; Fraaije et al., 1993). The serological assays can not provide information on the bacterium’s viability and pathogenicity (Schaad 1982). Therefore, the available methods in use by seed health laboratories are based on seed wash-dilution-plating assays on semi-selective media (Fraaije et al., 1993; Grondeau et al., 1993; Mohan and Schaad 1987) and confirmation of suspect colonies by a pathogenicity test (Grondeau et al., 1992; Malandrin and

Samson 1998).

This method for the detection of P. syringae pv. pisi on untreated pea seeds has been validated in a comparative test organised by the International Seed Health Initiative for Vegetables, ISF (ISHI-Veg) with results of seven laboratories. It includes a seed wash-dilution-plating on the KBBCA and SNAC semi-selective media, optional biochemical tests on suspect colonies and a pathogenicity test for their confirmation. The biochemical tests allow for a reduced number of P. syringae pv. pisi suspects to be confirmed and subsequently for reduced time and labour in the pathogenicity test. The two pathogenicity test methods provide the user with a higher flexibility to operate in different laboratory conditions.

Validation Studies V. Grimault, R. Germain and A. Politikou (2012)


Safety Precautions Ensure you are familiar with hazard data and take appropriate safety precautions, especially during preparation of media, autoclaving, and weighing out of ingredients. It is assumed that persons carrying out this procedure are in a laboratory suitable for carrying out microbiological procedures and familiar with the principles of Good Laboratory Practice, Good Microbiological Practice, and aseptic technique. Dispose all waste materials in an appropriate way (e.g. autoclave, disinfect) and in accordance with local health, environmental and safety regulations.



Treated seed Seed treatments may affect the performance of this test. This method was not validated on treated seed.

(Definition of treatment: any process, physical, biological or chemical, to which a

seed lot is subjected, including seed coatings. See 7.2.3.).

Sample and subsample size The sample (total number of seeds tested) and subsample size to be tested depends on the desired tolerance standard (maximum acceptable percentage of seeds infested) and detection limit (theoretical minimum number of pathogen propagules per seed which can be detected), in any case the minimum sample size should be 5,000 seeds and the maximum subsample size should be 1,000 seeds.

Materials Reference material - Known strain of Pseudomonas syringae pv. pisi or

standardised reference material Plates of KBBCA medium

- 9.0 cm Petri dishes (6 plates of each medium per subsample + controls)

Plates of SNAC medium - 9.0 cm Petri dishes (6 plates of each medium per subsample + controls)

Polythene bags or containers

- with sterile saline (0.85% NaCl) for soaking of seeds (2.5 mL per 1g of seed)

Cold room or refrigerator

- operating at 4°C.

Dilution bottles - containing 4.5 mL of sterile saline (2 per subsample). Other volumes may be acceptable, see General Methods

Automatic pipettes - check accuracy and precision regularly Sterile pipette tips Sterile bent glass rods 70% ethanol or equivalent disinfecting product

Balance - capable of weighing to the nearest 0.001 g Incubator - operating at 28°C ( 2°C) UV lamp (365 nm) to check fluorescence

-

Materials for Oxidase tests

- 1% aqueous N,N-dimethyl paraphenylene diamine oxalate solution or ready to use tests (e.g. Bactident Oxidase, Merck, 1.13300.0001)

Pea seedlings - susceptible to all races of the pathogen for pathogenicity test (e.g. cv. Kelvedon wonder)

Module/growth chamber - Capable of operating/maintaining temperature at 20oC (

2°C) Greenhouse - Capable of operating/maintaining temperature at 20-25

oC

Sample preparation This can be done in advance of the assay.

It is vital to exclude any possibility of cross-contamination between seed samples, it is therefore essential to disinfect all surfaces, containers, hands, etc. both before and after handling each sample. This can be achieved by swabbing/spraying equipment and gloved hands with 70% ethanol.

Count the number of seeds in a known weight. Estimate the Thousand Seed Weight (TSW) as:


Based on the estimated TSW, weigh out subsamples of the required size into new, clean polythene bags or containers.

Method [Critical control points are indicated by CCP]

1. Extraction

1.1. Suspend seeds of each subsample in sterile saline in a polythene bag or container. The volume of the sterile saline should be adjusted according to the number of seeds used (2.5 mL per 1 g of seeds).

1.2. Soak the subsamples overnight (18-24 h) at 4°C under agitation.


2. Dilution and plating

2.1. Shake by hand the polythene bags or containers to obtain a homogenous extract before dilution.

2.2. Prepare a two tenfold dilutions series from each seed extract. Pipette 0.5 mL of the extract into 4.5 mL of sterile saline and vortex to mix (10

-1 dilution).

Pipette 0.5 mL of the 10-1

dilution into another 4.5 mL of sterile saline and vortex to mix (10

-2 dilution) (see General Methods).

2.3. Pipette 100 L of each dilution and the un-diluted seed extract onto two plates of each of the semi-selective media (KBBCA and SNAC) and spread over the surface with a sterile bent glass rod or equivalent (see General Methods).

2.4. Incubate inverted plates at 28°C ( 2°C) and examine after 4-5 days (see paragraph 5).

3. Positive control (culture or reference material)

3.1. Prepare a suspension of a known strain of Pseudomonas syringae pv. pisi in sterile saline or reconstitute standardised reference material according to the supplier’s instructions.

3.2. Dilute the suspension sufficiently to obtain dilutions containing approximately 10

2 to 10

3 cfu/mL. This may require up to seven ten-fold

dilutions from a turbid suspension.

3.3. Pipette 100 L of appropriate countable dilutions onto plates of each of the semi-selective media (KBBCA, SNAC) and spread over the surface with a sterile bent glass rod or equivalent (see General Methods).

3.4. Incubate plates with the sample plates.

4. Sterility check

4.1. Plate a dilution series from a sample of the extraction medium (i.e., sterile saline), containing no seeds, and plate on each of the semi-selective media as for samples.

5. Examination of the plates

5.1. Examine sterility check and recovery of positive control on both semi-selective media (KKBCA, SNAC) (CCP).

5.2. Examine the sample plates for the presence of typical P. syringae pv. pisi colonies by comparison with the positive control plates.

5.3. On KBBCA after 4 days, P. syringae pv. pisi colonies are creamy and half-translucent(Fig. 1).

5.4. On SNAC after 4 days P. syringae pv. pisi colonies are circular, white to transparent, mucoid, dome shaped and levan positive. (Fig. 2).

6. Identification of suspect colonies

6.1. Pick up at least two suspect colonies, if present, per subsample grown on KBBCA medium and subculture on sectored plates of SNAC medium (CCP).

6.2. Pick up at least two suspect colonies, if present, per subsample grown on SNAC medium and subculture on sectored plates of KBBCA medium (CCP).

6.3. Repeat with the positive control colonies. Subculture on a sectored plate of SNAC medium two colonies grown on KBBCA and subculture on a sectored plate of KKBCA medium two colonies grown on SNAC.

6.4. Incubate sectored plates at 28°C ( 2°C) for 2-3 days.

6.5. Check colonies subcultured on SNAC medium for levan production. P. syringae pv. pisi colonies are levan positive (Fig. 2). Compare with the positive control.

6.6. Check colonies subcultured on KBBCA medium for blue fluorescence, under UV light and/or for the typical morphology (Optional step; it can decrease the number of suspect colonies). There is a variation in the genus and some P. syringae pv. pisi produce a blue fluorescent pigment under UV light whereas others do not (Fig. 3). As both types of pathogen colonies may be present it is necessary to make a comparison with a positive control strain on the same media.

6.7. Identify suspect colonies subcultured on both media with an oxidase test (Optional step; it can decrease the number of suspect colonies). Use ready to use tests (e.g. Bactident Oxidase Merck, 1.13300.0001) or put a drop of 1% aqueous N, N-dimethyl paraphenylene diamine oxalate solution on a filter paper. Add quickly an oose of a suspect bacterial colony on the filter paper and make a bacterial emulsion. P. syringae pv. pisi colonies are oxidase negative (no cytochrome C oxidase): no red staining (Fig. 4). Compare to the positive control.


6.8. Record results for each subcultured colony.

6.9. All oxidase negative, typical fluorescent or non-fluorescent colonies on KBBCA and all oxidase negative colonies that produce levane on SNAC are considered suspect colonies.

6.10. Confirm the identity of all the suspect colonies by a pathogenicity assay on pea seedlings of known susceptibility (CCP).

7. Pathogenicity assay (Option1)

7.1. Germinate seeds of a pea cultivar known to be susceptible to all races of P. syringae pv. pisi (e.g. cv. Kelvedon wonder) in a wet blotter paper. Roll the paper with the seeds and place it in a plastic bag. Incubate the closed bag at room temperature (18

oC-20

oC) for 2-4 days to allow for seed

germination. Make sure to germinate enough seeds for all the suspect colonies that will be tested.

7.2. Prepare a suspension in sterile demineralised water of 24-48 h suspect bacterial culture on KBBCA and SNAC and dilute to a concentration of 10

8

cfu/mL.

7.3. Repeat with a 24-48 h positive control culture to get a concentration of 108

cfu/mL (CCP).

7.4. Cut the root tips of 2 day-old germinated pea seeds and incubate 3 seeds in each bacterial suspension for 15 min.

7.5. Repeat with incubation of 3 pea seeds in sterile demineralised water to serve as negative control.

7.6. Remove seeds from bacterial suspension and sow them in a labelled potting substrate or equivalent. Incubate at 20°C (± 5

oC) with 12 h light/12 h dark

or 16 h light/8 h dark and 100% saturating humidity.

7.7. Examine seedlings for typical greasy lesions on stems and leaflets after 5-9 days (Fig. 5). Compare with positive and negative controls (CCP).

7.8. Record the suspect colonies as positive if greasy lesions are observed.

8. Pathogenicity assay (Option2)

8.1. Grow seedlings of a pea cultivar known to be susceptible to all races of P. syringae pv. pisi (e.g. cv. Kelvedon wonder) in small pots or container with potting soil at 20

oC-25

oC with sufficient light until 2 true leaf stage (approx.

8-10 days after sowing).

8.2. Prepare a suspension in sterile demineralised water of a 24-48 h suspect bacterial culture grown on KBBCA and SNAC and dilute to a concentration of 10

6 cfu/mL (CCP).

8.3. Repeat with a 24-48 h positive control culture to get a concentration of 106

cfu/mL (CCP).

8.4. Inject each bacterial suspension with a syringe and needle in the stem of at least 2 pea seedlings (2 seedlings per suspect colony).

8.5. Repeat injection with sterile demineralised water in the stem of 2 pea seedlings to serve as negative control.

8.6. Incubate the inoculated seedlings at 20oC (± 5

oC) with saturating humidity.

8.7. Examine seedlings for extended greasy lesions from the point of inoculation after 5-9 days. Compare with positive and negative controls (CCP).

8.8. Record the suspect colonies as positive if greasy lesions are observed.

Fig. 1. Plate of KBBCA medium after 4 days of incubation at 28°C ( 2°C) showing

typical colonies of P. syringae pv. pisi.


Fig. 2. Plate of SNAC medium after 4 days of incubation at 28°C ( 2°C) showing

typical colonies of P. syringae pv. pisi that are levan positive.

Fig. 3. Fluorescent and non-fluorescent P. syringae pv. pisi isolates under a UV light.

Fig. 4. Oxidase negative positive control isolate (A) and oxidase positive non P.

syringae pv. pisi isolate (B).

Fig. 5. Typical greasy lesions on the stem of a pea seedling cv. Kelvedon, 9 days

after inoculation following pathogenicity assay Option 1.

(A

)

(B

)



Preparation of ten-fold dilution series

Each dilution should be prepared by pipetting 0.5 mL (± 5%) from a well-mixed seed extract or previous dilution into a universal bottle (screw-capped) or similar container containing 4.5 mL (± 2%) of sterile diluent and then vortexing to mix prior to the next dilution step. A new sterile pipette tip should be used for each dilution step. Pipettes should be checked regularly for accuracy and precision and re-calibrated as necessary. It is acceptable to prepare ten-fold dilutions using other volumes provided that the laboratory can demonstrate that the required accuracy and precision can be achieved.

Plating of dilutions.

This should be done as soon as possible after dilutions have been prepared and certainly within 30 min. Working from the highest (most dilute) dilution to the undiluted extract, 0.1 mL is pipetted onto the centre of a surface-dry, labelled agar plate. The liquid should then be spread evenly over the entire surface of the medium with a bent glass rod. If care is taken to work from the highest to the lowest dilution (or undiluted extract) a single pipette tip and a single bent glass rod can be used for each sample. Ensure that all liquid has been absorbed by the agar before inverting and incubating plates. If necessary allow plates to dry under a sterile air-flow in a microbiological safety cabinet or laminar flow hood.

Sectored Plates

Using a laboratory marker pen draw lines on the base of a standard 9 cm plate (Petri dish) to divide it into six equal sectors. Subculture single colonies from dilution plates and make a single zigzagged streak within a single sector on the plate. Take care to leave sufficient space between each isolate to ensure the growth does not coalesce. Thus six suspect colonies can be subcultured to each sectored plate. Separate plates should be used for each sample/subsample. If the purity of subcultured isolates is doubtful, they should be further streaked out on whole plates.

Reporting Results

The result of a seed health test should indicate the scientific name of the pathogen and the test method used. When reported on an ISTA Certificate, results are entered under Other Determinations.

In the case of a negative result (pathogen not detected in any subsamples), the results should be reported in terms of the tolerance standard and detection limit. The tolerance standard depends on the total number of seeds tested, n, and is approximately 3/n (P=0.95) (see Roberts et al., 1993); the detection limit per subsample is equal to the detection limit per mL multiplied by the volume of extract.

In the case of a positive result, the report should indicate the number of positive subsamples out of the total number tested and the sample size or the maximum likelihood estimate of the proportion of infested seeds.

Quality Assurance General

A record should be kept of the date and results of pipette calibration checks.

It is essential that operators have received appropriate training and use automatic pipettes correctly.


[Identified by CCP in the methods]

Dilution plates prepared from positive control isolate(s) or reference material, should give single colonies with typical morphology (Step 5.1).

The numbers of colonies on dilution plates prepared from the positive control isolate(s) or reference material should be similar on both media (Step 5.1).

Numbers of bacteria on dilution plates should be consistent with the dilution (i.e. should decrease approx. tenfold with each dilution) (Step 5.1).

There should be no growth on dilution plates prepared as a sterility check (Step 5.1).

Due to the potential for non-pathogenic isolates to be present in seed lots together with pathogenic isolates, it is essential to subculture, if present, at least the minimum number of suspect colonies specified (two per subsample and per semi-selective medium) (Steps 6.1, 6.2) and to test all Pseudomonas-like subcultured isolates for pathogenicity (Step 6.10).

In Pathogenicity Test Option 2, the bacterial suspension of suspect and positive control colonies must not have a concentration higher than 10

6 cfu/mL (Steps 8.2 and

8.3). If the concentration exceeds the 106 cfu/mL then the risk of not having typical


symptoms on seedlings increases and in this case the test will not be considered accurate.

Positive control isolates (Steps 7.3 and 8.3) and inoculations with sterile demineralised water (Steps 7.5 and 8.5) should be included in every pathogenicity test.

The positive control isolate should give typical symptoms (Steps 7.7 and 8.7) and the negative control should give no symptoms in the pathogenicity test.

The activity units per gram of some antibiotics may vary between batches. It may be necessary to adjust the weight or volume added to ensure that the final number of units per litre of medium is consistent (KBBCA and SNAC media).

References Elvira-Recuenco., M. and Taylor, J.D. (2001). Resistance to bacterial blight

(Pseudomonas syringae pv. pisi) in Spanish pea (Pisum sativum) landraces.

Euphytica 118, 305-311.

Fraaije, B.A., Franken, A.A.J.M., van der Zouwen, P.S., Bino, R.J. and Langerak, C.J.

(1993). Serological and conductimetric assays for the detection of Pseudomonas

syringae pathovar pisi in pea seeds. Journal of Applied Microbiology 75, 409–415.

Grondeau, C. (1992). La graisse bactérienne du pois proteagineux due à

Pseudomonas syringae pv. pisi: identificaion, épidémiologie et méthodes de lutte.

Thèse de l’Institut National Polytechnique de Toulouse, 146 pp.

Grondeau, C., Saunier, M., Poutier, F. and Samson, R. (1992). Evaluation of

physiological and serological profiles of Pseudomonas syringae pv. pisi for pea blight

identification. Plant Pathology 41, 95–505.

Grondeau, C., Olivier, V. and Samson, R. (1993). Détection de Pseudomonas

syringae pv. pisi dans les semences de pois: Méthodes, limites et controverses.

Phytoma 455, 45-47.

Grondeau, C., Mabiala, A., Ait-Oumeziane., R. and Samson., R. (1996). Epiphytic life

is the main characteristic of the life cycle of Pseudomonas syringae pv. pisi, pea

bacterial blight agent. European Journal of Plant Pathology 102, 353-363.

Hollaway, G. J. and Bretag T. W. (1997) Survival of Pseudomonas syringae pv. pisi in

soil and on pea trash and their importance as a source of inoculum for a following

field pea crop. Australian Journal of Experimental Agriculture 37, 369–375.

Hollaway, G. J., Bretag, T. W. and Price, T. V. (2007). The epidemiology and

management of bacterial blight (Pseudomonas syringae pv. pisi) of field pea (Pisum

sativum) in Australia: a review. Australian Journal of Agricultural Research 58, 1086–

1099.

Lyons N.F. and Taylor J.D. (1990). Serological detection and identification of bacteria

from plants by conjugated Staphylococcus aureus slide agglutination test. Plant

Pathology 39, 584-590.

Malandrin L. and Samson R. (1998). Isozyme analysis for the identification of

Pseudomonas syringae pathovar pisi strains. Journal of Applied Microbiology 84:

895–902.

Mohan, S.K. and Schaad, N.W. (1987). An improved agar plating assay for detecting

Pseudomonas syringae pv. syringae and Pseudomonas syringae pv. phaseolicola in

contaminated bean seeds. Phytopathology 77, 1390-1395.

Roberts, S.J. (1992). Effect of soil moisture on the transmission of pea bacterial blight

(Pseudomonas syringae pv. pisi) from seed to seedling. Plant Pathology 41, 136–

140.

Roberts, S.J., Ridout, M.S., Peach, L. and Brough, J. (1996). Transmission of pea

bacterial blight (Pseudomonas syringae pv. pisi) from seed to seedling: effects of

inoculum dose, inoculation method, temperature and soil moisture. Journal of Applied

Microbiology 81, 65–72.

Schaad, N.W. (1982). Detection of seedborne bacterial plant pathogens. Plant

Disease 66, 885-890.

http://www.springerlink.com/content/?Author=M.+Elvira-Recuenco

http://www.springerlink.com/content/?Author=J.D.+Taylor

http://www.springerlink.com/content/w25465k011n16380/

http://www.springerlink.com/content/w25465k011n16380/

http://www.springerlink.com/content/?Author=Catherine+Grondeau

http://www.springerlink.com/content/?Author=Alexandre+Mabiala

http://www.springerlink.com/content/?Author=Rachid+Ait-Oumeziane

http://www.springerlink.com/content/?Author=R%c3%a9gine+Samson

http://www.springerlink.com/content/t614nr11l1557870/



http://www.springerlink.com/content/0929-1873/

http://www.springerlink.com/content/0929-1873/102/4/

http://onlinelibrary.wiley.com/doi/10.1111/ppa.1992.41.issue-2/issuetoc

http://onlinelibrary.wiley.com/doi/10.1111/jam.1996.81.issue-1/issuetoc


Preparation of sterile saline

Compound g/L

Sodium chloride (NaCl) 8.5


Preparation

1. Weigh out all ingredients into a suitable container.

2. Add 1000 mL of distilled/de-ionised water.

3. Dissolve and dispense into the final containers.


Storage

Provided containers are tightly closed, may be stored for several months before use.

Preparation of KBBCA medium

Compound g/L g/500 mL

Proteose peptone (e.g.#3 Difco) 20.0 g 10.0 g

Glycerol 10.0 g 5.0 g

K2HPO4 1.5 g 0.75 g

MgSO4 anhydrous 0.73 g 0.365 g

H3BO3 1.5 g 0.75 g

NaOH (1N) 2.0mL 1.0 mL

Agar 15 g 7.5 g

Distilled/de-ionised water 1000 mL 500 mL

Cycloheximidea 100.0 mg 50.0 mg

Cephalexin monohydrateb 40.0 mg 20.0 g

a, b Added after autoclaving

Preparation

1. Weigh out all ingredients except the antibiotics into a suitable container.


3. Stir to dissolve.


5. Prepare the antibiotic solutions and filter sterilise as appropriate.

6. Allow the medium to cool to approximately 50°C before adding the antibiotic solutions.

7. Mix the molten medium gently to avoid air bubbles and pour the plates (18 mL per 9.0 cm plate).


Antibiotics (amounts for guidance only, CCP) a Dissolve 500 mg of cycloheximide in 10 mL 70% ethanol. Add 1 mL/L.

b Dissolve 800 mg of cephalexin monohydrate in 10 mL 70% ethanol. Add 1 mL/L.

(Filter sterilise when the antibiotics are dissolved in water rather than 70% ethanol)

Note

Nystatin could be used as an alternative for cycloheximide to control fungi. Dissolve 350 mg of nystatin in 10 mL 70% ethanol, add 1 mL to cool medium.

Storage

Store prepared plates inverted in polythene bags at 4-8°C and use within four weeks of preparation to ensure activity of antibiotics.


Preparation of SNAC medium

Compound g/L g/ 500 mL

Tryptone 5.0 g 2.5 g

Peptone 3.0 g 1.5 g

NaCl 5.0 g 2.5 g

Sucrose 50.0 g 25 g

H3BO3 10 mL (0.1g/mL) 5 mL

Agar 15 g 7.5 g

Distilled/de-ionised water 1000 mL 500 mL

Cephalexin monohydratea 80.0 mg 40.0 mg

Nystatinb 35.0 mg 17.5 mg

a, b Added after autoclaving

Preparation

1. Weigh out all ingredients except the agar, antibiotics, skim milk powder and Tween 80 into a suitable container.


3. Stir to dissolve.


5. Prepare the antibiotic solutions.

6. Allow medium to cool to approximately 50°C and add the antibiotic solutions.

7. Mix the molten medium gently to avoid air bubbles and pour the plates (18 mL per 9.0 cm plate).


Antibiotics (amounts for guidance only, CCP) a

Dissolve 800 mg of cephalexin monohydrate in 10 mL 70% ethanol. Add 1 mL/L. b Dissolve 350 mg of nystatin in 10 mL 70% ethanol. Add 1 mL/L.

(Filter sterilise when antibiotics are dissolved in water rather than 70% ethanol)

Storage

Store prepared plates inverted in polythene bags at 8°C ( 2°C) and use within four weeks of preparation to ensure activity of antibiotics.


C.7.5


C.7.6. New seed health method

7-007: Detection of Alternaria linicola, Botrytis cinerea and

Colletotrichum lini on Linum usitatissimum (Flax) seed

New seed health method combining existing methods 7-007, 17 and 18.

The old methods will be deleted and the new combined method numbered 7-007.



Crop: Linum usitatissimum L. (flax, linseed)

Pathogens: Alternaria linicola J.W. Groves & Skolko, Botrytis cinerea Pers. (Teleomorph: Botryotinia fuckeliana (de Bary) Whetzel), and Colletotrichum lini (Westerd.) Tochinai, (= Colletotrichum linicola Pethybr. & Laff.)

Authors: V. Grimault1, I. Serandat

1, C. Brochard

1, R. Kohen

2, S. Brière

3

1GEVES-SNES rue Georges Morel- BP 90024--49071 BEAUCOUZE

cedex, France. e-mail: [email protected]

2Official Seed Testing Laboratory; The Volcani Center A.R.O. Bet-

Dagan 50520, Israël. e-mail: [email protected]

3Canadian Foof Inspection Agency-3851 Fallowfield Road, Ottawa,

Ontario, Canada. e-mail: [email protected] Revision History: Replacement of methods 7-007, 7-017 and 7-018, Version

November 2010. New version 2.0, 1 January 2014.

Background Three ISTA methods (7-007, 7-017 and 7-018) were used to detect the three main

pathogens of flax seeds, Botrytis cinerea, Alternaria linicola, Colletotrichum lini. The

Seed Health Committee of ISTA decided to amalgamate these three methods in a

simple one to detect the three pathogens. These three methods were compared and

conditions which varied between these methods and also with the other ISTA existing

ones were identified. A pretest was carried out in GEVES to compare the

concentration of streptomycin, temperature, light and medium on four replicates of

100 seeds. All conditions tested allowed the detection of the three pathogens, and

addition of streptomycin at 50 mg/L in the media allowed to avoid the development of

bacteria and at the same time did not affect the detection of the three pathogens. A

peer validation between the three participating laboratories was then carried out by

comparing the five proposed conditions. Based on these results, a new method was

proposed to detect the three pathogens of Linum with only one method. In this

method, two media can be used: Potato Dextrose Agar or Malt Agar with

streptomycin, seeds are incubated at 20°C, in darkness for 9 days and then under 12

h NUV/12 h dark to enhance sporulation if problem for pathogen identification occurs.

The validation studies showed that this method allowed detection of Alternaria

linicola, Botrytis cinerea, and Colletotrichum lini at a threshold of 1% with 100%

specificity and a sensibility of 73, 77 and 100% for Botrytis cinerea, Colletotrichum lini

and Alternaria linicola respectively. The comparative test has been organized by

International Seed Testing Association Seed Health Committee.

Validation studies Grimault V., Serandat I., Brochard C., Kohen R., Brière S. (2010). Peer validation for

detection of three fungal pathogens infecting Linum seeds by a single method.

Grimault V., Serandat I., Brochard C. (2010). Validation study for the new proposed

method to detect Botrytis cinerea, Alternaria linicola and Colletotrichum lini on Linum. Copies are available by e-mail from [email protected], or by mail from the ISTA Secretariat.






Safety Precautions Ensure you are familiar with hazard data and take appropriate safety precautions,

especially during preparation of media, autoclaving and weighing out of ingredients. It

is assumed that this procedure is being carried out in microbiological laboratory by

persons familiar with the principles of Good Laboratory Practice, Good

Microbiological Practice, and aseptic technique. Dispose of all waste materials in an

appropriate way (e.g. autoclave, disinfect) and in accordance with local health, safety

and environmental regulations.

Treated Seed This method has not been validated for the determination of Alternaria linicola,

Botrytis cinerea and Colletotrichum lini on treated seed. Seed treatments may affect

the performance of the method.

(Definition of treatment: any process, physical, biological or chemical, to which a

seed lot is subjected, including seed coatings. See 7.2.3.).

Sample Size The sample (total number of seeds tested) or subsample size to be tested depends on the desired tolerance standard (maximum acceptable percentage of seeds infested) and detection limit (theoretical minimum number of pathogen propagules per seed which can be detected). In any case, the minimum sample size should be of 400 seeds.

Materials

Reference material: The use of reference cultures or other appropriate material is

recommended.

PDA or MA plates with streptomycin sulphate: 9.0 cm Petri dishes (one per 10

seeds) Incubator: capable of operating at 20 ± 2°C, equipped with timer-controlled near

ultraviolet light (NUV, peak at 360 nm).

Sample Preparation The test is carried out on a working sample as described in Section 7.4.1 of the

International Rules for Seed Testing.

Method

1. Plating

Aseptically place a maximum of 10 seeds per plate, evenly spaced, onto the agar surface of each PDA or MA plate. 2. Incubation

Incubate plates for 9 days at 20°C in the dark. 3. Reference material

Subculture a reference culture to a PDA or MA plate at the same time the seeds are plated and incubate with the test plates. 4. Examination After 9 days of incubation, examine plates for Alternaria linicola, Botrytis cinerea and Colletotrichum lini.

Record the number of infected seeds in each plate, for each pathogen. 5. Prolongation of incubation

If no sporulation is observed at 9 days, extend incubation at 20°C with alternating 12 h periods of darkness and NUV to obtain spores until 14 days after plating. Examine plates for Alternaria linicola, Botrytis cinerea and Colletotrichum lini. Record the number of infected seeds in each plate, for each pathogen.

Identification criteria

Alternaria linicola: Examine plates for dense olive grey colonies, 1.5-3 cm diameter. Some colonies of saprophytic Alternaria spp. can resemble those of A. linicola but the conidia of A.


linicola are diagnostic (Fig. 1). Colonies should therefore be examined under x50 –

x100 magnification. Conidiophores are simple, occurring singly or in bundles, pale olivebrown, septate, and variable in length 5-8 μm. Conidia form singly, are smooth walled, olive-brown, obclavate with long, tapering occasionally branched beaks muriform 4-16 μm with transverse septa and occasionally 1-4 longitudinal septa, sometimes slightly constricted at the septa (Corlett and Corlett 1999; David 1991; Malone and Muskett 1997). Short red streaks and water soaked areas may be visible on the hypocotyls and cotyledons of some infected seedlings (Fig. 2).

Fig. 1. Olive-grey colonies of A. linicola and darker colonies of saprophytic A.

alternata on malt agar.

Fig. 2. Reddish streaks on cotyledons and hypocotyls (arrows) caused by Alternaria


linicola (right) and conidia of A. linicola x600 (left). Botrytis cinerea: Examine for roots showing a soft rot and covered by abundant grey mycelium (Fig. 3) or just mycelium very flat, diffuse and not aerial, possibility of sclerotia producing (Fig. 4). Colonies on agar measure up to 5 cm in diameter after 5 days. Identification can be checked by high-power microscope (magnification x200). Mycelium of tape-like hyphae producing bunches of branching conidiophores with ovoid-hyaline one-celled conidia 8–11 × 6–19 μm (Fig. 5). When analysts are familiar with the fungus, naked eye examination is sufficient for identification (Muskett and Malone 1941; Tempe 1963; Malone and Muskett 1997; Ellis and Waller 1974).

Fig. 3. Seedling showing a soft rot (arrow) and abundant sporulated grey mycelium.


Fig. 4. Colonies of Botrytis cinerea spreading from diseased flax seed on malt agar

after 9 days of incubation. Sclerotia are visible (right).

Fig. 5. Conidiophores and conidia of Botrytis cinerea and tapelike mycelium. x150.

Colletotrichum lini:

C. lini is easily recognised by visual examination. Examine the plates for shell pink to


salmon coloured colonies (Fig. 6). Colonies of C. lini are a fine wooly-grey at the

centre to salmon pink at the outer edge. Dark globose fuiting bodies (acervuli) may be scattered throughout the agar adjacent to the seed (Fig. 7). Characteristic long, black tapering hairs or setae 2-5 septate, 60-120 x 2-4 μm arise from the base of each acervulus. Bright orange conidial masses appear on the seed and agar adjacent to the seed. Conidia are hyaline; oblong to dumbell shaped, one celled, straight ends 9-15 x 3-4 μm (Malone and Muskett 1997; Kulshrestha et al., 1976). Record the number of infected seeds in each plate.

Fig. 6. Salmon colored colonies of Colletotrichum lini growing from flax seed on malt

agar.


Fig. 7. Acervuli of Colletotrichum lini. on flax seedling


1. Checking tolerances

Tolerances provide a means of assessing whether or not the variation in results

within or between tests are sufficiently wide as to raise doubts about the accuracy

of the results. Suitable tolerances, which can be applied to most direct seed

health tests, can be found in Tables 5B of Chapter 5 of the ISTA Rules, or in the

Handbook of Tolerances and Measures of Precision for Seed Testing by S.R.

Miles (Proceedings of the International Seed Testing Association 28 (1963) No3,

p 644).

2. Reporting results

The result of a seed health test should indicate the scientific name of the

pathogen detected and the test method used. When reported on an ISTA

International Seed Analysis Certificate, results are entered under Other

Determinations.

In the case of a negative result (pathogen not detected), the results should be

reported in terms of the tolerance standard (for example infection level less than

1% with 95% probability). The tolerance standard depends on the total number of

seeds tested, n, and is approximately 3/n (P=0.95) (see Roberts et al., 1993).

In the case of a positive result, the report should indicate percentage of infected

seeds.

Quality

Assurance

Specific Training

This test should only be performed by persons who have been trained in fungal

identification or under the direct supervision of someone who has.

Critical Control Points [identified in the methods by “CCP”].

Preparation of PDA or MA plates: the source of agar may influence the results. The level of available nutrients may vary from manufacturer to manufacturer. Both PDA and MA can be bought as a powdered medium, or MA can be made up as per recipe. Suitable products used in the comparative test include PDA, Cristomalt, agar-agar and streptomycin. Any equivalent products should be suitable. Whenever a new batch of agar is used, a check on the quality should be made, using a reference lot with a known infection level, or a reference isolate and sustainability of isolate measured. Pay particular attention to the growth characteristics of reference isolates.

Preparation of PDA + streptomycin

PDA (CCP i.e. Difco or equivalent): 39 g Distilled/de-ionized water: 1000 mL


Streptomycin sulphate*: 50 mg

*added after autoclaving Preparation

1. Weigh out ingredients into a suitable autoclavable container. 2. Add 1000 mL of distilled/de-ionized water. 3. Dissolve powdered PDA in the water by stirring. 4. Autoclave at 121°C and 15 p.s.i. for 20 min. 5. Allow the agar to cool to approximately 50°C and add streptomycin sulphate dissolved in sterile distilled water. 6. Pour 18-20 mL of the molten agar into 9.0 cm Petri dishes and allow to solidify before use.

Streptomycin sulphate Streptomycin sulphate can be dissolved in sterile distilled water. Storage

Prepared plates may be stored at 4°C for up to 6 weeks.

Preparation of MA + streptomycin

Agar-agar: 20 g Malt: 10 g Distilled/de-ionized water: 1000 mL Streptomycin sulphate*: 50 mg

*added after autoclaving If using a commercial preparation ensure that it contains 2% agar and 1% malt extract. Preparation

1. Weigh out ingredients into a suitable autoclavable container. 2. Add 1000 mL of distilled/de-ionized water. 3. Dissolve in the water by stirring. 4. Autoclave at 121°C and 15 p.s.i. for 20 min. 5. Allow the agar to cool to approximately 50°C and add streptomycin

sulphate dissolved in sterile distilled water. 6. Pour 18-20 mL of the molten agar into 9.0 cm Petri dishes and allow to

solidify before use. Streptomycin sulphate Streptomycin sulphate can be dissolved in sterile distilled water. Storage

Prepared plates may be stored at 4°C for up to 6 weeks.

References Anselme, C. and Champion, R. International Seed Testing Association (2012).

International rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-007 - Linum usitatissimum; Botrytis cinerea, p.1-7.

Champion, R. (1997). Identifier les champignons transmis par les semences. INRA

Editions, Paris, 398p.

Corlett, M. and Corlett, M. (1999). Fungi Canadensis No 341 Alternaria linicola.

Canadian Journal of Plant Pathology 21, 55-57.

David, J.C. (1991). CMI Descriptions of Fungi and Bacteria No. 1075 Alternaria

linicola. Mycopathologia 116, 53-54.

Ellis, M.B. and Waller J.M. (1974). C.M.I. Descriptions of pathogenic fungi and

bacteria No. 431. Commonwealth Mycological Institute, Kew. Kulshrestha, D.D., Mathur, S.B. and Neergaard, P. (1976). Identification of seed-

borne species of Colletotrichum. Friesia 11, 116-125.

Malone, J.P. and Muskett, A.E. (1997). Seed-borne fungi. Description of 77 fungus

species. Sheppard, J.W. (Ed.), 19-20. International Seed Testing

Association, Zurich, Switzerland.

Miles, S.R. (1963). Handbook of Tolerances and Measures of Precision for Seed

Testing. Proceedings of the International Seed Testing Association 28 (3).

Muskett, A.E. and Malone, J.P. (1941). The Ulster method for the examination of flax

https://www.seedtest.org/upload/cms/user/7-007.pdf


seed for the presence of seed-borne parasites. Annals of Applied Biology

28, 8-13.

Roberts, S.J., Phelps, K., Taylor, J.D. and Ridout, M.S. (1993). Design and interpretation of seed health assays. In: Sheppard, J.W., (Ed.) Proceedings of the First ISTA Plant Disease Committee Symposium on Seed Health Testing, Ottawa, Canada. pp. 115-125. Agriculture Canada, Ottawa, Canada.

Sheppard, J.W. International Seed Testing Association. (2012). International rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-017 - Linum usitatissimum; Alternaria linicola, p.1-6.

Sheppard, J.W. International Seed Testing Association. (2012). International rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-018 - Linum usitatissimum; Colletotrichum lini, p.1-6.

Tempe J. de (1963). Health testing of flax seed. Proceedings of the International Seed Testing Association28, 107-131.

Source of photographs

Figures 1 and 2: International Seed Testing Association. (2012).International Rules for Seed testing, annexe to Chapter 7 Seed Health Testing Methods, 7-017- Linum usitatissimum, Alternaria linicola, p. 1-6. Figures 3 and 4: GEVES-SNES, rue Georges Morel- BP 90024--49071 BEAUCOUZE cedex, France. Figure 5: International Seed Testing Association. (2012). International Rules for Seed testing, annexe to Chapter 7 Seed Health Testing Methods, 7-007- Linum usitatissimum, Botrytis cinerea, p. 1-7. Figure 6 (left): International Seed Testing Association. (2012). International Rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-018- Linum usitatissimum, Colletotrichum lini, p. 1-6. Figures 6 (right) and 7: GEVES-SNES, rue Georges Morel- BP 90024--49071 BEAUCOUZE cedex, France.


C.7.6






Chapter 8: Species and Variety Testing

C.8.1. Editorial and Committee review of the whole of Chapter 8.

Chapter 8 has been reviewed to make sure the Chapter is up to date. In addition

editorial changes have been made to reflect the new Chapter 19 proposed on GMO

testing. Note: if the vote on Chapter 19 results in any text modifications the

following text for Chapter 8 may need to be editorially modified by the Rules Chair

and Vice-Chair before publishing as the 2014 edition of the ISTA Rules.

This proposal is submitted by the Variety Committee and approved by vote.


Chapter 8: Species and Variety

Testing

8.1 Objects

Chapter 8: Species and Variety

Testing

8.1 Object

8.1.1 Verification of species and variety

The object is to determine the extent that

the submitted sample conforms to the

species or variety as requested by the

applicant, using methods not permissible

in a purity test according to Chapter 3.

The object of species and variety

verification is to determine the extent

that the submitted sample conforms to

the species or variety as requested by the

applicant, using methods not permissible


8.1.2 Testing for the presence of

specified traits

The object is to test for the presence of

traits in the submitted sample as

specified by the applicant (for examples

see 8.2.2) using methods not permissible


8.2 Definitions

8.2.1 Authentic standard sample

An authentic standard sample is a valid

seed sample of species or variety

identity or a valid sample with presence

of the specified traits.

8.2 Definitions

8.2.1 Authentic standard sample

An authentic standard sample is a seed

sample of a known species or variety or

a sample with a known specific trait. It is

recommended that this sample is of a

known origin, e.g. a certified reference

sample or a sample taken by an official

or another person who can vouch for the

sample identity and characteristics. This

sample will be used for obtaining

enzymatic, protein or DNA profiles.



8.2.2 Standard reference

A standard reference is a valid

descriptive attribute of a species or

variety, e.g. zygosity; isozyme, protein

or DNA banding pattern produced by gel

electrophoresis or similar techniques;

allelic profile or nucleotide sequence.

8.2.2 Standard reference

A standard reference is a valid

descriptive attribute of a species or

variety, e.g. zygosity, or an isozyme,

protein or DNA banding pattern

produced by gel electrophoresis or

similar techniques, or an allelic profile

or nucleotide sequence or a molecular

weight standard (MWS) for protein or

DNA. This descriptive attribute should

be obtained by an in-house validated or

internationally validated methodology

and should be from an authentic

standard sample or obtained from a

reliable source as for MWS.

8.2.3 Performance approved methods

Performance approved methods are

evaluated, approved and implemented

by the testing laboratory according to the

principles of the performance based

approach as laid down in the ISTA

document Principles and Conditions for

Laboratory Accreditation under the

performance based approach. They are

restricted to bio-molecular tests and

bioassays for the object of testing for the

presence of specified traits. Performance

approved methods can only be applied

when no standardised method is

included in this chapter for the test

required.

8.2.3 Performance approved methods

Performance approved methods are

evaluated, approved and implemented by

the testing laboratory according to the

principles of the performance based

approach as laid down in the ISTA

document Principles and Conditions for

Laboratory Accreditation under the

performance based approach.

8.3 General principles

8.3.1 Field of application

8.3.1.1 Verification of species and

variety

The determination is valid only if the

species or variety is stated by the

applicant, …


8.3.1 Field of application

The determination of a species or variety

is valid only if the species or variety is

stated by the applicant, ….

8.3.1.2 Testing for the presence of

specified traits

(Deletion of section).

8.3.2 Testing principles The determination is carried out,

depending on the species or variety or

specified trait in question, on seeds,

seedlings or more mature plants grown

in a laboratory, a glasshouse, a growth

chamber or a field plot.

8.3.2 Testing principles The determination is carried out,

depending on the species or variety in

question, on seeds, seedlings or more

mature plants grown in a laboratory, a

glasshouse, a growth chamber or a field

plot.



When an authentic standard sample is

available, the working sample is

compared with the authentic standard

sample. Whenever possible, the working

sample and the authentic standard

sample shall be handled in the same

way, e.g. in field plots they shall be

grown contemporaneously, near-by and

in identical environmental conditions,

and the evaluation shall be done at the

same stage of development.

When an authentic standard sample is

available, the working sample is

compared with the authentic standard

sample. Whenever possible, the working

sample and the authentic standard

sample must be handled in the same

way, e.g. in field plots they must be

grown contemporaneously, near each

other and in identical environmental

conditions, and the evaluation must be

done at the same stage of development.

When a standard reference is available,

the test is done by comparing the traits

of the seeds, seedlings or plants of the

working sample with the standard

reference.

When a standard reference is used in a

test, the interpretation of the result is

done by comparing the descriptive

attributes of the seeds, seedlings or

plants of the working sample with the

standard reference.

In the case of species or variety …

8.3.2.1 Principles for verification of

species and variety

In the case of species or variety …

8.3.2.2 Principles for testing for the

presence of specified traits

(Deletion of section)

8.4 Personnel and equipment The determination shall be made by a

specialist familiar with the

morphological, physiological,

biomolecular or other trait of seeds.

…

8.4 Personnel and equipment Determinations must be made by a

specialist familiar with the

morphological, physiological,

biomolecular or other traits of seeds.

….

Appropriate facilities and equipment

must be available as specified in detail

in 8.8 for testing the specified trait, and

in general as follows:

In the laboratory: …

In glasshouses and growth chambers:

…

Appropriate facilities and equipment

must be available as specified in detail in

8.8 for testing species and variety as

follows:

In the laboratory: …

In glasshouses and growth chambers:

…

In field plots: climatic, soil and cultural

conditions to permit normal

development of the trait and sufficient

protection against pests and diseases.

In field plots: climatic, soil and cultural

conditions to permit normal

development of the trait to be tested and

sufficient protection against pests and

diseases.

8.5 Procedures

8.5.1 Submitted sample …

§2

Guiding values for the size of the

submitted sample for tests covered by

this chapter are as follows:

8.5 Procedures

8.5.1 Submitted sample

…

§2

The guiding values for the size of the

submitted sample for tests covered by

this chapter are as follows:

… (Table unchanged) … (Table unchanged)

Depending on the method and the degree

of precision required, more seeds or less

seeds than the amount listed above may

be necessary.

Depending on the method and the degree

of precision required, more seeds or

fewer seeds than the amount listed above

may be necessary.



8.5.2 Working sample §1…

Preparation of the working sample and

the replicates shall be done according to

procedures described under 2.5.2.


§1 …

Preparation of the working sample and

the replicates must be done according to

the procedures described under 2.5.2.

8.5.2.1 Working samples for testing for

the presence of specified traits


8.5.3 Examination of seeds …

§2 For testing chemical traits, the seeds

shall be treated with the appropriate

reagent, and the reaction of each seed

noted.

…

8.5.3 Examination of seeds

…

§2 For testing chemical traits, the seeds

be treated with the appropriate reagent,

and the reaction of each seed must be

noted.

…

8.5.6 Examination of plants in field

plots §1 Each working sample shall be sown

in at least two replicate plots. …

8.5.6 Examination of plants in field

plots

§1 When plants are tested in field plots,

each working sample must be sown in at

least two replicate plots. ….

§2 Observations shall be made during

the whole growing period, but

particularly at times indicated in 8.10. …

§2 Observations must be made during

the whole growing period, but

particularly at the times indicated in

8.10. …

8.6 Calculation and expression of

results The calculation and expression of results

depends on the object, the method used,

the testing plan and whether a qualitative

or quantitative result or a confidence

probability for meeting a threshold is

requested by the applicant. …

8.6 Calculation and expression of

results The calculation and expression of results

depends on the object, the method used,

the testing plan and whether a qualitative

or quantitative result is requested by the

applicant. …

In the case of testing for the presence of

specified traits the result shall be

expressed as agreed with the applicant

by:

either reporting whether the trait is

present or not,

or calculating and expressing the

proportion of the trait,

or calculating and expressing the

confidence probability that the true

proportion of

the trait meets or exceeds a specification

on the basis of the test result.

8.6.1 Examination of individual seeds,

seedlings or plants

8.6.1 Examination of individual seeds,

seedlings or plants

§3… If the applicant requested a

reporting in a different way, it shall be

given in addition.

…

§3… If the applicant requests reporting

in a different way, it must be in addition

to the above..

…



8.6.2 Tests for traits of bulk samples Tests may be done by measuring traits

of a bulk sample that do not allow a

reference to individual seeds, seedlings

or plants. There are various different

principles for calculation and expression

of test results of such measurements.

The result shall be expressed as agreed

with the applicant.

8.6.2 Tests for traits of bulk samples For bulk samples, tests may be done by

measuring traits that do not allow a

reference to individual seeds, seedlings

or plants. There are various principles

for calculation and expression of test

results of such measurements. The result

must be expressed as agreed with the

applicant.

8.6.3 Calculation of the confidence

probability that the seed lot meets or

exceeds a specification



The results must be reported under

‘Other determinations’, …


Results must be reported under ‘Other

determinations’, …

8.7.1 Reporting results of verification

of species and variety

8.7.1.1 Results of examination of

individual seeds or seedlings

Suggested phrases for reporting

divergent seeds or seedlings, depending

upon the result are as follows:

…

8.7.1 Reporting results of verification

of species and variety

8.7.1.1 Examination of individual seeds

or seedlings

Suggested phrases for reporting

divergent seeds or seedlings are as

follows, depending upon the result:

…

8.7.1.2 Results of a field plot

examination

The results must, whenever possible, be

reported as a percentage of each other

species, other variety or aberrant found.

…

8.7.1.2 Field plot examinations

The results of a field plot examination

must, whenever possible, be reported as

a percentage of each other species, other

variety or aberrant found. …

8.7.2 Reporting test results of

presence of specified traits


8.8 Standardized methods for

examination of seeds

8.8.1 Cereals

Morphological characters of grain can be

observed by direct visual examination or

with suitable magnification.

In Hordeum, the most useful characters

are shape of grain, base of lemma,

colour, ventral crease hairs, opening of

ventral crease, rachilla hairs, dentation

of lateral dorsal nerves, wrinkling of

lemma and palea, shape and hairiness of

lodicules.

In Avena a useful character is grain

colour, which may be white, yellow grey

or black.

…

8.8 Standardized methods

8.8.1 Cereals

Morphological characters of cereal

grains can be observed by direct visual

examination or with suitable

magnification.

In Hordeum, the most useful characters

are shape of the grain, base of the

lemma, colour, hairs in the ventral

crease, opening of the ventral crease,

rachilla hairs, dentation of the lateral

dorsal nerves, wrinkling of the lemma

and palea, and shape and hairiness of the

lodicules.

In Avena a useful character is grain

colour, which may be white, yellowish

grey or black.

…



8.8.2 Fabaceae (Leguminosae) and

Poaceae (Graminae) …

In Lupinus spp., presence or absence of

alkaloids is a diagnostic feature. Soak

the seeds singly in water (2.5–5.0 ml

each seed) for at least 2 h in transparent

dishes or other suitable equipment.

Scarify or pierce each seed with an

appropriate tool (scalpel, needle, pliers)

to remove hardseededness and to allow a

release of alkaloids into the soaking

water. Soak the seeds for a further 5–24

h in water. Add 1–3 drops of freshly

prepared 1% Lugol’s solution (1.0 g

iodine + 2.0 g potassium iodide, made

up with water to 100 ml) to each seed. A

distinct brown-red precipitate indicates

presence of alkaloids. Cases of doubt

can be solved easily by adding further

drops of the Lugol’s solution. Evaluation

can be done on either a white surface or

a luminescent screen.

8.8.2 Fabaceae (Leguminosae) and

Poaceae (Graminae)

…

In Lupinus spp., the presence or absence

of alkaloids is a diagnostic feature. Soak

the seeds singly in water (2.5–5.0 mL for

each seed) for at least 2 h in transparent

dishes or other suitable equipment.

Scarify or pierce each seed with an

appropriate tool (scalpel, needle, pliers)

to remove hardseededness and to allow a

release of alkaloids into the water. Soak

the seeds for a further 5–24 h. Add 1–3

drops of freshly prepared 1% Lugol’s

solution (1.0 g iodine + 2.0 g potassium

iodide, made up with water to 100 mL)

to each seed. A distinct brown-red

precipitate indicates the presence of

alkaloids. Doubtful cases can be easily

resolved by adding further drops of the

Lugol’s solution. Evaluation can be done

on either a white surface or a

luminescent screen.

8.8.3 Standard reference method for

the verification of varieties of Triticum

and Hordeum by Polyacrylamide Gel

Electrophoresis (PAGE)

8.8.3 Hordeum (barley)

8.8.3.1 Principle

The alcohol-soluble proteins (gliadins

from Triticum, hordeins from Hordeum)

are extracted from the seeds and

separated by PAGE at pH 3.2. …

8.8.3.1 Principle

The standard reference method for

verifying varieties of Hordeum is by

polyacrylamide gel electrophoresis

(PAGE). The alcohol-soluble proteins

(hordeins) are extracted from the seeds

and separated by PAGE at pH 3.2…..

8.8.3.2 Apparatus and equipment

8.8.3.2.1 Apparatus

The Pharmacia GE-2/4 electrophoresis

apparatus and EPS 400/500 power

supply have been successfully used, but

any suitable vertical electrophoresis

system should give comparable results.


8.8.3.2.1 Apparatus

Any suitable vertical electrophoresis

apparatus with a cooling system and

power supply may be used.

8.8.3.3 Procedure

8.8.3.3.1 Extraction

8.8.3.3 Procedure

8.8.3.3.1 Protein extraction

…

To make 100 ml of gel medium, stock

gel buffer (approx. 60 ml) is taken and

acrylamide (10 g), bisacrylamide (0.4 g),

urea (6 g), ascorbic acid (0.1 g), ferrous

sulphate (0.005 g). The solution is

stirred and made up to 100 ml with stock

gel buffer solution. Freshly prepared

0.6% hydrogen peroxide solution (0.35

ml per 100 ml of gel medium) is added

mixed quickly, and the gel poured.

…

To make 100 mL of gel medium, stock

gel buffer (approx. 60 mL) is taken and

acrylamide (10 g), bisacrylamide (0.4 g),

urea (6 g), ascorbic acid (0.1 g), ferrous

sulphate (0.005 g) are added. The

solution is stirred and made up to 100

mL with stock gel buffer solution.

Freshly prepared 0.6% hydrogen

peroxide solution (0.35 mL per 100 mL

of gel medium) is added and mixed

quickly, and the gel poured.




the verification of varieties of Pisum

and Lolium

by Polyacrylamide Gel Electrophoresis

(PAGE)

8.8.4 Pisum and Lolium

8.8.4.1 Principle

Seed proteins are extracted from

individual Pisum seeds or from a meal

of Lolium seeds of meals, treated with

SDS and separated using a

discontinuous SDS-PAGE procedure. …

8.8.4.1 Principle

The standard reference method for the

verifying varieties of Pisum and Lolium

is by polyacrylamide gel electrophoresis

(PAGE). Seed proteins are extracted

from individual Pisum seeds or from a

meal of Lolium seeds, treated with SDS

and separated using a discontinuous

SDS-PAGE procedure….

… If a comparison is being made with a

standard value, sequential testing using

batches of 50 seeds can be undertaken in

order to minimize the workload. …

… If a comparison is made with a

standard value, sequential testing using

batches of 50 seeds can be undertaken in

order to minimize the workload. …


8.8.4.2.1 Apparatus


apparatus may be used (e.g. Pharmacia

GE 2/4, Bio-rad ‘Protean’). It is

recommended that a gel thickness of no

more than 1.5 mm is used.


8.8.4.2.1 Apparatus




8.8.4.3 Procedure

8.8.4.3.1 Pisum

… Diluted sample extraction buffer is

prepared by diluting the stock sample

extraction buffer (section 8.8.4.2.3e) in

the following ratio 17 buffer : 3

mercaptoethanol : 40 distilled water

(make up a volume of the diluted

extractant sufficient to be used within a

day).

8.8.4.3 Procedure

8.8.4.3.1 Pisum

…. Diluted sample extraction buffer is

prepared by diluting the stock sample

extraction buffer (section 8.8.4.2.3e) in

the ratio 17 buffer : 3 mercaptoethanol :

40 distilled water (make up only a

volume of the diluted extractant

sufficient to be used within a day).

8.8.4.3.2 Lolium

… Diluted extraction buffer is prepared

by diluting the stock sample extraction

buffer (see 8.8.4.2.3e) in the following

ratio 17 buffer : 6 mercaptoethanol : 10

dimethylformamide : 17 distilled water

(Note: make only a volume of this


day).

8.8.4.3.2 Lolium

…. Diluted extraction buffer is prepared

by diluting the stock sample extraction

buffer (see 8.8.4.2.3e) in the ratio 17

buffer : 6 mercaptoethanol : 10

dimethylformamide : 17 distilled water

(make up only a volume of this


day).

8.8.4.3.3 Gel preparation

…

Note that if de-gassing of the gel

mixture is a problem, it is possible to

eliminate this step and use a 3-times

higher concentration of APS (i.e. 3.75

ml of a 3% solution [0.3 g dissolved in

10 ml of distilled water]).


…

Note that if de-gassing of the gel mixture

is a problem, it is possible to eliminate

this step and use a three times higher

concentration of APS (i.e. 3.75 mL of a

3% solution [0.3 g dissolved in 10 mL of

distilled water]).



8.8.4.3.3.2 Stacking gel

… Again, de-gassing can be omitted if a

higher concentration of APS is used. It is

recommended that 3.0 ml of a 2%

solution (0.2 g in 10 ml of distilled

water) should be sufficient.

As an alternative polymerization system

for the stacking gel, it is possible to use

0.008% riboflavin solution (freshly

prepared), in place of APS.

Polymerization should occur if the gels

are left in the light, but it may be

necessary to use a UV lamp. …

8.8.4.3.3.2 Stacking gel

… Again, de-gassing can be omitted if a

higher concentration of APS is used. A

3.0 mL of a 2% solution (0.2 g in 10 mL

of distilled water) is sufficient.

As an alternative polymerization system

for the stacking gel, it is possible to use

a 0.008% riboflavin solution (freshly

prepared), in place of APS.

Polymerization should occur if the gels

are left in the light, but it may be

necessary to use an ultraviolet lamp. ….

8.8.4.3.4 Electrophoresis

The electrophoresis tank buffer (or

running buffer) comprises 3.0 g tris,

14.1 g glycine 1.0 g SDS made up to 1 l

with distilled water (it may be necessary

to warm the solution gently to dissolve

the SDS). …


The electrophoresis tank buffer (or

running buffer) comprises 3.0 g tris, 14.1

g glycine and 1.0 g SDS made up to 1 L

with distilled water (it may be necessary

to warm the solution gently to dissolve

the SDS). …

…The gel is placed in the tank and

electrophoresis carried out at 25 mA per

gel until the tracking dye has migrated

through the stacking gel, and then at 45

mA per gel until the bromophenol blue

is at the bottom of the gel….

…The gel is placed in the tank.

Electrophoresis is carried out at 25 mA

per gel until the tracking dye has

migrated through the stacking gel, and

then at 45 mA per gel until the

bromophenol blue is at the bottom of the

gel….

8.8.4.4 Evaluation of results

The methods are mostly used in a

comparative way i.e.: is the protein

pattern of the sample identical to that of

the authentic reference variety? …


This method is mostly used in

comparatively, i.e.: is the protein pattern

of the sample identical to that of the

authentic reference variety? …


the measurement of hybrid purity and

for the verification of varieties of Zea

mays (maize)by by Ultrathin-layer

Isoelectric Focusing (UTLIEF)

8.8.5 Zea mays (maize)

8.8.5.1 Principle

The alcohol-soluble proteins (zeins) or

water soluble proteins are extracted from

individual maize seeds and separated by

(IEF) in ultrathin-layer gels. …

8.8.5.1 Principle


measuring hybrid purity and verifying

varieties of Zea mays (maize) is by

ultrathin-layer isoelectric focusing

(UTLIEF). The alcohol-soluble proteins

(zeins) or water soluble proteins are

extracted from individual maize seeds

and separated by isoelectric focusing

(IEF) in ultrathin-layer gels. …

8.8.5.2 Apparatus and Equipment

8.8.5.2.1 Apparatus

Any suitable horizontal electrophoresis

apparatus with a cooling system (e.g.

‘Desaphor HF’, Desaga) and high

voltage power supply (e.g. ‘Multidrive

XL’, Pharmacia) may be used.


8.8.5.2.1 Apparatus



high voltage power supply may be used.




….

Approximately 50 mg of the seed meal

is extracted with 0.2 ml of extraction

solution (8.8.5.2.3a) in a micro-titreplate

plate or a microcentrifuge tube. The

samples are left for about 1 h at 20 °C.

After this time, the titreplate or

microtube is treated with ultrasound for

30 seconds and then centrifuged at 2000

× g for 5 minutes. …


…

Approximately 50 mg of the seed meal

is extracted with 0.2 mL of extraction

solution (8.8.5.2.3a) in a microtitre plate

or a microcentrifuge tube. The samples

are left for about 1 h at 20 °C. After this

time, the microtitre plate or microtube is

treated with ultrasound for 30 s and then

centrifuged at 2000 × g for 5 min. …


…. The plates/sheets must be treated

before use, …


…The plates or sheets must be treated

before use, …

A gel thickness of 0.12 mm is

recommended, which can be achieved

by the use of tesafilm (or parafilm or

defined thickness adhesive tape ) as a

spacer.

A gel thickness of 0.12 mm is


by the use of a defined thickness of

adhesive tape as a spacer.

…

For polymerization,

APS (20% (w/v) solution freshly

prepared) 0.35 mL

TEMED (full strength) 0.05 mL

are added carefully, to avoid introducing

excessive amounts of air.

…

For polymerization, 0.35 mL APS (20%

(w/v) solution freshly prepared) and

0.05 mL TEMED (full strength) are

added carefully, to avoid introducing

excessive amounts of air.

…This will be sufficient for 10 gels of

dimensions 240 × 180 × 0.12 mm. …

…This will be sufficient for 10 gels of

the dimensions 240 × 180 × 0.12 mm. …


… Samples (approx. 22 μl) are loaded in

the applicator strip 0.5 cm below the

bufferwick of the anode and focusing

carried out at 2500 V, 15 mA, 40 W for

about 1750 volt/hours (70 minutes) until

completion (for one gel).


… Samples (approx. 22 μL) are loaded

in the applicator strip 0.5 cm below the



about 70 min until completion (for one

gel).

Notes:

…

b) The precise conditions and times

required for focusing will vary

according to the dimensions of the gel,

and the type of maize hybrid, inbred line

etc., and may need to be determined

empirically.

Notes:

…

b) The precise conditions and times

required for focusing will vary

depending on the dimensions of the gel,

the type of maize hybrid, inbred line

etc., and may need to be determined

empirically.


…

…. Comparing the protein patterns of

the female and male parents with the

hybrid, one or more marker bands

(present in the male only) need to be

found in the hybrid (8.8.5.5, figure 1).

… Seeds with a different pattern may

also arise due to contamination with

another variety.


…

…. When comparing the protein patterns

of the female and male parents with the

hybrid, one or more marker bands

(present in the male only) need to be

found in the hybrid (8.8.5.5, Figure 8.1).

…. Seeds with a different pattern may

also occur if there is contamination with

another variety.



… figure 2 …

… figure 3 …

… figure 4 …

… Figure 8.2 …

… Figure 8.3 …

… Figure 8.4 …

…Normally it is suggested that 200

single seeds are analysed, as a

compromise between precision of results

and working time needed (see Chapter 4

in the, ISTA ‘Handbook of Variety

Testing – Electrophoresis Testing’,

1992). ….

…. It is suggested that normally 200

single seeds are analysed, as a

compromise between precision of results

and working time needed (see Chapter 4,

ISTA ‘Handbook of Variety Testing –

Electrophoresis Testing’, 1992). …


the verification of varieties of Avena

sativa by

Polyacrylamide Gel Electrophoresis

(PAGE) 8.8.6.1 Principle

The urea/ethylene glycol-soluble

proteins …

8.8.6 Avena sativa (oats) 8.8.6.1 Principle

The standard reference method for

verifying varieties of Avena sativa (oat)

is by polyacrylamide gel electrophoresis

(PAGE). The urea/ethylene glycol-

soluble proteins ….


8.8.6.2.1 Apparatus

The Pharmacia GE-2/4 electrophoresis

apparatus and EPS 400/500 power

supply can be successfully used, but any

suitable vertical electrophoresis system

e.g. Desaga, Biorad, Biometra should

give comparable results.


8.8.6.2.1 Apparatus




8.8.6.3.1 Extraction 8.8.6.3.1 Protein extraction


the measurement of hybrid purity and

for the verification of varieties of

Helianthus annuus (sunflower)by

Ultrathin-layer Isoelectric Focusing

(UTLIEF)

8.8.7.1 Principle

The alcohol-soluble proteins …

8.8.7 Helianthus annuus (sunflower)

8.8.7.1 Principle


measuring hybrid purity and verifying

varieties of Helianthus annuus

(sunflower) is by ultrathin-layer

isoelectric focusing (UTLIEF). The

alcohol-soluble proteins …

8.8.7.2.1 Apparatus


apparatus with a cooling system (e.g.

‘Desaphor HF’, Desaga) and high

voltage power supply (e.g. ‘Multidrive

XL’, Pharmacia) may be used.

8.8.7.2.1 Apparatus



high voltage power supply may be used.


… A gel thickness of 0.12 mm is


by the use of tesafilm (or parafilm or

defined thickness adhesive tape) as a

spacer.


… A gel thickness of 0.12 mm is


by the use of a defined thickness of

adhesive tape as a spacer.

The following components are taken and

mixed:

…

Ampholytes (pH 5–8) 2.90 ml This

is the composition of the seed mix

from SINUS pH 5–8/2–11 (4.40 mL) (pH 2–11) 1.50 ml

The following components are taken and

mixed:

…

Ampholytes (pH 5–8) 2.90 mL (pH 2–11) 1.50 mL




…Samples (approx. 4 μL) are loaded in




about 1750 volt/hours (70 minutes) until

completion (for one gel).


…Samples (approx. 4 μL) are loaded in




about 70 min until completion (for one

gel).

8.8.7.4.2 …Comparing the protein

patterns of the female and male parents

with the hybrid, one or more marker

bands (present in the male only) needs to

be found in the hybrid (8.8.5, figure

1)….

8.8.7.4.2 … When comparing the protein

patterns of the female and male parents

with the hybrid, one or more marker

bands (present in the male only) needs to

be found in the hybrid (8.8.5.5, Figure

8.1).

…titerplates … …titre plates …

8.9 Examination of seedlings

8.9.2 Beta spp. …. After seven days examine the

seedlings for hypocotyl colour. ….

8.9 Examination of seedlings

8.9.2 Beta spp. …. After seven days, the seedlings for

hypocotyl colour are examined.

8.9.3 Brassica spp.

… Germinate the seeds in darkness at

20–30 °C. After five days transfer the

cotyledons to Petri dishes containing

alcohol (85–96%) and placed on a white

surface. After four hours determine the

colour.

8.9.3 Brassica spp.

… Germinate the seeds in darkness at

20–30 °C. After five days the cotyledons

are transferred to Petri dishes containing

alcohol (85–96%) and placed on a white

surface. After four hours the colour is

determined.


C.8.1


C.8.2. New improved A-PAGE method for the verification of

Triticum

The statistical analysis revealed that different methods give similar results to with

the current ISTA method in the Rules. The scientists involved in this validation

consider that each step (8.8.8.2–11 of this new method) is independent from the

others. Thus, the proposed strategy consists of merging some solutions and

procedures that were understood to go together.

For this new method, laboratories will have options for some of the steps of the

procedure. Where there are options given, the laboratories will have to select one of

them, but not necessarily always the same one. For example, a laboratory may select

option 1 for “Extraction”, option 1 also for “Gel preparation”, but may select option

2 for “Electrophoresis” and for “Fixing and Staining”.

For ease of reading the text is presented without underline.

This proposal is submitted by the Variety Committee and approved by a vote.

PROPOSED VERSION

8.8.8 Triticum (wheat)

8.8.8.1 Principle

The standard reference method for verifying varieties of Triticum is by acetic acid

urea polyacrylamide gel electrophoresis (A-PAGE). The alcohol-soluble proteins

(gliadins) are extracted from seeds and separated by A-PAGE at pH 3.2. The pattern

of protein bands produced (electropherogram) is related to genetic constitution and

can be considered as a ‘fingerprint’ of a variety. The ‘fingerprints’ can be used to

identify unknown samples and mixtures, by single seed analysis.

8.8.8.2 Equipment

– Any suitable vertical electrophoresis system

– Cooling system

– Power supply

– Hood

– Mixer

– Centrifuge

– Shaker

– Transilluminator

– Oven or drying equipment (gel dryer or glass plates and cellophane sheets)

8.8.8.3 Chemicals

All chemicals must be of ‘analytical reagent’ grade or better (acrylamide and

bisacrylamide specially purified for electrophoresis).

8.8.8.4 Sample preparation

Seeds can be ground, crushed or halved with pliers or a razor blade and transferred

to microcentrifuge tubes (1.5 mL) or microtitre plates (200 µL).


PROPOSED VERSION

8.8.8.5 Extraction

8.8.8.5.1 Extraction (option 1)

8.8.8.5.1.1 Solutions

a) Extraction solution

Ethanol: 70% prepared immediately before use

Acetone: concentrated

b) Sample buffer

Glycerol: 30% w/v

Urea: 6 M

Acetic acid: 25 mM

Pyronine G: 0.05%

Water: to the final volume

Keep the solutions at room temperature.

8.8.8.5.1.2 Procedure

Add 70% ethanol at 200μL per seed or per 50–60 mg flour. When using

microcentrifuge tubes, mix the samples with e.g. a vortex. With microtitre plates,

mixing is not necessary. . Leave the sample in the dark at room temperature for 1 h.

Centrifuge, recover the clarified supernatant in 1.5 mL tubes, then add 1 mL acetone

stored at room temperature. Proteins will precipitate in a few minutes (keep at 4 °C

if not used). Centrifuge, discard the acetone, dry the pellet under the hood for 5 min.

Add 150 μL of sample buffer. The extraction is finished in about 2 h.

Extracts can be stored at 4 °C for some weeks.

8.8.8.5.2 Extraction (option 2)

8.8.8.5.2.1 Solution

2-Chlorethanol: 25–30%

Pyronine G or methyl green: 0.05%

Water: to the final volume

Keep the solution cold (4 ºC).

8.8.8.5.2.2 Procedure

Add 150–200 µL extraction buffer. When using microcentrifuge tubes, mix the

samples with e.g. a vortex. With microtitre plates, mixing is not necessary. Incubate

the samples overnight at room temperature (approx. 20 °C).

If necessary, before loading the gel, centrifuge the samples at 13 000 r.p.m. for 15

min.

Extracts can be stored at 4 °C for some days.


PROPOSED VERSION

8.8.8.6 Gel preparation and buffer tank solutions

8.8.8.6.1 Gel preparation (option 1)

8.8.8.6.1.1 Gel mix

Acrylamide: 12% (from 40% solution)

Bisacrylamide: 0.4% (from 2% solution)

Acetic acid: 0.75%

Urea: 12%

Ferrous sulphate: 0.0014%

Ascorbic acid: 0.1%

Add water to final volume (for example 80 mL for 2 gels of 16 cm x 18 cm x 1.5

mm thick)

Mix until complete dissolution.

8.8.8.6.1.2 Polymerization starter

Hydrogen peroxide: 100 vol, 0.001% (v/v), final gel concentration.

Gel preparation should be done quickly because polymerization is very rapid.

Cooling the cassettes to 4 °C before filling with the gel mix helps to delay the

polymerization.

8.8.8.6.1.3 Buffer tank solutions

Upper tank buffer: 700 mL water + 1 mL acetic acid (0.143% v/v)

Lower tank buffer: 4000 mL water + 10 mL acetic acid (0.25% v/v)

8.8.8.6.2 Gel preparation (option 2)

8.8.8.6.2.1 Gel mix

Acrylamide: 10% final concentration (from solution or powder)

Bisacrylamide: 0.4% Final concentration (from solution or powder).

Note: The powder forms of acrylamide and bisacrylamide are much more readily

inhaled, as they are very light and highly electrostatic, so the powder floats in the air

as soon as the bottle is opened. Handle in a fume hood.

Urea: 6%

Ferrous sulphate: 0.005%

Ascorbic acid: 0.005– 0.1%

Add the following buffer: 0.1% glycine (w/v), 2% Glacial acetic acid (v/v) and

water to final volume.

Mix until complete dissolution.

8.8.8.6.2.2 Polymerization starter

Hydrogen peroxide: 100 vol, 0.002–0.003% (v/v), 30%, final gel concentration.

Gel preparation should be done quickly because polymerization is very rapid.

Cooling the cassettes to 4 °C before filling with the gel mix helps to delay the

polymerization.

8.8.8.6.2.3 Buffer tank solution

Only one buffer: 0.4% glacial acetic acid (v/v) + 0.04% glycine (w/v) + water to

final volume


PROPOSED VERSION

8.8.8.7 Loading samples

5–20 µL, depending on the equipment used.

Loading can be performed using a syringe, a multichannel syringe, a pipette or a

multichannel pipette.

8.8.8.8 Electrophoresis

8.8.8.8.1 Electrophoresis (option 1)

Constant voltage: 500 V for the chamber.

Water should be circulated through the buffer tank to maintain the buffer

temperature at 18 °C.

Running time: 2 times the time required for the dye to leave the gel.

8.8.8.8.2 Electrophoresis (option 2)

Constant current: 40 mA for each gel.

Water should be circulated through the buffer tank to maintain the buffer

temperature at 10–20 °C.

Running time: 2 times the time required for the dye to leave the gel.

8.8.8.9 Fixing and staining

8.8.8.9.1 One-step fixing and staining (option 1)

Stock Coomassie: Coomassie R 250 1g/100 mL ethanol. Store this solution at 4ºC in

a dark bottle.

Fixing and staining solution: 2.5% stock Coomassie Blue R250 (v/v) + 6.25%

trichloroacetic acid (TCA) (w/v), water to 400 mL.

This solution is enough for 2 gels 16 x 18 cm x 1.5 mm thick.

Shake overnight with orbital shaker.

The solution can be used once only.

8.8.8.9.2 One-step fixing and staining (option 2)

Stock Coomassie: 0.25% (w/v) Coomassie Blue G250 + 0.75% (w/v) Coomassie

Blue R250 + water to complete volume.

Fixing and staining solution: 8.3% (w/v) trichloroacetic acid (TCA) + 5.8 (v/v)

acetic acid + 12.5 % (v/v) ethanol + 2% (v/v) stock Coomassie.

Staining is complete after 1 day, but at the earliest after 4 h.

The solution can be used six times.

8.8.8.9.3 Two-step fixing and staining (option 3)

Stock Coomassie: 0.25% (w/v) Coomassie blue G250 + 0.25% (w/v) Coomassie

blue R250, complete volume with ethanol 100%. Store this solution at 4ºC in a dark

bottle.

Fixing solution: 10% TCA. Store at room temperature under hood.

Staining solution: 20% stock Coomassie (v/v) + 8% acetic acid (v/v). Add water to

complete volume. Store under hood at room temperature in a dark bottle.

1. Fix gels in TCA 10% for 1 h. Gels can be saved in this solution for few days.

2. Stain the gels for approx. 3 h or overnight.

The fixing and staining solutions can be used six times.


PROPOSED VERSION

8.8.8.10 Destaining

Destaining with tap water: rinse the gels 1–2 times (30 min each).

For slow destaining, use a 10% TCA solution.

8.8.8.11 Storage of the gels

Gels can be kept in either 10% TCA solution or in a glycerol solution (3%), and

then dried between two cellophane sheets or photographed.

After drying they can be stored for years.


C.8.2


C.8.3. New SDS-PAGE method for the verification of Triticum and

×Triticosecale varieties

A modification of the UPOV approved method using the SDS-PAGE technique in

seed testing to confirm varietal identity of seed lots and species verification of

Triticum spp. and related species such as ×Triticosecale has been tested and is to

recommended to be added to the ISTA Rules.

See the validation study for details.

For ease of reading the text is presented in without underline.

This proposal is submitted by the Variety Committee and approved by a vote.

PROPOSED VERSION

8.8.9 Triticum and ×Triticosecale (wheat and triticosecale)

8.8.9.1 Principle

The standard reference method for verifying varieties of Triticum and ×Triticosecale

is by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE).

Seed proteins are extracted from individual seeds, treated with SDS and separated

using a discontinuous SDS-PAGE procedure. The pattern of protein bands found on

the gel is characteristic of a variety.

As a guideline, it is recommended that 100 individual seeds are used. Very precise

estimates of varietal purity may require a larger sample. If a comparison is being

made with a standard value, sequential testing using batches of 50 seeds can be

undertaken in order to minimise the workload. A simple check on the identity of a

single major constituent of a seed lot can be done using less than 50 seeds.

8.8.9.2 Equipment

Any suitable vertical electrophoresis system may be used.

8.8.9.3.Chemicals

All chemicals must be of ‘analytical reagent’ grade or better (acrylamide and

bisacrylamide specially purified for electrophoresis).

– Acrylamide 40% solution

– Bisacrylamide 2% solution

– Urea

– Glycine

– Ammonium persulphate (APS) and TEMED

– 2-Mercaptoethanol

– Sodium dodecyl sulphate (SDS) (10% stock solution)

– Tris

– Pyronine G/bromophenol Blue

– Coomassie Blue R-250

– Coomassie Blue G-250

– Purified water

8.8.9.4 Sample preparation

Single seeds crushed with pliers or alternatively 50–70 mg of flour are transferred to

1.5 mL polypropylene centrifuge tubes.

8.8.9.5 Extraction

8.8.9.5.1 Extraction buffer

Urea: 4.5 M, 3%

2-Mercaptoethanol: 10 % SDS


PROPOSED VERSION

8.8.9.5.2 Extraction procedure

Add 500 L of the extraction buffer and thoroughly mix the sample. Leave to stand

overnight at room temperature.

Heat the samples in a boiling water bath for 10 min and allow to cool. Before the gel

is loaded, the tubes are centrifuged at 18 000 x g.

8.8.9.6 Gel preparation

Two gels, 16 x 18 cm, 1.5 mm thickness

8.8.9.6.1 Stacking gel

Stacking gel: acrylamide 3%, 0.125 M Tris-HCl, pH 6.8.

Acrylamide 40% solution: 1.5 mL

Bisacrylamide 2% solution: 0.43 mL

Tris-HCl 1 M pH 6,8: 2.5 mL

SDS 10%: 0.16 mL

Water: 14.87 mL

For polymerization:

APS 1%: 0.75 mL

TEMED: 20 L

Add the reagents to a 19.46 mL of stacking gel solution.

8.8.9.6.2 Resolving gel

Resolving gel: acrylamide 10%, 0.375 M Tris-HCl, pH 8.8

Acrylamide 40% solution: 20 mL

Bisacrylamide 2% solution: 5.2 mL

Tris-HCl 1 M pH 8.8: 30 mL

SDS 10%: 0.8 mL

Water: 20.8 mL

For polymerization:

APS: 1% 2 mL

TEMED: 40 L

Add the reagents to a 76.80 mL of resolving gel solution.

8.8.9.6.3 Tank buffer

Tank buffer stock solution: Tris 0.0250 M, glycine 0.187 M, SDS 1%, pH 8.3

Glycine: 141.1 g

Tris: 30.0 g

SDS: 10.0 g

Make up to 1000 mL with water. Dilute the stock solution 1:10 before use.

8.8.9.7 Loading samples

10–15 µL, depending on the equipment used.

Loading can be performed using a syringe, a multichannel syringe, a pipette or a

multichannel pipette.


PROPOSED VERSION

8.8.9.8 Electrophoresis

Two gels, 16 x 18 cm, 1.5 mm thickness

Stacking gel: constant voltage at 100 V (about 40 mA)

Running gel: 80 mA (max. 400 mA)

Water should be circulated through the buffer tank to maintain the temperature at 15

to 20 °C.

Stop the run 40 min after the tracking dye has reached the bottom of the gel

8.8.9.9 Fixing and staining

Fixing: TCA 15%, approx. 30 min

Staining:

Sol A: Coomassie Blue G-250 0.25 g

Coomassie Blue R-250 0.75 g

Made up to 100 mL with water.

Sol B: TCA: 27.5 g

Acetic acid: 32.5 mL

Ethanol: 90 mL

Sol A: 12.5 mL

Water to 400 mL

Stain overnight at room temperature.

8.8.9.10 Destaining

Destaining with tap water: rinse the gels 1–2 times (30 min each).

For slow destaining, use a 10% TCA solution.

8.8.9.11 Storage of the gels

Gels can be stored in polythene bags at 4–6 °C for many months without

deterioration


C.8.3


Chapter 11: Testing Coated Seeds

C.11.1 Testing methods and reporting for the tetrazolium test for

coated seeds

Adding text for testing methods and reporting for the tetrazolium test for coated seed

units, seed mats and seed tapes.

Changes also needed to Chapter 1 if this is accepted.

Proposal made by the Tetrazolium Committee and approved by a vote.

PROPOSED VERSION

11.6 The tetrazolium test

11.6.1 Object

The objects are the same as defined in 6.1.

11.6.2 Definitions

The definitions are the same as described in 6.2.

11.6.3 General principles

The general principles are the same as described in 6.3.

11.6.4 Reagents

The reagents are the same as prescribed in 6.4.

11.6.5 Procedure

Coated seed units (seed pellets, encrusted seeds or seed granules): Four

replicates of 100 coated seed units are washed to remove the coating mass.

Depending on the consistency of the coating mass, it may be necessary to agitate,

whilst soaking, to release seeds from the coating. The duration of the washing

should not take longer than the premoistening period prescribed in Table 6A. The

number of seeds determined in each replicate of 100 coated seed units (of the

species stated by the applicant) must be reported as an average of all four replicates.

If there are more than 100 seeds in each replicate of coated seed units, only 100

seeds per replicate will be used for tetrazolium testing. Coated units without seeds

(e.g. empty pellets) are deemed to be non-viable seeds. The test procedure of the

washed, uncoated seeds then continues with the premoistening or, if the total

premoistening time is achieved, with the preparation for the staining step as

prescribed in Table 6A.

Seed tapes: The number of seeds (of the species stated by the applicant) per metre

must be detected and reported. To complete the test, 400 seeds must be extracted

from the seed tape. The test procedure then continues with the premoistening step as

prescribed in Table 6A.

Seed mats: The number of seeds (of the species stated by the applicant) per seed

mat must be determined and reported (in large seed mats the number of seeds per

square metre). To complete the test, 400 seeds must be extracted from the seed mats.

The test procedure then continues with the premoistening step as prescribed in Table

6A.

11.6.6 Calculation, expression of results and tolerances

The same criteria are valid as prescribed in 6.6.

11.6.7 Reporting results

The result of a tetrazolium test on coated seeds must be reported as follows:

- Following the species name, the words ‘seed pellets’, ‘encrusted seeds’, ‘seed

granules’, ‘seed tapes’ or ‘seed mats’, as applicable, must be clearly entered.


PROPOSED VERSION

The following additional information must be reported under ‘Other

determinations’:

- The statement ‘Number of seeds (of the species stated by the applicant) included

in 100 seed pellets’ (or ‘encrusted seeds’, or ‘seed granules’);

- or the statement ‘Number of seeds (of the species stated by the applicant)

included in one metre of seed tape’;

- or the statement ‘Number of seeds (of the species stated by the applicant)

included in one seed mat or in one square metre of seed mat’.

- The statement ‘Tetrazolium test: …% were viable’ must be entered.

- In cases where the testing procedure deviates from that prescribed in Table 6A,

any deviating procedure must also be reported. The only areas where variations

from procedures given in Table 6A are permitted are for premoistening time,

tetrazolium concentration, staining temperature and staining time. For precise

guidance about the limitation of the variations permitted, see 6.5.

- If individual seeds are tested at the end of the germination test, the result must be

reported in accordance with 5.9.

In addition, in the case of species of Fabaceae, one of the following, and only one,

must be reported:

either (in cases where the percentage of the viability of hard seed is not

determined) ‘Tetrazolium test: ...% of seeds were viable, ...% of hard seeds

found in the test’

or (in cases where the percentage of the viability of hard seed is determined)

‘Tetrazolium test: ...% of seeds were viable, ...% of hard seeds included in

the percentage of viable seed’

Changes also needed to Chapter 1. The same text as for 11.6.7 will be inserted at

1.5.2.8.1.

1.5.2.8.1 Tetrazolium test on coated seeds

Same text as for 11.6.7 above


C.11.1. AND C.1.1.


Chapter 18: Seed Mixtures

C.18.1. Testing methods and reporting for the tetrazolium test for

seed mixtures

Adding text for testing methods and reporting for the tetrazolium test for seed

mixtures.

Renumbering of sections also needed if this is accepted.

Changes also needed to Chapter 1 if this is accepted.

Proposal made by Tetrazolium Committee and approved by vote.

PROPOSED VERSION

18.7 Tetrazolium test

For species representing more than 5% of the seed mixture, four replicates of 100

seeds are tested from the pure seed of each component species. If insufficient seed is

available from the pure seed fraction, the test will be carried out on (in order of

priority) two replicates of 100 seeds, one replicate of 100 seeds or on all pure seed

of the species in the pure seed fraction, depending on seed availability.

For species representing 5% or less of the mixture, a tetrazolium test will not be

carried out except at the specific request of the customer. In this case the tetrazolium

test is carried out on two replicates of 100 seeds, one replicate of 100 seeds or on the

all pure seed of the species in the pure seed fraction, depending on seed availability.


…

18.9.4 Tetrazolium test

The tetrazolium results for each component species are reported under ‘Other

determinations’. The results are reported as a percentage and the number of seeds

tested is also reported.

When fewer than 100 seeds are tested, the number of viable seeds is reported

together with the total number of seeds tested.

Changes also needed to Chapter 1. The same text as for 18.9.4 will be inserted at

1.5.2.19.4 and teh numbering for the existing 1.5.2.19.4 updated to 1.5.2.19.5.

…

1.5.2.19.4 Tetrazolium test

Same text as for 18.9.4 above.

1.5.2.19.4.5 Weight determination


C.18.1. AND C.1.2.



C.19.1. New Chapter for the ISTA Rules

Previously guidelines for testing adventitious presence of Genetically Modified

Organism (Adventitious Presence of GMO) and/or GMO Trait Purity testing were

include in Chapter 8: Variety testing.

Now that ISTA has a Technical Committee for GMO testing it was felt that there

should be a separate ISTA Rules Chapter for GMO testing.

This initiative is supported by the Variety Committee. The GMO Committee has

prepared and approved by vote the following new Chapter for inclusion in the ISTA

Rules.

Note: If this Chapter is approved it will require the editorial deletions of sections of

Chapter 8: Varietal testing shown already but will not remove the allowance for

testing of varital traits that are not GMO by the performance based approach. See

proposal 8.1 for details.

Note: as this a completely new Chapter it has not been shown as underlined text for

ease of reading.

Changes to Chapter 1 will also be required if this proposal is accepted and are

shown following this proposal.

PROPOSED VERSION


19.1 Object

The object of testing for seeds of genetically modified organisms (GMOs) is to give

guidelines to detect, quantify or confirm the presence of GMO seeds in seed lots.

These guidelines can be applied to testing adventitious presence (AP) of genetically

modified organisms (GMOs) and GMO trait purity testing.

19.2 Definitions

19.2.1 Adventitious presence

Adventitious presence (AP) in seeds refers to the unintentional presence of foreign

material in a seed lot. This may happen during production, harvesting, storage or

marketing.

19.2.2 Analyte

An analyte is a substance or chemical constituent that is of interest in an analytical

procedure.

19.2.3 Certified reference material

Certified reference material is reference material which has been characterized

metrologically for a specific property by an official body. Such material is

accompanied by a document attesting to the value of that property, its associated

uncertainty and its metrological traceability.

19.2.4 Genetically modified organism

A genetically modified organism (GMO) is any living organism that possesses a

novel combination of genetic material obtained through the use of modern

biotechnology.

19.2.5 GMO event

A GMO event is a single transformation act that results in the integration of a new

trait at a unique site in the plant genome, giving rise to a transgenic plant and

subsequently incorporated into new varieties.

http://en.wikipedia.org/wiki/Harvesting

http://en.wikipedia.org/wiki/Food_storage


PROPOSED VERSION

19.2.6 GMO trait

A GMO trait is a novel phenotypic character, added by genetic engineering to an

organism and often derived from another species.

19.2.7 Limit of detection

The limit of detection is the smallest amount of target analyte that has been

demonstrated to be detected with a given level of confidence. This limit must be

verified by the laboratory.

19.2.8 Limit of quantification

The limit of quantification is the smallest amount of target analyte that has been

demonstrated to be reliably measured with acceptable levels of accuracy and

precision. This limit must be verified by the laboratory.

19.2.9 Performance-based approach

The performance-based approach (PBA) is an approach to testing in which

individual laboratories can choose the test method, as long as the method has been

validated as fit for purpose and complies to given performance standards.

19.2.10 Proficiency test

A proficiency test is a standardized test or series of tests that assesses the ability of a

laboratory or an individual operator to carry out a particular method.

19.2.11 Seed bulk

The seed bulk is the whole working sample that is prepared at one time (e.g.

grinding, DNA or protein extraction) and analysed (e.g. end-point PCR, ELISA,

real-time PCR).

19.2.12 Seed group

A seed group is one of the portions of the working sample that is separately prepared

(e.g. grinding, DNA or protein extraction) and analysed (e.g. end-point PCR,

ELISA, real-time PCR) when using the group testing approach.

19.2.13 Transgenic

Transgenesis is the process of introducing a foreign genetic construct – called a

transgene – into a living organism so that the organism will exhibit a new property

and transmit that property to its offspring. The organisms and lines containing

transgenes are referred to as transgenic. Cisgenesis occurs by the same process, but

using genes from the same species.

19.2.14 Reference material

According to ISO Guide 30, reference material is: "material, sufficiently

homogeneous and stable with respect to one or more specified properties, which has

been established to be fit for its intended use in a measurement process”. It can also

be classified according to its use, for instance "calibrants/calibrators" or "quality

control materials".


The ISTA strategy regarding methods for the detection, identification and

quantification of genetically modified seeds in conventional seed lots is available on

the ISTA web site at:

https://www.seedtest.org/upload/cms/user/42Int-M-

I200142ISTAPositionPaperonGMOapproved14112001-update1.pdf

http://en.wikipedia.org/wiki/Transgene

http://en.wikipedia.org/wiki/Living_organism

http://en.wikipedia.org/wiki/Offspring

https://www.seedtest.org/upload/cms/user/42Int-M-I200142ISTAPositionPaperonGMOapproved14112001-update1.pdf

https://www.seedtest.org/upload/cms/user/42Int-M-I200142ISTAPositionPaperonGMOapproved14112001-update1.pdf


PROPOSED VERSION

This chapter describes testing for adventitious presence of GM seeds and GMO trait

purity. Currently there is no universal threshold for GM seeds in conventional seed

lots, or of regulated GM seed in deregulated GM seed, or a specified level of GMO

purity in a seed lot; the establishment of reliable methods for the detection,

identification and quantification of GMO content is therefore very important.

Different technologies, strategies and methods for GMO testing are continuously

evolving and new methods being developed. The quality of these test results

depends much more on methodology, equipment and training than in other classical

seed testing methods. This makes the standardization of GMO testing very difficult.

The ISTA approach has targeted the uniformity in GMO testing results, not by the

uniformity in testing methodology, but by using a performance-based approach

(PBA). The PBA requires that laboratories demonstrate that the GMO detection,

identification or quantification methods that they are using on seed samples for

reporting results on ISTA Certificates meet acceptable standards set by ISTA. These

standards include, among others, sampling, testing and reporting. In order for a

laboratory to be recognised as ISTA accredited for GMO testing, it will need to

ensure that documented evidence of validation and reliability of the laboratory is

available to the ISTA auditors. The evidence must include:

– performance data based on seed samples for the event and species for

which the laboratory is seeking ISTA accreditation, and

– participation in an ISTA GMO proficiency test including the specific event

and species, if available.

This requirement will ensure the reliability of the analysis and the final test result

reported on the ISTA Certificate. The PBA gives seed testing laboratories the choice

to use different technological approaches, e.g. bioassays, protein-based methods and

DNA-based methods.

For further information, see the ISTA Principles and Conditions for Laboratory

Accreditation under the Performance Based Approach (see

http://www.seedtest.org/upload/cms/user/ISTAMethodValidationforSeedTesting-

V1.01.pdf)

Generally, GMO tests that are used to assess GMO trait purity are identical to the

tests used for testing for AP of GM seeds. However, there are differences in the

testing steps as well as in the objectives. This chapter addresses these distinctions

whenever they apply.

19.4 Procedure

Adventitious presence of GMO testing and GMO trait purity testing are “two sides

of the same coin”; both applications make use of the same tests, and follow a very

similar work flow (Figure 1). The expected results differ in the two applications. In

GMO AP testing, most of the time the expected outcome is “not detected” or a low

estimate of the proportion of GMO present. In GMO trait purity testing, the

expected result is the quantification of a high percentage of presence of the specified

trait.

The methods used for these analyses can be classified and characterized in a number

of ways. According to the level at which the analysis occurs, tests can be conducted

at the DNA level (19.5.1), protein level (19.5.2) or organism level, as in bioassays

(19.5.3).


PROPOSED VERSION

The appropriate approach to GMO testing is chosen according to the question which

the test is attempting to answer (see Figure 1). A qualitative question, e.g. “Is there

any GM seed in the sample?” can be answered by applying a qualitative test (see

19.5.1.2 and 19.5.2.2), while a quantitative question, e.g. “How much GM seed is

there in a seed lot?” can be answered by using either a quantitative test (see 19.5.1.3)

or a group-testing approach (Remund et al., 2001), also known as the semi-

quantitative method (which relies on qualitative tests of seed groups). Another

classification that applies only to DNA-based methods is in relation to the specificity

of the method, as described further in section 19.4.1.

Both AP GMO testing and GMO trait purity testing can be performed on individual

seeds or on seed bulks, although each application will require a different sampling

and testing scheme. Seed bulk testing is more common in AP GMO testing, where

the detection target is a transgenic protein or a DNA segment. GMO trait purity tests

are usually performed on a representative sample of individual seeds or seedlings,

and target the GMO trait or, similarly, the protein or the DNA. However, when

performed on seed bulks, the test is performed at the DNA level to detect the

absence of transgenic DNA, and targets the uninterrupted insertion site (Battistini

and Noli, 2009).

Figure 1. The different approaches to GMO testing and corresponding workflows.


PROPOSED VERSION

19.4.1 Sample size

Chapter 2: Sampling gives definitions of various sample types, including primary,

composite, submitted and working samples, as well as guidelines for obtaining seed

lot samples that represent the properties of the seed lot. These definitions and

guidelines apply also to GMO testing. The working sample is the portion of the

submitted sample that is actually tested by the testing method (as defined in Chapter

2). The size of the working sample depends on given threshold requirements, the

method capability and the degree of required statistical confidence, and can be

determined using appropriate statistical tools (e.g. SeedCalc (19.6.3)). The sample

submitted to the laboratory must therefore be at least the size of the working sample,

but more realistically larger than the working sample. For more information

regarding sampling, see Chapter 2.

The sizes of seed bulks and groups must be consistent with the performance of the

analytical method in terms of limit of detection, in order to allow the detection of

even one GM seed. For quantitative methods, the size of the sample must be

consistent with the limit of quantification, to allow the quantification of even one

GM seed in the sample.

19.4.2 Personnel and equipment

Many of the procedures used for GMO testing are composed of several stages (e.g.

seed planting or grinding, DNA or protein extraction, detection of the target analyte,

and reporting of results) which can be carried out by different personnel in the

laboratory (see Figure 1). The laboratory must show that personnel are adequately

trained in the procedures that they are carrying out, and that they understand the

overall workflow of the procedures and their contribution to that workflow. Each

part of the workflow and the equipment must be adequately validated, verified or

calibrated before use.

Appropriate equipment and facilities must be provided for the use of the chosen

methods. For biomolecular assays (DNA and protein), apparatus for grinding and

analyte extraction are necessary, as well as equipment dedicated to the detection of

the target analyte.

For DNA-based detection, it is important to prevent contamination, and the use of

separate rooms for certain manipulations is preferred.

For protein-based detection, care must be taken to avoid degradation of the matrix

and the extracted analyte.

For bioassays, care must be taken to ensure the provision of controlled germination

conditions adequate to allow the expression of the trait.

19.4.3 Test conditions

Tests must be carried out under conditions of the ISTA Accreditation Standard

quality framework. This includes, but is not limited to the following:

– Analysts involved in this testing must have the documented skills and

training in the corresponding procedures.

– All equipment must be appropriate to the techniques used. Scheduled

maintenance, verification, and calibration of the instrumentation used must

be carried out.

– The spatial arrangements and organization of the testing area must prevent

contamination.

– Reagents of appropriate grade and certified reference materials (when

available) must be used.

– Appropriate controls must be used to validate the testing results.


PROPOSED VERSION

19.5 Testing approaches

19.5.1 DNA-based methods

19.5.1.1 General principles of DNA-based testing

DNA-based testing requires a series of steps which can be carried out by different

laboratory personnel and which should all show evidence of validation and being fit

for purpose for the testing being carried out. The steps are the following:

– examination of the seed sample;

– grinding of the seed to produce a homogenous matrix;

– subsampling and DNA extraction;

– DNA amplification;

– detection of the amplified DNA.

Because of the amplification step, it is important that the laboratory ensures

adequate protection against contamination by seed dust, extracted DNA or amplified

DNA for each tested sample. Appropriate control samples (e.g. environmental, blank

or negative controls) must be used. If available, it is recommended to use certified

reference materials.

In the case of methods using the polymerase chain reaction (PCR), several types of

testing can be done that will differ in the level of selectivity and specificity.

– In GMO screening, primers are chosen that amplify individual genetic

elements frequently found in a number of different GMO events. The

detection of such targets suggests the presence of GMO, but does not

represent by itself conclusive evidence.

– In construct-specific PCR, the primers are chosen such that the

amplification target spans genetic elements not usually combined in nature,

providing a strong indication of the presence of a GMO event that includes

that construct.

– In event-specific testing, the primers are designed to detect the unique

integration site of a specific transformation event. Thus, a positive result is

indicative of the presence of that particular event.

Whatever the type of method selected and its origin, internally developed or publicly

available, its performance must be evaluated according to the PBA requirements and

following the procedures as directed by the ISTA GMO Committee.

19.5.1.2 End-point qualitative PCR

In end-point PCR, the standard steps of PCR are carried out, with detection of PCR

products at the end of the process. This detection step can be the electrophoresis of

the amplified DNA molecules on gel or the measurement of fluorescence associated

with the PCR reaction. With electrophoresis, the test is scored as positive if a band

of the appropriate size is observed on the gel, and negative if no band is observed.

With fluorescence detection, the test is scored by comparison to the fluorescence

measurement of appropriate positive and negative control samples.

19.5.1.3 Real-time PCR

During real-time PCR, DNA amplification activates fluorochromes attached to the

primers or probes. This activation can be measured in real time and can give an

estimate of the number of DNA molecules being amplified in each cycle.

DNA amplification can also be measured by activation of intercalating fluorescent

dyes. In this case, special attention to false-positive results must be paid, since the

activation of intercalating dyes can be associated with amplification of non-specific

PCR products.


PROPOSED VERSION

Real-time PCR can be qualitative or quantitative.

In qualitative real-time PCR tests, the test is scored positive if fluorescence above

the defined baseline is detected before a given PCR cycle (usually set by

amplification of a known GMO control DNA).

In quantitative real-time PCR tests, the assay is designed to quantify the target

against a standard curve produced from reference material. The experimental set-up

and reporting of results must follow accepted statistically sound methods such as

those suggested in the GMO Handbook.

19.5.1.4 Other technologies

The descriptions in section 19.4.1.3 apply to technologies (primer and probe sets,

methods and equipment used for amplification and detection as well as for

quantification) that are widely used in laboratories carrying out GMO testing.

Other methods are currently being developed for use in GMO detection. Use of

these methods can also be included in ISTA’s PBA as long as the laboratory

develops and maintains adequate validation data for the methods used.

19.5.2 Protein-based methods

19.5.2.1 General principles of protein-based testing

In order to detect single proteins in seeds, the seeds need to be ground and extracted

with a suitable buffer. The detection of proteins using an immunoassay in a complex

mixture such as that obtained by extraction of seed powder requires a number of

precautions. The detectable protein content may vary due to the protein itself, the

extraction process and buffer and the type of seed used. Particular difficulties are

well known (e.g. oil content of oilseed rape, gossypol in cotton seeds, varietal

differences, seed maturity, seed moisture) and the laboratory should have validated

the extraction and detection methods for each seed matrix by spike and recovery

tests (see GMO Method Handbook). Proteins are generally rapidly degraded. The

extraction should be carried out at room temperature, or below, and after extraction

the mixture should be used quickly or stored at low temperature. When using

commercial lateral flow strip tests (19.5.2.2) or ELISA kits (19.5.2.3), it is important

to refer to the assay conditions as defined by the test kit suppliers. Moreover, these

assay conditions must be internally validated in the laboratory conditions,

systematically include positive and negative controls in each test and follow the

ISTA Principles and Conditions for Laboratory Accreditation under the

Performance Based Approach (see

http://www.seedtest.org/upload/cms/user/ISTAMethodValidationforSeedTesting-

V1.01.pdf).

It is not recommended to use protein-based tests for quantification of GMO, as the

variations in sample type (e.g. germplasm, seed maturity) and in extraction and

detection methods can result in target protein content variation in the protein extract

and cause difficulty in estimating the GMO content. Protein detection is not always

event-specific, as several events may contain the same protein (e.g.

NK603/MON88017; MON810/Bt11), but the careful use of multiple methods may

allow a good indication of which event is being detected.

19.5.2.2 Lateral flow strip test

The lateral flow strip test consists of an immunoassay in which globulins or

antibodies are immobilized on a capillary paper. The strip is dipped into the protein

extract. The presence of the target protein (the antigen) is represented by the

appearance of at least two bands, a negative result only by a control band. The result

can be scored only if the control band is visible. A maximum time of reading must

be defined to avoid false-positive scoring, due to unspecific staining which can

occur after a long reaction time.


PROPOSED VERSION

19.5.2.3 Enzyme-linked immunosorbent assay

The enzyme-linked immunosorbent assay (ELISA) is a sensitive immunoassay that

uses an enzyme linked to an antibody or antigen as a marker for the detection of the

specific trait protein through a colorimetric reaction.

19.5.3 Bioassays

19.5.3.1 General principles of bioassays

Bioassays are tests based on visual assessment of phenotypic effects of treatments

on seeds or seedlings. The most common use of bioassays is to determine the

presence of seed which carries herbicide-resistance traits. In this case the seeds or

seedlings are exposed to herbicide, and the expected effect on the plant is lack of

normal development when the seeds do not contain the herbicide-resistance trait. All

seeds or plants that continue to germinate or grow normally are scored as positive

for the GMO trait. The appropriate concentration of herbicide must be determined

per crop and growth stage. It is important to consider that bioassays determine the

presence of a GMO trait, but cannot determine the presence of any specific event, as

in many crops multiple events exist with the same herbicide-resistant phenotype.

Therefore, in such cases herbicide bioassays can only be used to screen for the

presence of GMO, but cannot detect the presence of a particular event.

19.5.3.2 Scoring of GMO presence

Standardized methods of scoring and analysing the results for the herbicide testing

should be in place. This should include statistical considerations of the numbers of

seeds used and scored.

The result must take into consideration the germination percentage.

19.6 Calculation and expression of results

19.6.1 Consideration of the testing objective

The applicant must clearly state the specific testing objective, as this is critical in

defining the testing approach and in calculating and expressing results. Possible

testing objectives include:

– reporting the presence or absence of a GMO in the seed lot;

– estimating the proportion of the GMO present in the seed lot with the

associated measurement uncertainty.

The methods described in 19.5 produce either qualitative, i.e., detected (GM trait

observed) or not detected (GM trait not observed), or quantitative results. Both types

of results can be statistically analysed to meet the testing objective, but the data

analysis methods and associated calculation tools differ.

To assess for the presence of two or more stacked events in the same seed, testing

individual seed is the appropriate approach. When seed are tested in bulk, the

presence of stacked events cannot be demonstrated. However, some statistical tools

such as the one proposed by ISTA in SeedCalc Stack9 can estimate the percentage

of seeds that could have two or three stacked events.

19.6.2 Units of measurement

The calculation and expression of results depend on the testing objectives, testing

methods and the associated units of measurement. The aim or request of the

applicant will need to be carefully considered. In order to cope with the different

objectives and circumstances where quantification of seeds with GMO traits is

required, and in concordance with the PBA, it is acceptable to report quantitative

test results using any one of the following units:


PROPOSED VERSION

a) % in number of seeds: the estimate of the percentage of GM seeds in the

seed lot. In addition to individual testing, the percentage in number of seeds

is the unit to be used when a group testing approach is chosen; e.g. with

SeedCalc (see 19.6.3).

b) % in mass of seeds: the estimate of the percentage of GMO content by

mass. This unit should be used when a standard curve is prepared using

certified reference material certified by % mass (g/kg).

c) % DNA copies: the estimate of the percentage of GMO content by number

of copies. This unit should be used when a standard curve is prepared using

certified reference material certified by % DNA copies.

All these three units are acceptable for preparing ISTA Certificates for reporting

results by accredited laboratories. The acceptance of more than one unit can avoid

raising the difficult question of converting factors. A simple mechanical conversion

between units is complex or even impossible.

Whatever the unit used to express results, the resulting GM estimate should be

methodologically meaningful, that is, a laboratory using quantitative real-time PCR

should not report a value that is lower than its validated limit of quantification.

Moreover, in quantitative real-time PCR, results should be biologically meaningful.

The lab should pay attention to results that are lower than 1 divided by the size of

the working sample.

19.6.3 ISTA tools for calculation of results

Remund et al. (2001) and Laffont et al. (2005) provided statistical tools for

qualitative and quantitative testing methods which are implemented in the SeedCalc

MS Excel workbook (available on the ISTA web site).


The result of a genetically modified organism test must be reported under ‘Other

determinations’ as follows:

– the request of the applicant;

– the name and scope (with reference to the target) of the method(s) used;

– a description of the working sample (e.g. pure seed fraction, inert matter

present, other seeds present, washed seed);

– the number of seeds in the working sample;

– a description and the source of the reference material used (e.g. certified

reference material, provider);

– the limit of detection of the method (when testing seed groups or seed

bulk);

– the limit of quantification of the method (when testing seed bulk with a

quantitative method)

19.7.1 Qualitative test results

Suggested phrases for reporting the detection of test targets depending upon the

result are as follows:

a) If the test target(s) was(were) not detected: ‘ The test target was not

detected.’

b) If the test target(s) was (were) detected: ‘The test target was detected.’


PROPOSED VERSION

19.7.2 Quantitative results obtained by multiple qualitative tests of individuals or

groups of seeds or seedlings

Results should be reported relative to the percentage of seeds or seedlings showing

the test target specified by the applicant. The total number of seeds tested, the

number of groups, and the number of seeds per group must be reported. Suggested

phrases for reporting such results depending upon the result are as follows:

a) If the test target(s) was (were) not detected: ‘The test target(s) was (were)

not detected.’

b) If the test target(s) was (were) detected: ‘The % of seeds in the lot with the

test target(s) was determined to be …%, with a 95% confidence interval of

[…%, …%].’

or

‘For the test target(s) specified by the applicant, the seed lot meets the

specification of ...% (maximum or minimum) with …% confidence.’

If the results do not show evidence that the seed lot meets a given specification with

some confidence, then the applicant will report the point estimate with the 95%

confidence intervaI.

19.7.3 Quantitative measurements of GMO in bulk samples

Results should be reported relative to the percentage of the test target specified by

the applicant by mass or number of DNA copies. The testing plan (e.g. number of

replicate seed samples, number of replicate flour samples per seed sample, number

of extracts per flour sample, number of replicate measurements per extract) must be

indicated.

Required phrases for reporting depending upon the results are as follows:

a) If the test target was not detected (no signal or below the limit of detection):

‘The test target was not detected at a level above the limit of detection.’

b) If the test target was detected at a level above the limit of detection and

below the limit of quantification: ‘The test target was detected at a level below the

limit of quantification of the method used.’

c) If seeds showing the test target were found at a level above the limit of

quantification: ‘The test target(s) percentage in the seed lot was determined

to be …% by mass or number of copies, with a 95% confidence interval of

[…%,…%]‘

or

‘For the test target(s) specified by the applicant, the seed lot meets the

specification of ...% (maximum or minimum) by mass or number of copies

with …% confidence.’

If the results do not show evidence that the seed lot meets a given specification with

some confidence, then the applicant will report the point estimate with the 95%

confidence intervaI.


PROPOSED VERSION

19.8 References

Battistini E. and Noli E. (2009) Real-time quantification of wild-type contaminants

in glyphosate tolerant soybean. BMC Biotechnology 9, 16.

Laffont J-L., Remund, K.M., Wright, D.L., Simpson R.D., Gregoire S. (2005)

Testing for adventitious presence of transgenic material in conventional seed or

grain lots using quantitative laboratory methods: statistical procedures and their

implementation. Seed Science Research 15, 197-204.

Remund, K.M., Dixon D.A., Wright D.L. and Holden L.R. (2001) Statistical

considerations in seed purity testing for transgenic traits. Seed Science Research 11,

101-119.

SeedCalc: http://seedtest.org/en/stats-tool-box-_content---1--1143.html (last verified

2013-02-15)

Changes also needed to Chapter 1. The same text as for 19.7 and 19.7.1-19.7.3 will

be inserted at 1.5.2.20 and the existing 1.5.2.20 renumbered to 1.5.2.21.

….

1.5.2.20 Genetically Modified Organism test

Same text as for 19.7 and 19.7.1-19.7.3 above.

1.5.2.201 Reporting of results of tests not covered by the Rules

Update reference for 1.5.2.20

1.3

…..

c)

…ISTA Certificate (see 1.5.2.201).


C.19.1. AND C.1.3.

http://seedtest.org/en/stats-tool-box-_content---1--1143.html

rules proposals for the international rules for seed ...€¦ · centrosema pubescens benth....

Documents