running head: new insights on regulation of stm gene function

1

Running head: New insights on regulation of STM gene function.

The author responsible for distribution of materials integral to the findings presented in this

article in accordance with the policy described in the instructions for authors

(www.plantphysiol.org) is:

Neelima R. Sinha

Department of Plant Biology, College of Biological Sciences, University of

California, Davis, CA 95616, U. S. A.

Telephone: 530 754 8441

Email: [email protected]

Primary research area:

Genes, Development and Evolution

Plant Physiology Preview. Published on December 18, 2014, as DOI:10.1104/pp.114.248625

Copyright 2014 by the American Society of Plant Biologists

www.plantphysiol.orgon February 14, 2018 - Published by Downloaded from Copyright © 2014 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Transcriptional, post-transcriptional and post-translational

regulation of STM gene expression in Arabidopsis determines

gene function in the shoot apex

José Antonio Aguilar-Martínez1

Naoyuki Uchida1,2

Brad Townsley1

Donnelly Ann West1

Andrea Yanez1

Nafeesa Lynn1

Seisuke Kimura1,3

Neelima Sinha1*

1 Department of Plant Biology, University of California, Davis, CA, USA.

2 WPI-Institute of Transformative Bio-Molecules (WPI-ITbM), Nagoya University, Furo-cho, Chikusa-ku,

Nagoya, 464-8602, Japan.

3 Department of Bioresource and Environmental Sciences, Kyoto Sangyo University, Kyoto 603-8555, Japan

Components of the complex regulation of a homeobox gene key for plant development are dissected at

transcriptional, post-transcriptional and post-translational levels.



3

FOOTNOTES

This work was supported by a postdoctoral fellowship from Spanish Ministry of Science

(MICINN) to J.A.A.M. and a grant from the National Science Foundation (Plant Genome

grant no. 1238243) to N.S.



4

Abstract

The activity of SHOOT MERISTEMLESS (STM) is required for the functioning of the

shoot apical meristem (SAM). STM is expressed in the SAM but is downregulated at the

site of leaf initiation. STM is also required for the formation of compound leaves.

However, how the activity of STM is regulated at the transcriptional, post-transcriptional

and post-translational levels is poorly understood. We previously found two conserved

noncoding sequences (CNSs) in the promoters of STM-like genes across Angiosperms, the

K-box and the RB-box. Here we characterize the function of the RB-box in Arabidopsis

thaliana. The RB-box, along with the K-box, regulates the expression of STM in leaf

sinuses, which are areas on the leaf blade with meristematic potential. The RB-box also

contributes to restrict STM expression to the SAM. We identified FRS-RELATED

FACTOR1 (FRF1) as a binding factor to the RB-box region. FRF1 is an uncharacterized

member of a subfamily of four truncated proteins related to the FRS (FAR1-Related

Sequences) factors. Internal deletion analysis of the STM promoter identified a region

required to repress the expression of STM in hypocotyls. Expression of STM in leaf

primordia under the control of the JAGGED promoter produced plants with partially

undifferentiated leaves. We further found that the ELK domain has a role in post-

translational regulation of STM by affecting the nuclear localization of STM.



5

Introduction

The shoot apical meristem (SAM) contains a group of undifferentiated cells from which

the aerial plant lateral organs derive. Several genes important for the functioning of the

SAM have been characterized (reviewed in Barton, 2010; Aichinger et al., 2012). In

Arabidopsis thaliana, WUSCHEL (WUS) regulates the formation and maintenance of the

SAM (Laux et al., 1996; Mayer et al., 1998) and acts in a negative feedback loop with

CLAVATA (CLV) genes. WUS promotes stem cell activity while CLV genes suppress this

activity (Fletcher et al., 1999; Brand et al., 2001; Schoof et al., 2001). SHOOT

MERISTEMLESS (STM), a class I KNOTTED-LIKE HOMEOBOX (KNOX1) gene, is

required for the maintenance of the SAM to prevent cell differentiation (Endrizzi et al.,

1996; Long et al., 1996). STM and WUS act in different pathways (Lenhard et al., 2002).

The KNOX1 genes KNAT1/BP (KNOTTED1-LIKE IN ARABIDOPSIS THALIANA/

BREVIPEDICELLUS), KNAT2 and KNAT6 show expression in the SAM and are partially

redundant with STM (Byrne et al., 2002; Scofield and Murray, 2006). CUP-SHAPED

COTYLEDON (CUC) genes demarcate the boundaries between emerging leaf primordia

and the SAM and are required for the initial expression of STM during embryo

development (Aida et al., 1997; Aida et al., 1999; Takada et al., 2001).

In addition to these regulatory genes, plant hormones such as cytokinins (CKs) and

gibberellins (GAs) play an important role in the activity of the SAM. CKs are required for

the maintenance of the meristem cells in an undifferentiated state, whereas GAs promote

differentiation. STM promotes cytokinin expression by activating the cytokinin

biosynthesis gene ISOPENTENYL TRANSFERASE7 (IPT7; Jasinski et al., 2005; Yanai et

al., 2005). Simultaneously, STM activates a GA deactivating gene At-GA2ox2 (Jasinski et

al., 2005) and represses the expression of the GA biosynthesis gene At-GA20ox1 (Hay et

al., 2002). In turn, increased CK levels enhance the expression of STM (Rupp et al., 1999;

Kurakawa et al., 2007).



6

Leaves are formed on the flanks of the SAM. This process is characterized by the

accumulation of auxins at the site of leaf primordia initiation, the P0 site (Plastochron 0;

Benkova et al., 2003; Reinhardt et al., 2000), and by a down-regulation of STM (Long and

Barton, 1998). ASYMMETRIC LEAVES1/2 (AS1/2) are expressed in leaf primordia but the

activity of STM represses their expression in the SAM (Byrne et al., 2000).

STM also plays a role in the control of leaf morphology. Leaves of plants can be classified

as simple or compound, with simple leaves having a single lamina and compound leaves

having a lamina divided into leaflets. In simple-leaved species such as Arabidopsis, STM is

not expressed in leaf primordia, however STM expression is found in leaflet primordia of

compound-leaved species (Bharathan et al., 2002), with the exception of species within a

derived clade of legumes where the function of STM-like genes in generating leaflet

primordia is taken over by LEAFY-like genes (Bharathan et al., 2002; Champagne et al.,

2007; Hofer et al., 1997; Hofer et al. 2001). Furthermore, ectopic expression of STM-like

genes in compound-leaved species produces leaves with an increased degree of leaf

complexity (Hareven et al., 1996, Janssen et al., 1998). Conversely, a reduction in the

expression of STM-like genes in compound-leaved species reduces leaf complexity (Hay

and Tsiantis, 2006). The function of STM in leaf morphology is in part controlled by its

interaction with the truncated form of the KNOX1 factor PTS/KNATM

(PETROSELINUM/ KNOX ARABIDOPSIS THALIANA MEINOX) through competition

for the formation of dimers with BELL (BEL-like homeodomain) factors (Kimura et al.,

2008; Magnani et al., 2008). KNOX1 levels can also be controlled at the network level by

upstream factors in the PTS network module (Ichihashi et al., 2014).

Despite the importance of STM function in plant development, the regulation of STM

expression and the subsequent transcriptional, post-transcriptional and post-translational

controls that determine effective STM levels are poorly understood. Gene regulation at the

transcriptional level is mediated through the binding of transcription factors to cis-

regulatory sequences. These regulatory sequences are often embedded in conserved

noncoding sequences (CNSs), stretches of noncoding DNA that are evolutionary

preserved. Cis-regulatory sequences can also be located in introns. Importantly, intronic

sequences show direct regulation of KNOX1 genes: several dominant mutants in maize



7

knotted1 (kn1) that confer ectopic expression of the gene are caused by events of

transposon insertions in intron 3 in a region particularly rich in CNSs (Greene et al., 1994;

Inada et al., 2003). In grasses, a CNS has been characterized in intron 2 of the class I

KNOX genes liguleless 3 (lg3), lg4a and lg4b (Bauer et al., 2004). In rice, Oryza sativa

homeobox1 (OSH1) positively regulates its own expression through binding to CNSs in

intron 3 (Tsuda et al., 2011). In barley, the hooded mutation increases the expression of

Barley knox3 (Bkn3) due to a duplication of 305 base pairs in intron 4 (Müller et al., 1995).

Yeast one-hybrid experiments showed a number of factors that bind this intronic region

(Santi et al., 2003; Osnato et al., 2010). In rice, exonic sequences of class I KNOX genes

also have regulatory functions (Ito and Kurata, 2008). In general, however, most of the cis-

regulatory sequences are located in the 5’ upstream region of the genes. We have

previously described two CNSs in the STM promoter, the K-box and the RB-box (Uchida

et al., 2007). Transgenic plants harboring a deletion in the K-box did not affect the

expression of STM in the SAM and its down-regulation in P0, but showed an expansion of

the STM expression pattern outside of these domains with consequences on leaf shape

(Uchida et al., 2007). We determined that class I TEOSINTE BRANCHED1-

CYCLOIDEA-PROLIFERATING CELL FACTOR1 (TCP) transcription factors can bind

to the K-box region (Aguilar-Martínez and Sinha, 2013). However, a role for the RB-box

in Arabidopsis has not been defined and other promoter regions important for STM

regulation have yet to be characterized.

The regulation of STM at the protein level has been investigated more extensively. STM

interacts with BELL factors through the MEINOX domain to access the nucleus and

regulate the transcription of target genes (Bellaoui et al., 2001; Smith et al., 2003; Bhatt et

al., 2004; Cole et al., 2006). The homeodomain (HD) is required for DNA binding (Smith

et al., 2002; Viola and Gonzalez, 2009) and intercellular trafficking (Lucas et al., 1995;

Kim et al., 2005; Winter et al., 2007; Bolduc et al., 2008). However the role of the ELK

domain is less understood though it is considered to be required for protein-protein

interaction (Vollbrecht et al., 1991; Kerstetter et al., 1994) and for nuclear localization

signal sequences (NLSs; Meisel and Lam, 1996). Cole et al. (2006) indicated that STM

does not contain a NLS and in the rice KNOX1 gene OSH15, the ELK domain is not



8

required for nuclear localization, DNA binding, or homodimer formation, though it was

shown to have a role in suppressing transactivation activity (Nagasaki et al., 2001).

Here we analyze the regulation of STM through the study of promoter reporter constructs

and gene specific misexpression: we i) investigate the role of the RB-box in Arabidopsis,

ii) identify a binding factor to the RB-box region that belongs to a group of

uncharacterized proteins, iii) we delimit other important regions in the STM promoter for

the proper expression of the gene, iv) study the down-regulation of STM in P0 using a

gene-specific misexpression form of STM, and v) also show that the regulation of the

activity of STM in the cell nucleus is mediated by the ELK domain.

Results

The RB-box has a role in the control of STM regulation in Arabidopsis

We have previously shown that the STM gene promoter contains two CNSs, the K-box and

the RB-box (Uchida et al., 2007). The K-box is present in all species analyzed and has a

role in STM regulation (Uchida et al., 2007). A sequence analysis determined that the RB-

box is present in promoter regions of STM genes in all of the species we analyzed in this

study (Figure 1A; Uchida et al., 2007). In most of the species analyzed the RB-box is

located in a region around 500 base pairs (bp) upstream from the translation initiation

codon. However in the Brassicaceae species analyzed, the RB-box is located relatively far

from the translation initiation codon, ranging from -1412 bp in Cardamine hirsuta to -3484

bp in Thellungiella halophila (Fig. 1B).

In Arabidopsis thaliana STM expression is seen in the whole shoot apical meristem except

in the new leaf primordium initiation site (Long et al., 1996; Long and Barton, 2000). The

deletion of the core K-box expands the normal expression domain of STM to the base of

leaf primordia and the midvein of leaf petioles (Uchida et al., 2007). Through reporter

fusion experiments using the uidA gene, we wanted to determine expression patterns

produced by deletions of RB-box elements alone and in combination with deletions of

elements of the K-box (Fig. 2A; Table I). We analyzed 8 days-old seedlings of

representative T3 lines. A promoter fragment of 3379 bp (ProSTM:GUS) recapitulates the



9

endogenous STM expression (Uchida et al., 2007; Figs. 2B and 2C). Plants transformed

with the construct ProSTM-ΔLK:GUS lack the large K-box and showed a GUS expression

pattern similar to the plants with just the construct ProSTM:GUS (Figs. 2D and 2E). In

older plants, GUS expression is found in the abaxial side of leaves in ProSTM-ΔLK:GUS

just as in constructs ProSTM-ΔCK:GUS that lack the core K-box (Supplemental Fig. 1A;

Uchida et al., 2007). In ProSTM-ΔCRB:GUS plants there is a deletion in the core RB-box

and the GUS expression pattern is expanded to the abaxial side of the growing leaves and

some expression is also seen in the hypocotyl (Figs. 2F and 2G). A similar pattern, except

for the expression in the hypocotyl, is found in plants with deletions in both the core RB-

box and the core K-box (ProSTM-ΔCRB-CK:GUS; Figs. 2H and 2I). When the large RB-

box is deleted (ProSTM-ΔLRB:GUS), the expression of GUS is detected in patches in the

hypocotyl and the root (Fig. 2J). Analysis of transverse sections indicated that GUS

expression in the pericycle corresponded with the two xylem poles (Fig. 2K). No GUS

expression is detected in the shoot apex. A combined deletion of the large RB-box and the

core K-box (ProSTM-ΔLRB-CK:GUS) produced an expression similar to the pattern of

GUS in hypocotyls seen in ProSTM-ΔLRB:GUS (Figs. 2L and 2N). Furthermore, GUS is

located in the sinuses, or spaces between lobes or teeth, of the growing leaves (Figs. 2L,

2M and 2O). Deleting both the large RB-box and the large K-box (ProSTM-ΔLRB-

LK:GUS; Figs. 2P and 2Q) showed a pattern of GUS expression similar to the construct

with both core RB and core K boxes deleted (Figs. 2H and 2I). GUS expression was not

evident in plants harboring constructs with deletions in the 5’ region of the STM promoter

up to the RB-box, using a native promoter (ProSTM-ΔRB:GUS) nor with the additional

deletion of the core K-box (ProSTM-ΔRB-CK:GUS; Table I; Supplemental Figs. 1B and

1C), indicating that regions further upstream from the RB-box are needed for wild type

expression of STM.

In summary, this promoter analysis shows that the CNS in the RB-box are required for

proper STM expression and that there is interaction between the RB-box and K-box

regulatory functions.

FRF1 binds the RB-box



10

In order to gain insight into STM gene regulation, we used yeast one-hybrid screening to

identify factors that interact with the STM promoter region. We previously identified class

I TCP gene products binding to the K-box region (Aguilar-Martínez and Sinha, 2013).

Using a similar approach we wanted to study factors that bind the RB-box. For the yeast

one-hybrid analysis we used a fragment of the STM promoter containing the large RB-box

(-2133 to -1907 bp from the start codon). From the putative binding factors identified

(Supplemental Table I), we focused on At3g59470, which encodes for a putative DNA

binding factor (see below). We used an electrophoretic mobility shift assay (EMSA) and

determined that this factor interacts with the RB-box (Fig. 3A) and with the ΔCRB

fragment (representing a 17 bp deletion of the core, Supplemental Fig. 2). At3g59470 is

related to the FRS (FAR1-Related Sequences) genes, a family of transposase-derived

transcription factors (Hudson et al., 1999; Wang and Deng, 2002; Lin and Wang, 2004).

Well-known members of this family are FHY3 (FAR-RED ELONGATED HYPOCOTYL3;

Whitelam et al., 1993) and FAR1 (FAR-RED IMPAIRED RESPONSE1; Hudson et al.,

1999). We named At3g59470 FRF1 (FRS-RELATED FACTOR1). FRS factors are

characterized by having an N-terminal C2H2-type chelating motif of the WRKY-GCM1

family, a central core transposase domain of MULE transposases and a C-terminal SWIM

zinc-finger domain. The N-terminal domain acts as a DNA binding domain, while the C-

terminal domain is required for transcriptional factor activity (Lin et al., 2007). There are 4

FRF-like genes in the Arabidopsis genome. Interestingly, FRF1, FRF2, FRF3 and FRF4

only share the N-terminal motif with FRS proteins (Fig. 3B and Supplemental Data Set 1)

and form a well supported, though not well resolved, clade. We looked for FRF-like genes

in species other than Arabidopsis (Fig. 3C and Supplemental Fig. 3) and found that these

genes are represented across the dicots (tomato, Medicago truncatula, Vitis vinifera) and

monocots such as rice.

We wanted to study the function of FRF1 by analyzing insertion alleles for this gene. We

characterized one allele frf1-1 that had a tandem insertion located at -700 bp from the

putative start codon. Plants frf1-1 had the same phenotype as wild type plants. We then

made RNAi lines for FRF1 and these transgenic plants showed a normal phenotype.

Additionally, we studied an allele of FRF2, frf2-1, which had a tandem insertion at -140 bp



11

from the putative start codon. The frf2-1 allele also showed no phenotypic defects when

compared with the wild type. To the best of our knowledge, no insertion alleles are

available in the coding region for FRF1 nor FRF2. Insertion alleles for FRF3 were not

analyzed in this study. For FRF4 we analyzed an allele named frf4-1 with an insertion at

338 bp from the putative start codon. The phenotype of frf4-1 plants was similar to the

wild type. The small size and low conservation between these gene sequences precludes

simultaneous knock-down by RNAi or amiRNA strategies.

We looked at the expression pattern of FRF genes in the Arabidopsis eFP browser at BAR

(http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi; Winter et al., 2007), AtGenExpress

(http://jsp.weigelworld.org/expviz/expviz.jsp; Schmid et al., 2005) and GeneCAT

(http://genecat.mpg.de/899/genecat.html; Mutwill et al., 2008). FRF1 and FRF4 are

broadly expressed in Arabidopsis tissues, particularly in shoot apices (Supplemental Fig.

4). For FRF2 and FRF3 there are no data available in these databases. For these two genes

EST and cDNA matches are described in TAIR (The Arabidopsis Information Resource;

www.arabidopsis.org). According to the Cell eFP Browser (http://

bar.utoronto.ca/cell_efp/cgi-bin/cell_efp.cgi) FRF1 and FRF2 are located in the nucleus,

while FRF3 and FRF4 are present in the nucleus and cytoplasm.

In summary, we determined that FRF1 binds the RB-box and that FRF1 belongs to a small

family of factors phylogenetically conserved and FRS-related family of transcription

factors. Limited analysis of mutant alleles and RNAi lines suggests that these genes may

function redundantly.

Deletion analysis of the promoter of Arabidopsis STM reveals important regions for

its proper regulation

We further analyzed the role of other fragments of the gene promoter in regulating STM

expression. We divided the STM promoter into fragments of about the same size without

including the RB and K boxes, generated internal deletions, fused them to the uidA gene

and analyzed the GUS expression pattern in the transgenic plants from T3 lines (Fig. 4;

Table I). We divided the fragment upstream of the RB-box into three parts, F1, F2 and F3

of 335 bp each one, the fragment between both RB and K-box in 4 parts, F4 to F7 of 388



12

bp each one, and we used the fragment F8 between the K-box and the starting codon of

220 bp (Fig. 4A). Compared to the normal expression of STM in the shoot apex (Long et

al., 1996; Long and Barton, 2000; Uchida et al., 2007; Figs. 2B and 2C), the deletion of the

fragment F1 (ProSTM-ΔF1:GUS) showed no changes in the shoot apex localization of

GUS (Figs. 4B and 4C). Deleting the fragment F2 (ProSTM-ΔF2:GUS) lightly expanded

the GUS expression pattern through the hypocotyls (Figs. 4D and 4E). When the F3

fragment is removed (ProSTM-ΔF3:GUS) a strong GUS signal was observed throughout

the hypocotyl, while no expression was found in the shoot apex (Fig. 4F). Analysis of

cross-sections of the hypocotyls showed staining markedly confined to the stele (Fig. 4G).

Light expression in the shoot apex and the hypocotyls was found in constructs that lack the

F4 fragment (ProSTM-ΔF4:GUS, Figs. 4H and 4I) or the F5 fragment (ProSTM-ΔF1:GUS;

Figs. 4J and 4K). An expression similar to the native promoter was found in plants with the

F6 fragment deleted ProSTM-ΔF6:GUS (Figs. 4L and 4M). GUS expression in plants with

the construct ProSTM-ΔF7:GUS (Figs. 4N and 4O) was similar to the constructs ProSTM-

ΔF4:GUS and ProSTM-ΔF5:GUS. The deletion of the F8 fragment (ProSTM-ΔF8:GUS)

produced an expansion of GUS expression pattern mainly to the abaxial side of growing

leaves and petioles (Figs. 4P and 4O).

We also looked for conserved regions other than the K-box and RB-box in the promoters

of STM-like genes. We focused on the Brassicaceae species with sequenced genomes B.

rapa, T. halophila, C. rubella, A. thaliana, A. lyrata and C. hirsuta and in regions from the

RB-box up to -6000 bp from the translation initiation codon (Fig. 5A). Three regions Fa,

Fb and Fc appear greatly conserved. Fa is the most distant (Figs. 5A and 5B), Fb is located

between fragments F1 and F2 (Figs. 5A and 5C), while Fc is located in the fragment F3

close to the RB-box (Figs. 5A and 5D). The functional significance of these conserved

sequences remains to be elucidated.

We also studied the sequence conservation in intronic regions of STM-like genes in the

Brassicaceae species analyzed. Interestingly, sequences of introns I and II are greatly

conserved between species, while sequences of the intron III are poorly preserved

(Supplemental Fig. 5A). In comparison, sequences of introns I, II and IV of BP-like genes



13

are not conserved and only one fragment of intron III is well conserved between species

(Supplemetal Fig. 4B).

From this analysis we determined that the sequences in the F3 fragment greatly contribute

to the correct expression of STM, while the role of the other fragments analyzed appears to

be less prominent. Sequence conservation analysis suggests that further upstream

sequences as well as introns I and II may also harbor STM regulatory sequences.

STM expression in initiating leaf primordia

One of the most striking features of STM expression is its down-regulation in the incipient

leaf primordium, the P0. The P0 is characterized as the region containing a group of leaf

founder cells located at the flanks of the SAM. The down-regulation of STM at P0 is

required for the formation of new leaf primordia in a process that appears to be regulated at

the transcriptional level (Long et al., 1996; Long and Barton, 2000). We wanted to

determine the developmental consequences of expression of STM in P0, a site where the

gene is normally down-regulated. Based on mRNA in situ hybridization, the JAGGED

(JAG) gene is expressed in P0 (Dinneny et al., 2004; Ohno et al., 2004). JAG is also

expressed in young leaf primordia. In reproductive development JAG is expressed in all

flower organ primordia (Dinneny et al., 2004; Ohno et al., 2004). We found that 2.2 Kb of

the 5’ region of JAG recapitulates the endogenous expression of the gene (Figs. 6A, 6B

and Supplemental Fig. 6). We generated transgenic plants harboring 2.2 Kb of the JAG

promoter fused to the coding sequences of GFP and STM (ProJAG:GFP-STM) and

analyzed the phenotype (Figs. 6C-H). We expected that expression of STM in P0 would

lead to defects in leaf primordia initiation, as STM promotes the maintenance of the cells in

an undifferentiated stage. Compared to the wild type (Fig. 6C), the transgenic plants

ProJAG:GFP-STM recovered with a strong phenotype were of reduced size and with

epinastic cotyledons (Fig. 6D). Although leaf primordia emerged and show characteristics

of differentiation such as the presence of leaf trichomes, leaf growth and expansion were

arrested (Fig. 6D). These transgenic plants do not produce seeds. Transgenic plants with a

milder phenotype had bigger rosettes and small highly lobed leaves with broad petioles

(Figs. 6E and Supplemental Fig. 7A). Ectopic meristems were not observed on these



14

leaves. We used confocal microscopy to characterize GFP distribution in the transgenic

plants generated. In transgenic plants carrying ProSTM:GFP-STM GFP is located in the

SAM (Fig. 6 F and Supplemental Figs. 7B and 7C), similar to ProSTM:STM-VENUS

plants that use VENUS instead of GFP (Heisler et al., 2005). However in plants with STM

under the control of JAG promoter we observed a proliferation of stipule-like structures

that highly express GFP (Fig. 6G and Supplemental Figs. 7D-F). In ProJAG:GFP-STM

plants with less severe phenotype, GFP signal was more distributed throughout the base of

developing leaf primordia (Fig. 6H) and later in development stipule-like structures were

also observed (Supplemental Figs. 7G-I). These results indicate that ectopic expression of

STM in early leaf primordia disrupts normal development of these primordia.

The ELK domain is required for correct nuclear localization and activity of STM

The STM protein is characterized by having four well conserved domains, MEINOX,

subdivided into KNOX1 and KNOX2 subdomains, GSE, ELK and HD (Fig. 7A;

Vollbrecht et al., 1991; Kerstetter et al., 1994; Nagasaki et al., 2001). Despite the

conservation of the ELK domain, its role is poorly understood. To study the function of

this domain, we focused on the serine residue at position 272 (Supplemental Fig. 8). Serine

residues are a common target of protein post-translational modification through

phosphorylation and in addition serine residue at position 272 lies in a putative 14-3-3

protein binding site (http://scansite.mit.edu). We performed a site-directed substitution of

the S-272 to an alanine in ProSTM:GFP-STM (Uchida et al., 2007) to generate transgenic

plants ProSTM:GFP-STM-S272A and analyzed the phenotype. Compared with control

plants ProSTM:GFP-STM that behave as wild type (Uchida et al., 2007), plants carrying

ProSTM:GFP-STM-S272A were characterized by having lobed rosette leaves (Fig. 7B) and

highly lobed cauline leaves (Fig. 7C), while other organs were not affected (Fig. 7D). This

phenotype was different from plants Pro35S:STM-GR that ectopically express STM in a

inducible manner using the glucocorticoid receptor (GR) and are characterized by

producing multiple and very small leaves and ectopic stipules (Gallois et al., 2002; Cole et

al., 2006). Interestingly, plants that express both the BELL factor BLH9 (Pro35S:BLH9)

that interacts with STM to direct the complex to the cell nucleus and STM factor fused to



15

GR (Pro35S:STM-GR; Cole et al., 2006) have deeply lobed leaves, resembling

ProSTM:GFP-STM-S272A plants. Furthermore, transgenic plants that overexpress STM

fused to a NLS (Pro35S:NLS-GFP-STM; Cole et al., 2006) also have a similar phenotype

to plants ProSTM:GFP-STM-S272A. We then investigated if the targeted mutation STM-

S272A had an altered nuclear localization of STM which could correlate with the observed

phenotype. We transiently expressed the constructs GFP-STM and GFP-STM-S272A in

Nicotiana benthamiana leaves and observed the localization of STM using confocal laser

scanning microscopy. For the control construct GFP-STM the STM protein was found to

be located in the cytoplasm as previously described (Fig. 7E; Cole et al., 2006). However

the location of STM in STM-S272A was mainly nuclear (Fig. 7F). Taken together these

results suggest that the Serine 272 residue in the ELK domain has a role in the control of

nuclear localization of STM.

Nuclear localization of BELL factors depends on interaction with the nuclear export

receptor AtCRM1/AtEXPO1 (CHROMOSOME REGION MAINTENANCE1/

EXPORTIN1) through the BELL domain, which harbors both a nuclear export signal

(NES) and the STM-binding site (Rutjens et al., 2009). Treatment with leptomycin B

(LMB) specifically inhibits CRM1 activity and BELL factors accumulate in the nucleus

(Rutjens et al., 2009). We found that in N. benthamiana leaves, treatment with LMB also

determined the nuclear accumulation of STM (Supplemental Fig. 9). However, in a yeast

two-hybrid assay, AtCRM1 does not interact with STM (Rutjens et al., 2009) suggesting

that yeast endogenous factors might interfere with this interaction, or other plants factors

might be required for the interaction.

In conclusion, our results highlight the importance of the promoter region RB-box in STM

regulation. The RB-box is required for the expression of STM in the SAM and works with

the K-box in controlling STM expression in leaves. A putative transcription factor FRF1

from a previously uncharacterized subfamily of FRS proteins shows binding to the RB-

box. An initial scanning for important regulatory regions in STM other than the K-box and

the RB-box showed that the region F3 is required to repress the expression of STM in

hypocotyls. The expression of STM in leaf primordia using the JAG promoter does not

completely arrest leaf initiation, suggesting either that expression of STM in the P0 domain



16

does not have drastic consequences on leaf initiation or that STM is downregulated post-

transcriptionally in this domain. We also show that the ELK domain is required for a

correct post-translational regulation of STM. Combined, these results show that the

regulation of STM expression is complex with interplay between several promoter binding

TFs like the TCPs, FRFs and other as yet unknown factors in the regions of the promoter

upstream from the RB-box and between the RB- and K-boxes. Further analysis of

subcellular STM protein localization and protein levels in the P0 region of ProJAG:STM

plants is needed to determine the role post-transcriptional regulation plays in determining

STM expression in this domain.

Discussion

Role of the RB-box in STM transcriptional regulation

In Arabidopsis STM expression is normally restricted to the SAM. Our promoter deletion

analyses have shown that in certain constructs lacking the RB-box or both the RB-box and

the K-box, the expression of STM is expanded to the abaxial side of leaves. Interestingly,

the endogenous STM promoter of a species with dissected leaves, such as Cardamine

hirsuta, drives a similar expression pattern in either C. hirsuta or in Arabidopsis, a simple-

leaved species (Hay and Tsiantis, 2006). These authors proposed that the differences in

STM expression between species, and therefore in leaf morphology, can be due to

differences in regulatory regions of the STM promoters, reinforcing a role for the RB-box

and the K-box in this process. Although both species possess RB-box and K-box, subtle

sequence differences, including different spacing between regulatory sequences or

different response of trans-acting factors can account for different promoter activity.

We found that transgenic plants harboring a construct with a deletion of both the large RB-

box and the core K-box showed strong GUS expression in leaf sinuses. KNOX1 genes can

be expressed in leaf sinuses. For instance, in mutants as1-1 and as2-2 the genes KNAT1/BP

and KNAT2 are expressed in the sinuses (Ori et al., 2000). This expression is enhanced in

double mutants as1-1 se (serrate), as2-2 se and as1-1 axr1-3 (auxin resistant1-3) where

deeper sinuses are formed (Ori et al., 2000; Hay et al., 2006). In these double mutants,



17

ectopic structures resembling stipules are formed (Ori et al., 2000). STM has been found to

be expressed at low rate and intensity in leaf sinuses, inferred by the analysis of a construct

with the uidA gene fused to the native STM promoter (ProSTM:GUS; Kawamura et al.,

2010). STM is required for leaf serration (Depuydt et al., 2008; Kawamura et al., 2010).

CUC2 is also expressed in leaf sinuses (Nikovics et al., 2006) and mutants with increased

expression of CUC2 show expression of STM as small spots in some sinuses where stipule-

like organs are often observed (Kawamura et al., 2010). Leaf sinuses can be considered as

quiescent domains with the potential for meristem formation (Hu et al., 2011). In fact,

certain Kalanchoë species form plantlets on leaf sinuses (Garces et al., 2007). Our results

stress the importance of both the RB-box and the K-box in determining leaf shape through

regulation of leaf lobes and sinuses.

We have determined that different combinations of deletions of the RB-box and K-box

render different GUS expression patterns. For instance, the expression pattern found when

we combined deletions in the large RB-box and the core K-box is abolished when we used

the large RB-box and the large K-box. This indicates that other sequences close but

different to the core sequences are also important in STM regulation.

Transcription regulation operates in part through DNA bending that closely places

regulatory factors located relatively distant to the core promoter with the RNA polymerase.

It is possible that factors that bind the RB-box and the K-box participate in this bending

mechanism and that specific factors can cause interactions between these sites.

FRF proteins as putative binding factors at the RB-box

Through yeast one-hybrid and EMSA we determined that FRF1 is a putative binding factor

at the RB-box. This factor defines a group of uncharacterized proteins related to the FRS

transposase-derived transcription factors. Interestingly, FRF factors are conserved across

dicots, suggesting a conserved role for them in plant development. Further, FRF factors are

short or truncated versions of FRS factors, with only the N-terminal C2H2 zinc finger

domain sequence conserved. This domain is essential for direct DNA binding (Lin et al.,

2008). One possibility is that FRF factors could regulate the action of FRS factors through

competitive binding for the same DNA binding motifs. HY5 (LONG HYPOCOTYL5)



18

interacts with FHY3 and FAR1, interfering with their DNA binding capabilities (Li et al.,

2010). Interestingly, these interactions are mediated by the N-terminal C2H2 of FHY3 and

FAR1. Also FHY3 interacts with CCA1 (CIRCADIAN CLOCK-ASSOCIATED1), LHY

(LATE ELONGATED HYPOCOTYL) and PIF1 (PHYTOCHROME-INTERACTING

FACTOR1) through the N-terminal C2H2 domain (Li et al., 2011; Tang et al., 2012). Thus

another possibility is that FRF factors could interact with factors other than FRS factors.

Further functional studies on FRF factors would help to analyze these possibilities.

The F3 region as controller of the stem and root expression of STM

Our promoter deletion analysis showed that deletion of certain promoter fragments leads to

STM expression located at the pericycle. This is particularly noticeable for the fragment F3

and is also found in part in constructs without the large RB-box. The RB-box and the

fragment F3 are adjacent, indicating that sequences from this region, in particular from F3,

are important to repress the expression of STM in the pericycle. The pericycle is a primary

mersitem tissue and a place for shoot regeneration (Atta et al., 2009). In plants that have

secondary growth, tissue of the pericycle contributes to the development of the vascular

cambium. Furthermore, the pericycle has the capacity to produce lateral roots. Interestingly

the pattern of lateral root distribution is altered in the mutant stm-1 (Casimiro et al., 2001).

Indeed, the STM orthologs in tomato LeT6/TKN2 (Lycopersicum esculentum T6/ Tomato

Knotted2) and in Medicago truncatula Mt-knox-1 are found to be expressed in lateral roots

(Koltai and Bird, 2000; Koltai et al., 2001). The class I KNOX gene KNAT6 acts

redundantly with STM in SAM maintenance and is expressed in roots (Belles-Boix et al.,

2006; Dean et al., 2004). Similarly KNAT1 and the class II KNOX genes KNAT3, KNAT4

and KNAT5 show root specific tissue expression (Truernit et al., 2006). Furthermore

KNAT1 has a specific role in root skewing (Qi and Zheng, 2013).

Arabidopsis STM expression is found not only in the SAM but in stem tissue although not

uniformly (Long et al., 1996). In tomato LeT6 is expressed in the SAM and in vascular

tissue and in poplar the KNOX gene ARBORNOX1 (ARK1) is expressed in the SAM and in

the vascular cambium (Groover et al., 2006). Transcripts from the STM-like gene of the

parasitic plant Cuscuta pentagona are found in the haustoria, a specialized organ derived



19

from stems (Alakonya et al., 2012). However stem-tissue expression is more characteristic

of KNAT1-like genes, e.g., in Arabidopsis KNAT1 (Lincoln et al., 1994), tomato TKN1

(Hareven et al., 1996), poplar ARK2 (Du et al., 2009), maize kn1 (Smith et al., 1992;

Jackson et al., 1994) or Prunus persica KNOPE1 (Testone et al., 2012), with these genes

having a more prominent role in regulation of stem tissue differentiation (Townsley et al.,

2013).

We have also located three CNSs in the promoter of STM-like genes upstream of the RB-

box. It will be interesting to analyze if Fa has some function in the regulation of STM

expression. Fb could be the place for enhancer sequences, as constructs with deletions in

this region ProSTM-ΔF1:GUS and ProSTM-ΔF2:GUS have decreased GUS signal in shoot

apices. Fc, included in the F3 fragment, could contain the sequences for the repression of

STM expression in hypocotyls. Functional analyses will determine these possibilities.

Likewise, functional analyses of ProSTM-ΔCRB:STM and ProSTM-ΔF3:STM transgenic

lines will help to understand the roles of RB- and F3-boxes in SAM and leaf development.

Expression of STM in leaf primordia and mechanisms for regulation of STM

expression

Leaves of plants expressing ProJAG:STM with a weak phenotype resemble the leaves of

plants expressing Pro35S:KNAT1 or Pro35S:kn1 (Chuck et al., 1996; Lincoln et al., 1994)

while plants expressing ProJAG:STM with a strong phenotype resemble the phenotype of

plants expressing Pro35S:STM (Gallois et al., 2002; Williams, 1998) or plants that express

STM or Kn1 in a glucocorticoid (GR) inducible system (Pro35S:STM-GR, Pro35S:kn1-

GR) grown from germination on dexamethasone containing media (Gallois et al., 2002;

Hay et al., 2003). AINTEGUMENTA (ANT) is expressed in leaf primordia, along with

expression in other tissues (Elliott et al., 1996; Long and Barton, 2000). Plants expressing

ProANT:STM have a similar phenotype to plants ProJAG:STM (Lenhard et al., 2002). This

would suggest that the expression of STM at the site of presumptive leaf primordia

initiation can still produce rudiments of lateral organs although with suppression of cell

differentiation. Leaf initiation at P0 is characterized by a down-regulation of STM (Long

and Barton, 2000) and by the accumulation of auxin (Benkova et al., 2003; Reinhardt et



20

al., 2000), indicating that these processes can be functionally connected. PIN-FORMED1

(PIN1) and PINOID (PID) regulate polar auxin transport and in double mutant embryos

pin1-3 pid-2 the expression of STM is expanded to the cotyledon area, resulting in growth

inhibition of cotyledon primordia, indicating that both PIN1 and PID repress STM

(Furutani et al., 2004).

CUC1 and CUC2 are required for the establishment of organ boundaries in the SAM (Aida

et al., 1997; Aida et al., 1999). In double mutants cuc1 cuc2 the expression of STM is

abolished, indicating that both CUC1 and CUC2 could act as initiators of STM

transcription (Aida et al., 1999). Ectopic expression of CUC1 (Pro35S:CUC1) activates

the expression of STM, producing adventitious shoots at the sinuses of cotyledons. These

shoots are not formed in the stm mutant background (Hibara et al., 2003). However is not

known whether CUC1 and CUC2 directly or indirectly regulate STM. Also single mutants

for PINHEAD (PNH) and the related gene ARGONAUTE1 (AGO1) have defective apical

meristems although expression of STM is detected, however in the double mutant pnh ago1

the expression of STM is absent (Lynn et al., 1999).

Long-term repression of STM in leaves appears to be mediated by the action of Polycomb-

repressive complex2 (PRC2) and PRC1-like. CURLY LEAF (CLF) and SWINGER (SWN)

are members of PRC2. CLF directly binds the promoter of STM and double mutants clf

swn ectopically express STM in leaves (Schubert et al., 2006). Mutations in members of

PRC1-like also missexpress KNOX1 genes (Xu and Shen, 2008). It has been shown that

the leaf adaxial determinants AS1-AS2 interact with members of the PRC2 to mediate

long-term repression of KNOX1 genes KNAT1, KNAT2 and PTS/KNATM but not STM

(Lodha et al., 2013). Histone Deacetylase HDA6 participates in a complex with AS1 to

repress KNAT1, KNAT2 and PTS/KNATM (Luo et al., 2012). Class II TCP factors bind to

the promoters of KNAT1and KNAT2 and interact with AS2 to exert a repressive function

(Li et al., 2012). We determined that class I TCP factors can bind the STM promoter

through the K-box region (Aguilar-Martínez and Sinha, 2013). As regulation of STM

appears to not be mediated by the AS1-AS2 complex, it will be interesting to determine

which TCP interacting factors other than AS1-AS2 act in the regulation of STM.



21

Leaf abaxial polarity determinant YABBY factors FILAMENTOUS FLOWER (FIL) and

YAB3 have a role in the regulation of KNOX1 genes STM, KNAT1 and KNAT2, as double

mutants fil yab3 derepress the expression of these genes in leaves, generating ectopic

meristems (Kumaran et al., 2002). YABBY factors interact with transcriptional

corepressors LEUNIG (LUG) and LEUNIG_HOMOLOG (LUH), as well as with the

LUG/LUH transcriptional adaptor factors SEUSS (SEU) and SEUSS-LIKE (SLKs; Stahle

et al., 2009). In mutants lug -/- luh +/- the expression pattern of STM is expanded (Stahle et

al., 2009), while in mutants seu slk2 the expression levels of STM are greatly reduced (Bao

et al., 2010). In turn, LUG interacts with HDA19 and the Mediator components MED14

and CDK8 (Gonzalez et al., 2007). Moreover, mutant med14 shows an irregular expression

pattern of STM in the SAM (Autran et al., 2002). BASIC PENTACYSTEINE (BPC)

factors bind a promoter region in STM right upstream of the ATG as well as other

promoter regions in several other HOMEOBOX genes (Simonini and Kater, 2014). In rice,

OSH1 is positively autoregulated mainly through CNSs in introns (Tsuda et al., 2011). A

similar mechanism can operate in Arabidopsis STM, although CNSs similar in structure to

the RB-box and K-box are not described in introns of the STM-like genes from the species

analyzed in this study. Thus, a number of factors have a role in STM regulation yet a

comprehensive framework of control of STM gene regulation at transcriptional level

remains to be determined.

Role of the ELK domain in post-translational regulation of STM

The targeted mutation STM-S272A could affect the interaction with STM binding proteins

and hence correct nuclear localization and function. The ELK domain has been suggested

to mediate protein-protein interactions (Mushegian and Koonin, 1996; Sakamoto et al.,

1999). Nagasaki et al. (2001) showed that the ELK domain is not essential for homodimer

formation in rice KNOX factors. The interaction of STM with BELL factors is mediated

by the MEINOX domain (Bellaoui et al., 2001; Smith et al., 2002; Bhatt et al., 2004). It

will be interesting to determine if the activity of STM-S272A and its associated phenotype

is independent on the interaction with BELL factors in vitro and in vivo. Several members

of the OVATE family of factors (AtOFPs) interact with KNOX and BELL factors



22

regulating their subcellular localization (Hackbusch et al., 2005). BLH1, BLH7 and

KNAT1 interact with AtOFP1 (Hackbusch et al., 2005), BLH1 and KNAT3 with AtOFP5

(Pagnussat et al., 2007) and KNAT7 with OFP1 and OFP4 (Li et al., 2011). The interaction

of KNAT7 is mediated by the homeodomain (Li et al., 2011). However STM shows no

interaction with AtOFPs (Hackbusch et al., 2005).

Experiments with overexpression of the rice KNOX protein OSH15 carrying a deletion of

the ELK domain produced a novel phenotype in transgenic rice plants, suggesting that this

domain could have a defined function, such as interaction with a specific factor (Nagasaki

et al., 2001). The serine residue used for the targeted mutation in this study lies in a

putative 14-3-3 interacting binding region (http://scansite.mit.edu). Other regions of STM

protein are also putative binding sites for 14-3-3 factors. The role of these interactions is

under study. While the role of STM conserved domains KNOX1, KNOX2, HD and ELK

has been more extensively studied, the proposed function of the GSE domain in regulating

protein degradation (Volbretch et al., 1991; Nagasaki et al., 2001) has not been yet

determined.

In conclusion, while many aspects concerning the control of STM transcriptional regulation

and correct protein localization and stability are still unknown, our findings have revealed

regions and factors important for the correct regulation of STM, a transcription factor with

important roles in plant development.

Materials and methods

Plant materials and growth conditions

Allele frf1-1 (SAIL_292_C04) in Arabidopsis thaliana was obtained from the Syngenta

Arabidopsis Insertion Library (SAIL) (Sessions et al., 2002). Alleles frf2-1

(SALK_076709) and frf4-1 (SALK_048606C) were obtained from the Salk Institute

Genomic Analysis Laboratory (SIGnAL) (Alonso et al., 2003) through the Arabidopsis

Biological Resource Center (ABRC). The mutant alleles were in Columbia-0 (Col-0)

ecotype background. Growth conditions were as described in Aguilar-Martínez and Sinha

(2013).



23

Phylogenetic analysis and protein sequence analysis

For the alignment of the RB-box we used the promoter regions of Arabidopsis thaliana

STM (At1g62360.1) and the putative orthologs in A. lyrata gene 338146; Capsella rubella

gene Carubv10022235m.g; Brassica rapa gene Bra027050; Thellungiella halophila gene

Thhalv10023520m; Carica papaya evm.TU.supercontig_152.57; Populus trichocarpa

gene Potri.011G011100; Vitis vinifera gene GSVIVG01004811001; Solanum lycopersicum

gene LeT6 (Solyc02g081120; Janssen et al., 1998); Medicago truncatula gene Mt-knox-1,

Medtr5g085860 (Koltai et al., 2001); Glycine max gene Glyma09g01000; Phaseolus

vulgaris gene Phvul.006G145800 and Ricinus communis gene 29842.t000028. All

sequences were obtained from Phytozome (http://www.phytozome.net/; Goodstein et al.,

2012). For cotton (Gossypium raimondii) we used the geneBank accession number

CO081267, gene Gorai.010G183800; for Antirrhinum majus, geneBank accession number

AY072735.1; for Nicotiana tabacum, gene NTH15 (Tamaoki et al., 2007); for Pisum

sativum, gene Hop1, geneBank accession number AF063307.1 (Giles et al., 1998); for

Cardamine hirsuta, gene C. hirsuta STM (Hay and Tsiantis, 2006); for Asparagus

officinalis, geneBank accession number EF494254 (Uchida et al., 2007).

The sequence alignments were made using Muscle (http://www.ebi.ac.uk/Tools/msa/

muscle/) and Chaos+Dialign (http://dialign.gobics.de/chaos-dialign-submission; Brudno et

al., 2004). The alignment was edited using Mega5 software

(http://www.megasoftware.net/; Tamura et al., 2011) and displayed using Boxshade

version 3.31 in the Mobyle portal (http://mobyle.pasteur.fr; Néron et al., 2009).

The analysis of CNSs in the STM promoter of Brassicaceae species upstream of the RB-

box was made with mVISTA (http://genome.lbl.gov/vista/index.shtml; Frazer et al., 2004).

BP-like genes were Bra000638 in B. rapa, Thhalv10028724m.g in T. halophila,

Carubv10002748m.g in C. rubella and 489727 in A. lyrata. The protein domains of FRF

and FRS factors were analyzed with InterPro (http://www.ebi.ac.uk/interpro/; Hunter et al.,

2011) and drawn using DOG (Domain Graph, version 2.0.1; http:

//dog.biocuckoo.org/index.php; Ren et al., 2009).



24

For the analysis of FRF-like proteins, blastp searches were made against genomes of

tomato (ITAG 2.3 release of the sequenced tomato genome,

http://solgenomics.net/organism/Solanum_lycopersicum/ genome), Medicago truncatula

(MtPep-Medicago predicted proteins (Mt3.5) JCVI Medicago truncatula Genome Project

http://www.jcvi.org/cgi-bin/medicago/overview.cgi), Vitis vinifera and rice, both at

Phytozome (http://www.phytozome.net/). The alignments were made with TanslatorX

(Abascal et al., 2010; http://translatorx.co.uk/) using Muscle (http://www.

ebi.ac.uk/Tools/msa/muscle/), see Supplemental Data Set 2 for the alignment. We used the

conserved FAR1 DNA binding domain of the FRF-like proteins to generate a neighbor

joining tree and a parsimony tree with 1000 bootstrap replications. The alignments were

done on the translated amino acid sequence. Only unambiguously alienable portions of the

sequence that were present in all sequences were used for the tree. The region used was

columns 821-873 and 895-933 and all other positions were excluded. Two rice sequences

from the alignment were deleted because even though they were FAR sequences, the

alignment algorithm could not align them unambiguously to infer the relationships to the

other sequences. The phylogenetic trees were generated with PAUP* 4.0 (Swoford D.L.,

2003; paup.csit.fsu.edu) and edited with FigTree v1.4.2 (http://tree.bio.ed.ac.uk/software

/figtree/). Sequences of factors LeT6 (AAC49917.1) in tomato, NTH15 (BAA25546.1) in

tobacco and STM (AAC49148.1) in Arabidopsis were aligned with ClustalW2

(http://www.ebi.ac.uk/Tools/msa/clustalw2/).

Construction of transgenes and plant�transformation

The constructs with selected internal deletions in the STM promoter were generated using

overlapping PCR (Heckman and Pease, 2007). As templates we used constructs with

fusions of the gene uidA with the native STM promoter (ProSTM:GUS, 3379 bp; Uchida et

al., 2007) or the native STM promoter without the K-box (ProSTM-ΔK:GUS; Uchida et al.,

2007). The flanking master primers were STMpFH2 and STMpRBHI. The internal primers

were respectively for ProSTM-ΔLK:GUS, Lkb and Lkc, for ProSTM-ΔCRB:GUS, STMb2

and STMc2, for ProSTM-ΔCRB-CK:GUS, STMb2 and STMc2 on ProSTM-ΔK:GUS as

template, for ProSTM-ΔLRB:GUS, STMb1 and STMb2, for ProSTM-ΔLRB-CK:GUS,



25

STMb1 and STMc1 on ProSTM-ΔK:GUS as template, for ProSTM-ΔLRB-LK:GUS,

STMb1 and STMc1 on ProSTM-ΔLK:GUS as template. For ProSTM-ΔF1:GUS, F1b and

F1c, for ProSTM-ΔF2:GUS, F2b and F2c, for ProSTM-ΔF3:GUS, F3b and F3c, for

ProSTM-ΔF4:GUS, F4b and F4c, for ProSTM-ΔF5:GUS, F5b and F5c, for ProSTM-

ΔF6:GUS, F6b and F6c, for ProSTM-ΔF7:GUS, F7b and F7c, and for ProSTM-ΔF8:GUS,

F8b and F8c. For ProSTM-ΔRB:GUS and ProSTM-ΔRB-CK:GUS, we used the pair of

primers STMpRBHIf and STMpRBHI on ProSTM:GUS and ProSTM- ΔK:GUS as

templates, respectively.

For the RNAi construct for FRF1, a fragment of 200 bp of the coding sequence was

amplified using primers FARRNAf (5’-AACGAACACGACAAAATTCAGGAACTGA-

3’) and FARRNAr (5’-CTATACTTGGTGGTTCTGTTGATGATCT-3’) and cloned into

pCR8⁄GW⁄TOPO TA entry vector (Invitrogen). We used pK7GWIWG2(II) (Karimi et al.,

2002) as destination vector.

To generate plants ProJAG:GUS, a 2.2 Kb fragment at 5’of JAGGED in Col-0 ecotype

was isolated using oligos JAGpEcoRIF and JAGpBHIR. The fragment was LR cloned into

pkGWFS7 (Karimi et al., 2002). T3 lines were analyzed. For the generation of plants

ProJAG:GFP-STM, we first isolated a fragment GFP6-STM-T35S from the construct

STMp-STM (Uchida et al., 2007) using oligos GF6FBHI and T35SRBHI. This fragment

was cloned into an entry vector containing the promoter of JAG and LR cloned into the

plasmid pMDC123 with Basta selection in planta (Curtis and Grossniklaus, 2003). Col-0

ecotype plants were transformed with the ProJAG:GFP-STM construct.

Generation of GFP-STM was previously described (Uchida et al., 2007). S272A mutation

was introduced by PCR-based method and the resultant GFP-STM-S272A fragment was

cloned into pCR8/GW/TOPO vector. These constructs served as the entry vectors to

transfer protein coding regions into the pMDC32 vector containing 2 x CaMV 35S

promoter through LR cloning reaction (Invitrogen; Curtis and Grossniklaus, 2003).

ProSTM:GFP-STM expression cassette in pMDC123 was previously reported (Uchida et

al., 2007) and construction of pMDC123/ProSTM:GFP-STM-S272A was carried out using

the same method.



26

Constructs were introduced into Agrobacterium strain GV3101 (pMP90) (Koncz and

Schell, 1986) by electroporation. For plant transformation we used the “floral dip” method

(Clough and Bent, 1998). Primer sequences are indicated in Supplemental Table II.

Characterization of the alleles

Allele frf1-1 was genotyped using the combination NS264_S26Lp and NS264_S26Rp for

the wild type and NS264_S26Lp and LB1SAIL and NS264_S26Rp and LB1SAIL for the

insertions. For genotyping the allele frf2-1 we used the combination NS288_S31Lp and

NS289_S31Rp for the wild type copy and NS288_S31Lp and LBa1 and NS289_S31Rp

and LBa1 for the insertions. The genotype of the allele frf4-1 was made using primers

S6Lp and S6Rp for the wild type and S6Rp and LBa1 for the insertion. The sequences of

the primers were retrieved from the web tool at http://signal.salk.edu/tdnaprimers.2.html

and the positions of the insertions were determined by sequencing. Primer sequences can

be found in Supplemental Table II.

GUS histochemical assays

We used 8 day-old plants of T3 transgenic lines. The staining was for 5 hours and as

described in Aguilar-Martinez and Sinha (2013).

Yeast one-hybrid assay

The Yeast One-Hybrid assay was made according to the MATCHMAKER One‐Hybrid

System (Clontech, Palo Alto, CA) and to Kooiker et al., (2005). 226bp (-2133 to -1907bp)

of the Arabidopsis STM promoter including the RB-box was introduced into the EcoRI and

SacI sites of the pHisi plasmid using oligos RBRIF and STMpRBSacIR to obtain the

pHisi-RB plasmid. The plasmid was sequenced and introduced upstream of the HIS3

reporter gene of the Y187 yeast strain (MAT α) using small scale transformation according

to the Yeast Protocols Handbook (Clontech). In order to assess background due to leaky

HIS3 expression, 3-aminotriazole (3-AT, Sigma A-8056) was used as a competitive

inhibitor of the His3 protein. The reporter strain was titrated on SD/-His plates with

varying amounts of 3-AT (0–60 mM) to determine the optimal concentration of 3-AT for



27

background suppression. 15 mM 3-AT was sufficient for background suppression in the

yeast strains. We mated with a yeast strain AH-109 (MAT a) containing a normalized

library of cDNA from Arabidopsis in the plasmid pGADT7 kindly offered by Simona

Masiero (University of Milan). The growing colonies were plated again to confirm the

interactions. The pGADT7 plasmids were isolated and sequenced with the primer V7 (5’-

CTATTCGATGATGAAGATACCCC).

EMSA

The EMSA analysis was performed as in Aguilar-Martínez and Sinha, (2013). Briefly, the

coding sequence of FRF1 was cloned and used to generate a GST-fusion–protein-

expressing construct. The probes were generated with oligos NS171_RBabiot (5’-A

ATCCAGTTTGGTAATATATAAATATG-3’) and NS169_Rbdbiot (5’-GCTAATTTT

TCTTGCTTTTAGGTTAAG-3’). For the fragment of 246 bp covering the RB-box of

STM the plasmid with the construct ProSTM:GUS (Uchida et al., 2007) and ProSTM-

ΔCRB:GUS for the RBΔcore were used as templates. For competition we amplified the

same fragments using unlabeled oligos. We used the LightShift Chemiluminescent EMSA

Kit (Pierce).

Microscopy and chemical treatment

For analysis of ProJAG:GFP-STM and ProSTM:GFP-STM transgenic plants a LSM 710

laser scanning microscope (Carl Zeiss) was used. Chlorophyll autofluoresce collected at

wavelengths 647-721nm and GFP fluorescence collected at wavelengths 495-528nm were

excited using a combination of excitation from 488nm and 633nm lasers. In addition, the

range from 416nm-728nm was collected to increase the visibility of non-fluorescing

features. Light and fluorescence microscopy on vibratome sections of ProJAG:GFP-STM

plants was also employed according to Koenig et al., (2009), using bandpass filters at

525nm (GFP1) and 500nm (GFP2).

Detection of GFP-tagged proteins was performed by agro-infiltration method according to

the previous report (Voinnet et al., 2003). Briefly, Agrobacterium strains harboring

pMDC32/GFP-STM or pMDC32/GFP-STM-S272A were infiltrated into the abaxial air



28

spaces of Nicotiana benthamiana plants together with Agrobacterium C58C1 strain

expressing p19, a silencing suppressor encoded by tomato bushy stunt virus. After 2 days,

GFP fluorescence was observed using Leica TCS SP2 confocal microscope (Leica). When

required, leaves were treated with 20 nM LMB (Sigma) 2 hours before observation as

previously reported (Igarashi et al., 2001; Ishida et al., 2004).

Accession numbers

The Arabidopsis Information Resource (TAIR; http://www.arabidopsis.org/) locus

identifiers for the FRF genes are: FRF1 (At3g59470), FRF2 (At3g07500), FRF3

(At4g12850) and FRF4 (At2g43280). FRF-like proteins in tomato are

Solyc06g073200.2.1, Solyc06g073210.2.1, Solyc09g057880.2.1 and Solyc09g057870.2.1,

in Medicago truncatula Medtr2g098920.1, Medtr2g098880.1, in contig_103701_3.1 and in

contig_49211_1.1, in Vitis vinifera GSVIVT01010765001, GSVIVT01010762001,

GSVIVT01001896001, GSVIVT01010761001, GSVIVT01010768001,

GSVIVT01010788001, GSVIVT01032951001, GSVIVT01036426001,

GSVIVT01036422001 and GSVIVT01012789001 and in rice LOC_Os03g15040.1,

LOC_Os10g06860.1, LOC_Os11g19030.1, LOC_Os11g02964.1, LOC_Os07g18260.1,

LOC_Os05g40680.1 and LOC_Os07g39490.1.

Supplemental material

Supplemental Figure 1. Expression pattern of GUS in plants ProSTM-ΔLK:GUS,

ProSTM-ΔRB:GUS and ProSTM-ΔRB-CK:GUS.

Supplemental Figure 2. FRF1 binds the RB-box.

Supplemental Figure 3. Phylogenetic tree of FRF factors.

Supplemental Figure 4. Expression pattern of FRF genes.



29

Supplemental Figure 5. Sequence conservation on introns of KNOX1 genes in

Brassicaceae species.

Supplemental Figure 6. GUS expression pattern in plants ProJAG:GUS.

Supplemental Figure 7. Leaf phenotype in plants expressing STM under the JAG

promoter and GFP distribution under the endogenous STM promoter or the JAG promoter.

Supplemental Figure 8. Sequence alignment of STM ortholog factors.

Supplemental Figure 9. Effect of LMB treatment on STM cellular distribution.

Supplemental Table I. Sequenced clones from Yeast One-Hybrid assay.

Supplemental Table II. List of primers used in this study.

Supplemental Data Set 1. Sequence alignment of the FRF and FRS factors.

Supplemental Data Set 2. Sequence alignment of FRF-like factors in eudicot species.

Acknowledgements

We thank Lucia Colombo and Simona Masiero (University of Milan) for the cDNA library

for the yeast one-hybrid assays and members of Sinha lab for discussions and comments

on the manuscript and Preetveer Kaur and Katrina Torres for technical assistance with the

confocal image analysis.

Author contributions

J.A.A.M., N.U. and N.S. designed the research. J.A.A.M., N.U., S.K., B.T., D.A.W., A.Y.

and N.L. performed the research. J.A.A.M., N.U. and N.S. analyzed the data and wrote the

paper.



30

Literature cited

Abascal F, Zardoya R, Telford MJ (2010) TranslatorX: multiple alignment of nucleotide

sequences guided by amino acid translations. Nucleic Acids Res. 38:W7-13

Aguilar-Martínez JA, Sinha NR (2013) Analysis of the role of Arabidopsis class I TCP

genes AtTCP7, AtTCP8, AtTCP22 and AtTCP23 in leaf development. Front Plant

Sci 4: 406

Aichinger E, Kornet N, Friedrich T, Laux T (2012) Plant stem cell niches. Annual

Review of Plant Biology 63: 615-636

Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997) Genes involved in organ

separation in Arabidopsis, an analysis of the cup-shaped cotyledon mutant. Plant

Cell 9: 841–857

Aida M, Ishida T, Tasaka M (1999) Shoot apical meristem and cotyledon formation

during Arabidopsis embryogenesis, interaction among the CUPSHAPED

COTYLEDON and SHOOTMERISTEMLESS genes. Development 126: 1563–1570

Alakonya A, Kumar R, Koenig D, Kimura S, Townsley B, Runo S, Garces HM, Kang

J, Yanez A, David-Schwartz R, Machuka J, Sinha N (2012) Interspecific RNA

interference of SHOOTMERISTEMLESS-like disrupts Cuscuta pentagona plant

parasitism. Plant Cell 24: 3153-3166

Alonso JM, Stepanova AN, Leisse TJ, Kim C J, Chen H, Shinn P, et al. (2003)

Genome-Wide Insertional Mutagenesis of Arabidopsis thaliana. Science 301: 653-

657

Atta R, Laurens L, Boucheron-Dubuisson E, Guivarc’h A, Carnero E, Giraudat-

Pautot V, Rech P, Chriqui D (2009) Pluripotency of Arabidopsis xylem pericycle

underlies shoot regeneration from root and hypocotyl explants grown in vitro. The

Plant Journal 57: 626–644



31

Autran D, Jonak C, Belcram K, Beemster GT, Kronenberger J, Grandjean O, Inzé

D, Traas J (2002) Cell numbers and leaf development in Arabidopsis: a functional

analysis of the STRUWWELPETER gene. EMBO J 21: 6036-49

Bao F, Azhakanandam S, Franks RG (2010) SEUSS and SEUSS-LIKE transcriptional

adaptors regulate floral and embryonic development in Arabidopsis. Plant Physiol

152: 821-836

Barton KM (2010) Twenty years on: the inner workings of the shoot apical meristem, a

developmental dynamo. Developmental Biology 341: 95-113

Bauer P, Lubkowitz M, Tyers R, Nemoto K, Meeley RB, Goff SA, Freeling M (2004)

Regulation and a conserved intron sequence of liguleless3/4 knox class-I homeobox

genes in grasses. Planta 219: 359-68

Bellaoui M, Pidkowich MS, Samach A, Kushalappa K, Kohalmi SE, Modrusan Z,

Crosby WL, Haughn GW (2001) The Arabidopsis BELL1 and KNOX TALE

homeodomain proteins interact through a domain conserved between plants and

animals. Plant Cell 13: 2455–2470

Belles-Boix E, Hamant O, Witiak SM, Morin H, Traas J, Pautot V (2006) KNAT6: An

Arabidopsis Homeobox Gene Involved in Meristem Activity and Organ Separation.

Plant Cell 18: 1900–1907

Benkova E, Michniewicz M, Sauer M, Teichmann T, Seifertova D, Jurgens G, Friml J

(2003) Local efflux dependent auxin gradients as a common module for plant organ

formation. Cell 115: 591–602

Beschtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium-mediated gene transfer

by filtration of adult Arabidopsis thaliana plants. C R Acad Sci (Paris) 316: 1194–

1199

Bharathan G, Goliber TE, Moore C, Kessler S, Pham T, Sinha NR (2002) Homologies

in leaf form inferred from KNOXI gene expression during development. Science

296: 1858–1860

Bhatt AM, Etchells JP, Canales C, Lagodienko A, Dickinson H (2004) VAAMANA–a

BEL1-like homeodomain protein, interacts with KNOX proteins BP and STM and

regulates inflorescence stem growth in Arabidopsis. Gene 328: 103–111



32

Bolduc N, Hake S (2009) The maize transcription factor KNOTTED1 directly regulates

the gibberellin catabolism gene ga2ox1. Plant Cell 21: 1647-1658

Brand U, Fletcher JC, Hobe M, Meyerowitz EM, Simon R (2001) Dependence of stem

cell fate in Arabidopsis on a feedback loop regulated by CLV3 activity. Science

289: 617–619

Brudno M, Steinkamp R, Morgenstern B (2004) The CHAOS/DIALIGN WWW server

for multiple alignment of genomic sequences Nucl Acids Res 32: W41-W44

Byrne ME, Barley R, Curtis M, Arroyo JM, Dunham M, Hudson A, Martienssen RA

(2000) Asymmetric leaves1 mediates leaf patterning and stem cell function in

Arabidopsis. Nature 408: 967–971

Byrne ME, Simorowski J, Martienssen RA (2002) ASYMMETRIC LEAVES1 reveals

knox gene redundancy in Arabidopsis. Development 129: 1957–1965

Casimiro I, Marchant A, Bhalerao RP, Beeckmand T, Dhooged S, Swarupb R,

Graham N, Inzé D, Sandberg G, Casero PJ, Bennett M (2001) Auxin transport

promotes Arabidopsis lateral root initiation. Plant Cell 13: 843-852

Champagne CEM, Goliber TE, Wojciechowskib MF, Mei RW, Townsley BT, Wang

K, Paz MM, Geeta R, Sinha NR (2007) Compound leaf development and

evolution in the legumes. Plant Cell 19: 3369-3378

Chuck G, Lincoln C, Hake S (1996) KNAT1 induces lobed leaves with ectopic meristems

when overexpressed in Arabidopsis. Plant Cell 8: 1277-1289

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated

transformation of Arabidopsis thaliana. Plant J 16: 735-743

Cole M, Nolte C, Werr W (2006) Nuclear import of the transcription factor SHOOT

MERISTEMLESS depends on heterodimerization with BLH proteins expressed in

discrete sub-domains of the shoot apical meristem of Arabidopsis thaliana. Nucleic

Acids Res 34: 1281-1292

Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput

functional analysis of genes in planta. Plant Physiol 133: 462–469

Dean G, Casson S, Lindsey K (2004) KNAT6 gene of Arabidopsis is expressed in roots

and is required for correct lateral root formation. Plant Mol Biol 54: 71-84



33

Depuydt S, Doležal K, Lijsebettens MV, Moritz T, Holsters M, Vereecke D (2008)

Modulation of the hormone setting by Rhodococcus fascians results in ectopic

KNOX activation in Arabidopsis. Plant Physiology 146: 1267-1281

Dinneny JR, Yadegari R, Fischer RL, Yanofsky MF, Weigel D (2004) The role of

JAGGED in shaping lateral organs. Development 131: 1101-1110

Du J, Mansfield SD, Groover AT (2009) The Populus homeobox gene ARBORKNOX2

regulates cell differentiation during secondary growth. Plant J 60: 1000-1014

Elliott RC, Betzner AS, Huttner E, Oakes MP, Tucker WQ, Gerentes D, Perez P,

Smyth DR (1996) AINTEGUMENTA, an APETALA2-like gene of Arabidopsis

with pleiotropic roles in ovule development and floral organ growth. Plant Cell 8:

155–168

Endrizzi K, Moussian B, Haecker A, Levin JZ, Laux T (1996) The SHOOT

MERISTEMLESS gene is required for maintenance of undifferentiated cells in

Arabidopsis shoot and floral meristems and acts at a different regulatory level than

the meristem genes WUSCHEL and ZWILLE. Plant Journal 10: 967–979

Fletcher JC, Brand U, Running MP, Simon R, Meyerowitz EM (1999) Signaling of

cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems. Science 283:

1911–1914

Frazer KA, Pachter L, Poliakov A, Rubin EM, Dubchak I (2004) VISTA:

computational tools for comparative genomics. Nucleic Acids Res 32: W273-279

Furutani M, Vernoux T, Traas J, Kato T, Tasaka M, Aida M (2004) PIN-FORMED1

and PINOID regulate boundary formation and cotyledon development in

Arabidopsis embryogenesis. Development 131: 5021-5030

Gallois JL, Woodward C, Reddy GV, Sablowski R (2002) Combined SHOOT

MERISTEMLESS and WUSCHEL trigger ectopic organogenesis in Arabidopsis.

Development 129: 3207-3217

Garces HMP, Champagne CEM, Townsley BT, Park S, Malho R, Pedroso MC,

Harada JJ, Sinha NR (2007) Evolution of asexual reproduction in leaves of the

genus Kalanchoë. PNAS 104: 15578-15583



34

Giles JE, Villani PJ, DeMason DA (1998) A class 1 Knox full-length cDNA from pea

shoot tips (Accession No. AF063307) (PGR98-115) Plant Physiol 117: 1125

Gonzalez D, Bowen AJ, Carroll TS, Conlan RS (2007) The transcription corepressor

LEUNIG interacts with the histone deacetylase HDA19 and mediator components

MED14 (SWP) and CDK8 (HEN3) to repress transcription. Mol Cell Biol 27:

5306-5315

Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W,

Hellsten U, Putnam N, Rokhsar DS (2012) Phytozome: a comparative platform

for green plant genomics. Nucleic Acids Res 40: (D1), D1178-D1186

Greene B, Walko R, Hake S (1994) Mutator insertions in an intron of the maize knotted1

gene result in dominant suppressible mutations. Genetics 138: 1275–1285

Groover AT, Mansfield SD, DiFazio SP, Dupper G, Fontana JR, Millar R, Wang Y

(2006) The Populus homeobox gene ARBORKNOX1 reveals overlapping

mechanisms regulating the shoot apical meristem and the vascular cambium. Plant

Mol Biol 61: 917–932

Hackbusch J, Richter K, Müller J, Salamini F, Uhrig JF (2005) A central role of

Arabidopsis thaliana ovate family proteins in networking and subcellular

localization of 3-aa loop extension homeodomain proteins. PNAS 102: 4908–4912

Hareven D, Gutfinger T, Parnis A, Eshed Y, Lifschitz E (1996) The making of a

compound leaf: Genetic manipulation of leaf architecture in tomato. Cell 84: 735–

744

Hay A, Kaur H, Phillips A, Hedden P, Hake S, Tsiantis M (2002) The gibberellin

pathway mediates KNOTTED1-type homeobox function in plants with different

body plans. Current Biology 12: 1557-1565

Hay A, Jackson D, Ori N, Hake S (2003) Analysis of the competence to respond to

KNOTTED1 activity in Arabidopsis leaves using a steroid induction system. Plant

Physiol 131: 1671-1680

Hay A, Tsiantis M (2006) The genetic basis for differences in leaf form between

Arabidopsis thaliana and its wild relative Cardamine hirsuta. Nat Genet 38: 942-

947



35

Hay A, Barkoulas M, Tsiantis M (2006) ASYMMETRIC LEAVES1 and auxin activities

converge to repress BREVIPEDICELLUS expression and promote leaf

development in Arabidopsis. Development 133: 3955-3961

Heckman KL, Pease LR (2007) Gene splicing and mutagenesis by PCR-driven overlap

extension. Nature Protocols 2: 924-932

Heisler MG, Ohno C, Das P, Sieber P, Reddy GV, Long JA, Meyerowitz EM (2005)

Patterns of auxin transport and gene expression during primordium development

revealed by live imaging of the Arabidopsis inflorescence meristem. Current

Biology 15: 1899-1911

Hibara K, Takada S, Tasaka M (2003) CUC1 gene activates the expression of SAM-

related genes to induce adventitious shoot formation. Plant J 36: 687-96

Hofer J, Turner L, Hellens R, Ambrose M, Matthews P, Michael A, Ellis N (1997)

UNIFOLIATA regulates leaf and flower morphogenesis in pea. Current Biology 7:

581–587

Hofer J, Gourlay C, Michael A, Ellis THN (2001) Expression of a class 1 knotted1-like

homeobox gene is down-regulated in pea compound leaf primordia. Plant Mol Biol

45: 387–398

Hu W, Feng B, Ma H (2011) Ectopic expression of the Arabidopsis MINI ZINC

FINGER1 and MIF3 genes induces shoot meristems on leaf margins. Plant Mol

Biol 76: 57-68

Hudson M, Ringli C, Boylan MT, Quail PH (1999) The FAR1 locus encodes a novel

nuclear protein specific to phytochrome A signaling. Genes Development 13: 2017-

2027

Hunter S, Jones P, Mitchell A, Apweiler R, Attwood TK, Bateman A, et al. (2012)

InterPro in 2011: new developments in the family and domain prediction database.

Nucleic Acids Res 40: D306-312

Ichihashi Y, Aguilar-Martínez JA, Farhi M, Chitwood DH, Kumar R, Millonc LV,

Peng J, Maloof JN, Sinha NR (2014) Evolutionary developmental transcriptomics

reveals a gene network module regulating interspecific diversity in plant leaf shape

PNAS 111: E2616-E2621



36

Igarashi D, Ishida S, Fukazawa J, Takahashi Y (2001) 14-3-3 Proteins regulate

intracellular localization of the bZIP transcriptional activator RSG. Plant Cell 13:

2483-2497

Inada DC, Bashir A, Lee C, Thomas BC, Ko C, Goff, SA, Freeling, M (2003)

Conserved noncoding sequences in the grasses. Genome Res 13: 2030-2041

Ishida S, Fukazawa J, Yuasa T, Takahashi Y (2004) Involvement of 14-3-3 signaling

protein binding in the functional regulation of the transcriptional activator

REPRESSION OF SHOOT GROWTH by gibberellins. Plant Cell 16: 2641-2651

Ito Y, Kurata N (2008) Disruption of KNOX gene suppression in leaf by introducing its

cDNA in rice. Plant Science 174: 357-365

Jackson D, Veit B, Hake S (1994) Expression of maize KNOTTED1 related homeobox

genes in the shoot apical meristem predicts patterns of morphogenesis in the

vegetative shoot. Development 120: 405-413

Janssen BJ, Williams A, Chen JJ, Mathern J, Hake S, Sinha N (1998) Isolation and

characterization of two knotted-like homeobox genes from tomato. Plant Mol Biol

36: 417-425

Jasinski S, Piazza P, Craft J, Hay A, Woolley L, Rieu I, Phillips A, Hedden P, Tsiantis

M (2005) KNOX action in Arabidopsis is mediated by coordinate regulation of

cytokinin and gibberellin activities. Current Biology 15: 1560-1565

Karimi M, Inze D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated

plant transformation. Trends Plant Sci 7: 193–195

Kawamura E, Horiguchi G, Tsukaya H (2010) Mechanisms of leaf tooth formation in

Arabidopsis. Plant Journal 62: 429–441

Kerstetter R, Vollbrecht E, Lowe B, Veit B, Yamaguchi J, Hake S (1994) Sequence

analysis and expression patterns divide the maize knotted1-like homeobox genes

into two classes. Plant Cell 6: 1877-1887

Kim JY, Rim Y, Wang J, Jackson D (2005) A novel cell-to-cell trafficking assay

indicates that the KNOX homeodomain is necessary and sufficient for intercellular

protein and mRNA trafficking. Genes Dev 19: 788-793



37

Kimura S, Koenig D, Kang J, Yoong F, Sinha N (2008) Natural variation in leaf

morphology results from mutation of a novel KNOX gene. Current Biology 18:

672–677

Koenig D, Bayer E, Kang J, Kuhlemeier C, Sinha N (2009) Auxin patterns Solanum

lycopersicum leaf morphogenesis. Dev 136: 2997-3006

Koltai H, Bird DM (2000) Epistatic repression of PHANTASTICA and class 1 KNOTTED

genes is uncoupled in tomato. Plant Journal 22: 455-459

Koltai H, Dhandaydham M, Opperman C, Thomas J, Bird D (2001) Overlapping plant

signal transduction pathways induced by a parasitic nematode and a rhizobial

endosymbiont. Molecular Plant-Microbe Interactions 14: 1168-1177

Koncz C, Schell J (1986) The promoter of TL -DNA gene 5 controls the tissue-specific

expression of chimeric genes carried by a novel type of Agrobacterium binary

vector. Mol Gen Genet 204: 383-396

Kooiker M, Airoldi CA, Losa A, Manzotti PS, Finzi L, Kater MM, Colombo L (2005)

BASIC PENTACYSTEINE1, a GA binding protein that induces conformational

changes in the regulatory region of the homeotic Arabidopsis gene SEEDSTICK.

Plant Cell 17: 722-729

Kumaran MK, Bowman JL, Sundaresan V (2002) YABBY polarity genes mediate the

repression of KNOX homeobox genes in Arabidopsis. Plant Cell 14: 2761-70

Kurakawa T, Ueda N, Maekawa M, Kobayashi K, Kojima M, Nagato Y, Sakakibara

H, Kyozuka J (2007) Direct control of shoot meristem activity by a cytokinin

activating enzyme. Nature 445: 652–655

Laux T, Mayer KFX, Berger J, Jürgens G (1996) The WUSCHEL gene is required for

shoot and floral meristem integrity in Arabidopsis. Development 122: 87–96

Lenhard M, Jürgens G, Laux T (2002) The WUSCHEL and SHOOTMERISTEMLESS

genes fulfil complementary roles in Arabidopsis shoot meristem regulation.


Li J, Li G, Gao S, Martinez C, He G, Zhou Z, Huang X, Lee JH, Zhang H, Shen Y,

Wang H, Deng XW (2010) Arabidopsis transcription factor ELONGATED



38

HYPOCOTYL5 plays a role in the feedback regulation of phytochrome A

signaling. Plant Cell 22: 3634-49

Li E, Wang S, Liu Y, Chen JG, Douglas CJ (2011) OVATE FAMILY PROTEIN4

(OFP4) interaction with KNAT7 regulates secondary cell wall formation in

Arabidopsis thaliana. Plant J 67: 328–341

Li G, Siddiqui H, Teng Y, Lin R, Wan XY, Li J, Lau OS, Ouyang X, Dai M, Wan J,

Devlin PF, Deng XW, Wang H (2011) Coordinated transcriptional regulation

underlying the circadian clock in Arabidopsis. Nat Cell Biol 13: 616-22

Li Z, Li B, Shen WH, Huang H, Dong A (2012) TCP transcription factors interact with

AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana. Plant J 71:

99-107

Lin R, Wang H (2004) Arabidopsis FHY3/FAR1 gene family and distinct roles of its

members in light control of Arabidopsis development. Plant Physiology 136: 4010–

4022

Lin R, Ding L, Casola C, Ripoll DR, Feschotte C, Wang H (2007). Transposase-derived

transcription factors regulate light signaling in Arabidopsis. Science 318: 1302-

1305

Lin R, Teng Y, Park HJ, Ding L, Black C, Fang P, Wang H (2008) Discrete and

essential roles of the multiple domains of Arabidopsis FHY3 in mediating

phytochrome A signal transduction. Plant Physiol 148: 981-92

Lincoln C, Long J, Yamaguchi J, Serikawa K, Hake S (1994) A knotted1-like

homeobox gene in Arabidopsis is expressed in the vegetative meristem and

dramatically alters leaf morphology when overexpressed in transgenic plants. Plant

Cell 6: 1859–1876

Lodha M, Marco CF, Timmermans MCP (2013) The ASYMMETRIC LEAVES

complex maintains repression of KNOX homeobox genes via direct recruitment of

Polycomb-repressive complex2. Genes Development 27: 596-601

Long JA, Moan EI, Medford JI, Barton MK (1996) A member of the KNOTTED class

of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379:

66–69



39

Long J, Barton MK (2000) Initiation of axillary and floral meristems in Arabidopsis. Dev

Biol 218: 341-53

Lucas WJ, Bouche-Pillon S, Jackson DP, Nguyen L, Baker L, Ding B, Hake S (1995)

Selective trafficking of KNOTTED1 homeodomain protein and its mRNA through

plasmodesmata. Science 270: 1980-1983

Luo M, Yu CW, Chen FF, Zhao L, Tian G, Liu X, Cui Y, Yang JY, Wu K (2012)

Histone Deacetylase HDA6 Is Functionally Associated with AS1 in Repression of

KNOX Genes in Arabidopsis. PLoS Genet 8: e1003114

Lynn K, Fernandez A, Aida M, Sedbrook J, Tasaka M, Masson P, Barton MK (1999)

The PINHEAD/ZWILLE gene acts pleiotropically in Arabidopsis development and

has overlapping functions with the ARGONAUTE1 gene. Development 126: 469-

481

Magnani E, Hake S (2008) KNOX lost the OX: the Arabidopsis KNATM gene defines a

novel class of KNOX transcriptional regulators missing the homeodomain. Plant

Cell 20: 875–887

Mayer KF, Schoof H, Haecker A, Lenhard M, Jurgens G, Laux T (1998) Role of

WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95:

805-815

Meisel L, Lam E. (1996) The conserved ELK homeodomain of KNOTTED-1 contains

two regions that signal nuclear localization. Plant Mol Biol 30: 1–14

Müller KJ, Romano N, Gerstner O, Garcia-Maroto F, Pozzi C, Salamini F, Rohde W

(1995) The barley Hooded mutation caused by a duplication in a homeobox gene

intron. Nature 374: 727-30

Mushegian A, Koonin EV (1996) Sequence analysis of eukaryotic developmental

proteins: Ancient and novel domains. Genetics 144: 817–828

Mutwil M, Obro J, Willats WG, Persson S (2008) GeneCAT: novel Webtools that

combine BLAST and co-expression analyses. Nucleic Acids Res 36: W320–W326

Nagasaki H, Sakamoto T, Sato Y, Matsuoka, M (2001) Functional analysis of the

conserved domains of a rice KNOX homeodomain protein, OSH15. Plant Cell 13:

2085-2098



40

Néron B, Ménager H, Maufrais C, Joly N, Maupetit J, Letort S, Sébastien Carrere S,

Tuffery P, Letondal C (2009) Mobyle: a new full web bioinformatics framework.

Bioinformatics 25: 3005-3011

Nikovics K, Blein, T, Peaucelle, A, Ishida T, Morin H, Aida M, Laufs P (2006) The

balance between the MIR164A and CUC2 genes controls leaf margin serration in

Arabidopsis. Plant Cell 18: 2929–2945

Ohno CK, Reddy GV, Heisler MG, Meyerowitz EM (2004) The Arabidopsis JAGGED

gene encodes a zinc finger protein that promotes leaf tissue development.


Ori N, Eshed Y, Chuck G, Bowman JL, Hake S (2000) Mechanisms that control knox

gene expression in the Arabidopsis shoot. Development 127: 5523-5532

Osnato M, Stile MR, Wang Y, Meynard D, Curiale S, Guiderdoni E, Liu Y, Horner

DS, Ouwerkerk PBF, Pozzi C, Müller KJ, Salamini F, Rossini L (2010) Cross

talk between the KNOX and ethylene pathways is mediated by intron-binding

transcription factors in barley. Plant Physiology 154: 1616-1632

Pagnussat GC, Yu HJ, Sundaresan V (2007) Cell-fate switch of synergid to egg cell in

Arabidopsis eostre mutant embryo sacs arises from misexpression of the BEL1-like

homeodomain gene BLH1. Plant Cell 19: 3578–3592

Qi B, Zheng H (2013) Modulation of root-skewing responses by KNAT1 in Arabidopsis

thaliana. Plant Journal 76: 380-392

Reinhardt D, Mandel T, Kuhlemeier C (2000) Auxin regulates the initiation and radial

position of plant lateral organs. Plant Cell 12: 507–518

Ren J, Wen L, Gao X, Jin C, Xue Y, Yao X (2009) DOG 1.0: Illustrator of protein

domain structures. Cell Research 19: 271–273

Rupp HM, Frank M, Werner T, Strnad M, Schmulling T (1999) Increased steady state

mRNA levels of the STM and KNAT1 homeobox genes in cytokinin overproducing

Arabidopsis thaliana indicate a role for cytokinins in the shoot apical meristem.

Plant Journal 18: 557–563



41

Rutjens B, Bao D, van Eck-Stouten E, Brand M, Smeekens S, Proveniers M (2009)

Shoot apical meristem function in Arabidopsis requires the combined activities of

three BEL1-like homeodomain proteins. Plant J 58: 641-54

Sakamoto T, Nishimura A, Tamaoki M, Kuba M, Tanaka H, Iwahori S, Matsuoka M

(1999) The conserved KNOX domain mediates specificity of tobacco

KNOTTED1-type homeodomain proteins. Plant Cell 11: 1419–1432

Santi L, Wang Y, Stile MR, Berendzen K, Wanke D, Roig C, Pozzi C, Müller K,

Müller J, Rohde W, Salamini F (2003) The GA octodinucleotide repeat binding

factor BBR participates in the transcriptional regulation of the homeobox gene

Bkn3. Plant J 34: 813-26

Schmid M, Davison TS, Henz SR, Pape UJ, Demar M, Vingron M, Schölkopf B,

Weigel D, Lohmann J (2005) A gene expression map of Arabidopsis

development. Nature Genetics 37: 501-506

Schoof H, Lenhard M, Haecker A, Mayer KF, Jurgens G, Laux T (2001) The stem cell

population of Arabidopsis shoot apical meristems is maintained by a regulatory

loop between the CLAVATA and WUSCHEL genes. Cell 100: 635–644

Schubert D, Primavesi L, Bishopp A, Roberts G, Doonan J, Jenuwein T, Goodrich J

(2006) Silencing by plant Polycomb-group genes requires dispersed trimethylation

of histone H3 at lysine 27. EMBO J 25: 4638–4649

Scofield S, Murray JAH (2006). KNOX gene function in plant stem cell niches. Plant Mol

Biol 60: 929–946

Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P,

Bacwaden J, Ko C, Clarke JD, Cotton D, Bullis D, Snell J, Miguel T,

Hutchison D, Kimmerly B, Mitzel T, Katagiri F, Glazebrook J, Law M, Goff

SA (2002) A High-Throughput Arabidopsis Reverse Genetics System. Plant Cell

14: 2985-2994

Simonini S, Kater MM (2014) Class I BASIC PENTACYSTEINE factors regulate

HOMEOBOX genes involved in meristem size maintenance. J Exp Bot 65: 1455-

1465



42

Smith HM, Boschke I, Hake S (2002) Selective interaction of plant homeodomain

proteins mediates high DNA- binding affinity. PNAS 99: 9579-9584

Smith HM, Hake S (2003) The interaction of two homeobox genes,

BREVIPEDICELLUS and PENNYWISE, regulates internode patterning in the

Arabidopsis inflorescence. Plant Cell 15: 1717–1727

Smith LG, Greene B, Veit B, Hake S (1992) A dominant mutation in the maize

homeobox gene, Knotted-1, causes its ectopic expression in leaf cells with altered

fates. Development 116: 21-30

Stahle MI, Kuehlich J, Staron L, von Arnim AG, Golz JF (2009) YABBYs and the

transcriptional corepressors LEUNIG and LEUNIG_HOMOLOG maintain leaf

polarity and meristem activity in Arabidopsis. Plant Cell 21: 3105-3118

Swoford, D.L. (2003) PAUP*. Phylogenetic analysis using parsimony (*and other

methods). Version 4. Sinauer associates, Sunderland, Massachussets.

Takada S, Hibara K, Ishida T, Tasaka M (2001) The CUP-SHAPED COTYLEDON1

gene of Arabidopsis regulates shoot apical meristem formation. Development 128:

1127–1135

Tamaoki M, Sato Y, Matsuoka M (1997) Dorsoventral pattern formation of tobacco leaf

involves spatial expression of a tobacco homeobox gene, NTH15. Genes Genet Syst

72: 1-8

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5:

molecular evolutionary genetics analysis using likelihood, distance, and parsimony

methods. Mol Biol Evol 28: 2731-2739

Tang W, Wang W, Chen D, Ji Q, Jing Y, Wang H, Lin R (2012) Transposase-derived

proteins FHY3/FAR1 interact with PHYTOCHROME-INTERACTING FACTOR1

to regulate chlorophyll biosynthesis by modulating HEMB1 during deetiolation in

Arabidopsis. Plant Cell 24: 1984-2000

Testone G, Condello E, Verde I, Nicolodi C, Caboni E, Dettori MT, Vendramin E,

Bruno L, Bitonti MB, Mele G, Giannino D (2012) The peach (Prunus persica L.

Batsch) genome harbours 10 KNOX genes, which are differentially expressed in



43

stem development, and the class 1 KNOPE1 regulates elongation and lignification

during primary growth. J Exp Bot 63: 5417-35

Townsley BT, Sinha NR, Kang J (2013) KNOX1 genes regulate lignin deposition and

composition in monocots and dicots. Front Plant Sci 4: 121

Truernit E, Siemering KR, Hodge S, Grbic V, Haseloff J (2006) A map of KNAT gene

expression in the Arabidopsis root. Plant Mol Biol 60: 1-20

Tsuda K, Ito Y, Sato Y, Kurataa N (2011) Positive autoregulation of a KNOX gene is

essential for shoot apical meristem maintenance in rice. Plant Cell 23: 4368–4381

Uchida N, Townsley B, Chung K, Sinha N (2007) Regulation of SHOOT

MERISEMLESS genes via an upstream-conserved noncoding sequence coordinates

leaf development. PNAS 104: 15953-15958

Viola IL, Gonzalez, DH (2009) Binding properties of the complex formed by the

Arabidopsis TALE homeodomain proteins STM and BLH3 to DNA containing

single and double target sites. Biochimie 91: 974–981

Voinnet O, Rivas S, Mestre P, Baulcombe D (2003) An enhanced transient expression

system in plants based on suppression of gene silencing by the p19 protein of

tomato bushy stunt virus. Plant J 33: 949-56

Vollbrecht E, Veit B, Sinha N, Hake S (1991) The developmental gene Knotted-1 is a

member of a maize homeobox gene family. Nature 350: 241-243

Wang H, Deng XW (2002) Arabidopsis FHY3 defines a key phytochrome A signaling

component directly interacting with its homologous partner FAR1. EMBO J 21:

1339–1349

Wang H, Chen J, Wen J, Tadege M, Li G, Liu Y, Mysore KS, Ratet P, Chen R (2008)

Control of compound leaf development by FLORICAULA/LEAFY ortholog

SINGLE LEAFLET1 in Medicago truncatula. Plant Physiol 146: 1759–1772

Whitelam GC, Johnson E, Peng J, Carol P, Anderson ML, Cowl JS, Harberd NP

(1993) Phytochrome A null mutants of Arabidopsis display a wild-type phenotype

in white light. Plant Cell 5: 757–768

Williams RW (1998) Plant homeobox genes: many functions stem from a common motif.

Bioessays 20: 280-282



44

Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007) An

‘Electronic Fluorescent Pictograph’ browser for exploring and analyzing large-

scale biological data sets. PLoS ONE 2: e718.

Winter N, Kollwig G, Zhang S, Kragler F (2007) MPB2C, a microtubule-associated

protein, regulates non-cell-autonomy of the homeodomain protein KNOTTED1.

Plant Cell 19: 3001-3018

Xu L, Shen WH (2008) Polycomb silencing of KNOX genes confines shoot stem cell

niches in Arabidopsis. Current Biology 18: 1966-1971

Yanai O, Shani E, Dolezal K, Tarkowski P, Sablowski R, Sandberg G, Samach A, Ori

N (2005) Arabidopsis KNOXI proteins activate cytokinin biosynthesis. Current

Biology 15: 1566-1571

Table I. Name of the constructs of the STM promoter and fragments deleted.



45

Construct name Fragment deleteda

ProSTM-ΔLK:GUS -355 to -220 ProSTM-ΔCRB:GUS -2004 to -1987 ProSTM-ΔCRB-CK:GUS -2004 to -1987 and -263 to -239 ProSTM-ΔLRB:GUS -2114 to -1907 ProSTM-ΔLRB-CK:GUS -2114 to -1907 and -263 to -239 ProSTM-ΔLRB-LK:GUS -2114 to -1907 and -355 to -220 ProSTM-ΔRB:GUS -3379 to -1907 ProSTM-ΔRB-CK:GUS -3379 to -1907 and -263 to -239 ProSTM-ΔF1:GUS -3119 to -2784 ProSTM-ΔF2:GUS -2784 to -2449 ProSTM-ΔF3:GUS -2449 to -2114 ProSTM-ΔF4:GUS -1907 to -1519 ProSTM-ΔF5:GUS -1519 to -1131 ProSTM-ΔF6:GUS -1131 to -743 ProSTM-ΔF7:GUS -743 to -335 ProSTM-ΔF8:GUS -220 to 0

a Relative position, in base pairs, with respect to the start codon.

Figure legends

Figure 1. RB-box presence in STM genes. (A) The RB-box is present in all STM gene

promoters analyzed. Multiple sequence alignment made with Muscle and displayed with

Boxshade. The line over the alignment indicates the location of the large RB-box. The box

demarcates the highly conserved core RB-box. (B) Relative location of the core RB-box in

the STM gene promoters of the species analyzed. The numbers indicate the position

relative to the translation initiation codon. Brassicaceae species are characterized by

having a relatively distant location of the RB-box with respect to the transcriptional start

site.



46

Figure 2. Expression of GUS in the Arabidopsis STM promoter constructs harboring

combinations of RB-box and K-box deletions. (A) Schemes of the STM promoter

fragments used. Numbers indicate the position relative to the translation initiation codon

ATG. Solid lines indicates the fragment of the promoter used, dashed boxes indicate the

promoter region deleted for every construct. Vertical dashed lines connect the boxes

between constructs for clarification. (B-Q) Whole-mount and transverse sections of 8 days-

old T3 seedlings harboring the constructs depicted in (A). (B, C) Staining of plants with

the construct ProSTM:GUS with the native fragment of 3379bp. Seedling (B) and

transverse section (C) through the shoot apex. (D, E) Staining of plants with the construct

ProSTM-ΔLK:GUS harboring the STM promoter without the long K-box. (F, G) seedling

(F) and cross-section (G) of plants with the construct ProSTM-ΔCRB:GUS having the STM

promoter without the core RB-box. (H, I) GUS expression pattern in plants ProSTM-

ΔCRB-CK:GUS lacking both the core RB-box and the core K-box. (J, K) Staining of

plants with the construct ProSTM-ΔLRB:GUS without the large RB-box. (J) Seedling and

(K) cross-section through the hypocotyl. (L-O) GUS expression pattern in plants ProSTM-

ΔLRB-CK:GUS lacking both the large RB-box and the core K-box. Seedling (L),

transverse section through the shoot apex (M), the hypocotyl (N) and young leaf with GUS

accumulation in sinuses (O). (P, Q) Staining of plants with the construct ProSTM-ΔLRB-

LK:GUS harboring deletions of the large RB-box and the large K-box. Seedling (P) and

transverse section (Q) through the shoot apex. Dashed lines outline leaf primordia. Bars

are B, D, F, H, J, L and P = 0.5 mm, C, E, G, I, K and N = 50 µm, M and Q = 100 µm.

Figure 3. Characterization of FRF1 and related factors. (A) FRF1 is capable to bind

the RB-box through EMSA analysis. Indicated is also the positive control (C+) from the

manufacture’s kit. Arrows mark the shifted bands and arrowheads the free probe of 246 bp

for the RB-box and 60 bp for C+. (B) FRF factors are related to FRS factors. Protein-

domain structure of FRF and FRS factors. The FAR1 DNA binding domain is indicated by

a pale grey box, the MULE transposase domain by dark grey box and the Zinc finger of the

SWIM-type by a black box. Numbers indicate the size of each factor. (C) Phylogenetic

analysis of FRF factors in Arabidopsis, tomato, medicago, grape and rice. Neighbor



47

joining tree with 1000 bootstrap replications using the conserved FAR1 DNA binding

domain of the FRF factors. Branch lengths are indicated. The tree was generated using

PAUP* 4.0 (Swoford D.L., 2003; paup.csit.fsu.edu).

Figure 4. GUS expression pattern in constructs with internal deletions in the

Arabidopsis STM promoter. (A) Schemes of the STM promoter with the internal deletion

fragments used. Numbers indicate the position relative to the translation initiation codon

ATG. The position of the RB-box and the K-box are also indicated. Solid lines indicate the

fragment of the promoter used, dashed boxes indicate the internal deletion on each

construct. Vertical dashed lines connect the boxes between constructs for clarification. (B-

R) Whole-mount and transverse sections of 8 days-old T3 seedlings harboring the

constructs indicated in (A). (B, C) Staining of plants with the construct ProSTM-

ΔF1:GUS. Seedling (B) and transverse section through the shoot apex (C). (D, E) Staining

of plants with the construct ProSTM-ΔF2:GUS. Seedling (D) and cross-section through the

shoot apex (E). (F, G) Seedling (F) and cross-section through the hypocotyl (G) of stained

plants with the construct ProSTM-ΔF3:GUS. (H, I) GUS expression pattern in plants

ProSTM-ΔF4:GUS. Whole-mount stained seedling (H) and cross-section through the shoot

apical region (I). (J, K) Staining of plants with the construct ProSTM-ΔF5:GUS. Seedling

(J) and cross-section through the shoot apex (K). (L, M) GUS expression pattern in plants

ProSTM-ΔF6:GUS. Seedling (L) and transverse section through the shoot apex (M). (N,

O) Staining of plants with the construct ProSTM-ΔF7:GUS. Seedling (N) and cross-section

through the shoot apical region (O). (P-R) Staining of plants with the construct ProSTM-

ΔF8:GUS. Seedling (P) and cross-section through the shoot apex (Q) and through the

hypocotyl (R). Leaf primordia are outlined with dashed lines. Bars are B, D, F, H, J, L, N

and P = 0.5 mm, C, E and O = 25 µm, G, K, M and R = 50 µm, I and Q = 100 µm.

Figure 5. CNSs in STM-like gene promoters of Brassicaceae species upstream of the

RB-box. (A) mVISTA alignment of B. rapa STM promoter compared with the

corresponding genes of T. halophila, C. rubella, A. thaliana, A. lyrata and C. hirsuta.

Three regions, Fa, Fb and Fc are identified. (B) Sequence alignment in the Fa region. (C)



48

Alignment of the sequences for the Fb region. (D) Sequence alignment in the Fc region.

Sequence aligments were made with Muscle and displayed with Boxshade.

Figure 6. Expression of STM under the control of JAGGED promoter.

(A, B) Consecutive transverse sections through the shoot apex of transgenic Arabidopsis

plants ProJAG:GUS expressing the gene uidA under the control of the JAGGED promoter.

(A) GUS is expressed in Po leaf primordia (arrowhead). (B) GUS is found in Po

(arrowhead) and in the developing leaves (asterisks). (C-E) Expression of STM directed by

the JAG promoter. (C) Rosette of a wild type plant. (D) Representative rosette of

ProJAG:STM plants with a strong phenotype. Plants are very small with partially

undifferentiated leaves. (E) Rosette of plants ProJAG:STM with a mild phenotype. The

plants are small and have deeply lobed leaves. (F-H) Confocal anlysis of plants expressing

GFP-STM under STM or JAG promoters. (F) Confocal merged image of plants

ProSTM:GFP-STM. GFP signal is found at the base of the shoot apex (arrowhead). (G)

Confocal merged image of the shoot apex of a plant ProJAG:GFP-STM with strong

phenotype showing intense GFP expression in stipule-like structures. (H) Confocal merged

image of a plant ProJAG:GFP-STM with highly lobed leaves and GFP expression in the

base of developing leaves. Bars are A and B = 50 µm, C = 0.5 cm, D and E = 0.25 cm, F =

25 µm, G and H = 100 µm.

Figure 7. Altering the ELK domain affects leaf development and cellular localization

of STM. (A) Diagram depicting the conserved domains of STM KNOX1, KNOX2, GSE,

ELK and HD. Numbers indicate relative position from the first amino-acid. (B-D) Effect of

the S272A mutation in the ELK domain in leaf development. Compared with plants

ProSTM:GFP-STM that have a phenotype similar to wild type (Uchida et al., 2007), plants

ProSTM:GFP-STM-S272A produce smaller and lobed rosette leaves (B) and highly lobed

cauline leaves (C) while overall plant architecture remains unaffected (D). Representative

plants and isolated leaves are five-week-old. (E-F) The mutation S272A alters the cellular

distribution of STM. In agro-infiltration experiments in N. benthamiana leaves, STM

(GFP-STM) is distributed throughout the cytoplasm (E), however in the S272A mutation

(GFP-STM-S272A) STM is located in the cell nucleus (F). Arrow indicates a cell nucleus.



49

STM distribution visualized with confocal microscopy. Bars are B = 1 cm, C = 5 mm, D =

2 cm, E and F = 20 µm.



running head: new insights on regulation of stm gene function

Documents